DK162169B - Recombinant proteins having thrombomodulin activity, DNA constructs which encode them, vectors, cells and process for preparing them, pharmaceutical preparations which comprise the proteins, and the use of the proteins for coating </HO> The invention comprises a group of compounds which possess thrombomodulin activity defined by a high degree of affinity binding to thrombin and the ability to provide a complex between such a compound and thrombin having the ability to activate protein C, and which comprise, from the C-terminal moiety of the molecule, two or more of the following structural elements: a) a short cytoplasmic domain of approx. 56 amino acids, b) a transmembrane region of approx. 24 amino acids, c) a region which is rich in serine, threonine and proline residues, d) a domain which comprises at least two EGF domains, and e) a N-terminal domain, where one or more of the elements a), b) and/or c) can be omitted or replaced with affinity-imparting units or units which increase the solubility in physiological solutions, or physiologically compatible derivatives thereof. In a preferred embodiment, four EGF domains are coupled N- terminally to the signal peptide from human tissue-type plasminogen activator with the aid of an adapter sequence. The proteins can be used for treating and/or preventing thrombic episodes. - Google Patents

Description

1 DK 162169 B

The present invention relates to modified human thrombomodulin produced by recombinant DNA techniques, DNA sequences encoding these molecules, 5 vectors, cells, and to the method of producing the human thrombomodulin, pharmaceutical compositions containing such molecules, and their use for coating articles.

Thrombomodulin Physiology 10 Blood coagulation is the classic example of chemical enhancement. Upon coagulation, a weak stimulation of relevant substances, such as platelets, factor XII and / or factor VII, can trigger a complete clotting of the blood. The amplification occurs through a series of proteolytic activations, which include coagulation factors XII, IX, VIII, X, V and prothrombin that lead to plasma fibrin deposition and containment of the cellular components. However, blood coagulation is required to be regulated by other interactions that outweigh coagulation-promoting impulses and adapt the inherent explosive cascade response to local physiological needs. Without these influences, an initial coagulation would run smoothly and widespread intravascular coagulation would be the result.

The endothelial cells that make up the inside of 25 blood vessels are a source of powerful antithrombotic materials. Heparan sulfate on the endothelial surface significantly enhances the effect of antithrombin III, which can slow down the coagulation process at several levels.

Tissue plasmin gene activator, another blood fluid regulating principle, is released from endothelial cells following certain stimuli and initiates responses to redissolve already formed fibrin fibers.

A third topic addressed by the present application is thrombomodulin.

Thrombomodulin is a glycoprotein on the surface of endothelium and certain other cells that contributes to the control of coagulation (W. Owen and C. Esmon, J. Biol. Chem. 256: 5532-5535; N. Esmon et al., J .Biol.Chem.

257; 859-864, 1982; see also L. Clouse and P. Comp, N.Engl.

DK 162169B

2 J.Med. 314: 1298-1304, 1986). It binds stoichiometric to thrombin, the last step of the coagulation cascade, and alters its proteolytic specificity. Usually thrombin converts fibrinogen to insoluble fibrin. It also activates factors V and VIII to Va and Villa, respectively, thereby enhancing coagulation upon positive feedback. After binding to thrombomodulin, a new activity becomes predominant: the thrombin-thrombomodulin complex activates Protein C. The activated Protein C (PCa) breaks down with protein S the activated cofactors Va and Villa, thus terminating the coagulation (R. Marlar et al.,

Blood 59: 1067-1072, 1982). Activated Protein C also degrades the plasminogen activator inhibitor (PAI), thereby facilitating fibrinolysis (V. van Hinsburgh et al., Blood 65: 444-451, 1985). At the same time, the interaction between thrombo modulin and thrombin apparently causes thrombin to lose its ability to clot fibrinogen, activate factor V, and clot platelets (C. Esmon et al., J. Biol. Chem. 257: 7944-7947, 1982, N. Esmon et al., J. Biol. Chem. 258: 20, 12238-12242, 1983). In short, the interaction with thrombomodulin changes thrombin from playing a procoagulant to playing an anticoagulant and fibrinolytic role.

The action of thrombomodulin is dramatic, it accelerates the formation of PCa from 100 to 20,000 times. In fact, the thrombin-thrombomodulin complex is by far the most powerful known activator of Protein C and probably the only or most important of physiological significance.

The negative feedback loop initiated by the thronbin-thrombomodulin core peak and mediated by Protein C is of great importance in vivo. People with partial Protein C deficiency, presumably caused by a heterozygous genetic defect, experience recurrent bouts of intravascular thrombosis (L. Clouse and P.

Comp, ibid.). The fate of patients with complete Protein C 35 deficiency is harder if possible. They usually die as children of massive thrombotic seizures unless treated with Protein C-rich concentrates.

Thrombomodulin-initiated feedback appears

DK 162169 B

3 therefore play an important regulatory role in the body's hemostatic mechanism. In accordance with this view, thrombomodulin has anticoagulant properties in vitro. A concentration of approx. 4 nM kept in 5 solution of detergent is described as doubling the partial thromboplastin time of human plasma (S. Kurosawa and N. Aoki, Thromb.Res. 37: 353-364, 1985).

Thrombomodulinmolekvlet

Human thrombomodulin has been purified from placenta (H. Salem et al., J. Biol. Chem. 259: 12246-12251; S. Kurosawa and N. Aoki, ibid.). Briefly, the procedure consisted of membrane preparation, solubilization in a nonionic detergent and double affinity chromatography on solid phase thrombin whose protease activity had been disrupted by diisopropylphosphofluridate. Both purifications included an additional step, either ion exchange chromatography or size exclusion chromatography.

Thrombomodulin is an unusually stable glycoprotein. Activity can be quantitatively recovered from samples 20 treated with 1% SDS, 8 M Urea, pH 2, pH 10 or even boiled for 10 minutes. However, treatment with mercaptoethanol or pepsin completely destroys activity. The molecule is very difficult to soluble in the absence of detergents.

Purified throrbomodulin preparations show a diminishing band in gel electrophoresis. Biological activity can be collected from the gels and corresponds to the band. The electrophoretic mobility is roughly equivalent to a molecular weight of 88 - 105,000 daltons, but estimates appear to be fairly dependent on the gel system. The isoelectric point is low, approx. 4. An estimated amino acid composition has been published (S. Kurosawa and N. Aoki, ibid.), But detailed characterization is greatly hampered by lack of material.

