JPH02257891A - Production of protein by recombinant animal cell - Google Patents

Abstract

PURPOSE:To produce protein such as hormone, enzyme or enzyme inhibitor by culturing recombinant animal cell having protein-producibility in medium containing cytokinin such as tumor necrosis factor or lymphotoxin. CONSTITUTION:Recombinant animal cell having protein-producibility synthesized using manifestation plasmid containing SV40 initial promoter and SV40 latter promoter, etc., is cultured in medium containing cytokinin and propagated, then the culturing is continued till protein is sufficiently accumulated to produce protein. Suitable examples of cytokinin are tumor necrosis factor derived from human and lymphotoxin derived from human, etc., and concentration of cytokinin contained in medium is suitably 10<2>unit/ml-10<4>unit/ml. Concrete examples of resultant protein are human granulocyte colony-stimulating factor and human prourokinase, etc.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention provides a method for producing proteins using recombinant animal cells capable of producing proteins by allowing cytokines to be present in the culture medium containing the animal cells. Concerning how to produce.

[Conventional technology]

When producing hormones, cytokines, enzymes, etc. industrially using animal cells as hosts, the cells that originally produce the protein are cultured in large quantities to obtain the target protein. However, productivity is low and it is difficult to obtain sufficient quantities.

In order to improve productivity and more efficiently obtain the desired pallor, recombinant animal cells are being bred using genetic engineering techniques.

In order to further enhance the productivity of these recombinant animal cells, the effects of culture medium additives on productivity were investigated.

being investigated. Among these medium additives, sodium acetate has been well studied, and it has been proposed to increase the productivity of recombinant human growth hormone-producing cells by adding an appropriate amount to the medium (Japanese Patent Application Laid-Open No. 63-5032
However, to date, there has been no example of further enhancing the productivity of recombinant animal cells using cytokines as medium additives.

[Problem to be solved by the invention]

An object of the present invention is to provide a production method for further enhancing the productivity of useful proteins by recombinant animal cells compared to conventional methods.

[Means to solve the problem]

In order to solve this problem, the present invention investigated the effect of adding cytokines to the culture medium of recombinant animal cells on productivity, and found that the addition of cytokines significantly improved the productivity of the target protein. heading,
This has led to the completion of the present invention.

The present invention provides: (1) A method for producing a protein, which is characterized in that when producing a protein using a recombinant animal cell capable of producing a protein, a cytokine is allowed to exist in a medium containing the recombinant animal cell.

(2) The production method according to (1) above, wherein the cytokine is tumor necrosis factor (hereinafter abbreviated as TNF), lymphotoxin (hereinafter abbreviated as LT), or a derivative of LT.

(3) The above (2) in which TNFSLT is of human origin
Production method described.

(4) The production method according to (2) above, wherein the LT derivative is a derivative in which 11 or 22 amino acids are deleted from the N-terminus of mature human LT.

(5) Cytokine at 10 units/ml
~107 units/-1 preferably 10”unft
The production method according to any one of (1) to (4) above, wherein the concentration of s/d to 10'units/all is present.

(6) The above (1) in which the protein produced is a hormone, enzyme, enzyme inhibitor, cytokine, or immunoglobulin.
Production method described.

(7) The animal cells are human cells or CIO (Chinese Hamster cells).
0vary) cell according to the above (1).

(8) The production method according to (1) above, wherein the protein produced is human granulocyte colony stimulating factor (hereinafter abbreviated as hG-CSF) or human prourokinase (hereinafter abbreviated as Pro-UK).

(9) The production method according to (1) above, wherein the protein to be produced is in a crude or isolated form.

011 As a promoter of the expression plasmid used to express the protein in the recombinant animal cells, SV40
Early Flow motor, SV40 late Flow motor, Mo
1oney marine leukemia vir
us LTR promoter, Rous sarcom
a virus LTR promoter, Husan T
-cell leukemia virus-I LT
SV40 early promoter containing a part of R, preferably SV40 early promoter or HTLV-I LT
The production method according to (1) above, which uses the SV40 early promoter containing a part of R.

The production method according to (1) above, wherein recombinant animal cells capable of producing aO protein are cultured and grown in a medium containing a cytokine, and the culture is continued until the protein is accumulated.

0. The production method according to (1) above, wherein recombinant animal cells capable of producing proteins are maintained in contact with cytokines in a cytokine-containing medium.

031 In the first step, recombinant animal cells capable of producing proteins are grown in a growth medium until reaching a predetermined cell density, and then in the second step, cytokines are brought into the presence and brought into contact with the recombinant animal cells. The production method described in 02) above.

It is related to.

The present invention will be explained in detail below.

According to the present invention, there is provided a production method for further enhancing the productivity of recombinant animal cells that produce hormones, enzymes, enzyme inhibitors, cytokines, immunoglobulins, etc., compared to conventional methods.

As human LT (hereinafter abbreviated as hLT) used in the present invention, either a naturally-derived preparation or a preparation produced by recombinant technology can be used.

Any hLT derivative can be used as long as it has LT activity, but preferably,
Created by the present inventors (Japanese Unexamined Patent Publication No. 62-18129
8) A derivative in which the 11th amino acid from the N-terminus of mature hLT is deleted [hereinafter abbreviated as hLT (Δ1-11)], a derivative in which the 22nd amino acid from the N-terminus of mature hLT is deleted [ Hereinafter, abbreviated as hLT(Δ1-22)] can be used (Table 1).

Table 1 Amino acid sequence of mature hLT Properτhrma111PMPMG17AlaFh
@1A1aLau middle! -Human TNF used in the present invention (
(hereinafter abbreviated as hTNF) is a naturally derived preparation,
Any specimen produced by recombinant technology can be used. In addition, any derivative having TNF activity can be used. For example, a derivative lacking the N-terminus of mature hTNF reported by Carlino et al.
ino) et al.: The Journal of Biological Sciences
Chemistry (J, Biol, Chem,)% invitation, 95
B (19B?) can also be used.

Although any animal cell can be used as a host, human Natsalv
a cells (ATCC CRL1432), CHO cells deficient in the dihydrofolate reductase gene (hereinafter abbreviated as dhfr) [G, Urlaub & L, A, Chasin (G, Urlaub & L, A, Chasin):
Proc, Natl.

^cad, sci,, USA, 77.4216 (198
0)) etc.

The protein to be produced may be any protein such as hormones, enzymes, enzyme inhibitors, cytokines, or immunoglobulins, but here, pro-UK is used.

hG-CSF is shown as an example.

Any expression plasmid can be used as long as it can integrate and express the gene of the protein of interest. The promoter used at this time is SV
40 early promoter, SV40 late promoter, M
o1oney n+urine leukemiavi
rus LTR promoter Rous sarcom
a virus LTR promoter, HTLV4 LT
The SV40 early promoter, preferably the SV40 early promoter, containing a portion of the HTLV-I
The SV40 early promoter containing part of LTR(7) can be used. S containing part of HTLV-ILTR
It has been reported that the V40 early promoter has stronger promoter activity than the SV40 early promoter in many cells [Yobe et al.: Molecular &amp;
Cellular Biology (Mo1.Ce11.Biol
), 8, 466 (198B)).

The dhfr gene amplification system is often used to produce useful fluorescent substances in animal cells.The method developed by the present inventors is also effective for recombinant cells in which these genes have been amplified. be.

Pro-UK expression plasmids include PSEIUKprol-1 shown in Reference Example 13 and psEtUKISEdl-3 shown in Reference Example 16, and hG-CSF expression plasmids include pASLB3- shown in Reference Example 17.
As a plasmid having 3 and dhfr as a selection marker, psv 2-dhfr (Vis suprama;
(S, Sabramani) et al.: Molecular and Cellular Biology (Mol.

Ce11. Biol, ), 854 (1981))
hLT, hL using Namalima cells and dhfr-deficient CHO cells as host animal cells.
T (Δ1-11), hLT (Δ1-22), hT
An example in which the effect of adding NF was investigated will be described below.

First, an example of breeding the pro-UK polypeptide producing strain 0110 will be described.

psEIUKprol-1 and pSV2-dhfr
For example, using the calcium phosphate method [Graham & Van der Eb:
Virology 52, 546 (19
78) ) into dhfr-deficient CIO cells.

psEIUKprol-1 and pSV2-dhfr
Transformants having the following can be selected, for example, using MEM ALPHA medium (free of ribonucleic acid and deoxyribonucleic acid: manufactured by GIBCO) containing 0418 and dialyzed fetal bovine serum. By culturing the obtained transformed strain in a medium, pro-UK polypeptide can be produced in the culture solution.

The activity of urokinase (hereinafter abbreviated as UK) was determined using the fibrin plate assay method (GranelliPip).
Erno and Re1ch: Journal of Experimental Medicine (J, Exp, Med,)
148.223 (197B)).

Next, an example of breeding a pro-UK polypeptide-producing Namalwa strain will be described.

psEIUKlsEdl-3, for example, by electroporation [Neus+ann et al.: EMBOJ, 1.841 (198
2)) into Namalwa cells. psE
A transformed strain having IUKlsEdl-3 is, for example, G
418 and fetal bovine serum (manufactured by Hinaga Pharmaceutical Co., Ltd.). By culturing the obtained transformed strain in a medium, pro-UK polypeptide can be produced in the culture solution.

Furthermore, methotrexate (hereinafter referred to as M) was selected from among the transformed strains.
It is also possible to obtain a transformed strain in which the pro-UK polypeptide gene has been amplified using TX (abbreviated as TX). By culturing the obtained transformed strain in a medium, pro-UK polypeptide can be produced in the culture solution.

UK activity is 1. It can be measured by fibrin plate assay.

Next, hG-CSF polypeptide producing Nama 1wa
An example of breeding a strain will be described.

pASLB3-3 is introduced into Namalsma cells by, for example, electroporation. pASLB3-
Transformants having 3 can be selected, for example, in RPMI 1640 medium containing 0418 and fetal bovine serum. By culturing the obtained transformed strain in a medium, hG-CSF polypeptide can be produced in the culture solution. Furthermore, a transformed strain in which the hG-CSF polypeptide gene has been amplified can also be obtained from among the transformed strains using MTX. By culturing the obtained transformed strain in a medium, hG-CSF polypeptide can be produced in the culture solution.

The protein amount of hG-CSF is determined by enzyme-linked immunosorbent assay (ELISA) using an anti-hG-CSF monoclonal antibody. In addition, as a standard substance at this time, an hG-CSF preparation produced and purified using Escherichia coli and quantified by the Lowry method is used.

In addition, the anti-hc-cSF monoclonal antibody was prepared using the method of Hana et al.
Flowers: Cancer Research
), 46, 4438 (1986)).

Next, hLT was added to the pro-UK polypeptide-producing CHO strain.
An example will be described in which the effect was investigated by adding .

hLT was obtained by the method disclosed by the present inventors (Japanese Unexamined Patent Publication No. 62-1
81298) or purchased from Cosmo Bio etc.
Its/Ild! Add and incubate. UK activity in the culture fluid can be measured by fibrin plate assay by sampling over time.

Addition of hLT clearly had an effect of enhancing pro-UK production, demonstrating the effectiveness of the present invention.

Next, pro-UK polypeptide produced Na+wa1wa
hLT, hLT (Δ1-11), hLT (
Δ1-22), an example in which the effect of adding hTNF was investigated will be described.

hLTShLT (Δl-11), hLT (Δ1-
22) is the method disclosed by the present inventors (Japanese Unexamined Patent Application Publication No. 1986-1
81298). hTNF can be purchased from Cosmo Bio, etc.

hL to the pro-UK polypeptide-producing Namalwa strain.
T, hLT (Δ1-11), hLT (Δ1-22
) or hTNF, for example, I
s/rd or I X 10'units/
ad! After 3 days of culture, UK activity in the culture solution can be measured by fibrin plate assay. Alternatively, UK activity in the culture fluid can be measured by fibrin plate assay by sampling over time.

hLT, hLT (Δ1-11), hLT (Δ
l-22) Alternatively, the addition of hTNF clearly increases pr
The effect of enhancing o-UK production was observed, demonstrating the effectiveness of the present invention.

Next, an example will be described in which the effect of adding hLT to the hG-CSF polypeptide-producing NamaLwa strain was investigated.

For example, hLT is added to the h'G-C'SF polypeptide-producing Namalwa strain at 103 units/me or 10' units/rd and cultured. For example, hG-
The amount of CSF protein can be measured by ELISA method.

Addition of hLT clearly had an effect of enhancing hG-C5F production, demonstrating the effectiveness of the present invention.

The culture medium and culture method used in the present invention are as follows.

Examples of media include Ham's FIO medium supplemented with various serums (e.g., fetal bovine serum), Ham's F12 medium (all manufactured by Flow Lab), Dulbecco's MEM medium, and RPMI-1640 medium (
(manufactured by Hinaga Pharmaceutical Co., Ltd.), MEM ALPHA medium, and a mixed medium thereof are used. For the culture medium, if necessary,
Glutamine 0.5-5mM, antibiotics [penicillin (2
5U/ml), streptomycin (25μg/adl
), 041B (0.3mg/m), etc.], baking soda (0.3mg/m), etc.), 041B (0.3mg/m), etc.
, 01%) or the like may be added in an appropriate amount.

For culturing, various culture bottles, dishes, roller bottles, bottles, pinner flasks, jar fermenters, etc. can be used. Culture is usually carried out at a seed cell density of 5×1
0'~lXl0' cells/ml, 30~40 °C1
When carried out for 2 to 10 days, pro-UK
Alternatively, hG-CSF is mainly secreted extracellularly. In addition, in the present invention, when producing a protein using recombinant animal cells having protein-producing ability, the cells are directly cultured and grown in a medium containing cytokines, and the culture is continued until the protein accumulates. However, in the first step, recombinant animal cells capable of producing proteins are cultured in another growth medium until a certain cell density is reached, and then in the second step, cytokines are made to exist, and the animal cells and You may maintain contact.

Next, the means for preparing the expression plasmid to be inserted into the recombinant animal cells of the present invention will be shown in Reference Examples. In addition, the reaction conditions in the recombinant technique in the following reference examples are as follows.

Digestion reaction of DNA with restriction enzymes is usually 0.1 to 20μ
g of DNA at 2-200mM (preferably 10-40mM
M) Tris-HCI (pH 6,0-9.5 preferably pH 7,0-8.0), O-200mM NaC
1,2-20mM (preferably 5-10mM) Mg
Using 0.1 to 100 units of restriction enzyme (preferably 1 to 3 units per 1 gg of DNA) in a reaction solution containing 1 g of C, at 20 to 70°C (the optimal temperature varies depending on the restriction enzyme used). The termination of the 0 reaction, which is carried out for 15 minutes to 24 hours, is usually done by heating at 55 to 75°C for 5 to 30 minutes, but a method of inactivating the restriction enzyme with a reagent such as phenol or diethylpyrocarbonate can also be used. .

Purification of DNA fragments or gapped duplex DNA generated by restriction enzyme digestion is performed using low melting point agarose gel electrophoresis (hereinafter abbreviated as LGT method) [L, Wies-1ander].
:Analytical Biochemistry
tical Biochemistry) 98,30
5 (1979)) or an agarose gel freeze-thaw method (hereinafter abbreviated as AFT method). This AFT method involves applying an equal amount of T to a slice of agarose gel (0.7-1.5%) containing DNA fragments.
E buffer (10mM Tris-HCI (pH 7,
5), 1mM EDTA) and double the amount of phenol (T
(saturated with E buffer), mixed and then -70
This is a method in which freezing and thawing are repeated twice at °C and 65 °C, and then the upper aqueous solution produced by centrifugation is separated, and DNA fragments are recovered by ethanol precipitation. D
NA fragment recovery machine Max Yield AE-3241 type (
DNA fragments can be eluted and purified from agarose gel or polyacrylamide gel by electrophoresis using ATO (manufactured by ATO Co., Ltd.) [hereinafter, this method will be abbreviated as electro-elution].

The DNA fragment binding reaction is carried out using 2 to 200 mM (preferably 10 to 40 IIM) Tris-HCI (pH 6
, 1 to 9.5, preferably pH 7.0 to 8.0), 2 to
20mM (preferably 5-10mM) MgCh,
0.1-10mM (preferably 0.5-2゜OmM)
of ATP, 1-501mM (preferably 5-10mM)
Using 1 to 1.000 units of T4 DNA ligase in a reaction solution containing dithiothreitol (hereinafter also referred to as DTT) at 1 to 37°C (preferably 3 to 20°C) for 15 minutes to 72 hours (preferably 2 to 20 hours).

The recombinant plasmid DNA produced by the ligation reaction is
If necessary, the transformation method of Cohen et al. [Nis, N. Cohen et al.: Proceedings]
of the National Academy of Sciences (Proc, Natl, Acad, Sci,), USA
, 69°2110 (1972)) or Hanahan's transformation method (Hanahan: Journal of Molecular Biology (J, Mo1. Biol.
,) 1fifi, 557 (1983)),
Introduce into E. coli.

Recombinant M13 phage RF generated by binding reaction
DNA can be obtained by known transfection methods if necessary [
Yoshiyuki Hino et al.: Protein/Nucleic Acid/Enzyme Dishes, 294 (198
4)) into Escherichia coli JM105 strain [J. Messing et al.: Gene, 103 (1985)].

Isolation of recombinant plasmid DNA and recombinant M13 phage RF DNA from E. coli was carried out using the method of Birnboim et al.
C., Birnboim) et al.: Nucleic acid.
Lisa Tchi (Nucleic Ac1ds Res,)
7 +1513 (1979)).

Isolation of single-stranded DNA from recombinant M13 phage is performed using a known method [Yoshiyuki Kuchino et al.: Protein/Nucleic Acid/Enzyme Research, 2]
94 (1984)).

The deoxyoligonucleotides used in the present invention are synthesized by solid-phase synthesis using the phosphoramidite method (S, L).

Beaucage et al.: Tetrahedron Q Letters (Te
tra-hedron Lett,) 22.1859
(1981)), Andori, J.

BcBrie et al. 24.245 (1983)), Applied Biosystems, Inc. 380^・DN
A synthesis $1 (Applied Biosystems
Inc., Foster C1ty CA 9440
4). When used in a reaction to combine synthesized deoxyolibonucleotides with other DNA fragments, approximately 20 picomoles (pmoles)
Deoxyoligonucleotides were added to 20μ2 of T4 kinase buffer (50mM Tris-HCI (pH 7,6).
), lQmMgClg, 5IIM dithiothreitol, 0.1mM EDTA, 0.5mM ATP
) by adding 5 units of 74 DNA kinase.

When used as a probe for hybridization, 0.5mM A in the T4 kinase buffer described above.
20-50 μC1 of 5'-Cr-”P instead of TP
) A T P (3000Ci/mn+oL amateur
Jam (Amer-shan+, ArliArlln
Radiolabel the 5' end using Lights, If).

For structural analysis of plasmid DNA, refer to plasmid D
After digesting NA with 1 to 10 types of restriction enzymes, the cleavage site is examined by agarose gel electrophoresis or polyacrylamide gel electrophoresis. Furthermore, when it is necessary to determine the base sequence of DNA, we use dideoxy 5equence using M13 phage.
) determined by law.

Reference Example 1 Construction of plasmid ptp^7 carrying human t-PA cDNA: (1) Poly(A) from Detroit 562 cells
Preparation of RNA: human pharyngeal cancer cell line De tro i
t562, the guanidine thiocyanate-lithium chloride method [Cathala et al.: DNA
Poly(A) according to NA) 2°329 (1983))
RNA having the following was prepared as follows.

Human pharyngeal cancer Detroit562 (Petermen)
W Day Jr. (Peterson, W.
D.

Jr.) et al.: Proceedings of the Society for Experimental Biology and Medicine (Proc, Soc.

Exp, Biol, Med, ) 136, 1187
(1971)), 10% tallow serum, 1/100 volume of 100x non-essential amino acid solution (manufactured by Flow Laboratories), 1mM sodium pyruvate, 0.
1% lactalbumin hydrate (Gibco Oriental)
Using 501d MEM medium (manufactured by Hinaga Pharmaceutical Co., Ltd.) containing
Tissue Culture Flask (Corning Corporation, 1
50 cffl). After culturing to confluence at 37°C, cells were washed with PBS and treated with 1100 n/d phorbol myristate acetate (PMA:
Phorbol myristateace ta t
30 ml of the above medium added with e) and excluding fetal bovine serum
was added and further cultured at 37°C for 24 hours.

Cells were then treated with 0.05% trypsin, 0.02% EDT.
A cell suspension was obtained by treatment with 10+++1 of a solution containing A. A total of 1×101 liters of cells were obtained from the six tissue culture flasks described above.

Cells were collected from the cell suspension by centrifugation at 1,1100X at 4°C for 110 min, washed with 80 d of phosphate buffer, and then washed with 5 M guanidine thiocyanate, 10 mM
EDTA, 50mM Tris-H (/!
Solubilization was carried out using a portex mixer in 10 ml of a solution consisting of pH 7) and 8% (V/V) 2-mercaptoethanol. Transfer this lysate to a centrifuge tube and
After adding 80 d of M LiCl1 solution and stirring, the temperature was increased to 4°C.
It was left standing for 120 hours. After centrifugation for 90 minutes at 9,000 rpm+ in an old tachi RPRIO rotor, RNA was collected as a precipitate. Precipitate RNA with 4M urea and 2
Suspended in 50rn1 of a solution consisting of M lithium chloride,
tachi RPRIOC1';'-Nite9. OOOr
After centrifugation for 60 minutes, RNA was again collected as a precipitate. RNA precipitates were mixed with 0.1% sodium lauryl sulfate, 1 mM EDTA, 10 mM Tris-H (
/! (pH 7.5), extracted with phenol-chloroform, and recovered by ethanol precipitation. Approximately 2.5 μm of the obtained RNA was diluted with 10 mM
Tris-HCf (pH 8,0) and 1 a+M
It was dissolved in Solution 1 consisting of EDTA.

Heat the ink at 65°C for 5 minutes, add 0.1 d of 5M Na
Added C1. The mixture was transferred to an oligo(dT) cellulose column [P-L Biochemical Co., Ltd.
chromatography (column volume: 0.5 d). m with adsorbed poly(A)
RNA was diluted with 10mM Tris-HCffi (pH 7,
About 90 μm of mRNA containing poly(A) was obtained by elution with a solution consisting of iDTA (5) and 1 mM).

(2) cDNA synthesis and insertion of the DNA into a vector: Okayama-Berg
) method [Molecular and Cellular Biology (Mo1. Ce11. Biol,), 2.1
6H1982)), cDNA was synthesized and a recombinant plasmid incorporating it was constructed. An outline of the process is shown in FIG.

pcDVl (Okayama and Barb)
s+a&Berg): Molecular and Cellular Biology 4 (Mo1. Ce11. Bio
l, ), 3.280 (1983) ) 400ag to 10o+M Tris-HCj! (pH 7,5), 6
aMMgCfg and 10ml NaCl! A solution consisting of 300III! plus an additional 500 units of K
pn I was added and reacted at 37°C for 16 hours, and the plasmid was cleaved at the Kpn1 site. After phenol-chloroform extraction, DNA was recovered by ethanol precipitation. Approximately 200 mg of the Kpn-cleaved DNA was mixed with 40mM sodium cacodylate, 30mM Tris-HCj!
(pH 6,8), 1mMCaCj! * and 0. I
Add dTT to a buffer solution (hereinafter abbreviated as TdT buffer) consisting of n+M dithiothreitol (hereinafter abbreviated as DTT).
P'L was added to 200 rinses of a solution containing P to give a concentration of 0.25 mM, and 81 units of terminal deoxynucleotidyl transferase (hereinafter abbreviated as TdT) (P'L
Biochemicals) and heated to 37°C.
The reaction was allowed to proceed for 11 minutes. Here, Kpnl of pCDVl
Approximately 67 poly(dT) chains were added to the 3' end of the cleavage site. From the solution, pcDV with poly(dT) chains was extracted by phenol-chloroform extraction and ethanol precipitation.
Approximately 100 μ of IDNA was recovered. The DNA was 10mM
Tris-HCl (pH 7,5), 6mM MgClt
, 100mM NaCj! In addition to 150 units of a buffer consisting of 360 units of EcoRI, the mixture was reacted at 37°C for 2 hours. After treating the reaction solution with the LGT method, about 3.1
A DNA fragment of kb was recovered to obtain pcov 1 with approximately 6 ON poly(dT) chains added. The DNA was diluted with 10mM Tris.
-Dissolved in a solution consisting of HCIt (pH 8,0) and 1mM EDTA, incubated at 65°C for 5 minutes, cooled with water, and dissolved in 50ml of 5M NaCl. , added.

The mixture was subjected to oligo(dA) cellulose column chromatography (manufactured by Collaborative Tip Research). Poly(dT) with a sufficient chain length is adsorbed onto the column and added to 10mM Tris-HCj! (pH 8.0) and 1mM ED T^, 27 pcDVl (hereinafter abbreviated as vector primer) having a poly(dT) chain was obtained.

Next, linker DNA was prepared.

pt, 1 (Okayama and Barb (Okaya+w)
a&.

Berg): Molecular and Cellular Biology (Mo1. Ce11. Biol,), 3
, 280 (1983)) about 14 g of 10 mM Tri
s-HCj! (p)17.5) , 6mM MgCj
! z and 50mM NaCj! A buffer solution consisting of 20
In addition to the 0 yield, 50 units of PstI were added, and 37'
After reacting for C4 hours, pLIDNA was cleaved at the Pst1 site.

After phenol-chloroform extraction of the reaction product, ethanol precipitation was performed, and about 13 pLIDNAs were cut with PstI.
trg was collected. The DNA is about 13. q was added to 50 μg of a solution containing dGTP at a final concentration of 0.25 mM in TdT buffer, and then T d T (P-L Biochemical
Alls) was added to the 3' end of the Pstl cleavage site of pLl and incubated at 37°C for 13 minutes.
Approximately 14 dG) chains were added. After phenol-chloroform extraction, DNA was recovered by ethanol precipitation. The DN
A is On + M Tris-HCf (pH 7,5),
6dMgCj! z and 60mM NaCj! In addition to 100 units of buffer consisting of
and incubate at 37°C for 3 hours.
A was cut at the HindI [1 site. The reaction product was fractionated by agarose gel electrophoresis, and approximately 0.5 kb of DNA was fractionated by agarose gel electrophoresis.
The fragments were processed using the DEAE paper method [Dretz et al.
en) et al.: Analytical Biochemistry (
AHL, Biochem, ), 112, 295 (19
81) ) to obtain linker DNA (hereinafter simply referred to as linker DNA) with an oligo(dG) chain.

Approximately 4n of poly(A) RNA prepared above and approximately 1.4cm of vector primer were added to 50mM Tris-HCf.
(pH 8,3), 8mM MgCj2□, 30mM
MCI, 0.3mM DTT.

2d dNTP (dATP, dTTP, dGTP
and dCTP) and lO unit glue bonuclease inhibitor (manufactured by P-LBiochen+1cals)
10 units of reverse transcriptase (manufactured by Seikagaku Kogyo Co., Ltd.) was added and incubated at 41"C for 90 minutes to synthesize NA complementary to mRNA. The reaction product was dissolved in phenol- Chloroform extraction and ethanol precipitation were performed to recover vector primer DNA with an RNA-DNA double strand added.
Dissolve 14 units of TdT (P-L Bi) in TdT buffer containing dCTP and 0.2μ
.

Chemicals) and incubated at 37°C for 2 minutes to add 20 (dC) strands to the 3' end of the cDNA. The reaction product was extracted with phenol-chloroform, and cDN with added (dC) chains was obtained by ethanol precipitation.
A-vector primer DNA was recovered. The DNA was dissolved in 10mM Tris-HCj2 (pH 7,5), 6m
MMgCj! z and 60mM NaCl, add 20 units of HindI, and add 3
It was incubated at 7°C for 2 hours and cleaved at the Hind111 site. The reaction product was extracted with phenol-chloroform,
Ethanol precipitation adds 0.5 pmol of (dC) chain c
DNA-vector primer DNA was obtained. The DNA
0.2 pmol and 0.4 pmol of the above linker DNA in 10 mM Tris-HCj! (pH 7,5
), dissolved in a solution consisting of 0.1M NaC42 and 1ff1MEDT, 65°C242°C10°
The cells were incubated at C for 10, 25, and 30 minutes, respectively. 20mM Tris-HCj! (pH 7.5),
4mM MgClz, IOIIIM (N114)
zsOa, 0.1MKC! and 0.1mM β-NA
A reaction solution was prepared with the composition of D so that the total amount was 1000. Add 25 units of Escherichia coli DNA ligase (manufactured by New England Bioraps) to the reaction solution, and heat at 11°C and 18°C.
Time ink evolved. The reaction solution was diluted with dN of 40 μM each.
TP, 0.15mM β-NAD, 10 units of E. coli DNA ligase, 20 units of E. coli DNA polymerase I (P-LBioch).
(manufactured by P-L Biochemicals) and 10 units of E. coli ribonuclease H (manufactured by P-L Biochemicals).
were added and incubated at 12°C and 125°C for 1 hour each. In the above reaction, recombinant DNA containing cDNA
circularization and the RNA part of the RNA-DNA duplex becomes DNA
A and a complete double-stranded DNA recombinant plasmid was produced.

(3) Recombinant DNA containing human t-PA-cDNA
Next, using colony hybridization, human t-PA-cDNA (Pennica et al.: Nature 301.214 (198
3) Synthesis of a base that matches a part of the base sequence of the t-PA signal peptide region of ) NA5'-ATGGATGCAATGAAGAGAGGG
t-PA-cDNA was selected in the following manner as a clone that associates with the CTCTGCTGT-3' probe labeled with 3tp.

First, using the recombinant plasmid obtained in (2), E. coli C600SF 8 strain [Gameron
: Proceedings of the National Academy of Sciences (Proc, Natl, Acad)
, Sci.) USA 72.3416 (1975)) to the Hanahan method (Hanahan: Journal of Molecular Biology U, Mol, Bio
Transformation was carried out according to the following method (1983). Approximately 10,000 colonies were obtained using the method of Hanahan and Meselson.
son: Method in Enzymology (Met
(Hods in Enzymology) 100
, 333 (1983)), nitrocellulose
fixed on the filter. Next, prehybridization of the filter was performed using 6 XNET (I XNET
・150mM NaCj! , 15mM Tris-HC
j! (pH 7,5), 1mM EDTA), 10x Denhardt's solution, and 100g/-
65° in a solution containing fragmented E. coli chromosomal DNA.
C14: 1 hour or more.

As mentioned above in this prehybridization solution! A p-labeled probe was added and allowed to associate with the DNA on the filter (65°C for over 116 hours). Next, filter the filter with 6XSSC (I XSSC=150mM NaCj!,
Wash twice with 15mM sodium citrate) at room temperature for 5 minutes.
The cells were washed for 30 minutes with a solution containing 2xssc and 0.1% SDS at 65°C. Further 2XSS at 65°C
After washing for 15 minutes with a solution containing C and 0.1% SOS,
Washed twice with XSSC at room temperature (5 minutes each).

After air drying the filter, one positive clone was identified by autoradiography.

cDNA of plasmid ptPA7 carried by this positive clone
The nucleotide sequence of A was determined by the deideoxy-Siefens method using M13 phage.

As a result, the cDNA of ptPA 7 was found to be the amino acid sequence of t-PA reported by Pennica et al. (Pennica et al.: Nature 301.214 (1983)).
) was found to encode t-PA, which completely matches t-PA. However, it was found that the 95th aspartic acid codon (GAC) and the 51212th leonine codon (ACA) of mature t-PA are GAT and ACC, respectively.

This seedling strain is Escherichia coli Et.
PA7 FF! It has been deposited with the Institute of Fine Technology as RMBP-1467.

Reference example 2゜Plasmid p carrying human pro-UK cDNA
Creation of UKl: c[ of Detroit 562 cells created in Reference Example 1]
lNA library was screened by colony hybridization method and human pro-UK cDNA
A clone was isolated. That is, first, using the recombinant plasmid obtained in Reference Example 1, E. coli C600SF 8
Stock [Gamerom H Proceedings of the National Academy of Sciences (Proc, Natl, Acad, Sci,) [I
SA 72.3416 (1975)) to Hanahan's method (Hanahan: Journal of Molecular Biology (JoMol, Biol, ), 16
6, 557 (1983)). Approximately 30,000 colonies obtained were subjected to the Hanahan and Meselson method (Hanahan and Meselson's method).
:Method in Enzymology
in Enzya+ology) 100.333(
(1983)) and fixed on nitrocellulose filters. Next, prehybridization of the filter was carried out using 6 XNET, IOX Denhardt (De
The test was carried out at 65° C. for 4 hours or longer in a solution containing Nhard T) solution and 100×/ml of fragmented E. coli chromosomal DNA.

Next, human pro-UK cDNA (Holmes et al., Bio/T
technology) 3.

923 (1985)) 41-base synthetic NA 5'-GGGAATGGTCACTTTACCGAG
A probe labeled with 3tP of GAAAGGCCAGCACTGACAC-3' (corresponding to the underlined nucleotide sequence in Table 5 for the human pro-UK cDNA isolated by the present inventors) was It was added to the prehybridization solution and allowed to associate with the DNA on the filter (65°C for over 116 hours). Next, the filter was washed twice with SSC (room temperature, 5 minutes each time).
Afterwards, it was washed for 30 minutes with a solution at 57°C containing 1X5SC and 0.1% SDS. Furthermore, lX5SC and 0.1% SDS
After washing for 15 minutes with a 57° C. solution containing 57° C., the cells were washed twice with 6X SSC (room temperature, 5 minutes each). After air drying the filter, one positive clone was identified by autoradiography. The nucleotide sequence of the cDNA of plasmid pUK1 (in the margins below this page) carried by this positive clone was determined using Deideoxy phage using M13 phage.
Determined by the sea-fence method (Table 2).

As a result, the cDNA of 1 in pU is pro-UK in Table 2.
According to the numbering of amino acid residues in pro-UK, it was revealed that it encodes the translated region and 3' untranslated region of pro-UK downstream from the 41st Cys residue of pro-○. p encoded by the cDNA of pUK1
The amino acid sequence of ro-UK was obtained from Holmes et al.
s et al.: Biotechnology (BioTechnolo-
gy) 3.923 (1985)), but the third base of the four amino acid codons shown below was different.