35 Studies of thrombomodulin from other species largely confirm the above (N. Esmon et 4

DK 16 216 9 B

al., J. Biol. Chem. 217: 859-864, 1982). In addition, new results may shed further light on the molecular characteristics of human thrombomodulin. A partial cDNA sequence of oxethrombomodulin comprising the C-terminal half 5 shows that this portion bears some similarity to the LDL receptor (R. Jackman et al., Proc.Natl. Acad.Sci., USA 83: 8834-8838, 1986). An area of approx. 240 amino acids contain cysteine residues, the spacing of which would be consistent with the formation of six modules similar to 10 epidermal growth factors (EGF). There are two possible sites for N-linked glycosylation in this region. It is also partially covered by an area of 56 amino acids rich in serine, threonine and proline residues which, in parallel with the LDL receptor, could carry 0-linked sugar chains. Then there is a portion of 24 hydrophobic amino acids, probably representing a transmembrane region, and finally a segment of 56 amino acids starting with several positively charged residues likely representing a short cytoplastic domain. As described below, our 20 results show that human and oxthrombomodulin are at least partially homologous.

Rabbit throne bomodulin was recently separated by ion exchange into an acidic and a non-acidic moiety which differed in their anticoagulant properties (M.C. Bourin et al., Proc.Natl.Acad.Sci. USA 83: 5924-5928, 1986). Both fractions contained the thrombin cofactor activity required for Protein C activation. The acidic portion also prevented thrombin thrombin with thrombin and stimulated thrombin neutralization with antithrombin in a heparin-like manner. The last two properties were abrogated by the polybrene cation and by heparinase. These results appear to show that direct and indirect thrombin neutralization activities depend on secondary glycosylation of the peptide chain, whereas Protein C coactivator activity does not depend on it.

International Patent Application No. PCT JP86 / 00330 (WO 87/00050) mentions a compound isolated from human lung tissue with thrombomodulin activity.

DK 162169 B

5

Certain problems have so far hampered the use of thrombomodulin as an anticoagulant: 1) the molecule is only available in small amounts of limited purity from primary human material, 2) the molecule is only soluble in the presence of detergents.

These problems must be resolved before thrombomodulin may be clinically applicable. Furthermore, it would be desirable to increase the specificity of thrombomodulin by targeting the molecule to specific physiological structures.

10 In this connection, it is interesting to note that the presence of a soluble form of thrombomodulin is disclosed (H. Ishii and P.W. Majerus, J.Cl. Invest.

76: 2178-2181, 1985). The authors also speculate on the composition of the soluble thrombomodulin and cite the possibility that it is derived from the synthesis of thrombomodulin without the membrane binding domain.

These difficulties are now overcome in the present invention using DNA recombinant technique by expressing the human thrombomodulin gene in suitable hosts and by modifying the gene to remove inherent disadvantages in the naturally occurring human thrombomodulin and / or increase its usefulness in targeting.

DEFINITIONS

Before describing the invention, it may be helpful for the understanding thereof to define certain terms to be used hereinafter.

Complementary DNA or cDNA: A DNA molecule or sequence that is enzymatically synthesized from sequences in a 30 mRNA template.

DNA Construction: A DNA molecule or clone of such a molecule, either single or double stranded, which can be isolated in partial form from a naturally occurring gene or modified to contain DNA sequences.

DK 162169 B

6 ments that are combined and connected in a way that would not otherwise occur in nature.

Plasmid or vector: A DNA construct containing genetic information that can provide for its replication when inserted into a host cell. A plasmid generally contains at least one gene sequence to be expressed in the host cell, as well as sequences encoding functions that facilitate such gene expression, including promoters and transcription initiation sites. It can be a linear 10 or closed circular molecule.

Joined: DNA sequences are said to be joined when the 5 'and 3' ends of a phosphodiester linker sequence are connected to the 3 'and 5' ends of an adjacent sequence, respectively. Joining can be achieved by such routes as ligation of blunt or contiguous ends, by synthesis of joined sequences by cDNA cloning, or by removing intermediate sequences by a controlled mutagenesis.

Pre-pro region: An amino acid sequence that usually occurs at the amino ends of the precursors of certain proteins and is often cleaved off the protein, at least in part, upon secretion. The pre-pro region partially includes sequences that lead the protein into the cell's secretory pathway.

Domain or module: A three-dimensional, self-assembling array of amino acids in a protein molecule containing structural elements necessary for a specific biological activity of this protein.

For further defining and further references to domains and modules of particular importance for coagulation and fibrinolysis, including fingers, growth factor regions, pretzels, and vitamin K dependent gamma carboxylated regions, see L. Banyai et al., FEBS Letters 163: 37

DK 162169 B

7, 41, 1983, and L. Patthy, Cell 11: 657-663, 1985.

thrombomodulin

Thrombomodulin may have three independent activities. First, it binds to high affinity thrombin. Second, it specifically provides the thrombin-thrombomodulin complex with the ability to activate Protein C. Third, this binding can modify the reactivity of the complex-bound thrombin to a variety of components, including fibrinogen, platelets, and antithrombin. To meet the objectives of this invention, we must consider the thrombomodulin activity as equal to the first and second of these activities and disregard the third type of activity. Accordingly, thrombomodulin derivatives or, in general, thrombomodulins will be considered active if they have the protein C coactivator activity, whether or not they modify other reactivities of the bound thrombin.

Activation of Protein C

Protein C is a double-chain glycoprotein with a molecular weight of approx. 57,000 daltons. A chain called the light chain consists of an amino-terminal gar-acarbylated region, followed by two domains with homology to epidermal growth factor (EGF). The second chain called the heavy chain contains a serine protease domain. Activation of protein C 25 consists of cleavage of a single peptide bond, Arg-12 to Leu-13 in the heavy chain. It is this reaction whose catalysis with the thrombin-thromodulin complex can accelerate dramatically, typically between 100 and 20,000 times. The thrombin-thrombomodulin complex is, in fact, the most powerful known activator of protein C, and probably the only physiologically important one.