254th amino acid Asn: AAC4AAT34
0th amino acid Leu: CTA4CTG345
th amino acid Pro: CCC4CCA346th amino acid Gln: CAA4CAG This strain is Escherichia colt EUK IF
HRM BP-1463) has been deposited with the Institute of Fine Technology.

Reference Example 3 Plasmid p carrying human pro-UK cDNA
Construction of UK11: Since the pro-UK cDNA encoded by the plasmid PUK 1 obtained in Reference Example 2 does not contain the pro-UK signal region and growth factor metoin region, the following procedure was used. cDNA containing these regions
A was cloned.

First, the vector pCCK used for cDNA cloning
2 was constructed as follows.

(1) Construction of recombinant plasmid pCCK 1: Plasmid pRc19 containing rat brain cholecystokinin (CCK, precursor cDNA) constructed by Kuwano et al. (Kuwano et al.: Journal of Biochemistry = (J, B)
iochem, ) 96.923-926 (1984)
) was cultured, and pRc19 DNA was prepared from the cultured cells by a conventional method. The resulting pRc19 DNA was approximately 31! Il 30. ccji
(D10a+M Tris-HCj! (pH7,5)
, 7mM HgCllt, 6+*M2-) JL/
Dissolve in a buffer containing captoethanol and 50 MNa (/! (hereinafter abbreviated as "Y-50 buffer"),
One unit of PvuII was added, and the digestion reaction was carried out at 37°C for 1 hour. As a result of this reaction, the DNA was partially digested by Pv, uI. After heat treatment at 65℃ for 10 minutes, AF
A DNA fragment of approximately 530 bp was purified using the T method. On the other hand, the plasmid DNA pU created by Norlander et al.
c19 (Norrander, J, et al.: Gene (G
ene) 26.101 (1983): pUc19 plasmid DNA is available from Takara Shuzo Co., Ltd.] approx.
10mM Tris-HCI (pH 7,5), 7
mM MgCl! , z, dissolved in 30% of a buffer containing 6mM 2-mercaptoethanol (hereinafter abbreviated as "Y-0 buffer"), added 16 units of Smal, and incubated at 30°C.
Digestion reaction was carried out for 2 hours. After heat treatment at 65°C for 110 minutes, a DNA fragment of approximately 2.7 kb was purified using the AFT method.

Approximately 530 bp derived from pUc19 obtained in this way
DNA fragment (approximately 0.01.w) and an approximately 2.7 kb DNA fragment (approximately 0.05 g) derived from pUc19 were added to 201Tris-HCj! of 20 rhinoceros. (pH 7,6), 10m
M MgCj! x+ 10mM DTT and 1aM
Dissolve 200 units of T4DN in a buffer containing ATP (hereinafter this buffer will be abbreviated as "T4 ligase buffer").
A ligase was added and the ligation reaction was carried out at 4'C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an ampicillin (hereinafter abbreviated as Ap) resistant strain. Plasmid DNA, pccKl, was isolated from this transformed strain and subjected to structural analysis using restriction enzymes, and it was confirmed that it had the desired structure (see Figure 4).

(2) Construction of recombinant plasmid pCCK 2: Dissolve about 2 cods of pCCK 1 plasmid DNA obtained above in 30% Y-0 buffer, add 12 units of 5acI,
The digestion reaction was carried out at 7°C for 2 hours. Furthermore, 2M NaCjl of 1.5 rhinoceros! and 10 units of BamHI to give 37
The digestion reaction was carried out for 2 hours at °C. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 0.55 kb was purified using the AFT method. On the other hand, pTrS obtained in Reference Example 5 described below
Approximately two copies of the 33 plasmid DNA were subjected to the same reaction as above, and the resulting approximately 2.85 kb 5acl-Ban+HI fragment was purified using the AFT method.

Approximately 0.55 from pCCK 1 thus obtained
A DNA fragment of 1.5 kb (approximately 0.02 g) and a DNA fragment of approximately 2.85 kb (approximately 0.1 g) derived from pTrS33 were
Dissolve 50 units of T4DN in Kai's T4 ligase buffer.
A ligase was added and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA pCCK2 was isolated from this transformed strain, and structural analysis using restriction enzymes confirmed that it had the desired structure (see Figure 5).

(3) Isolation of plasmid pUK11 carrying human pro-UK cDNA: Poly(A) RNA (mRNA) of Detroit 562 cells prepared in Reference Example 1
mMTris-HCI (pH 7,5)-0,5mM H
[dissolved in DTA] was heated at 65°C for 10 minutes and then quenched in water.

This solution was mixed with 50mM Tris-HCjl! (pH
8,3), 8mMHzClt, 30mM KCj
! , 5+aM DTT, 1mM dNTP (dA
TP, dTTP, dGTP and dCTP), 1
0 units of glue bonuclease inhibitor (P-L Bi
chemical), and 5 pg/a
After adjusting to 11 oligo(dT) + 2-ts (manufactured by Collaborative) (total amount 80 relatives),
It was kept warm at 41°C for 15 minutes. Next, 20 units of reverse transcriptase (manufactured by Seikagaku Corporation) were added and kept at 41°C for 90 minutes to synthesize cDNA complementary to mRNA. After the reaction product was subjected to phenol-chloroform extraction and ethanol precipitation, mR
NA was hydrolyzed. Next, 10 rinses of I M Tris
-HCj! (pH 7,5) and 40fi 0.3NH
After neutralization by addition of Cf, single-stranded cDNA was recovered by ethanol precipitation and dissolved in 28.5 d HzO.

This solution was mixed with 50mM Tris-11C1 (pH 8,
3), 8n+MMgCfg, 30gM MCβ, 5mM
DTT.

1mM dNTP (dATP, dTTP, dGT
P and dCTP), and 2.5n/d synthetic NA
Puller (7-CATGAGAGCCCTGCTGG (
After adjusting the base sequence to match the base sequence of part of the signal peptide region of human pro-UK (total amount of 4O), the mixture was incubated at 65°C for 1o and then at 41"C for 30 minutes. Add 10 units of reverse transcriptase and incubate at 41°C.
By incubating for 60 minutes, single-stranded cDNA was converted into double-stranded cDNA. The reaction product was subjected to phenol-chloroform extraction and ethanol precipitation, and then 25mM N
aCj! Dissolve in Y-0 buffer 30itII containing 2
5 units of Bs5HII with Knee England Bio 511
(manufactured by S.A., Inc.) was added thereto, and the digestion reaction was carried out at 50°C for 2 hours. Furthermore, 1.25I4! 2M NaCl and 12 units of Bal
1l HI was added and the digestion reaction was carried out at 37°C for 2 hours. 6
After heating at 5℃ for 10 minutes, approximately 1.1 ~
A 1.4 kb cDNA fragment was purified.

On the other hand, the pCCK2 plasmid DNA obtained above
After cutting N with Bs5HI[-Ba5HI in the same manner as above, approximately 2.9 kb of Bs5HI[-Ba5HI was obtained using the AFT method.
The s+HI fragment was purified.

The approximately 1.1-1.4 kb cDNA obtained in this way
A fragment (approximately 0.02 g) and approximately 2.9 g from pCCK 2
kb DHA fragment (approximately 0.05■) and 20I11 T
200 units of T4 DNA dissolved in 41J gauze buffer
Ligase was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained recombinant plasmid mixture, E. coli C6
By transforming 00SF 9 strain, approximately 25.0
00 Ap-resistant strains were obtained, and among these AP-resistant strains, using the colony hybridization method described in Reference Example 2, pro-UK cDN
Approximately 1.00 positive clones associated with the same probe as that used for isolation of A were obtained. The hybridization and filter washing conditions are as in Reference Example 2.
It was the same. Plasmid pUKII (see Figure 6) possessed by one positive clone thus obtained was isolated, and the nucleotide sequences of the signal peptide, growth factor domain, and kringle domain regions of pro-UK were determined from M13.
It was determined by the Deideoxy Seafence method using phages. As a result, the base sequence was determined by Holmes (Ho
l+aes et al.: Bio/Tech
The results were consistent with those reported by (Nology) 3, 923 (1985)).

This strain is Escherichia colt EU
It has been deposited with the Institute of Fine Technology as KII FERMBP-1464.

Reference example 4゜Plasmid pcsFl-2 carrying hG-CSF cDNA
and construction of pCSF2 (1) Poly(A)R from normal human peripheral blood macrophages
Preparation of NA: White blood cells obtained by centrifugation from the peripheral blood of a normal person were cultured in a plastic bottle, and macrophages, which are adhesive cells, were isolated by washing and removing non-adherent cells. From this macrophage, the guanidine thiocyanate-lithium chloride method [Catha la
et al.: DNA k 329 (
(1983)), poly(A)-containing RNA was prepared as follows.

400 m of normal human peripheral blood was centrifuged for 20 minutes at 1800 rp Ill in an old Tachi RPRIO rotor to precipitate blood cells, and this was added to 50111 phosphate buffered saline (Na
Cj! 8 g/It, KCj20.2g/It, anhydrous NatHPOa 1.15g/l, KH2PO40.2
g#! (pH 7.2; hereinafter abbreviated as PBS)]. 25 ml of this suspension was layered on a 25-ml lymphocyte separation solution [manufactured by Pionetics (BIONII! TlC5)], and the mixture was stirred using a Hitachi RPRIO rotor at 18°C.
Centrifugation was performed at 00 rpm for 30 minutes. Separate the white blood cells in the middle layer and wash with an equal amount of Pus (formerly tachi RPRIO
After 1500 rpm + w for 10 minutes on the rotor,
The cells were suspended in 20d RPMI 1640 medium (manufactured by Hinaga Pharmaceutical Co., Ltd.) containing 5% fetal bovine serum and cultured. A tissue culture flask (manufactured by Corning) was used for culture.

After culturing at 37°C for 1.5 hours, the culture supernatant was removed together with non-adherent cells. New 201d same medium and Escherichia coli ribopolytJ! (LPS) was added at a concentration of 0.3/-, and the cells were further cultured at 37°C for 4 hours.

Next, cells were collected from the culture medium by centrifugation at 1.1100X and 4°C for 110 minutes, washed with 801d PBS, and then treated with 5M guanidine thiocyanate and 10ml 1'IED.
TA, 50mM Tris-HCj! (pH 7) and 8% (v/v) 2-mercaptoethanol using a portex mixer.

This solubilized material was transferred to a centrifuge tube and 4M LiCl1 solution 80-
After stirring, the mixture was left standing at 4° C. for 20 hours.

9. At Hitachi RPRIO rotor. OOOr
pm, and after centrifugation for 90 minutes, RNA was collected as a precipitate. Precipitate the RNA with a solution of 4M urea and 2M lithium chloride 5011d! suspended in the old tachi RPR
After centrifugation in an IO rotor at 9,00 Orps+ for 60 minutes, RNA was recovered as a precipitate.

Precipitate RNA with 0.1% sodium lauryl sulfate, 1
mM EDTA, 10mM Tris-HCf (
It was dissolved in a solution 10d consisting of pH 7.5), extracted with phenol-chloroform, and then recovered by ethanol precipitation. Approximately 0.8 mg of the obtained RNA was added to 10a+M Tr
is-ICf (pH 8,0) and 1 mW t! DT
It was dissolved in a solution IId consisting of A. Incubate at 65°C for 5 minutes and add 0.1a+1 5M NaCl! added. The mixture was transferred to an oligo(dT) cellulose column [PL Biochemi Co., Ltd.
Cal) Chromatography (column volume 0.5
m1).

The mRNA with adsorbed poly(A) was extracted with HTris.
mRNA with poly(A) eluted with a solution consisting of -HCl (pH 7,5) and 1 mM EDTA
Approximately 30 ttg was obtained.

(2) cDNA synthesis and insertion of the DNA into a vector: Okayama-Berg's method (Molecular and Cellular Biology)
Mo1. Ce11. Biol, ), 2.161 (
cDNA was synthesized and a recombinant plasmid incorporating it was constructed according to (1982)). An outline of the process is shown in FIG.

Approximately 3trg of poly(A) RNA prepared above and approximately 1.4lrg of vector primer were mixed with 50mM Tris-H.
Cf (pH 8,3), 8+aMMgCj! z, 30mM
KCl, 0.3mM DTT, 2sM dNT
P(dATPSdTTP, dGTP and dCTP)
and lO units of glue bonuclease inhibitor (P-
Solution 22 consisting of L Biochemicals)
．． Dissolved in 3 rhinoceros, added 10 units of reverse transcriptase (manufactured by Seikagaku Corporation), incubated for 90 minutes at 41'C, and mR
Complementary NA was synthesized. The reaction product was subjected to phenol-chloroform extraction, ethanol precipitation, and RN
Vector primer DNA with A-DNA double strand added
was recovered. The DNA was treated with 66 μM dCTP and 0.
2. Dissolve in TdT buffer 20I11 containing poly(A) and add 14 units of TdT (P-L Bioche+wica
ls) and incubate for 2 minutes at 37°C.
Twenty (dC) strands were added to the 3' end of the DNA. The reaction product was extracted with phenol-chloroform, and the cDNA-vector primer DNA with the (dC) strand added was recovered by ethanol precipitation. The DNA was diluted with 10mM Tri
s-HCl (pH 7,5), 6mM MgCj! z and 60tsM NaCj! Dissolved in 400 ha of a liquid consisting of
Add 20 units of HindI[I, incubate for 2 hours at 37°C, and cut at the BindI[I site. The reaction product was extracted with phenol-chloroform and precipitated with ethanol to obtain 0.5 pmol of (dC) chain-added cDNA-vector primer DNA. 0.2 pmol of the D N A and 0.4 pmol of the linker D N A were added to 1
0mM Tris-HCj! (pH 7,5), 0.
Solution 100III consisting of 1 M NaCl and 1 mM EDTA! and incubated at 65°C, 42°C, and 0°C for 10 minutes, 25 minutes, and 30 minutes, respectively. 2 M Tris-HCj! (pH7,5)+
4 mM MgCj2z.

10mM (NH,)zsO4,0,1M KCj!
and Q, composition of 1mM β-NAD, panoramic view 1000I
A reaction solution was prepared so that the reaction time was t1. 25 units of Escherichia coli DNA ligase (manufactured by New England Biolabs) were added to the reaction solution and incubated at 11°C for 18 hours. The reaction solution was treated with 40 μM each of dNTP, 0.15 m
M β-NAD and other components were additionally prepared, and 10 units of E. coli DNA ligase, 20 units of E. coli DNA polymerase I (manufactured by P-L Biochemicals) and 10 units of E. coli ribonuclease H (P-L Biochemicals) were added.
(manufactured by LBiochemicals) and heated at 12°C for 2 hours.
Incubation was performed at 5° C. for 1 hour each. In the above reaction, circularization of recombinant DNA including cDNA and RNA-D
The RNA portion of the NA duplex was replaced with DNA, producing a complete double-stranded DNA recombinant plasmid.

(3) Selection of recombinant DNA containing hG-CSF cDNA: Using the recombinant plasmid obtained in (2), E. coli C
The 6005F 8 strain was transformed according to the method of Scott et al. [Katsuya Shigesada: Cell Engineering 2.616 (1983)]. About 9,200 colonies obtained were fixed on a nitrocellulose filter.1. ,f,=.

Nagata et al.
27-base synthetic NA 5'-ACCCCCCCTGGGCCCTGCCAGCT corresponding to the N-terminal 9 amino acids of the mature protein of hG-CSF isolated by Nature) 319, 415 (1986))
60 to CCCTG-3' probe labeled with 3-P
Two strains that strongly associated at ℃ were selected [Grunstein-Hogness method, Proceedings of the National Academy of Sciences (Proc. Natl.
d, sci,) USA? 2+39601975))
M
It was determined by the Deideoxy Seefence method using phage No. 13. As a result, pCSF 1-2 and pC
The cDNA possessed by SF 2 was found to encode KG-CSF.

The microorganism containing plasmid pcsF 1-2 is Esche
ri-chia coli EC5FI-2[FERM
BP-1220) and plasmid pC5F
The microorganism containing 2 is Escherf-chia coli
It has been deposited with the Institute of Fine Technology as HCSF2 (FERM BP-2073).

Reference Example 5 Construction of recombinant plasmid pTrS33: (1) ATG
Construction of vector pTrs20: According to the procedure shown in FIG. 7, an ATG vector pTrs20 having a distance of 14 bases between the SD sequence and the ATG start codon and a 5 acl site immediately after the ATG codon was constructed.

First, pKYPlo 3trg prepared by the method described in JP-A-58-110600 was treated with 10d Tris-H
Cj! (pH 7,5).

7mM MgCj! □, Dissolved in a buffer containing 6mM 2-mercaptoethanol and 100mM NaCl (hereinafter abbreviated as "Y-100 buffer") to 30%, and added the restriction enzyme BanI and the restriction enzyme NruI (manufactured by New England Biolabs), respectively. Add 6 units each,
The cleavage reaction was carried out at 37°C for 3 hours. From this reaction solution, LO
About 3 containing Ptrp by T method.

Fragment (Banll [-Nrul fragment) approx.

On the other hand, the ATG initiation code is downstream of Ptrp. Use the following DNA linker to It was synthesized by the method.

8kb of DNA 5n was obtained.