In one aspect, the present invention relates to a group of compounds which have become known in this specification

DK 162169 B

8 called thrombomodulins and comprising human thrombomodulin and derivatives thereof. The thrombomodulins of the invention all have certain properties in common which have been discussed above and will be further specified in the following.

It is envisaged that the thrombomodulins will be useful in the therapeutic control of coagulation. By increasing the amount of thrombomodulins in a patient, it will be possible to increase the activation of protein C, thereby enhancing the patient's anticoagulability.

It is expected that the thrombomodulin-derived anticoagulants of the invention will be superior poisons to well-known anticoagulants such as heparin and vitamin K antagonists. These well-known anticoagulants intervene at several levels of the coagulation cascade and prevent normal coagulation mechanisms by inhibiting synthesis of the activity coagulation factors. Furthermore, vitamin K antagonists reduce inadvertent protein C's physiological anticoagulation responses by randomly blocking the formation of gamma-carboxylated proteins, and thrombic episodes that typically manifest as skin necrosis have occurred early in anti-vitamin K treatment (A. Broekroans et al., Thromb. Haemost. 49: 251, 1983).

Thrombomodulins, on the other hand, will enhance natural anticoagulant and fibrinolytic mechanisms by limiting the survival of PAI and activated factors Va and Villa, but leave the inventory of plasma coagulant factors largely intact. Spatial specificity will be high since activity is dependent on local throne formation and systemic activity would thus be negligible. The anticoagulant activity of the thromborodulins of the invention will not interfere directly with the formation of the hemostatic plug, nor does it alter the fibrin structure. Therefore, fewer complications are anticipated in the form of bleeding episodes compared to the use of the traditional anticoagulant substances.

Thrombomodulins will be particularly useful as anticoagulants in patients with increased bleeding risk or

DK 162169 B

9 clays in patients where such a risk cannot be accepted. Such patients include those who have just had a blood clot in the brain caused by a thrombus in a brain blood vessel, patients who have recently been operated on or 5 who have a potential source of bleeding (tumor, ulcer, etc.).

The invention will be further described below with reference to the drawings and examples.

In the drawings, FIG. Figure 1 shows the sequence of a 60-10 mer DNA probe used to identify human thrombomodulin cDNA clones; Figure 2 shows a series of DNA sequences with derived amino acid sequences from ox thrombomodulin (B) cDNA (nucleotides 850 to 1035) (Jackman et al., PNAS, USA 83: 15 8834-8838, 1986, Figure 3) and from the corresponding region of human thrombomodulin (H) cDNA clone p2.1 (this invention). A strong homology (indicated by boxes) is observed in this part of the molecule containing the transmembrane region, FIG. 3 shows a series of DNA sequences with deduced amino acid sequences from oxethrorbcnodulin (B) cDNA (Jackman et al., PNAS, USA 83: 8834-8338, 1936, Fig. 3) and from the corresponding regions of human thrombomodulin (H) cDNA clone p2 .1 (this invention). Two regions (oxenucleotide 25 numbers 1 to 66 and 145 to 186) are compared and identical points between the two molecules are indicated as boxes; 4 shows a human thrombomodulin cDNA sequence from clone p2.1 (this invention). The sequence shows 365 bp corresponding to nucleotides 1754 to 2123 (369 bp) in the 3 'untranslated portion of the cx cDNA sequence (Jackman et al., PNAS, USA 83 = 8834-8838, 1986, fig. 3, fig. Figure 5 shows an RNA blot analysis of human cell line A549 mRNA Five micrograms of rnRNA from two different preparations were separated on a 1% agarose gel, duplicated over 35 on nitrocellulose and hybridized with a nick-translated restriction fragment from plasmid p2.1. The nucleotide length of known DNA is indicated. .

DK 162169B

10 FIG. Figure 6 shows the amino acid sequence of human tissue plasminogen activator with selected domains labeled A, B and C; 7 shows the DNA sequence of the 3640 bp insert 5 in p2.1. The amino acid sequence of human thrombomodulin with its signal peptide at the amino end is shown with all the amino acid residues indicated by their single letter abbreviations. 8 shows the sequence of the BamHI insert in plasmid pBoel 1743-2-9-8. Regions constructed from synthetic oligonucleotides are underlined with horizontal arrows. The amino acid sequence of the encoded human tPA signal peptide and the human thrombonodulin mutant is indicated by the single letter abbreviation of all amino acid residues. The position of some restriction endonuclease recognition sites is indicated. 9 shows the construction of the maromal expression vector pBoel-TM1; and FIG. Figure 10 shows the construction of the mammalian expression vector pBoel-TM2.

In one of its essential aspects, the present invention relates to a group of recombinant proteins with thrombomodulin activity defined by a high affinity binding to thrombin and the ability to equip a complex between such a compound and thrombin with the ability to activate protein C which is peculiar in that they comprise from the C-terminal part a) an O-glycosylation-rich domain b) at least four EGF domains c) the human tissue-type plasminogen activator (tPA) signal peptide and a short adapter sequence, or a ') at least four EGF domains b *) the human tissue type plasminogen activator (tPA) signal peptide and a short adapter sequence.

In a specific embodiment of the present invention, the modified thrombomodulin consists of the

DK 162169 B

Figure 11 shows four carboxy-terminal epidermal growth factor regions together with the extracellular O-glycosylation-rich region N-terminally joined to the human peptide plasminogen activator (tPA) signal peptide and a short adapter sequence (Figs.

5 8).

However, another specific embodiment is similar to the fifth embodiment, without the extracellular O-glycosylation-rich region.

These embodiments of the invention are thrombo-modulins having the amino acid sequences set forth in claim 2.

Further preferred embodiments are such thrombomodulins according to the above which are substantially free of contamination of human origin.

It is contemplated that the C-terminal portion of the native thrombomodulin may be replaced by affinity-providing units or units that enhance solubility in physiological solutions or physiologically compatible derivatives thereof.

In this aspect, the present invention describes molecules of thrombomodulin activity which have obtained enhanced solubility properties in physiological solutions over authentic human thrombomodulin. Other molecules envisaged have been given affinity for particular tissue structures that occur in vivo or are available for conjugation to surfaces or other molecules or entities.

Such modified thrombomodulins contain part of the amino acid sequences of human thrombomodulin, the C-terminal portion including some or all of the hydrophobic membrane spanning region being removed or replaced by affinity-generating units.

A preferred site for terminating the human thrombomodule sequence is at the beginning of the hydrophobic membrane spanning region corresponding to His-12 to Gly-14 (bases 883-891) of Figure 2 (corresponding to His-514 to Gly-516 (bases 1670-1678) in Figure 7).

Another preferred place where the human

DK 162169B

12 thrombomodulin sequence can be terminated is at the C-terminus of the series of growth factor domains.

further preferred embodiments include molecules containing only regions e) and d) where the number of EGF domains is equal to or greater than four.

This suggests further preferred embodiments wherein the human thrombomodulin sequence terminates at the N-terminus of any of the first two growth factor domains and C-terminally at the beginning of the hydrophobic, membrane spanning region or the C-terminus of any of the growth factor domains 4. , 5 or 6,

The modified thrombomodulins may at the same time be fusion proteins insofar as they are provided with novel desirable heterologous protein domains such as N- or 15 C-terminal extensions, which domains have desirable affinity for specific physiological structures, i.e. fibrin lumps, membrane surfaces, receptor molecules, or extracellular matrix components.

A preferred site where the human thrombo-modulin sequence can be fused to a suitable heterologous domain is at the beginning of the membrane spanning region corresponding to His-12 to Gly-14 in Figure 2.

Another preferred site where the human thrombomodulin can be fused to a suitable heterologous domain is at the C-terminus of the growth factor module sequence.

Further preferred sites where the human thrombomodulin can be fused to a suitable heterologous domain are at the N-terminus of any of the growth factor regions 1, 2 or 3 or at the C-terminal 30 for any of the growth factor regions 4, 5 or 6th

Domains with specific affinity for physiological structures, domains suitable as fusion partners, include growth factor modules, pretzels, finger modules, vitamin K-dependent calcium-binding gamma carboxylated regions, and antibody-derived, antigen-recognizing structures.

Preferred heterologous regions with affinity for

DK 162169 B

13 physiological structures include the finger modules from tissue plasminogen activator and fibronectin, the growth factor modules from urokinase, tissue plasminogen activator and protein C, the tissue module from tissue plasminogen activator, and the first, fourth, and fifth prong modules from plasminogen.

In a particular embodiment of such throne boom modules, the modified thrombomodulin consists of the N-terminal sequences of human thrombomodulin up to Ser-13 in FIG. 2, C-terminally extended to include the finger region of the tissue plasminogen activator (region A of Fig. 6, comprising amino acids 4 to 50). This would equip the molecule with affinity for fibrin.

In another specific embodiment of such thrombomodulins, the modified thrombomodulin consists of 15 the N-terminal sequences of human thrombomodulin up to Ser-13 in FIG. 2, C-terminally extended to include the second pretzel region (region B of Fig. 6, comprising the aminc acids 176 to 263) from tissue plasminogen activator. This would also equip the molecule with affinity for fibrin.

In a third specific embodiment of such thrombomodulins, the modified thrombomodulin consists of the N-terminal sequences of human thrombomodulin up to Ser-13 in FIG. 2, C-terminally extended to include the growth factor module of tissue plasminogen activator (region C 25 in Fig. 6, comprising amino acids 50 to 87).

In a fourth specific embodiment of such thrombomodulins, the modified thrombomodulin consists of the N-terminal sequences of human thrombomodulin up to but not including the first cysteine residue of its last growth factor module, C-terninally extended to include the growth factor module of the tissue plasminogen activator cysteine. in this module (amino acid 51 of Fig. 6).

Alternatively, the molecules may contain a C-terminal extension comprising a free cysteine residue or one or more lysine residues to facilitate covalent conjugation in vitro or simply a highly charged region rich in lysine and arginine, or glutamate and aspartate to mediate

DK 162169B

14 are noncovalent adhesion to surfaces.

In further embodiments of such thrombo-modulins, the modified thrombomodulins may consist of the N-terminal sequences of human thrombomodulin up to 5 the cut-off sites mentioned in the preceding sections, which N-terminal sequences are conjugated by a spacer molecule. for affinity-generating entities such as antibodies or portions thereof. For a description of suitable spacer molecules and techniques, see Tijssen's "Practice and 10 Theory of Enzyme Immunoassays, Elsevier, Amsterdam, The Netherlands, 1985, or Danish Patent Application No. 1107/87, hereinafter referred to.

In another major aspect, the present invention provides means for the preparation of the aforementioned modified human thrombomodulins by expressing a cloned nucleic acid construct encoding portions of the complete human thrombomodulin molecule in a suitable cell.

The thrombonodulin or relevant portions thereof may be expressed alone or as fusions with other domains to facilitate preparation or provide desired additional domains as explained above.

In a preferred embodiment, the authentic or modified thrombomodulins are encoded in a cloned nucleic acid construct in a form comprising the natural regions of the human thrombomodulation which are responsible for expression of such amino acids which are actively involved in the export of the natural protein from the cell, and which amino acids are eventually completely or at least partially cleaved from the protein.

In another preferred embodiment, the authentic or modified thrombomodulins are encoded in a cloned nucleic acid construct in a pre-pro form comprising the pre-pro region of the tissue plasminogen activator.

In a third major aspect, the present invention describes pharmaceutical compositions containing modified thrombomodulins useful in the treatment of patients for the purpose of preventing or preventing

DK 162169 B

15 help a thrombotic condition.

Because of the present invention, it is now possible to prepare modified thrombomodulins by recombinant DNA technique, using cDNA or genome 5 clones as starting material.

Techniques for determining the complete sequence from DNA clones and for obtaining new independent but homologous clones once a partial sequence has been determined are well known in the art and described in publications such as Maniatis et al. "Molecular Cloning, A Laboratory Manual" Cold Spring Harbor Press, New York, N.Y., USA, cited.

The construction of DNA sequences encoding preferred terminated human thrombomodulins and of DNA sequences encoding fusion between portions of human thrombomodulins and preferred functional domains of other proteins is best performed following the introduction of specific restriction enzyme recognition sites at specific sites. human thrombomodulin c DNA and ic DNA for the 20 preferred donor donor molecules. The introduction of restriction enzyme recognition sites at specific points in a DNA molecule can be advantageously achieved using one of several well known, effective methods for oligodoxyribonucleotide-directed site-specific mutagenesis (e.g.