Synthetic NA of triesters 19-+set and 17-aver (10 picomole each) giving 10% of Tris-HC was added to 50mM Tris-HC/!
(pH 7.5), 10+sM MgC j! z5wM
Dithiothreitol, 0. Dissolve in a total volume of 20 liters of solution containing ImM EDTA and 1mM ATP, and add T.
4 polynucleotide kinase 3 units (manufactured by Zenshuzo Co., Ltd.) were added, and a phosphorylation reaction was performed at 37°C for 60 minutes.

Next, Banl [-Nru
Dissolve 0.1 ar of the l fragment (approximately 3.8 kb) and approximately 0.5 picomole of the above DNA linker in T4 ligase buffer 20, add 2 units of T4 DNA ligase, and incubate at 4°C.
The binding reaction was carried out for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli H.
8101 strain [Boliver et al.: Gene 2, 75 (1977)] was transformed to obtain AP-resistant colonies. Plasmid DNA was recovered from the cultured cells of this colony. The structure of the obtained plasmid was determined using the restriction enzymes EcoRl, Ban■, H
After cutting with ind m, Sacl, and Nrul, it was confirmed by agarose gel electrophoresis. This plasmid is pTr
It was named s20 (Figure 7). Banl of pTrs20
I[, old ndlI[, the base sequence near the site is as follows.
Confirmed using the sea fence method.

(2) Construction of pTrS33: Approximately 3μ of the pTrs20 plasmid DNA obtained above was reduced by 30 Y-
0 buffer, add 12 units of SaCl, and incubate at 37°
The digestion reaction was carried out at C for 2 hours. Furthermore, 2 of 1.5Ita
Add MNaCf and 10 units of PstI and incubate for 2 hours at 37°C.
A time digestion reaction was performed. After heat treatment at 65° C. for 110 minutes, a DNA fragment of about 1.15 kb was purified by AFT method. On the other hand, pKYP26 (E. coli containing pKYP26 is Escherichia colt IKYP26) prepared by the method described in JP-A No. 62-48699.
(Deposited with FEMA as FERNBP-863)] was dissolved in 30% Y-100 buffer, 8 units of PstI and 10 units of BamHI were added, and the mixture was heated at 37°C.
Digestion reaction was carried out for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of about 1.7 kb was purified by AFT method.

Also, M13mp18RF DNA (Norra
der, J. et al.: Gene” L, 101
(1983): 2 g of M13mp18RF DNA (obtained from Takara Shuzo Co., Ltd.) was dissolved in 30 rhinoceros Y-[1 buffer solution, 10 units of 5 acl was added, and a digestion reaction was performed at 37°C for 2 hours. In addition, 1.5 precepts IMNaCj! and 10
Unit Cj! aI was added and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of about 0.65 kb was purified by AFT method. Apart from these, two synthetic NAs (43 bases and 45 bases) are shown in Figure 19.
Applied Biosystems 3BOA -
They were synthesized using a DNA synthesizer and each was 5'-phosphorylated using the same method as described above.

Approximately 1.15 from pTr520 obtained in this way
kb DNA fragment (approximately 0.1 g), approximately 1.7 kb DNA fragment derived from pKYP26 (approximately 0.1 g)
), an approximately 0.65 kb DNA fragment (approximately 0.05 g) derived from M13+p18, and the above two 5'-phosphorylated synthetic NAs (I Pllole each) were dissolved in 20 fi T4 ligase buffer, 50 units of T
4 DNA ligase was added, and the ligation reaction was carried out at 4°C for 18 hours.

Using the mixture of recombinant plasmids thus obtained, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid pTrS33 was isolated from this transformed strain, and structural analysis by restriction enzyme digestion and deideoxy-Siefens method using M13 phage were performed to determine pTrS33.
It was confirmed that TrS33 has the desired structure (8th
(see figure).

Reference Example 6 Construction of recombinant plasmid pTers 2: pKYP26
Plasmid DNA (Unexamined Japanese Patent Publication No. 62-48699)
About 2J! g to 10mM Tris4Cj! (p)18
．． 0), 75+mM NaCl.

16 units of Asp71 were dissolved in solution 30 containing 7mM HgClt, 6mM 2-mercaptoethanol.
B (manufactured by Boehringer Mannheim) and 10 units of P
stl was processed and a digestion reaction was performed at 37°C for 2 hours. 65
After heat treatment at °C for 110 minutes, approximately 1.7
A kb DNA fragment was purified. On the other hand, reference example 5 (1)
Approximately 2n of pTrs20 plasmid DNA obtained in
8 units of Pst in Y-100 buffer
1 and 10 units of NruI (manufactured by Boehringer Mannheim) were added, and the digestion reaction was carried out at 37°C for 2 hours. 6
After heat treatment at 5°C for 110 minutes, approximately 1.
A 5kb DNA fragment was purified. In addition, two types of synthetic NAs (19 bases and 23 bases) shown in Figure 20 were synthesized using an Applied Biosystems 380A-DNA synthesizer, and each was synthesized using the same method as described above separately. 5'-phosphorylation was performed using The approximately 1.7 kb DNA fragment derived from pKYP26 (approximately 0
．． 1), approximately 1.15 kb DNA derived from pTrs20
The fragment and two 5'-phosphorylated synthetic NAs (lpmole each) were dissolved in 20 rhinoceros T4 ligase buffer, 50 units of T4 DNA ligase was added,
The binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, pTerm2, was obtained from this transformed strain.
was isolated and structurally analyzed by restriction enzyme digestion and the deideoxy-Siefens method using M13 phage.
We confirmed that pTerm 2 has the desired structure (
(See Figure 9).

Reference Example 7 Construction of recombinant plasmid p'rspto: Plasmid ptP carrying human t-PA cDNA obtained in Reference Example 1
ptPA7 DNA was prepared from cultured cells of E. coli C60QSF 8 strain carrying A7 by a conventional method.

Approximately 2n of the obtained ptPA7 DNA was dissolved in 30ml of Y-100 buffer, 8 units of restriction enzyme Bgj2 I was added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 110 minutes, approximately 2. OKb's DNA
The fragment was purified using pTrS33 DNA (
Reference example 5) Approximately 2 cods were mixed in 30% fake Y-100 buffer for 10%.
One unit of restriction enzyme Ba+*HI was added, and the digestion reaction was carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 2.
An 8 kb DNA fragment was purified.

Approximately 2.0% of the thus obtained ptPA7. OKb
DNA fragment (approximately 0.1 g) and approximately 2.8 kb DNA fragment (approximately 0.1 trg) derived from pTrS33,
Dissolve the total amount in T4 ligase buffer in the order of 20, and add T4 DNA.
Fifty units of ligase were added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. From this transformed strain, plasmid DNA ApTSFlo was isolated and structurally analyzed by restriction enzyme digestion. However, it was confirmed that the desired structure existed (see Figure 10).

Reference Example 8 Construction of recombinant plasmid pTA4: Dissolve approximately 3n of pTsF10 plasmid DNA obtained in Example 7 in 30ml of Y-0 buffer, add 12 units of restriction enzyme KpnI, and digest at 37°C for 2 hours. After carrying out the reaction, 1.5 scraps of 3M NaCj! and 12 units of restriction enzyme Bs
tEI [New England Biolabs (NeivE)
(manufactured by NGLAND Biolabs) was added thereto, and the digestion reaction was further carried out at 60''C for 2 hours. Subsequently, a DNA fragment of approximately 0.3 kb was purified using the AFT method.

Apart from this, Escherichia coli IGHA2 (FERM
BP-400), and pG was extracted from the cultured cells using a conventional method.
I (A 2 plasmid DNA (JP-A-60-2210)
No. 91) was prepared. Approximately 2 cans of the obtained pGHA2 DNA were dissolved in 30I11 Y-100 buffer, and 8 units of P
stI and 8 units of BgfII were added, and a digestion reaction was performed at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 0.
A 75 kb DNA fragment was purified.

In addition, about 3 μg of ptpA7 DNA (Reference Example 1) was added to 30
bracken 10mM Tris-) 1cf (pH 7,5),
Dissolved in a buffer containing 7mM MgCf*, 6mM 2-mercaptoethanol and 150mM NaCl (hereinafter abbreviated as "Y-150 buffer'"),
After adding 1 unit of BstE It and carrying out the digestion reaction at 37°C for 2 hours, 12 units of BstE [
Digestion reaction was carried out at 0°C for 2 hours. Subsequently, a DNA fragment of approximately 1.55 kb was purified using the AFT method.

In addition, pTerm 2 DNA obtained in Reference Example 6
Approximately 2 K to 12 units of Kp in 30 It1 of Y-0 buffer
After adding nl and carrying out the digestion reaction at 37°C for 2 hours,
．． 2M NaCJ in 5 ha! , and add 8 units of Pstl,
The digestion reaction was further carried out at 37°C for 2 hours. Then AF
A DNA fragment of approximately 1.7 kb was purified using the T method.

Four types of DNA fragments (pTsF
0.03 g of fragment derived from pGHA2, 0 fragment derived from pGHA2
．． Fragment 0.1 trg from 05xSptPA 7,
and 20 fragments derived from pTerm 2 (0.1 n)
Dissolve 200 units of T41 in T4 ligase buffer.
4 DNA ligase was added, and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an -Ap-resistant strain. Plasmid DNA pTA4 was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 11).

Reference example 9゜t-PA expression psEIPA I 5E1d
Construction of hfrl-9A: (1) Construction of recombinant plasmid pAGE105M: Plasmid E) AGE2B constructed by the present inventors
(Mizukami et al.: Journal of Biochemistry (
J.Biochem, ) 101, 1307-1
310 (1987)) was cultured, and pAGE28 DN was isolated from the cultured cells by a conventional method.
A was prepared.

The resulting pAGIl! 30 y-io with 2B DNA approximately 2N.

Dissolve in buffer solution, 8 units of Xhol and 12 units of 5ca
1 was added, and the digestion reaction was carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, about 2.
An 8 kb DNA fragment was purified. On the other hand, Escherichia coli containing plasmid pAGE103 constructed by the present inventors is Escherichic colt EAGE 10.
3 (103 (FER1312)) and has been deposited with the Institute of Fine Technology.

[Mizukami et al.: Journal of Biochemistry (J
, Biochem, ) 101.1307 1310 (
Escherichia coli H8101 strain harboring 1987)) was cultured, and pAGE103 DNA was prepared from the cultured cells by a conventional method. The obtained pAGE103 DNA approximately 3R was
4I in y-ioo buffer, 10 units of EcoR
I was added, and the digestion reaction was carried out at 37°C for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. The total amount of this DNA fragment is 40
A of 50mM Tris-HCj! (pH7,8)
, 5s+M MgCj! z, 7mM 2-mercaptoethanol and dATP, dTTP, d
GTP.

Buffer solution containing dCTP at 100 μH each (hereinafter “
The protruding end of EC0RI was changed to a flat end by dissolving it in ``polymerase buffer'', adding 6 units of Klenow fragment, and reacting for 1 hour at 15°C.The reaction was stopped by phenol extraction, and chloroform extraction was performed. After that, DNA fragments were recovered by ethanol precipitation.

This DNA fragment was dissolved in 307J Y-100 buffer, 12 units of Xhol was added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65° C. for 110 minutes, a DNA fragment of approximately 0.4 kb was purified using the AFT method. Also,
Plasmid pKCR constructed by O'Hara et al.
(0'Hara et al.: Proceedings of the National Academy of Sciences (Proc. N.
atl, Acad, Sci,) USA 78.15
27 (1981)) was cultured, and pKCR-DNA was prepared from the cultured cells by a conventional method. Approximately 2K of the obtained pKCR-DNA was transferred to Y-1 from 30
50 buffer solution, 12 units of Bam old and 16 units of Saf I were added, and a digestion reaction was performed at 37°C for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. This DNA fragment was dissolved in a polymerase buffer with a total volume of 40 ItIl, 6 units of Klenow fragment was added, and the Ban+HI protruding ends and Saf I protruding ends were changed to flat ends by reacting at 15°C for 1 hour. After heat treatment at 65°C for 10 minutes,
A DNA fragment of approximately 1.85 kb was purified using the AFT method. Approximately 2.
8kb DNA fragment (approximately 0.05q), pAGE10
Approximately 0.4 kb DNA fragment (approximately 0.03R) derived from No. 3,
and an approximately 1.85 kb DNA fragment derived from pKCR (
Dissolve approximately 0.2■) in 20/41 T4 ligase buffer, add 300 units of T4 DNA ligase, and incubate at 4℃ for 1
The binding reaction was carried out for 8 hours.

Using the mixture of recombinant plasmids thus obtained, Escherichia coli strain MM294 was transformed to obtain a kanamycin (hereinafter abbreviated as Km) resistant strain. Plasmid pAGE105M was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 12).

(2) Construction of recombinant plasmid pAGE106: Approximately 2n of pAGB105M-DNA obtained above was injected into 30
d was dissolved in the Y-100 buffer solution, 12 units of 5 cal were added, and the digestion reaction was performed at 37°C for 2 hours. 65°C1
After heat treatment for 10 minutes, approximately 5. The Okb DNA fragment was purified. On the other hand, in the same manner as in Example 1, a 5'-phosphorylated EcoR1 linker was prepared.

Approximately 5.
A 0 kb DNA fragment (approximately 0.11 g) and 1 pmol of a 5'-phosphorylated EcoRI linker were combined with 20 reduced T
The DNA was dissolved in T4 ligase buffer, 100 units of T4 DNA ligase was added, and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, Escherichia coli MM 294 strain was transformed to obtain a Km-resistant strain. Plasmid DNA pAGE106 was isolated from this transformed strain, and structural analysis by restriction enzyme digestion revealed that pA
It was confirmed that GE106 had the desired structure (first
(See Figure 3).

(3) t-PA expression plasmid psEIPAI-5
Approximately 2n of pAGE106 DNA obtained in step 2 was added to 30. Dissolve 12 units of Kpn in cJ Y-0 buffer.
1 was added, and the digestion reaction was carried out at 37°C for 2 hours. moreover,
2M NaCff1 of 1.5 yield and 10 units of BamHI were added, and a digestion reaction was performed at 37°C for 2 hours. 65°C1
After heat treatment for 10 minutes, a DNA fragment of approximately 5.0 kb was purified using the AFT method. On the other hand, the pt obtained in Reference Example 1
Approximately 3N of PA7 plasmid DNA was added to 75mM NaCj!
12 units of Fok
1 and 12 units of EcoRI were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 110 minutes, AF
A DNA fragment of approximately 0.7 kb was purified using the T method.

In addition, two types of synthetic NAs (21 bases and 2 bases) shown in Figure 14 were used.
1 base) from Applied Biosystems 3BOA-DNA
They were synthesized using a synthesizer and 5'-phosphorylated using the same method as described in Example 1 separately.

Approximately 5.5% of the pAGE106 thus obtained. O
kb DNA fragment (approximately 0.I n ) and p tPA7
Approximately 0.7kb DNA fragment (approximately 0.II!g
)% approximately 1.4 from pTA 4 prepared in Reference Example 8
kb EcoRI-Kpnl fragment (approximately 0.05 g),
and the two 5'-phosphorylated synthetic NAs obtained above (l pmole each) were reduced by 20 T4.
The mixture was dissolved in ligase buffer, 50 units of T4 DNA ligase was added, and a binding reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, Escherichia coli MM 294 strain was transformed to obtain a Km-resistant strain. Plasmid DNA APSEIPA 1-
5 was isolated, and structural analysis by restriction enzyme digestion and M13
It was confirmed that psEIPAl-5 had the desired structure by the Deideoxy Seefence method using phages (see Figure 14).

(4) t-PA expression plasmid psEIPA1-9
The psi obtained on the creation of the second! IPA I-5 DNA about 2N to 30I! 1 in Y-〇 buffer, 12 units of KpnI was added, and a digestion reaction was performed at 37°C for 2 hours. In addition, 2M NaCj from 1.5! and 8 units of Bindl
[I was added and the digestion reaction was performed at 37°C for 2 hours. 65
After heat treatment at 110 minutes at °C, approximately 5. O
A kb DNA fragment was purified. On the other hand, psEIPA 1
-5 DNA was dissolved in 3011I yo buffer, 12 units of KpnI was added, and a digestion reaction was performed at 37°C for 2 hours. Furthermore, 2MNaCjl on 1.0! and i
o units of Ncol was added and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 510 minutes, a DNA fragment of approximately 4.9 kb was purified using the AFT method. Also the first
The four types of synthetic NA shown in Figure 5 (47 bases, 49 bases, 4
9 bases and 47 bases: These synthetic NAs are t-PA
Applied Biosystems 380A-DNA
They were synthesized using a synthesizer and 5'-phosphorylated using the same method as described in Example 1 separately.

The approximately 5.0 kb (7) DNA fragment (approximately 0.1 ttg) derived from psEIPA 1-5 and the approximately 4.9 kb (7) DNA derived from psEIPA 1-5 thus obtained.
The fragment (approximately 0.I n ) and four types of 5'-phosphorylated synthetic NAs (1 parole each) were added to 2
Dissolve 50 units of T4D in rhino T4 ligase buffer.
NA ligase was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, Escherichia coli strain 294 was transformed to obtain a Km-resistant strain. Plasmid DNA psEIPA 1-9 was isolated from this transformed strain, and ps
It was confirmed that EIPA 1-9 had the desired structure (see Figure 15).