Y. Morinaga et al., BIO / TECHNOLOGY 2: 636-639, 1984).

Generation of C-terminally deleted modified human thrombomodulins can be advantageously obtained using oligonucleotide-directed site-specific mutagenesis. Such a preferred modified human thrombomodulin ending 30 at the beginning of the hydrophobic membrane spanning region can be constructed by the specific introduction of a stop codon at the position of the existing Gly codon GGC (at base numbers 889 to 1891 in Fig. 2). . In this same mutagenesis experiment, an oligonucleotide 35 which also introduces a convenient restriction enzyme recognition site equal to 3 'to the introduced stop codon could be used, facilitating further construction work with this abbreviated version of human thrombomodulin cDNA. The various parts of

DK 162169B

The human thrombomodulin cDNA and the various parts of other cDNAs from which specific domains are to be taken can most conveniently be subcloned into small DNA vectors (such as pUC19, pBR322 and pGEM3) prior to mutagenesis. After appropriate mutagenesis to introduce new restriction sites at joining sites, the cDNAs should be sequenced to confirm the mutated genotype. The mutated fragments can then be joined directly by ligation reactions in expression vectors or joined using 10 short double-stranded synthetic oligonucleotide adapters.

All of these manipulations involve procedures known in the art (T. Maniatis et al., "Molecular Cloning, A Laboratory Manual," Cold Spring Harbor Press, New York, NY, 1982), as well as ligation of DNA fragments and their cloning in different vectors for either further construction or expression of the encoded mutated and fused proteins.

Various host cells can be used to prepare the proteins including mannal cells, yeast, fungi and bacteria. However, cultured nanna cells are preferred. A particularly preferred cell line is the BHK cell line tk-tsl3 (Waechter and Baserga, Proc.Natl.Acad.Sci.

USA 79: 1106-1110, 1982). Methods for expressing cloned genes in each of these types of hosts are known in the art.

To express modified thrombomodulins in cultured old cells, expression vectors containing cloned thrombin bonodulin sequences are introduced into the cells by appropriate transfection techniques such as calciurphosp-30-mediated transfection (Graham and Van der Eb, Virology 52: 456-467, 1973; , Proc. Natl. Acad. Sci., USA 77: 3567-3570, 1980). A DNA calcium phosphate precipitate is formed and this precipitate is added to the cells. Part of the cells take up DNA and retain it in the cell for several days. A small portion of the cells integrate DNA into the host cell genome. These integrants are identified by cotransfection with a gene that produces a selectable phenotype (a selectable marker). A preferred one

DK 162169 B

17 selectable marker is the mouse dihydrofolate reductase (DHFR) gene, which provides cellular resistance to the drug methotrexate (MTX). After the host cells have taken up DNA, drug selection is used to select a cell population that expresses the selectable marker in a stable manner.

Thrombomodulin-active compounds made from transfected cells can be purified from the cell culture medium by adsorption to an ion exchange column or affinity chromatography. A preferred affinity column contains inactivated, immobilized thrombin (H. Salem et al., J.Cool. 259: 12246-12251, 1984). Another technique which will be advantageous is the use of monoclonal antibodies or fragments thereof directed to specific antigenic determinants on the desired thrombomodulin. These can be used as affinity reagents conjugated to a solid phase to provide effective column purification. The rise of monoclonal antibodies, their conjugation to column matrices, and the use of antibody affinity columns for isolation and purification are known in the art.

Example 1

Preparation of messenger RNA from human cell line A549

The human cell line A549 (American Type Culture Collection CCL 185) isolated from lung carcinoma tissue (Giard et al. (1972) J.Natl.Cancer Inst. 51: 1417-1423) has been shown to express ca. 10,000 thrombomodulin molecules per cell. A549 was used soro source for mRNA preparation. A549 was grown to a total cell count of 30.4 x 107 in RPMI 1640 containing 10% fetal calf serum and antibiotics.

Total RNA was isolated by the quanidinium thiocyanate method (Chirgwin et al. (1979) Biochemistry 18: 5293-5299) and purified by CsCl gradient centrifugation.

DK 162169 B

18

A total of 950 Mg was obtained and mRNA was isolated using an oligo (dT) cellulose column (Aviv & Leder (1972) PNAS 69: 1408-1412). 61 Mg mRNA was the result of 750 Mg total RNA (one cycle). After ethanol precipitation 5, this mRNA preparation was resuspended in 10 mM Tris HCL pH 7.5, 0.1. mM EDTA-Na2 at a final concentration of 1 μq / μl and stored at -80 ° C for later use.

mRNA prepared as described was used to prepare a cDNA library and mRNA blot analysis.

10 Construction of cDNA library from A549 mRNA

A cDNA library was constructed following the method described by Okayama & Berg (Mol. Cell. Biol. 2: 161-170 (1982); Mol. Cell. Biol. 3: 280-289 (1983)).

E. coli K12 (MC1061) (Casadaban & Cohen C.J.

Mol. Biol. 138: 179-207) was used for transformation.

MC1061 was grown in L medium at 37 ° C to OD66Q = 0.5. 20 ml was centrifuged and the cell pellet was resuspended in 7 ml of ice-cold sterile 0.1 M CaCl 2, incubated on ice for 30 minutes, centrifuged for a short time, and then stored in 20 cold rooms overnight.

95 μΐ transformation competent E. coli MC106L was added per 10 ml cDNA preparation. The mixture was incubated on ice for 30 minutes, heat shocked at 43.5 ° C for 45 seconds and finally after addition of L medium, 25 incubated at 37 ° C for 30 minutes. After resuspension, the cells were spread on L-medium dishes containing ampicillin (50 μq / ml) and cultured for 8 hours at 37 ° C. A total of 2.9 x 10 5 individual colonies could be collected from this library.