(5) Construction of recombinant plasmid pUc19H (Ap
Portapling of resistance genes): Plasmid DNA pUc19 constructed by Norlander et al.
(Norrander+ J, et al.: Gene (Ge
ne)26゜1001983); pUc197
Escherichia coli strain H8101 having '-y Sumi F DNA available from Takara Shuzo Co., Ltd.] was cultured, and pLlc19 DNA was prepared from the cultured cells by a conventional method. The obtained plJ
Approximately 21 nI of c19 DNA was dissolved in 30 μm Y-50 buffer, 10 units of Hindnl and 1 unit of Dr.
al was added, and the digestion reaction was carried out at 37°C for 1 hour. As a result of this reaction, the DNA was completely digested with Hind■ and partially with Dral. After heat treatment at 65°C for 10 minutes, A
Using the FT method, approximately 1.55 kb of HindI[[-Dr
Two DNA fragments were purified: the al fragment and the approximately 1.1 kb Dral-HlndlI fragment. Separately, 20 pmoles of Hindll linker (CAAG)
CTTG (manufactured by Collaborative Research, Inc.) was 5'-phosphorylated using a method similar to that described in Example 1.

Approximately 1.55k derived from pUc19 obtained in this way
b DNA fragment (0.03g) and approximately 1.1 kb DNA
A fragment (0.03x) and 1 pmol of 5'-phosphorylated Hindl[[linker] were dissolved in T4 ligase buffer from 20%, 50 units of T4 DNA ligase was added, and the ligation reaction was carried out for 18 hours at 4 °C. I did it.

Using the obtained mixture of recombinant plasmids, Escherichia coli MM 294 strain was transformed to obtain an Ap-resistant strain. Plasmid DNA pUc19 H was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 16).

(6) Construction of recombinant plasmid psHIPA1-9A (insertion of Ap resistance gene into psBIPA1-9)
Approximately 2 rhinos of the pUc19 H plasmid DNA obtained above were dissolved in 30 IItl of Y-50 buffer, and 8 units of H
indl [and 8 units of PvuII and incubated at 37°C for 2
A time digestion reaction was performed. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. Dissolve the entire amount of this DNA fragment in 40% polymerase buffer, add 6 units of Klenow fragment, and incubate at 15°C for 1 hour.
Hindl[[protruding ends were changed to flat ends by reacting for a time.

After heat treatment at 65°C for 10 minutes, approximately 1,
A 4 kb DNA fragment was purified. On the other hand, the t-PA expression plasmid psIl obtained above! Dissolve approximately 2N of IPA I-9 in Y-150 buffer at 30 degrees, add 8 units of
hol and 8 units of EcoRV were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, AFT
A DNA fragment of approximately 5.9 kb was purified using the method. In addition, dissolve approximately 3 μ of the pAGE2B plasmid DNA prepared above in 30 ptI Y-150 buffer, and add 10 units of X
hol and 10 units of EcoRV were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, A
A DNA fragment of approximately 0.85 kb was purified using the FT method.

Approximately 1.4
kb DNA fragment (approximately 0.1■) and psEIPA I-
An approximately 5.9 kb DNA fragment (approximately 0.1 ■) derived from pAGE2B and an approximately 0.85 kb DNA fragment (approximately 0
．． 05g) in 20 rhino T4 ligase buffer,
00 units of T4 DNA ligase was added and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM 294 was transformed to obtain a strain that was resistant to both Ap and Km. Plasmid DNA from this transformed strain
When A psEIPA 1-9^ was isolated and structurally analyzed by restriction enzyme digestion, it was confirmed that it had the desired structure (see Figure 17).

The microorganism containing plasmid DNA ApSEIPAl-98 is Escherichia colt EhPA1-
September 1988 as 9A FERM BP-1460
It was deposited with the Institute of Fine Technology on May 3rd.

(7) Construction of recombinant plasmid psH1dhfrlA Approximately 2 pAGE106 plasmid DNA obtained in step 8
Dissolve As in 30% Y-50 buffer and add 12 units of As.
Add p71B (manufactured by Boehringer Mannheim),
The digestion reaction was carried out at 37°C for 2 hours. After phenol and chloroform extraction, DNA was extracted by ethanol precipitation.
Fragments were recovered. Dissolve this DNA fragment in a total amount of 40% polymerase buffer, add 6 units of Klenow fragment,
By reacting at 15°C for 1 hour, Asp71B
The protruding end was changed to a flat end. Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol precipitation were dissolved in Y-150 buffer with a total volume of 30/IJ, 10 units of MfuI was added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 110 minutes, AF
A DNA fragment of approximately 3.3 Kb was purified using the T method.

Separately, pSV 2 dh selects the dhfr gene.
fr plasmid DNA (Subramani
ni) et al.: Molecular and Cellular Biology (t'Ioll, Cell 1, Biol, ), 854 (1981)) about 3K to 30 heels of Y-100.
Dissolve in buffer solution, add 12 units of Bgfn, and incubate at 37°C.
Digestion reaction was carried out for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. Dissolve the entire amount of this DNA fragment in 40% polymerase buffer, add 6 units of Klenow fragment, and incubate at 15°C.
8g2■ protruding ends were changed to flat ends by reacting for 1 hour. Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol precipitation were dissolved in a total amount of 30 Y-100 buffer, 12 units of Hindll was added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 0.75 Kb was purified using the AFT method. In addition, about 3N psgtpa 1-9A plasmid DNA obtained above
was dissolved in 30 H of Y-100 buffer and 12 units of Hi
nd III was added, and the digestion reaction was carried out at 37°C for 2 hours. In addition, IMNaCI of 1,5 pI! , and 12 units of MIlul were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 2.9 Kb was purified using the AFT method.

The thus obtained pAGE106-derived DNA fragment (approximately 0.I n ), pSV 2 dhfr-derived DNA fragment (approximately 0.03 g), and psEIPA 1-9A
20pt of the original DNA fragment (approximately 0.1g)! T4D
100 units of T4 DNA dissolved in NA ligase buffer
IJ gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA pSE1dhfrlA was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion.
It was confirmed that it had the desired structure (see Figure 18).

(8) Recombinant plasmid psHIPA1sB1dhf
Construction of rl-9A: ps! obtained above! ! 1dhfrlA plasmid DNA
Approximately 300 mg of the protein was dissolved in 300g of Y-100 buffer, 12 units of Xhol was added, and a digestion reaction was performed at 37°C for 2 hours.

After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation.

This DNA fragment was dissolved in a total amount of 40 polymerase buffer, 6 units of Klenow fragment was added, and the mixture was reacted at 15° C. for 1 hour to change the XhoI protruding end to a flat end. Subsequently, after phenol extraction and chloroform extraction, the total amount of DNA fragments recovered by ethanol precipitation was 3
0I4I in Y-150 buffer and 12 units of MI
LuI was added and the digestion reaction was carried out at 37°C for 2 hours. 65
After heat treatment at °C for 110 minutes, approximately 4.4
The Kb DNA fragment was purified.

Separately, approximately 3n of the psEIPA 1-9A plasmid DNA obtained above was dissolved in 30I11 Y-5011 solution, and 12 units of CI! , aI was added, and the mixture was heated at 37°C for 2
A time digestion reaction was performed. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. Dissolve the entire amount of this DNA fragment in 40% polymerase buffer, add 6 units of Klenow fragment, and incubate at 15°C for 1 hour.
By reacting for a period of time, C1al protruding ends were changed to flat ends.

Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol extraction were diluted with a total volume of 30 Il.
Dissolved in Y-150 buffer of a, 12 units of MIl, u
I was added, and the digestion reaction was carried out at 37°C for 2 hours. 65°C
After heat treatment for 110 minutes, approximately 6.75K using AFT method.
The DNA fragment of b was purified.

The thus obtained psB1dhfrlA-derived D
NA fragment (approximately 0.IJlg) and psEIPA 1-9A
The DNA fragment (approximately 0.1 cod) was dissolved in T4 ligase buffer from 20 years ago, 100 units of T4 DNA ligase was added, and a ligation reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA psEIPA 15E was obtained from this transformed strain.
When 1dhfrl-98 was isolated and subjected to structural analysis by restriction enzyme digestion, it was confirmed that it had the desired structure (see Figure 18).

Reference Example 10 Construction of hG-CSF expression plasmid pAS3-3: (See Figures 19 and 20).

(1) Construction of recombinant plasmid pC5F3-3:
The pCSF 2.2 river obtained in Reference Example 4 was transferred to 20P1 Y-1.
Dissolve in 50 buffer and add restriction enzyme Sal! , 10 units of ■ were added, and the digestion reaction was carried out at 37°C for 2 hours. Then, 5 units of the restriction enzyme ApaLI were added, and an additional 10 units of restriction enzyme was added at 37°C.
The partial cleavage reaction was carried out for minutes. From this reaction solution, approximately 4. OKb DNA fragment C3al I-Ap
aL I fragment) approximately 1.54 was obtained.

On the other hand, in order to obtain cDNA completely containing the translated region of hG-CSF, three DNA linkers shown below were synthesized.

(Margin below this page) 29a+er, 31mer, 32mer shown above
, -terminal chain D of 30mer and 39s+er (2 types)
NA is Applied Biosystems 380A-D
It was synthesized using an NA synthesizer.

29mer and 31mar, which are complementary to each other, each contain 20 pmol each to 40Ilt! 50mM Tris-HCf
(pH 7,5), 10mM MgCllt, 5mM
DTT, 0. in+M EDTA and 1mM A
It was dissolved in a buffer containing TP (hereinafter this buffer will be abbreviated as "T4 kinase buffer"), 6 units of T4 polynucleotide kinase was added, and a phosphorylation reaction was carried out at 37°C for 60 minutes. 32mar and 30+++e complementary to each other
Phosphorylation reactions were performed on r and 39n+er in the same manner.

5affil-A derived from pcsP2 obtained above
paLl fragment (approximately 4.0 Kb) 0.1M to T4 DNA
After dissolving in ligase buffer 30ml, the above three sets of DNA
Linker was added in 2 pmol portions. Furthermore, T4DNA4
The ligation reaction was carried out using DNA ligase 400 monomer at 4°C for 18 hours.

E. coli H8101 strain was transformed using the reaction solution, and A
A p-resistant strain was obtained. Plasmid DNA from the transformed strain
A was isolated and subjected to structural analysis by restriction enzyme cleavage, which confirmed that it was the target plasmid DNA 5pC5F3-3.

(2) hG-CSF expression plasmid [!
Construction of IGC3-3: Dissolve pCSF3-3.3N obtained in the previous section in 40% yo buffer, add 110 units of restriction enzyme Dra, and incubate at 37°C.
The digestion reaction was carried out at C for 2 hours. NaCl concentration is 15OR
Add NaC12 to IM and add restriction enzyme 5af.
After adding 10 units of fil, the cleavage reaction was further carried out at 37°C for 2 hours. From this reaction solution, approximately 0.7
Kb DNA fragment (DraI-3afI fragment) approximately 0.6
I got n. Apart from this, pAGE1 obtained in Reference Example 9
06. Dissolve 2 substances in 30% Y-0 buffer and add restriction enzyme S.
MailO units were added and the cleavage reaction was carried out at 37°C for 2 hours. After that, NaCj! NaCj! so that the concentration is 150mM! and restriction enzyme Saj! 10 units of I were added and the cleavage reaction was carried out at 37°C for an additional 2 hours.

Approximately 5. Approximately 1.5 n of OKb DNA fragment (Sma I-5al I fragment) was obtained.

Next, Dral − derived from pcsF 3-3 obtained above
3af fragment (about 0.lb) about 0.6n and pAGE106
SmaI-3afl fragment (approximately 5.OKb) derived from approximately 1.
Dissolve 0■ in T4 DNA ligase buffer and add 40
0 units of T4 DNA ligase was added and the binding reaction was carried out at 4°C for 18 hours.

E. coli H8101 strain was transformed using the reaction solution, and A
A p-resistant strain was obtained. A plasmid was isolated from the transformed strain, and structural analysis by restriction enzyme digestion confirmed that it was the desired plasmid DNA, psEIGc 3-3.

(3) hG-CSF expression plasmid pAS3
-3 Creation: Dissolve 5 g of pcfTAL (see Reference Example 15) in 50 rhinoceros Y-100 buffer, add restriction enzyme Hind
Add 10 units each of Ill and BamHI and heat at 37°C.
Digestion reaction was carried out for 2 hours. From this reaction solution, a DNA fragment of approximately 1.6 b (Hindl[I-Ba
mHI fragment) 1■ was obtained. This approximately 1.6 Kb DNA
Dissolve the fragment 1 in Y-100 buffer, add 10 units of restriction enzyme pdeI (manufactured by Toyobo Co., Ltd.), and incubate at 37℃ for 2 hours.
A time digestion reaction was performed. DNA was recovered by phenol/chloroform extraction and ethanol precipitation, dissolved in 30 Klenow buffer, added with 2 units of DNA polymerase 2/Klenow fragment, and reacted at 37°C for 1 hour. 68
After inactivating the DNA polymerase ①/Klenow fragment by treatment at ℃ for 10 minutes, the DNA was recovered by ethanol precipitation.

The recovered DNA was dissolved in 20 to 150 buffer solution and 10 units of restriction enzyme Aatn (manufactured by Toyobo Co., Ltd.) was added to give 37.
The cleavage reaction was carried out at °C for 2 hours. About 0.1 g of a DNA fragment of about 0.2 Kb (DdeI (flat end)-AatII fragment) was obtained from this reaction solution by the LOT method.

Separately, 2N of psEIGc 3-3 obtained in the previous section was
The mixture was dissolved in a 150% buffer solution, 10 units of restriction enzyme AatI (manufactured by Toyobo Co., Ltd.) was added, and a digestion reaction was performed at 37°C for 2 hours. Thereafter, 10 units of the restriction enzyme Xhol were added, and the digestion reaction was further carried out at 37°C for 2 hours. About 0.8 Kb DNA fragment (Aat
II-Xho I fragment) approximately 0.1n was obtained.

On the other hand, psEIPAlsEldhfrt obtained in Reference Example 9
Dissolve 21℃g of -9A in 20pa Y-0 buffer,
10 units of restriction enzyme Smal were added and a digestion reaction was performed at 37°C for 2 hours. Then, NaC1A concentration was 100mM
10 units of restriction enzyme Xhol were added, and the digestion reaction was further carried out at 37°C for 2 hours.

About one DNA fragment (Sea I-Xho I fragment) of about 8.7 Kb was obtained from this reaction solution by the LGT method.

Ddel (
flat end), Aatn fragment (approximately 0.2 Kb) approximately 0.1
．． Aat U -Xho derived from 5psEIGc 3-3
I fragment (about 0.8 Kb) about 0.1 g, psIEI
Saga I from PA 15E1dhfrl-9A
- Approximately 1 g of Xho I fragment (approximately 8.7 Kb) was added to 30 tumors of T
400 units of T4DN dissolved in 4DNA ligase buffer
A ligase was added and the ligation reaction was carried out at 4°C for 18 hours. Transforming E. coli H8101 strain using the reaction solution,
An Ap-resistant strain was obtained. A plasmid was isolated from the transformed strain, and structural analysis by restriction enzyme digestion confirmed that it was plasmid DNA SpAS3-3 having the desired structure.

Reference Example 11 Construction of recombinant plasmid pUKA 2: Plasmid pU carrying human pro-υK cDNA obtained in Reference Example 2
pU was obtained from Escherichia coli C600SF8 strain carrying K1 by a conventional method.
KI DNA was prepared. Obtained pUKI DNA
Dissolve approximately 2 Ifg in 30 Il of Y-100 buffer and add 8
Add 1 unit of restriction enzyme Nco I and 8 units of 5tuI,
Digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 1.2 kb was purified using the AFT method. On the other hand, pTrs33 obtained in Reference Example 5
Approximately 2 plasmid DNA 10+wM Tris-HC
l2 (pH 7,5), 25mM MCI, 7mM
MgCj! z, a solution containing 6mM 2-mercaptoethanol (hereinafter abbreviated as "K-25 buffer") 3
0Il&, 16 units of restriction enzyme Sma I was added, and a digestion reaction was performed at 30°C for 2 hours. Subsequently, 1.5 units of IMNaC/: and 10 units of Nco I were added, and a further 2-digestion reaction was performed at 37°C. After heat treatment at 65°C for 10 minutes, approximately 2.85 kb of DNA was extracted using AFT method.
The fragment was purified.

Approximately 1.2 kb derived from pUK1 thus obtained
DNA fragment (approximately 0.05 g) and approximately 2.85 kb DNA fragment (approximately 0.1 N) derived from pTrS33, in a total amount of 20
/11 T4 ligase buffer, 100 units of T4 DNA ligase was added, and a binding reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, pUKA2, was isolated from this transformed strain,
Structural analysis by restriction enzyme digestion confirmed that it had the desired structure (see Figure 21).

Reference Example 12 Construction of recombinant plasmid pUKB101: Dissolve approximately 2n of the pUKA 2 plasmid DNA obtained above in 30p& of Y-0 buffer, add 12 units of restriction enzyme Kpnl, and perform a digestion reaction at 37°C for 2 hours. I did it.