Screening of the A549 library for cDNA clones encoding human thrombomodulin 4 x 10 4 individual colonies was screened by standard colony hybridization technique using a nitrocellulose filter (Maniatis et al., Supra). A 60-mer oligonucleotide shown in Figure 1 corresponding to oxethron bombomile

DK 162169 B

19, the dulcine sequence covering nucleotides 532 to 591 as described by Jackman et al. (1986) PNAS 83: 8834-8838) was synthesized (DNA synthesizer from Applied Biosystems, USA), 32.32 labeled with P (using T4 polynucleotide chamois and γ-P-ATP) 5 and used for the screening. The hybridization solution contained 6 x SSC, 5 x Denhardt's solution, 0.05% SDS (Manitatis et al.), And 106 cpm / ml. After low-strings washing, four colonies were selected for further analysis. Plasmid preparations were prepared, subjected to Hind III degradation, electrophoresed in 1% agarose, blotted on nitrocellulose filters and hybridized with said 6C mer. One of the plasmids named p2.1 gave a strong hybridization signal and was selected for further characterization.

Characterization of p2.1 15 p2.1 had a cDNA insert of approx. 3.8 kb, and within this insert, partial DNA sequences (Maxam and Gilbert, Methods Enzymol. 65: 499-560, 1980. Sanger et al., PNAS, USA 74: 5463-5467, 1977) were determined for further analysis. characterization and identification of the clone.

FIG. 2 and 3 show sequence homology between selected regions of bovine (Jackman et al., PNAS, USA 83: 8834-8838, 1986, fig. 3) and the human cDNA as determined from p2.1. Amino acid identity regions are framed. From Figure 2, it can be seen that within the 24 amino acid residue long putative trans-membrane region of the bovine sequence (from Gly-14 (889) to Leu-37 (960)), only two amino acid substitutions have been identified.

Figure 4 shows a sequence from a 3 'untranslated region of p2.1. In this part of the molecule, well-preserved regions between ox sequences and 30 human sequences can also be identified.

To judge the completeness of the clone, the following experiment was performed.

Blot analysis of human thrombomodulin nRNA

Five micrograms of human cell line A549 mRNA were separated along with denatured P-labeled DNA molecular weight markers (Phage lambda DNA digested with Hind III) by

DK 162169B

Electrophoresis through a 1% agarose gel containing 2.2 M formaldehyde (Maniatis et al., "Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press" New York, N.Y., USA, 1982). After electrophoresis, gel 5 was rinsed 2 x 10 minutes in 1 x SSC (1 x SSC is 0.150 M NaCl and 0.015 M sodium citrate (pH 7)) for blotting of mRNA to a Gene Screen * hybridization transfer membrane overnight in 10 x SSC. The exposed mRNA was baked to the membrane for 2 hours at 80 ° C. Prehybridization (5 hours) and hybridization (20 hours) were performed in 50% formamide; 0.1% each of bovine serum albumin, Ficoll, and polyvinylpyrrolidone? 5 x SSC, 1% S DS and 0.5 mg / ml heat-denatured salmon seed DNA at 42 ° C. As a hybridization probe, a nick-translated p2.1 cDNA restriction fragment was used. After hybridization 15, the mRNA was blotted successively in 2 x SSC for 2 x 5 minutes at room temperature, 2 x SSC, 0.5% SDS for 2 x 30 minutes at 65 ° C, and in 0.1 x SSC for 2 x 30 minutes at room temperature. Figure 5 shows an autoradiography from this experiment. Lanes 1 and 2 show mRNA from two different 20 preparations, and lane 3 shows DNA molecular weight markers. In this experiment, an approx. 3.8 kb human thrombomodulin mRNA.

From the size of this human thrombomodulin mRNA, it is concluded that p2.1 contains a human thrombomodulin 25 c full-length or substantially full-length DNA insert.

The complete sequence of cDNA in plasmid p2.1 was determined (Tabor, S. and Richardson, CC (1987) Proc- Natl.Acad. Sci. USA, 84: 4667-4771), and is shown in Figure 30 7. In addition to the sequence shown, the plasmid contained pieces of G: C homopolymer tails at the 5 'end in addition to a poly (A) tail at the 3' end of the cDNA insert.

Example 2

Human Thrombomodulin Mutants 35 Desirable Human Thrombomodulin (hTM) Mutants

DK 162169 B

21 should be expressed as soluble proteins without the membrane spanning region. To obtain such mutants, the following steps were performed. p2.1 was digested with PstI. and an 870 bp fragment (nucleotide 952 to 1821 in Figure 7) was isolated and subcloned into pGEM3 (Promega Biotec). A subclone with KpnI site in hTM cDNA targeting the BamHI site of the multi-linker in pGEM3 was named pBoel743-2. The insert of this plasmid was mutagenized (Morinaga, Y. et al., (1984) BIO / TECHNOLOGY, 2: 636-639) with an oligodeoxyribonucleotide, NOR 570: 5 '(GATGGAGATGCCTATGGGATCCTAGGAGTGCACGAGCCCCACGGC) 3'

All synthetic oligodeoxyribonucleotides described in this invention were synthesized on an Applied Biosystems Inc. (USA) DNA synthesizer and purified on polyacrylamide gels.

This mutation resulted in the introduction of a TAG translation stop codon at the glycine 516 codon GGC position. In addition to this change, the oligonucleotide introduced an ApaLI (GTGCAC) site just 5 · to the new translation-20 stop signal, an AvrII (CCTAGG) site-wide stop signal, and a BamHI (GGATCC) site on its 3 'side. A correct mutant pBoel 1743-2-9 was identified by colony hybridization and by mapping with appropriate restriction enzymes.

In a desirable hTM derivative mutant, the expressed protein contained only the four carboxy-terminal epidermal growth factor homologous domains along with the extracellular O-glycosylation-rich domain.

This mutant was generated as follows.

pBoel743-2-9 was digested with BamHI and Hindi and a 0.53 30 kb HincII / -BanHI fragment was isolated. This fragment was linked to synthetic DNA encoding the signal peptide from the human tissue type plasminogen activator (tPA) (Pennica et al. (1983) Nature, 301: 214-221) and a short adapter sequence, in BamHI digested pUC13. A correct recombinant pBoel743-2-9-8 was identified with restriction enzyme degradation and the synthetic region was sequenced.

DK 162169 B

22 certainly.

The 711 bp sequence of the tPA coding region, the adapter and the HincII / BamHI fragment of pBoel743-2-9-8 is shown in Figure 8.