Next is 2MNaCj on 1 and 5! and 10 units of Nco
I was added, and the digestion reaction was further carried out at 37°C for 2 hours. 6
After heat treatment at 5℃ for 10 minutes, approximately 1.2
A kb DNA fragment was purified. On the other hand, approximately 2K of pTrS33 plasmid DNA obtained in Reference Example 5 was dissolved in 125 buffer solution, 16 units of Sn + Al were added, and 3
Digestion reaction was carried out at 0°C for 2 hours. Then 1.5pII of 2M NaCf and 10 units of Pstl were added and an additional 37
The digestion reaction was carried out for 2 hours at °C. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 1.15 kb was purified using the AFT method.

In addition, pTer+w2 plasmid D obtained in Reference Example 6
Approximately 2 cans of NA were dissolved in 30 rhinoceros Y-0 buffer, 12 units of Kpnl was added, and a digestion reaction was carried out at 37 °C for 2 hours.

Next is 1.5 relative 2MNaCj! and 10 units of Pstl
was added, and the digestion reaction was further carried out at 37°C for 2 hours. 65
After heat treatment for 110 minutes at °C, approximately 1.7
A kb DNA fragment was purified. In addition, the following two types of synthetic NA (41mer and 45n+er) are applied and
Synthesis was performed using a Biosystems 380A-DNA synthesizer.

5'-GGGAATGGTCACTTTACCGAG
GAAAGGCCAGCACTGACAC-3' (
41mer)3'-CCCTTACCAGTGAAA
^↑GGCTCCTTTTCCGGTCGTGACTGT
GGTAC-5' (45mer) These synthetic RNAs
Phosphorylate the 5' end of the synthetic NA by adding 5 units of T4 polynucleotide kinase in 20-min T4 kinase buffer to 20 pmoles of each and incubating for 30 minutes at 37°C. did.

Approximately 1.2k from pUKA 2 thus obtained
DNA fragment of b (approximately 0.05 g), approximately 1.15 kb DNA fragment derived from pTrS33 (approximately 0.05 g), p
A DNA fragment of approximately 1.7 kb (approximately 0.05 g) derived from Tern+ 2 and two types of 5' phosphorylated synthetic NA (1 picomole each) were dissolved in a total amount of 20 microliters of T4 ligase buffer, and the One unit of T4 DNA ligase was added and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, ptlKBlol, was isolated from this transformed strain, and structural analysis by restriction enzyme digestion and nucleotide sequence determination by the M13 deideoxy-Siefens method confirmed that pUKB 101 had the desired structure (No. (See Figure 22).

Reference example 13゜human pro-LIK expression plasmid psEIUKpro
Construction of l-IA = (1) Recombinant plasmid pUKF
Construction of 2: Dissolve about 3n of pUK11 plasmid DNA obtained in Reference Example 3 in 30-Yen Y-100 buffer,
Add 2 units of Neo I and 12 units of Hindlu,
Digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 1-10 minutes, approximately 0.45 kb DN was extracted using AFT method.
The A fragment was purified.

On the other hand, about 24 pieces of pUKA 2 plasmid DNA obtained in Example 11 (1) was dissolved in 30II&Y-0 buffer, 10 units of Kpnl was added, and a digestion reaction was carried out at 37°C for 2 hours. Next is 1.5 Kai's 2MNaC/! and io
Unit of Nc.

I was added, and the digestion reaction was further carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 1.
A 2kb DNA fragment was purified. Additionally, about 2 μm of pTerta 2 plasmid DNA obtained in Reference Example 6 was dissolved in 30% Y-0 buffer, 10 units of KpnI was added,
The digestion reaction was carried out at 37°C for 2 hours. Next is 1.5 Rhinoceros 2MNaCj! and 8 units of HindI[I were added, and the digestion reaction was further carried out at 37°C for 2 hours. 65°C110
After heat treatment for a minute, A,, approximately 2.85 kb using the FT method.
The DNA fragment was purified.

Approximately 0.45 pUK11-derived pUK11 obtained in this way
kb DNA fragment (approximately 0.02.av), pUKA2
Approximately 1.2kb DNA fragment (approximately 0.05//g)
, and 2.85 kb DNA from pTerm 2
Dissolve the fragment (approximately 0.05μ) in a total volume of 20 units of T4 ligase buffer, add 50 units of T4 DNA ligase, and add 40 units of T4 DNA ligase.
The binding reaction was carried out for 18 hours at °C.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an AP-resistant strain. Plasmid DNA, pUKF2, was isolated from this transformed strain, and its structure was analyzed by restriction enzyme digestion.
It was confirmed that F2 had the desired structure (see Figure 23).

(2) Construction of recombinant plasmid pUKFpro: Approximately 2Ar of pUKF2 plasmid DNA obtained above was dissolved in yo buffer containing 25mM NaCl of 30 rhinoceroses,
Bs5Hn (manufactured by New England Biolabs) was added to 10 units of Bs5Hn, and a digestion reaction was performed at 50°C for 2 hours. Next is 2M NaCl from 1.0! and Hi in lO
ndl[I was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65° C. for 110 minutes, a DNA fragment of approximately 4.3 kb was purified using the AFT method. On the other hand, the following six types of synthetic pNA (39mer, 41mer,
41mer, 39mer, 17mer, 17mer)
was synthesized and 5'-terminally phosphorylated according to the method described above.

5'-AGCTTGTCCCCGCAGCGCCGTC
GCGCCCTCCTGCCGCAG-3' (39ma
r) 3'-TCT CGG GACGA (: CGC
GC-5' (17a+er) The approximately 4.3 kb DNA fragment derived from pUKF2 (approximately 0
．． 1trg) and 6 kinds of 5'-phosphorylated synthetic NAs (1 pmol each) were dissolved in T4 ligase buffer at 20 degrees, added with 300 units of T4 DNA ligase, and ligated at 4°C for 18 hours. The reaction was carried out.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Apm-resistant strain. Plasmid DNA% pUKFpro was isolated from this transformed strain, and structural analysis by restriction enzyme digestion and nucleotide sequencing by M13 deideoxy-Siefens method confirmed that pUKPpro had the desired structure (No. 24 (see figure).

(3) Recombinant plasmid pSt! IUKprol-I
Construction of A: Approximately 2n of psEIPAl-9A plasmid DNA obtained in Reference Example 9 was dissolved in 30I4I Y-0 buffer, 10 units of Kpnl was added, and a digestion reaction was performed at 37°C for 2 hours.

Next is 1.5 Rhinoceros 2MNaCj! and 10 units of Hind
I [I was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65° C. for 110 minutes, a DNA fragment of approximately 6.3 kb was purified using the AFT method. On the other hand, about 3N of plJKFpro plasmid DNA obtained above was
y- of production.

It was dissolved in a buffer solution, 15 units of Kpnl was added, and a digestion reaction was performed at 37°C for 2 hours. Then 2M of t, SIl&
Add 1 NaCl and 10 units of HindI, and add 3 more
The digestion reaction was carried out at 7°C for 2 hours. After heat treatment at 65°C for 110 minutes, approximately 1.55 kb of DNA was extracted using the AFT method.
The fragment was purified.

The approximately 6.3 kb DNA fragment (approximately 0.1 n) derived from psEIPAl-9A thus obtained and pUKF
1.55kb DNA fragment derived from pro (approximately 0.051
! Dissolve g) in T4 ligase buffer with a total volume of 20~1
00 units of T4 DNA ligase was added and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a Km-resistant strain. From this transformed strain, plasmid DNA psEIUKprol
-IA was isolated and subjected to structural analysis by restriction enzyme digestion, and it was confirmed that psEllKprol-IA had the desired structure (see Figure 25).

Reference Example 14゜1) Isolation of plasmid pt, t1 carrying human LT cDNA: (1) Preparation of poly(A) RNA from LukI cells: from human lymphoblastoid cell line Lukn, guanidine thiocyanate-lithium chloride Law (Cathal)
a) et al: DeNA (DNA) 2゜329 (19
83)), poly(Ao)-containing RNA was prepared as follows.

Human lymphoblastoid cell line Lukll (Berish Y, Rubin et al.: Proceedings of the National Academy of Sciences (Proc, Natl, ^cad, sci)
, ) USA I, 6637 (1985) ), 5%
11. containing fetal bovine serum and 1mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES). The cells were inoculated into RPM11640 medium (manufactured by Tadami Seiyaku Co., Ltd.) at a concentration of 8 XIO'/d and allowed to grow. A spinner culture bottle was used for culture.

After culturing at 37°C for 48 hours, the cells were collected by centrifugation and treated with long/In1 phorbol myristat acetate (PMA).
e acetate) and 5% fetal bovine serum and lmM
11 new RPM116 including HE P E S
40 medium and further cultured at 37°C for 48 hours.

Subsequently, cells were collected from a portion of this cell suspension (250IIIi) by centrifugation at 1,1100X at 4°C for 10 minutes, washed with phosphate buffer for 80 d, and then
M guanidine thiocyanate, 10mM EDTA,
50. mM Tris-HC/! (pH 7) and 8
% (V/V) Solubilized in 10 d of a solution consisting of 2-mercaptoethanol using a portex mixer. This solubilized material was transferred to a centrifuge tube, 80% of a 4M LiCl solution was added thereto, stirred, and then allowed to stand for 4°CCl2O hours. 9.00 with Hitachi RP RIO rotor
After centrifugation in Orpm for 90 minutes, RNA was collected as a precipitate. Precipitate RNA with 50# solution consisting of 4M urea and 2M lithium chloride! 1! suspended in the old tachiRP
After centrifugation in an R10 rotor at 9,000 rpa+ for 60 minutes, RNA was recovered as a precipitate. Precipitate RNA with 0.1% sodium lauryl sulfate, 1mM EDT.
A, 10mM Tris-HCf (pH 7,5)
A melt consisting of? [0trdl], extracted with phenol-chloroform, and recovered by ethanol precipitation. Approximately 2.5 mg of the obtained RNA was added to 10 mM Tris-HC.
I (pH 8,0) and I n+M EDTA were dissolved in a solution 1rn1.

Incubate at 65°C for 5 min, add 0.1 m 5M
NaCl was added. The mixture was transferred to an oligo(dT) cellulose column [P-LBio Chemical Co., Ltd.
Chemical) chromatography (column volume: 0.5 m). mRNA with adsorbed poly(A) was dissolved in 10mM Tris-HCf (pH 7,
About 100n of mRNA containing poly(A) was obtained by elution with a solution consisting of 5) and 1e+MEDTA.

(2) cDNA synthesis and insertion of the DNA into a vector: Okayama-Berg's method [Molecular and Cellular Biology 4 (
Mo1. Ce11. Biol, ), 2.161 (
(1982)), cDNA was synthesized and a recombinant plasmid incorporating it was constructed. An outline of the process is shown in FIG.

Approximately 2n of poly(A) RNA and approximately 1.4μ of vector primer prepared above were mixed with 5mM Tris-H (f! (p
H8,3), 8mM FIGCflt, 30mM
KCj! , 0.3mM DTT, 2mM d
NTP (dATP, dTTP, dGTP and dC
TP) and 10 units of bonuclease inhibitor (manufactured by P-L Biochemicals) in solution 22.3, 10 units of reverse transcriptase (manufactured by Seikagaku Corporation) were added, and the mixture was incubated at 41°C for 90 minutes. , synthesized NA complementary to mRNA.

The reaction product was subjected to phenol-chloroform extraction and ethanol precipitation to recover vector primer DNA with an RNA-DNA double strand added thereto.

The DNA was diluted with 66, m dCTP and 0.2N poly(
A) was dissolved in 20p1 of a TdTIl buffer solution containing TdTIl, and 14 units of TdT (manufactured by P-L Biochemicals) was added and incubated at 37°C for 2 minutes.
Twenty (dC) chains were added to the A3' end. The reaction product was extracted with phenol-chloroform, and the cDNA-vector primer DNA with the (dC) strand added was recovered by ethanol precipitation. The DNA was treated with 1On+M Tris
-HCl (pH 7,5), 6 mM MgClz
and 60mM NaCj! 20 units of Hindl[I was added thereto, incubated at 37°C for 2 hours, and cleaved at the Hindl[ site. The reaction product was extracted with phenol-chloroform and precipitated with ethanol to obtain 0.5 pmol of (dC) chain-added cDNA-vector primer DNA. - 0.2 pmol of the DNA and 0.4 pmol of the linker-DNA were mixed in 10 mM Tris-HCI (pH 7,5), 0.
1 M NaCj! Dissolved in a solution consisting of 1 ra MEDTA and 65°C142°C, O
The cells were incubated for 10 minutes, 25 minutes, and 30 minutes, respectively. 20mM Tris-HCI (pH 7,5),
4mM MgC1z+10mM (NHa)zsO
A reaction solution was prepared with a composition of 4,0,1M MCI and 0.1mM β-NAD so that the total amount was 10OII&. Add 25 units of E. coli DNA ligase (manufactured by New England Bioraps) to the reaction solution, and heat at 11°C.
Incubated for hours. The reaction solution was diluted with dN of 40 uM each.
TP, additional components to make 0.15mM β-NAD, 10 units of E. coli DNA ligase, 20
unit of Escherichia coli DNA polymerase I (PL Bio
Chemicals) and 10 units of Escherichia coli ribonuclease H (P-LBiochemicals) were added and incubated at 12°C and 125°C for 1 hour each. In the above reaction, recombinant DNA containing cDNA
circularization and the RNA part of the RNA-DNA duplex becomes DNA
A and a complete double-stranded DNA recombinant plasmid was produced.

(3) Selection of recombinant DNA containing human LT cDNA: Using the recombinant plasmid obtained in (2), E. coli C60
0SF8 stocks [Gameron: Proceedings of the National Academy of Sciences]
Science (Proc, Natl, Acad, Sci,
) USA72.3416 (1975) ) 5cots
(7) Method [Katsuya Shigesada: Cell Engineering 2.616 (1
Transformation was performed according to 983)). About 30.00 obtained
0 colonies were fixed on nitrocellulose filters. Human LT cDNA (Batrick W.
Gray (Patrick W, Gray) et al.: Neichi+
-(Nature) 312 721 (1984)
) and a part of the 17s nucleotide sequence in the 5' untranslated region of
+er synthesis NA5'-GATCCCCGGCCTG
One strain that strongly associated with the CCTG-3' probe labeled with 'P at 52°C was selected [Grunstein-Hogness method,
Proceedings of the National Academy of Sciences (Proc, Natl, Acad,
Sci,) USA? 2+3961 (1975)
). The entire base sequence of the cDNA of plasmid pLT1 carried by this strain was determined using deideoxy phage and M13 phage.
Determined using the sea fence method. As a result, pLT 1
The cDNA was found to encode human LT.

2) Construction of recombinant plasmid pLA 1 (see Figure 26): pLT 1 (4.7 kb) obtained by the method in the previous section
5 Nitrate was dissolved in Y-0 buffer with a total volume of 50 rhinoceros, 10 units of restriction enzyme XhoII (manufactured by Boehringer Mannheim) was added, and a cleavage reaction was carried out at 37°C for 2 hours. Next item,
Add NaCl to a final concentration of 150 mM, and add restriction enzyme N5iI (manufactured by New England Biolabs) 1.
0 units were added and the cleavage reaction was carried out for an additional 3 hours at 37°C. A DNA fragment of about 750 bp (XhoII-Nsi
I fragment) approximately 0.3% was obtained.

Separately, pLT 120J! 20074 g! Y-50
It was dissolved in a buffer solution, 40 units of restriction enzyme Haem was added, and a cleavage reaction was carried out at 37°C for 2 hours.

Next, NaCl was added to a final concentration of 150 mM, 140 units of N5i were added, and the cleavage reaction was further carried out at 37°C for 3 hours. Approximately 50 b cells containing the N-terminal portion of human LT were extracted from the reaction solution by polyacrylamide gel electrophoresis.
p DNA fragment (HaeI [Natl fragment)] approximately 40 ng
I got it.

On the other hand, dissolve pGEL 1 (3,4 kb) 3 trg in a total of 30 rinses of Y-100 buffer, add 5 t of restriction enzyme
Add 6 units each of uI and restriction enzyme BgfII to 3
The cleavage reaction was carried out at 7°C for 3 hours.

From this reaction solution, a DNA fragment of approximately 2.3 kb (Stul-Bgzn fragment) containing the Ap resistance gene was obtained by LC and T methods.
Approximately 1.0 rivers were obtained.

Next, the pLT1-derived (7) Xhol[-Nsi
I fragment (approximately 750 bp) 0.2 g and Haem
-Nsi 1 fragment (approximately 50 bp) 20 ng and pGE
The 5tuI Bgim fragment from L1 (approximately 4.3 k
b) 0.6 Ar was dissolved in a total volume of 20% T4 ligase buffer, and 2 units of T4 DNA ligase (manufactured by Zenshuzo Co., Ltd.) was further added to this mixed solution, and a reaction was carried out at 4°C for 18 hours.

Using the recombinant plasmid DNA thus obtained,
Escherichia coli K M 430 strain was transformed by the method of Cohen et al. to obtain Ap-resistant colonies. Plasmid DNA was isolated and purified from this transformed strain according to a known method, and the plasmid DNA was transformed into 5t
The structure of the plasmid was analyzed by cutting it with a restriction enzyme such as uI.