5 In this figure, all synthetic DNAs are indicated by horizontal arrows. Methods used for purification, base pairing, cloning and ligation of the adapter fragments to the 0.53 kb HincII / BamHI fragment were all standard techniques and well known to those of skill in the art of 10 recombinant DNA techniques (cf. Maniatis et al. Supra).

pBoel743-2-9-8 was digested with BamHI and a 0.71 kb fragment corresponding to the synthetic region was purified by agarose gel purification. This fragment was cloned into BamHI digested Zem219b (described in US Patent Application No. 58061 filed June 4, 1987). Zem219b is a mammalian expression vector that expresses inserted cDNA under the control of the mouse metal lothionein promoter and. the human growth hormone terminator. The plasmid also carries a mouse DHFR (dihydrofolate reductase) c DNA under the control of SV40 regulatory elements to provide a selection marker in transfected mammalian cells.

A correct recombinant pBoel-TM1 was isolated and characterized by restriction enzyme degradation. pBo-el-TMl was propagated in E. coli on a large scale and purified on CsCl / Ethidium Bromide gradients by ultracentrifugation. Another desirable hTM mutant was to be expressed as a soluble protein without the O-glycosylation-rich region and without the membrane-spanning region. To obtain such a mutant, the following steps were performed. pBoel743-2 was mutagenized (Figure 10) with an oligonucleotide, NOR571; 5 '(CTCGCCAGAGCCGCTGGATCCCTAGTCCACCTTGCCGGA) 3'

This mutation resulted in the introduction of a TAG translation stop codon at the position of the glycine-487 codon GGT. In addition to this change, the oligonucleotide introduced a BamHI (GGATCC) site just 3 'ford the translation stop signal.

DK 162169 B

23

A correct mutant pBoel743-2-10 was identified by colony hybridization, by restriction enzyme mapping, and by DNA sequencing.

pBoel743-2-10 was broken down with Hindi and BamHI.

5 and a 0.44 kb fragment was purified on a polyacrylamide gel. This DNA fragment was linked to a 0.18 kb BamHI / Hindi fragment of pBoel743-2-9-8 in BamHI digested and alkaline phosphatase treated Zem219b to generate pBoel-TM2.

The correct structure of this plasmid was controlled for restriction enzyme degradation. pBoel-TM2 encodes a mutant hTM precursor in which the four carboxy-terminal epidermal growth factor homologous domains can be secreted from a mammalian cell under the control of the human tPA signal peptide.

pBoel-TM2 was grown on a large scale in E. coli to prepare sufficiently pure plasmid for transfection of mammalian cells.

Example 3 Expression of TM Mutants in Mammalian Cells

For expression of mutant hTM in cultured BHK cells (Syrian Hamster, thymidine kinase mutant line tk ': sl3, Waechter and Baserga, (1982), Proc.Natl.Acad.Sci. USA, 79: 1106-1110. American Type Culture Collection CRL 1632 ) The expression vectors pBoel-TM1 and pBoel-TM2 were introduced into the cells by the calcium phosphate-mediated transfection procedure (Graham and Van der Eb, (1973), Virology, 52: 456-467).

Transient expression 30 48 hours after transfection, each petri dish was washed with serum-free Dulbeccos Modified Eagle Medium (containing 25 mM N-2-hydroxyethyl-piperazine-N'-2-ethanesulfonic acid (HEPES), pH 7.4, 10 mg / l insulin, 0.2% bovine serum albumin) and incubated in the same medium for 24 hours.

DK 162169B

24

The medium used was collected and assayed for TM activity in an assay described below.

Selection of TM mutant-producing clones 48 hours after transfection, cells were trypsinized and diluted in medium containing 400 nM methotrexate (MTX). After 10 to 12 days, individual colonies were cloned and propagated separately. The widespread cultures were propagated for 24 hours in serum-free medium as described above, and production clones were identified, using an assay for protein C coactivator activity.

Protein C coactivator activity

Protein C activation was measured by one by Bourin et al. modified method (Proc.Natl.Acad.Sci. US 83/5924 (1986)). 200 μΐ serum-free supernatant from transfected cultures was mixed with 40 μΐ Protein C and 10 μΐ thrombin (final concentrations of 1 μΜ and 20 nM, respectively) and calcium chloride was added to a final concentration of 2 mM. The mixture was then incubated at 37 ° C for 30 minutes and quenched with 200 pmol of Antithronbin III and 5 U of heparin. The volume was adjusted to 650 μΐ with 50 mM Tris.HCl / 0.1 M NaCl, pH 8.3 and 10 μΐ 1 mM S-2266 (D-Val-Leu-Arg-β-nitroanilide, KabiVitrum) in the same buffer was added.

25 Increasing absorbance at 405 nm caused by protein C activity was recorded. A standard curve was established using known amounts of Protein C completely activated by thrombin in the presence of rabbit TM.

The results of this sample are shown in Table 1 30 below:

DK 162169 B

25

Table 1

Protein C coactivator activity in supernatants from transfected cultures

Transfected DNA Growth type Protein C activation 5 pnol / min

None Transient 0.5 TM-1 Transient 1.7 TM-2 Transient 1.3

None Host cells 0.3 10 No Host cells 0.9 TM-1 Clone 1 1.5 TM-1 Clone 2 6.5 TM-2 Clone 1 3.8 TM-2 Clone 2 4.8 15 The table clearly shows that the modified thrombomodulins of the invention have a Protein C coactivating activity.

Inhibition of solidification activity

For inhibition of solidification activity, 500 20 μΐ serum-free tissue culture supernatant was dialyzed against 100 mM

NaCl, 50 mM Tris.HCl, pH 7.4. 100 μΐ APTT reagent (Dade) was incubated with 100 μΐ standard citrate plasma for 3 minutes at 37 * c. 100 μΐ dialyzed tissue culture supernatant was added and immediately thereafter 130 μΐ 30 mM calcium chloride.

Coagulation was measured in seconds.

The results of this sample are shown in Table 2 below:

DK 162169B

26

Table 2

Anticoagulant activity of dialyzed supernatants from transfected cultures

Transfected DNA Growth type Clotting time 5 seconds

No Host Cells 28 TM-1 Clone 1 35 TM-1 Clone 2 70 TM-2 Clone 1 56 10 TM-2 Clone 2 49

From Table 2, it can be seen that the coagulation time of the supernatants containing the modified thrombomodulin according to the invention was substantially longer than that of the control group which did not contain thrombomodulin.

While the present invention has been described in connection with particular embodiments thereof, it is to be understood to include such equivalents and modifications which are within the skill of the art, and the invention is further to be understood and interpreted in connection with the appended claims. .

Claims (10)

A recombinant protein with thrombomodulin activity defined by a high affinity binding to thrombin and with the ability to equip a complex between the protein and thrombin with the ability to activate Protein C, k characterized in that it from the C-terminal moiety of the molecule comprises a) an O-glycosylation rich domain b) at least four EGF domains 10 c) the human tissue type plasminogen activator (tPA) signal peptide and a short adapter sequence, or a ') at least four EGF domains b') the human tissue type plasmino-15 signal peptide gene activator (tPA) and a short adapter sequence. 2. CCGAGGGCTTCGCGCCCATTCCCCACGAGCCGCACAGGTGCCAGATG- TTTTGCAACCAGACTGCCTGTCCAGCCGACTGCGACCCCAACACCCA- GGCTAGCTGTGAGTGCCCTGAAGGCTACATCCTGGACGACGGTTTCA- TCTGCACGGACATCGACGAGTGCGAAAACGGCGGCTTCTGCTCCGGG- GTGTGCCACAACCTCCCCGGTACCTTCGAGTGCATCTGCGGGCCCGA- 2. The protein of claim 1, characterized in that it comprises the following arincsyresekvenser: MDAMKRGLCCVLLLC GAVFVSPSQEIHARFRRGAR 20 SYQDVDDCILEPSPCPQRCV NTQGGFECHCYPNY DLVDGE CVEPVDPCFRANCEYQCQPL NQTSYLCVCAEGFAPI BIPHEP HRCQMFCNQTACPADCDPNT 25 QASCECPEGYI LDDGFI CTD In DECENGGFCSGVCHNLPGT FECICGPDSALARHIGTDCD SGKVDGGDSGSGEPPPSPTP GSTLTPPAVGLVHS 30 or DK 162169B MDAMKRGLCCVLL .lc GAVFVSPSQEIHARFRRGAR SYQDVDDCILEPSPCPQRCV NTQGGFECHCYPNYDLVDGE 5 CVEPVDPCFRANCEYQCQPL NQTSYLCVCAEGFAPIPHEP HRCQMFCNQTACPADCDPNT QASCECPEGYILDDGFICTD IDECENGGFCSGVCHNLPGT 10 FECICGPDSALARHIGTDCD SGKVD 3. CTCGGCCCTTGCCCGCCACATTGGCACCGACTGTGACTCCGGCAAGG- TGGACTAGGGATCC Protein according to any one of claims 1 or 2, characterized in that it is substantially free of contamination of human origin. DNA construct characterized in that it contains a nucleotide sequence encoding a) the human tissue type plasminogen activator (tPA) signal peptide and a short adapter sequence, b) at least four EGF domains, and c) an O-glycosylation rich domain. or a ') the signal peptide from human tissue type plasmininogen (tPA) and a short adapter sequence; b') at least four EGF domains. 5. The DNA construct system according to claim 5, characterized characterized in that it contains the following nucleotide sequence: DK 162 169 B-GGATCCGAATTCCACCATGGATGCAATGAAGAGAGGGCTCTGCTGTG TGCTGCTGCTGTGTGGCGCCGTCTTCGTTTCGCCCAGCCAGGAAATC-CATGCCCGATTCAGAAGAGGAGCCAGATCTTACCAAGACGTCGACGA-CTGCATTCTAGAGCCCAGTCCGTGTCCGCAGCGCTGTGTTAACACAC-5-AGGGTGGCTTCGAGTGCCACTGCTACCCTAACTACGACCTGGTGGAC GGCGAGTGTGTGGAGCCCGTGGACCCGTGCTTCAGAGCCAACTGCGA-GTACCAGTGCCAGCCCCTGAACCAAACTAGCTACCTCTGCGTCTGCG-CCGAGGGCTTCGCGCCCATTCCCCACGAGCCGCACAGGTGCCAGATG-TTTTGCAACCAGACTGCCTGTCCAGCCGACTGCGACCCCAACACCCA-10 GGCTAGCTGTGAGTGCCCTGAAGGCTACATCCTGGACGACGGTTTCA- TCTGCACGGACATCGACGAGTGCGAAAACGGCGGCTTCTGCTCCGGG-GTGTGCCACAACCTCCCCGGTACCTTCGAGTGCATCTGCGGGCCCGA-CTCGGCCCTTGCCCGCCACATTGGCACCGACTGTGACTCCGGCAAGG-TGGACGGTGGCGACAGCGGCTCTGGCGAGCCCCCGCCCAGCCCGACG -15 CCCGGCTCCACCTTGACTCCTCCGGCCGTGGGGCTCGTGCACTCCTA- GGATCC or GGATCCGAATTCCACCATGGATGCAATGAAGAGAGGGCTCTGCTGCTGCTGTGTGGCTGTGTGGCGCCGTCGTC TCGACGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG An expression vector capable of directing the expression of a protein according to claim 1 or 2, characterized in that the vector comprises a promoter, DK 162169B operably linked to a DNA construct as defined in any of claims 4 or 5. A cell, characterized in that it contains a vector according to claim 6, preferably a bacterial cell, fungal cell, yeast cell or mammalian cell, preferably a mammalian cell. A method for producing a protein according to claim 1, 2 or 3, characterized in that it comprises: a) inserting into cells of a vector according to claim 6, which cells are preferably bacterial, yeast, fungal or frame cells, preferably mammalian cells, b) culturing the cells in a suitable medium, and c) isolating the protein product with thrombomodulin activity encoded by the vector and produced by the cells. Pharmaceutical composition, characterized in that it contains at least one protein or a physiologically compatible salt or ester thereof according to any one of claims 1 to 3 in combination with a pharmaceutically acceptable carrier or addition, preferably in the form of of a physiological solution. Use of a protein according to claim 1, 2 or 3 for coating an article designed to be in contact with blood and / or gut and / or graft 25. a mammal's body.