As a result, it was confirmed that the desired plasmid was obtained. This recombinant plasmid is called pLA1.

3) Construction of LT expression plasmid pLSA 1 (see Figure 27): Escherichia coli strain KM430 containing pLA 1 (3.1 kb) obtained in the previous section was cultured, and pLAI DNA was prepared from the cultured cells by a conventional method. Obtained pLAI DNA
3. Dissolve the cod in 30% of Y-101 buffer and add
Add 3 units each of I and BgfII and heat to 3 at 37°C.
A time cleavage reaction was performed. From this reaction solution, about 0.5 g of a DNA fragment of about 790 bp (Stul-BgfI [fragment]) containing most of the human LT gene was obtained by the LGT method.

Separately, pKYPlo 3 ~ prepared by the method described in JP-A-58-110600 was dissolved in 30% of Y-100 buffer, 6 units each of restriction enzyme Bann and restriction enzyme PstI were added, and the mixture was heated at 37°C for 30 minutes. A time cleavage reaction was performed. Approximately 1.1 kb of DNA containing the tryptophan promoter (P trp) was extracted from this reaction solution by the LGT method.
A fragment (BanllI-PstI fragment) approximately 0.6
I got ts.

Also, pGELl (3,4kb) 2. g to Y-10
0 buffer solution, and restriction enzyme Hindl [I,
Add 4 units each of BamHI and PstI to 3
The cleavage reaction was carried out at 7°C for 3 hours. From this reaction solution, LGT
Approximately 1 containing a lipoprotein-derived terminator by the method
．． Approximately 0.7 pg of a 7 kb DNA fragment (PstI-BamHI fragment) was obtained.

On the other hand, Leu, which is the N-terminus of the mature human LT polypeptide,
(CTA), the fifth amino acid Gly(G
It is necessary to add up to the second base (GO) of cc) and the start codon (ATG) necessary for expression, and
The distance between the SD sequence downstream of trp and ATG is 6 to 1
The following DNA linker was synthesized because it needed to have an appropriate length between 8 bρ.

First, -main product DNA, 27-mar and 25-mar, were synthesized by the usual triester method. 20 picomoles each of 27-mar and 25-mar were dissolved in a total volume of 40/47 T4 kinase buffer, 6 units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.) was added, and a phosphorylation reaction was performed at 37°C for 60 minutes. .

Next, the Stul-Bgf■ fragment (approximately 790 bp) 0.3 n derived from pt and ^1 obtained above and the expression vector pKY
Banm-Pst I fragment of P10 (approximately 1.1 kb)
Pstl-B from 0.4Jtg and pGEL1
The amHI fragment (approximately 1.7 kb) 0.6x was dissolved in T4 ligase buffer 25I11, and approximately 1 picomole of the above DNA linker was added to this mixture. Add T to this mixed solution.
Six units of 4DNA A IJ gauze were added, and the binding reaction was carried out at 4°C for 18 hours.

E. coli K using a reaction mixture containing the recombinant plasmid.
The M430 strain was transformed and Ap-resistant colonies were obtained. Plasmid DNA was recovered from the cultured bacterial cells of this colony. The structure of the obtained plasmid is expressed using the restriction enzyme EcoR.
1, Ban1l[, PstI, Hindl[, BgJ
! After cleavage with I, it was confirmed by agarose gel electrophoresis. This plasmid is called pLSA1. pLSA
The nucleotide sequence near BanI[[[[, HindI[[] is as follows using the Maxam-Gilbert method [A, M, Maxam et al.: Proceedings of the National Academy of Science (Proc, Natl, Ac
ad, 5ci-)+USA? 4.560 (197
7) Confirmed with ).

Reference Example 15 Construction of hG-CSF expression plasmid pCfTA 1 (see Figure 28): pcsF 1-2D NA obtained in Reference Example 4
The total amount of 2 rivers was dissolved in 20111 Y-100 buffer, and the restriction enzyme ApaI (Boehringer Mannheim (Boehringer)
rin-ger Mannheim) and BamH
10 units of each of I were added and the reaction was carried out at 37°C for 4 hours. From this reaction solution, 1.5 kb of DNA was extracted using the LGT method.
Fragment 0.44 was purified and recovered.

Plasmid pLsA1 prepared separately by the method of Reference Example 14
Dissolve 2x in Y-100 buffer 20ml, add restriction enzyme Ba
10 units each of n1[I (manufactured by Toyobo Co., Ltd.) and BamHI were added, and the reaction was carried out at 37°C for 4 hours.

From this reaction solution, 0.8 g of a 2.8 kb DNA fragment was purified and recovered by the LGT method.

On the other hand, the N-terminal 1st to 5th amino acids of the mature hG-CSF polypeptide [threonine' (ACA or ACT), proline t (OCA or 0CT),
Leucine 3 (CTA), Glycine' (GGC),
It is necessary to provide a codon encoding proline' (CCC) and a start codon (ATG) necessary for expression;
In addition, the following DNA linker was synthesized because the distance between the SD-sequence downstream of the tryptophan promoter (P trp) and ATG needs to be an appropriate length between 6 and 1 abpO.

(Space below overlapping) First, heavy chain DNA, 26a+er and 20ser, were prepared using the usual triester method [R, Crea et al.:
Proceedings of the National Academy
・Op Science (Proc, Natl, Aca
d.

Sci.), USA 75.5765 (1978)
). Two volumes of 26ser and 20ser were dissolved in T4 kinase buffer, 30 units of T4 polynucleotide kinase was added, and a phosphorylation reaction was performed at 37°C for 60 minutes.

Apa I-Ba derived from pCSF 1-2 obtained above
mHI fragment (1,5 kb) 0.4 n and pLSA 1
Ban1l[-Ba+sHI fragment (2,8kb) derived from
Dissolve 0.2 pg of the DNA linker in 25d T4 ligase buffer, and add 0.1 pg of the above DNA linker to this mixture.
added. Six units of T4 DNA ligase were further added to this mixed solution, and a binding reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli 1
Strain 8101 [Bolivar et al.: Gene (
Gene) 2.75 (1977)) using the method of Cohen et al.
n) et al.: Proceedings of the National Academy of Sciences (Proc. Natl.

Acad, Sci, ) USA, 69.2110 (1
972)) to obtain AP-resistant colonies. Plasmid DNA was recovered from the cultured cells of this colony. The structure of the obtained plasmid is BanI[I
After cutting with ,Rsal,,Ps,HindlI[,BglII, it was confirmed by agarose gel electrophoresis. This plasmid is called pCfTA1. It was confirmed by the Deideoxy Seefence method using M13 phage that the nucleotide sequence near Ban■ and Hindl[[ of pCfTA1 is as follows.

Reference Example 16 Human pro-UK expression plasmid psEIUK1sEd
Construction of l-3: (1) Construction of recombinant plasmid pUKGprol: pU
E. coli strain 18101 containing c19 plasmid DNA was cultured, and pUc19 DNA was prepared from the cultured cells by a conventional method. Approximately 2 μg of the obtained pUc19 DNA was transferred to 30 μg.
l of Y-〇 buffer, dissolve in buffer solution, 10 units of 5tsa l
After 2 hours of digestion reaction at 37°C, 1.0μ
! of 3M NaC1 and 10 units of old ndIII,
The digestion reaction was carried out at 7°C for 2 hours. Subsequently, a DNA fragment of approximately 2.7 Kb was purified using the AFT method.

On the other hand, about 2 μg of p[IKFpro obtained in Reference Example 13
was dissolved in 30 ui of Y-100 buffer and 10 units of B
amflll and 10 units of old ndlll were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65° C. for 110 minutes, a DNA fragment of approximately 1.3 Kb was purified using the AFT method. In addition, about 8 μg of pUKFpro was added to 50 Y-1
00 buffer, 20 units of Bamtl I and 20
One unit of Pvull was added, and the digestion reaction was carried out at 37°C for 2 hours. After polyacrylamide gel electrophoresis, a DNA fragment of approximately 120 bρ was purified by electrophoretic elution.

Approximately 2.7 Kb derived from pUc19 obtained in this way
DNA fragment (approximately 0.1 μg), approximately 1.3 Kb DNA fragment (approximately 0.1 μg) derived from pUKFpro, and pUK
Approximately 120 bp DNA fragment derived from Fpro (approximately 0.01
ug) in 20 μl of T4 ligase buffer, 1
00 units of T4 DNA ligase was added and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA ApUKGprol was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion.
It was confirmed that it had the desired structure (see Figure 29).

(2) Construction of recombinant plasmid pUc19UKd3: p
E. coli strain 88101 containing Uc19 plasmid DNA was cultured, and pUc19 DNA was prepared from the cultured cells by a conventional method. Approximately 2 μg of the obtained pUc19 DNA was
After dissolving in μl of Y-O buffer and adding 10 units of Sea 1 and performing a digestion reaction at 37°C for 2 hours, 1. O
Add uf of 3M NaCl and 10 units of old ndlII,
Further, the digestion reaction was carried out at 37°C for 2 hours. Then AFT
A DNA fragment of about 2.7 Kb was purified using the method.

On the other hand, the pUKGprol plasmid DNA obtained above
Approximately 20g to 200uj! of Y-0 buffer, 50 units of Kpn I was added, and a digestion reaction was performed at 37°C for 2 hours. 50 μf of this reaction solution (5 μf as DNA)
5 times the concentration of BAL311! with liquid solution (100
n+MTris-HCI <9 H8,1), 3MNa
C1, 60mM CaC1z, 60mM MgC1z 5
11M EDTA) to 20μ! , add 30 ul of water and further add 0.4 units of nuclease BAL31 to make 37
The reaction was carried out at ℃ for 1 minute. This reaction solution was extracted with phenol and chloroform, and DNA was recovered by ethanol precipitation.
It was dissolved in a buffer solution, 20 units of old ndIII was added, and the digestion reaction was further carried out at 37°C for 2 hours.

Subsequently, a DNA fragment of approximately 1.4 Kb was purified using the AFT method.

Approximately 2.7 Kb derived from pUc19 obtained in this way
DNA fragment (approximately 0.1 μg) and approximately 1.4 Kb DNA fragment (approximately 0.1 μg) derived from pLIKGprol were added to 20
Dissolve 100 units of T4 in μi of T4 ligase buffer.
DNA ligase was added and the binding reaction was carried out at 4°C for 18 hours. Using the resulting mixture of recombinant plasmids,
Escherichia coli MM294 strain was transformed to obtain an Ap-resistant strain.

Plasmid DNA pUC19UKd was obtained from this transformed strain.
3 was isolated and subjected to structural analysis by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 30).

pUc19UKd3 contains approximately 30 bp of the 31-untranslated region of pro-UK.

(3) Human pro-UK expression plasmid psEIUK1
Construction of sEdl-3: Approximately 2 μg of the pUc19UKd3 Boo) After, 1. Ou j! of 3M NaCl and 10 units of old ndlII were added, and the digestion reaction was further carried out at 37°C for 2 hours. Subsequently, a DNA fragment of approximately 1.4 Kb was purified using the AFT method.

On the other hand, psEIPAlsEldhf obtained in Reference Example 9
rl-9AAg2S was dissolved in 30μ2 of Y-0 buffer, 10 units of Kpn I was added, and the digestion reaction was performed at 37°C for 2 hours. Ott 7! of 3M NaCl and 10 units of Xho I were added, and the reaction was further carried out at 37°C for 2 hours. Subsequently, an approximately 8.8 Kb DNA fragment was purified using the AFT method.

Separately, about 2 μg of pAGE106 obtained in Reference Example 9 was
Dissolve 10 units of Xho in μ2 of Y-100 buffer.
1 and 10 units of old ndlll were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65℃ for 10 minutes, AF
A DNA fragment of approximately 370 bρ was purified using the T method.

About 1 from pUC19UKd3 obtained in this way
, 4 Kb DNA fragment (approximately 0.1 μg) and psEI
Approximately 8.8 Kb D from PAlsEldhfrl-9A
20 μg of NA fragment (approximately 0.1 μg) and approximately 370 bp DNA fragment (0.03 μg) derived from pAGE106.
1 of T4 ligase buffer and 100 units of T4D.
NA ligase was added and the binding reaction was carried out at 4°C for 18 hours. Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA ApSEIUKI was obtained from this transformed strain.
When SIEdl-3 was isolated and structurally analyzed by restriction enzyme digestion, it was confirmed that it had the desired structure (see Figure 31).

Reference Example 17 Construction of human c-csp expression plasmid pASLB3-3: (1) Construction of recombinant plasmid pAGEL106: LTR of HTLV-I constructed by Shimizu et al. Plasmid pATKO3 containing the +1 region (Shimizu et al.: Proceedings of the National Academy of Op Science)
Proc, Natl, Acad, Sci,) USA 8
E. coli 1 with 0.3618-3622 (1983))
8101 strain was cultured, and pATK was extracted from the cultured cells using a conventional method.
O3DNA was prepared. Obtained pATK03DN
A: Approximately 20μg to 200μ! Dissolve in Y-0 buffer of 6
0 units of BanII was added and the digestion reaction was carried out at 37°C for 2 hours. After polyacrylamide gel electrophoresis, a DNA fragment of approximately 410 bp was purified by electrophoretic elution. Dissolve 0.1 μg of this DNA fragment in 20 μl of Y-100 buffer, add 10 units of 5au3AI, and mix at 37°C.
The digestion reaction was carried out at C for 2 hours. After polyacrylamide gel electrophoresis, approximately 270 bp of D
The NA fragment was purified.

On the other hand, about 2 μg of pAGE106 obtained in Reference Example 9 was
0μ! of y-ioo buffer, 10 units of Bam
H.

1 and 10 units of Bgl I were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 110 minutes, AF
A DNA fragment of approximately 4.9 Kb was purified using the T method. In addition, the following two types of synthetic NA (6-mer and 5-mar
) from Applied Biosystems 380A-DNA
Synthesized using a synthesizer.

5'-CGGGCT-3'(6-mar)3'-
GGAGC-5' (5-mar) 20 pmoles of each of these synthetic NAs were separately added.
The 5′ end of the synthetic NA was phosphorylated by adding 5 units of T4 polynucleotide kinase in reduced T4 kinase buffer and reacting for 30 minutes at 37°C.

Approximately 270b derived from pATKO3 thus obtained
P DNA fragment (approximately 0.01 μg), approximately 4.9 Kb DNA fragment derived from pAGE106 (approximately 0.1 μg), and two types of 5” phosphorylated synthetic NA (1 pmol each) in a total amount of 20 ttfl. was dissolved in T4 ligase buffer, 300 units of T4 DNA ligase was added, and the ligation reaction was carried out at 4°C for 18 hours.Escherichia coli MM294 strain was transformed using the obtained recombinant plasmid mixture, and Ap-resistant A strain was obtained. From this transformed strain, plasmid D
When NApAGEL106 was isolated and structurally analyzed by restriction enzyme digestion, it was confirmed that it had the desired structure (see Figure 32).

(2) Recombinant plasmid I) Construction of ASLB3-3S:
About 10 pAGEL106 plasmid DNA obtained above
μg was dissolved in 100 μ2 of Y-0 buffer, 30 units of S+sa I was added, and a digestion reaction was performed at 37° C. for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 5
The IKb DNA fragment was purified. Separately, 20 pmol of Sal I linker (GGTCGACC: manufactured by Takara Shuzo Co., Ltd.)
was 5"-phosphorylated using a method similar to that described in Reference Example 1. 5 μg of a DNA fragment of approximately 5.IKb derived from pAGEL106 and 5"-phosphorylated
10 pmol of I linker was dissolved in a total volume of 20 μl of T4 ligase buffer, 100 units of T4 DNA ligase was added, and a binding reaction was performed at 4°C for 18 hours. 65℃, 10
After heat treatment for 1 minute, DNA was recovered by ethanol precipitation. The DNA fragment obtained in this way was transferred to a 40μ2 Y
-150 buffer, 20 units of 5alt and 20 units of Mlu I were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C (10 minutes), a DNA fragment of approximately 1.7 Kb was purified using the AFT method.

On the other hand, about 2 μg of pAS3-3 obtained in Reference Example 10 was
10 units of 5ai dissolved in 0aX Y-150 buffer
After heat treatment at 65°C for 110 minutes, AFT
A DNA fragment of approximately 6.7 Kb was purified using the method.

Approximately 1.
A 7 Kb DNA fragment (approximately 0.1 μg) and an approximately 6.7 Kb DNA fragment derived from pAS3-3 (approximately 0.1 μg) were added to 20
Dissolve 100 units of T4 in μl of T4 ligase buffer.
DNA ligase was added and the binding reaction was carried out at 4°C for 18 hours. Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a Km-resistant strain. Plasmid DNA pASLB3-3S was obtained from this transformed strain.
was isolated and subjected to structural analysis by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 33).
.

(3) Human G-C5F expression plasmid pASLB3-3
Construction: pASLB3-3S plasmid D obtained above
Dissolve approximately 2 μg of NA in 30 μl of Y-150 buffer,
Add 10 units of Xho I and 10 units of Mlu I;
Digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, approximately 7. : A 3 Kb DNA fragment was purified.

On the other hand, about 2 μg of pAS3-3 obtained in Reference Example 10 was
091! , 0) dissolved in Y-150 buffer, 10 units (
7) XhoI and 10 units of Mlu I were added and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 110 minutes, a DNA fragment of about 2.6 Kb was purified using the AFT method.

Approximately 7 cells derived from pASLB3-3S thus obtained
．． A 3Kb DNA fragment (approximately o, iμg) and pAS3-
An approximately 2.6 Kb DNA fragment (approximately 0.1 μg) derived from No. 3 was dissolved in 20 μi of T4 ligase buffer, 100 units of 74 DNA ligase was added, and a ligation reaction was performed at 4° C. for 18 hours. Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA pASLB3-
3 was isolated and subjected to structural analysis by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 34).

The microorganism containing plasmid pASLB 3-3 is Esch
eri-chia colt EASLB 3-3 (
FERM 0P-2358) on March 28, 1999, and was deposited with the Institute of Fine Technology.

Examples of the invention are shown below.

Example 1 (1) Pro-tlK polypeptide production Production COO prespecies psEIUKprol-1 and pSV 2-dhfr
was introduced into the dhfr-deficient CHO strain according to the calcium phosphate method. In other words, fetal bovine serum (hereinafter referred to as FC3)
) was added to 10% and 7.5% NaHCO3 solution (F
(manufactured by Low Laboratories) 1750
volume, 100x non-essential amino acid solution (Flow Labo
MEM with 1/100 amount of MEM (manufactured by Ratories) added
ALPHA medium (contains ribonucleic acid and deoxyribonucleic acid; manufactured by Gibco Oriental) [Hereinafter, this medium will be referred to as ME
Cells were inoculated at a ratio of 1 x 1 OS cell/IR1 to 15d, abbreviated as Mα (non-selective medium).
cm datesch was used. Manufactured by LUX (hereinafter, LU and X dates were used for culture) L 37°C, C
O. Cultured in an incubator for 1 day. On the other hand, ps
EllJKprol-I DNA 10/l/g and psV2-dhfr DNA 1 ug at 450μ
! of 10mM Tris-HCI (pH 7,5) and 500μffi of 280mM
aC1+ 1.5n+M NaJPO4゜50mM
HEPES (N-2-hydroxyethylpiperazine-N
'-2-ethanesulfonic acid) (pH 7.1) was added and mixed. Additionally, 50 μl (2,5M)
The CaCl solution was added and mixed, and the mixture was allowed to stand at room temperature for 5 minutes. Remove the entire amount of this DNA solution from the medium and add it to fresh MEMα.
(Non-selective medium') 10 d was added to the dhfr-deficient CHO strain, which was further cultured for 1 hour, and incubated for 8 hours. Wash cells with PBS and 5! d MEMα (non-selective medium) was added and cultured for 16 hours.

PBS (NaC18g/41!, KC
l 0.2g/I! , Na2HPOa (anhydrous > 1
．． After washing with 15 g/l KH, HPo, 0.2 g/f), adding solution 3- containing 0.05% trypsin and 0.02% EDTA (ethylenediaminetetraacetic acid), and removing excess solution, 37 Incubated at °C for 5 minutes (trypsinization). 10% dialysis F-C3 (manufactured by Gibco Oriental) and 11% 7.5% NaHCOs solution
/J50! , 1/1 100X non-essential amino acid solution
00! , G418 (manufactured by Gipco Oriental) 0
．． 3■ MEM ALP added to become /IIdl
HA medium (ribonucleic acid and deoxyribonucleic acid free) [
Hereinafter, this medium will be abbreviated as MEMα (selective medium)] to thoroughly suspend the cells, and cultured for 5 days at 37° C. in a CO2 incubator using a 10 cm diameter dish. Cells were washed with PBS, MEMα (selective medium) was added, and cultured for 5 days.

The same operation was performed and the cells were cultured for an additional 5 days. After washing cells with PBS, trypsinization and 51n10MEM
α (selective medium) was added to suspend the cells, and the cells were cultured for 3 to 7 days at 37°C in a CO2 incubator using a 6c11 diameter dish. After the colonies that appeared were treated with trypsin, they were inoculated into a 6 cm diameter dish using 5-MEMα (selective medium) at a cell concentration of 1×10′/mf, and cultured until they reached confluency. 5 relative MEMα (selective medium), 1
After a day, the activity of UK in the culture fluid was determined by fibrin plate assay (Granel 11-Piperno and Re
1ch; Journal of Experimental
Medicine (J, Exp, Med,) Akitsukuda, 233
(1978)). As a result, pr.

- The production volume in the UK was approximately 50 units/In1 day. This strain was named 0716Na7.

(2) Effect of hLT on pro-UK polypeptide-producing CHO strain pro-UK polypeptide-producing C obtained in (1) above
The HO strain and the 0716 Nα7 strain were inoculated into four 6 cm diameter dateschews at a concentration of 2 XIO'/d and incubated at 37°C.
(M until confluent in incubator
Cultured in EMα (selective medium). After removing the medium and washing with PBS, MEMα (selective medium) was added for 51 d. At this time, add hLT to 2 dates for I x 10'unit.
It was added so that the ratio was s/d. The cells were cultured in an incubator at 37°C, CO, and the culture fluid was sampled over time. Figure 1 shows the results of examining UK activity in the culture medium by fibrin plate assay.

Example 2 (1) Breeding of Namalwa strain producing pro-UK polypeptide psEIUK1sEdl-3 was introduced into Namalwa cells according to the electroporation method. That is, cells were incubated at 4 × 10'/d in PBS (137mM KCI, 2.7mM Na
C1,8,1mM NaJPOa, 1.5mM KHz
5SH-C
40 volumes were dispensed into 13 chambers (manufactured by Shimadzu Corporation).

To this, psEIUKlsEdl-3D NA solution (
1gg/μl) to 4μ! Add and mix well. Voltage 3. OK
Gene transfer was performed under the conditions of V/■, pulse width of 100 uSeC, and pulse number of 2 times. After standing for 10 minutes to allow the DNA to be incorporated into the cells, the number of viable cells was measured by trypan blue staining. Add 10% FCS and 7.5% NaHCO1 solution to 1/40 so that the number of viable cells is IXIO'/d.
Volume, 200pl1ML-Glutamine solution (manufactured by GIBCO) at 3%, penicillin-streptomycin solution (G
IBCO, 5,000 units/I11 penicillin, 5. OOOag/m2 streptomycin) at 0.
RPMI 1640 medium containing 5% (manufactured by Hinaga Pharmaceutical Co., Ltd.) [hereinafter referred to as RPMI 1640. FCS (10) medium] was prepared in a 96-well microtiter plate) (N
(manufactured by unc) in 200 μl portions.

After culturing in a COz incubator at 37° C. for 24 hours, 6418 was added at a concentration of 0.5 μ/rd and cultured for 2 weeks. The colony that appeared is 0418 0.3■/
RPMI 1640. 5 FCS (10) medium
0ul was added to the cellar and cultured, and when it reached confluency, the activity of UK in the culture solution was measured by fibrin plate.
It was investigated using an assay method. Clones that showed high activity were cultured in a 15 ci tissue culture flask (manufactured by Corning).・Collect cells by centrifugation, 0418
RP containing 0.3 mg/rtrfl and 50 nM MTX
MI 1640/FCS (10) medium with IXIO'/
1111! Alternatively, the suspension was suspended at 2 XIO'/d, and 200 pl was dispensed into a 96-well microtiter plate. 2-3 times at 37°C, CO□ incubator
A 50 nM MTX resistant strain was induced by culturing for weeks. At the time of confluency, the activity of UK in the culture solution was examined using a fibrin plate assay. Among the 50 nM MTX resistant clones thus obtained, clone 31 showed the highest activity (10) 15
The activity of UK in the culture medium is approximately 50 units JS/Il.
! i!・It was day.

(2) hLT, hLT (Δ1-11), hLT (
Δ1-22), Effect of hTNF on pro-U obtained in (1) above
amalwa strain, 31 (10) 15 strains were treated with G418 at 0.
3+ng/ml, RPMI 1 containing 50 nM MTX
5 x 10'units/in 640・FCS(10) medium
(Gre
(manufactured by iner). , hLT prepared by the inventors, hLT(Δ1-11), hLT(Δ
1-22), respectively, I X10”unfts/m2
Alternatively, the cells were added to 103 units/kg and cultured in a CO□ incubator at 37°C for 3 days.

Similarly, hTNF (manufactured by Cosmo Bio) was added at 1×10
The cells were added at 2 units/d and cultured at 37°C in a CO2 incubator for 3 days. The experiment was conducted in duplicate. After 3 days of culture, the culture solution was sampled, and the U in the culture solution was
Tables 3 and 4 show the results of examining K activity by fibrin plate assay.

Similarly, hLT was added to I X10'units/m
The cells were cultured in a COz incubator at 37°C, and the culture solution was sampled over time. Figure 2 shows the results of examining UK activity in the culture medium by fibrin plate assay.

(Margin below heavy responsibility) Table 3 hLT (Induct) lXl0'1X10" hLT (△1-11) 0 1X10"1X10" 1.00 3.05 3.05 1.00 1.74 1.98 X103 1X10" 1 .95 2.20 Table 4 1 X 10” 370 370
4.35 Example 3 (1) hG-CSF polypeptide production Nan+
Breeding of a1we strain pAsLB3-3 was introduced into Namalwa cells according to the electroporation method. That is, cells were suspended in -PBS at 4 x 10'/-,
5SI (40tt1 was dispensed into a C13 chamber. To this, pASLB3-3 DNA solution (1 μg/μ
4 μl of 1) was added and mixed well. Cell fusion device 5SH
-1 using voltage 3. OKV/c+m, pulse width 100
Gene introduction was performed under the conditions of μseC and two pulses. After standing for 10 minutes to allow the DNA to be incorporated into the cells, the number of viable cells was measured by trypan blue staining. RPMI 1640・F so that the number of viable cells is 1 x 105/d.
It was prepared with CS (10) medium and dispensed into 966 microtiter plates (manufactured by Nunc) at 200 μR each.

After culturing in a CO□ incubator at 37°C for 24 hours, 0418 was added at a concentration of 0.5□/mA and cultured for 2 weeks. The colony that appeared is 0418 and 0.3
50 μl of RPMI 1640/FCS (10) medium containing 1/3 was added and cultured further. When the culture reached confluency, the amount of hc-csF protein in the culture solution was determined by anti-hG-C.
It was determined by ELISA using 5F monoclonal antibody. hc;-Clones with a high production amount of CSF were mixed, and 7
The cells were cultured in a 5c+l&ll tissue culture flask. The cells were collected by centrifugation, and 6418 was added at 0.3 mg/d and MTX was added at 50 mg/d.
RPMr 1640・FCS containing 0 nM (10) 1×10S/r1t1. Alternatively, suspend at 2 x 10'/d and transfer to 966 microtiter plate.
00μ! Dispensed in portions. A 50 nM MTX resistant strain was induced by culturing in an incubator at 37°C for 2 to 3 weeks.
The protein amount of G-C5F was determined by ELISA using anti-hG-CSF monoclonal antibody. 5 obtained in this way
Among the 0 nM, MTX resistant clones, clone 6-28, which showed the highest productivity, produced about 1.0 Fg/d·day of hG-CSF in the culture solution.

(2) hG-CSF polypeptide production Nama
Effect of hLT on lwa strain hG-CSF polypeptide production N obtained in (1) above
amalva strain, 6-28 strain, 0418 at 0.3 mg/
d, RPMI 1640 containing 50 nM MTX. F.C.
Suspended in S(10) medium at a concentration of 5 x 10'/d,
0, hLT, and hLT were dispensed into 6-well plates.
respectively, lXl0'units/- or I
x10'units/m1 and 37°C
, and cultured in a COz incubator for 4 days. Experiment 2
We went together. After 4 days of culture, the culture solution was sampled and E
The production amount of hc-CSF was compared by LISA. The results are shown in Table 5.

(Leaving space below major responsibilities) Table 5 0 3.1 2.9 1.
002.7 1 X 1036.7 6.0 2
．． 0?5.3 1 X 10' 10.1 9.8
3.38 [Effects of the Invention] According to the present invention, the use of cytokines significantly improves the productivity of useful proteins in recombinant animal cells,
An extremely advantageous method for producing useful proteins using recombinant animal cells is provided.

[Brief explanation of drawings]

Figure 1 shows the effect of hLT on pro-UK production in pro-UK producing CHO strain. Figure 2 shows the effect of hLT on pro-UK production in pro-υ producing Naana1wa strain.
Figures 3 (1) and (2) showing the effect of hLT on o-UK production are shown in Figure 3 (1) and (2).
A diagram showing the process of DNA synthesis and the construction of a recombinant plasmid containing the DNA, FIG. 4 is a diagram showing the construction process of plasmid pccK1,
FIG. 5 is a diagram showing the construction process of plasmid pCCK2,
FIG. 6 is a diagram showing the construction process of plasmid pUK11,
Figure 7 is a diagram showing the construction process of plasmid pTrs20, Figure 8 is a diagram showing the construction process of plasmid pTrS33, Figure 9 is a diagram showing the construction process of plasmid pTera+2, and Figure 1O is a diagram showing the construction process of plasmid pTsF10. Figure 11 shows the construction process of plasmid pTA4. Figure 12 shows the construction process of plasmid pAGE105M.
Figure 13 is a diagram showing the construction process of plasmid pAGE106, Figure 14 is a diagram showing the construction process of plasmid psEIPA1-5, and Figure 15 is a diagram showing the construction process of plasmid psEIPA1-9. Figure 16 is a diagram showing the construction process of plasmid pc019H, Figure 17 is a diagram showing the plasmid process, Figure 18 is a diagram showing the plasmid process, Figure 19 is a diagram showing the plasmid process, and Figure 20 is a diagram showing the plasmid process. , Plasmi Figure 21 is Bra, Sumi Figure 22 is Plasmi diagram, Figure 23 is Plasmi Figure 24 is Plasmi diagram, Figure 25 is a diagram showing Blasumi, Figure 26 is Plasmi Figure 27 Figure 28 shows the plasmid, Figure 29 shows the plasmid diagram, and shows the construction process to psEIPA1-9.
Construction of psEIGc3-3 into 1sE1dhfrl-9
Figure 1 shows the creation process of pAS3-3, Figure 1 shows the creation process of pUKA2, and Figure 2 shows the creation process of pUKF2, which shows the creation process of pUKB101. A diagram showing the creation process of psEIUKprol-1, a diagram showing the creation process of pLA1, a diagram showing the creation process of pTS^1, a diagram showing the creation process of pCfT^1, a diagram showing the creation process of pUKGprol. FIG. 30 shows the steps for constructing plasmid pUc19UKd3, FIG. 31 shows the steps for constructing plasmid psEIUK1sEdl-3, and FIG. 32 shows the steps for constructing plasmid pAGEL106 (Sau3AI cleavage site 33 is a diagram showing the construction process of plasmid pASLB3-33, and FIG. 34 is a diagram showing the construction process of plasmid pASLB3-3.

Claims (1)

[Scope of Claims] 1. A method for producing a protein, which comprises, when producing a protein using a recombinant animal cell capable of producing the protein, allowing a cytokine to be present in a medium containing the recombinant animal cell. 2. The production method according to claim 1, wherein the cytokine is tumor necrosis factor (hereinafter abbreviated as TNF), lymphotoxin (hereinafter abbreviated as LT), or a derivative of LT. 3. The production method according to claim 2, wherein TNF and LT are derived from humans. 4. The production method according to claim 2, wherein the LT derivative is a derivative in which 11 or 22 amino acids are deleted from the N-terminus of mature human LT. 5. Cytokine, 10 units/ml ~ 10^7
units/ml, preferably 10^2 units/
The production method according to any of claims 1 to 4, wherein it is present at a concentration of ml to 10^4 units/ml. 6. The proteins produced are hormones, enzymes, enzyme inhibitors,
The production method according to claim 1, which is a cytokine or an immunoglobulin. 7. The animal cell is a human Namalwa cell or
The production method according to claim 1, characterized in that the cells are CHO (Chinese Hamster Overary) cells. 8. The protein produced is human granulocyte colony stimulating factor (
The production method according to claim 1, wherein the production method is hG-CSF (hereinafter abbreviated as hG-CSF) or human prourokinase. 9. The production method according to claim 1, wherein the protein produced is in a crude or isolated form. 10. As promoters of the expression plasmid used to express proteins in the recombinant animal cells, SV40 early promoter, SV40 late promoter, Molon
eymurine leukemia virus LTR promoter, Roussarcomavirus LTR
Promoter, HumanT-celleukemi
2. The production method according to claim 1, wherein the SV40 early promoter containing a portion of the Avirus-I LTR, preferably the SV40 early promoter or the SV40 early promoter containing a portion of the HTLV-I LTR is used. 11. The production method according to claim 1, wherein the recombinant animal cells capable of producing the protein are cultured and grown in a medium containing cytokines, and the culture is continued until the protein is accumulated. 12. The production method according to claim 1, wherein the recombinant animal cells capable of producing protein are maintained in contact with the cytokine in a medium containing the cytokine. 13. In the first step, after growing recombinant animal cells with protein-producing ability in a growth medium until reaching a predetermined cell density, in the second step, cytokines are made to exist and the recombinant animal cells are combined with the recombinant animal cells. Claim 1 to maintain contact
Production method described in 2.