RU2500816C1 - RECOMBINANT PLASMID DNA pAK380 CODING POLYPEPTIDE OF RECOMBINANT FACTOR IX OF HUMAN BLOOD COAGULABILITY, LINE OF CELLS Cricetulus griseus CHO, 1E6-PRODUCER OF RECOMBINANT FACTOR IX OF HUMAN BLOOD COAGULABILITY, AND METHOD FOR OBTAINING POLYPEPTIDE HAVING ACTIVITY OF RECOMBINANT FACTOR IX - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant blood coagulability factor IX of human being (hFIX). Recombinant plasmid DNA pAK380 containing gene of protein rhFIX, MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transcription enhancer CMV and an internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase for stability to geneticin (Neo), a cassette for expression in bacteria cells of gene β-lactamase for stability to ampicillin, is used for obtaining recombinant factor hFIX in cells of line Cricetulus griseus CHO 1E6. By transformation of cell line C. griseus CHO DHFR - recombinant plasmid DNA pAK380 there obtained is cell line C. griseus CHO 1E6 producing recombinant hFIX with stable high yield at the level of 50 mg/l/24 h. After cultivation of cells-producers there extracted is hFIX by pseudoaffine chromatography on Q Sepharose with elution of 10mM CaCl2; then, on Heparin-Sepharose FF with elution of 600 mM NaCl, and chromatography on hydroxyapatite of type I with elution of 600 mM K3PO3 and chromatography on Source 30Q with elution of 600 mM with ammonium acetate.

EFFECT: improvement of the method.

4 cl, 5 dwg, 7 ex, 3 tbl

Description

Technical field

The invention relates to biotechnology, in particular to genetic engineering, and can be used to obtain recombinant human coagulability factor IX (rhFIX). The invention is a recombinant plasmid DNA pAK380 encoding a polypeptide with a sequence of a recombinant human blood coagulation factor IX and a producer based on the Cricetulus griseus CHO 1E6 cell line containing said plasmid DNA and synthesizing a recombinant human blood coagulation factor IX.

State of the art

Blood coagulation factor IX (FIX) or, otherwise, Christmas factor is a glycoprotein consisting of 415 amino acids. It is synthesized in hepatocytes as a single-chain inactive precursor with a molecular weight of 55 kD. Before secretion into the bloodstream, the signal sequence of 46 amino acids is cleaved. In the process of coagulation, factor IX is activated and its transformation into an active form under the action of a complex of coagulation factor VIIa and tissue thromboplastin (external coagulation pathway) or factor XIa (internal coagulation pathway) in the presence of divalent calcium cations. The active form of factor IX - factor IXa - in combination with factor VIII activates factor X, which, in turn, promotes the transition of prothrombin to thrombin and the formation of a fibrin clot.

Factor IX deficiency underlies hemophilia B. The incidence of this disease is 1: 30,000 men. In Russia, according to the National Hemophilia Foundation, there are currently about 3,000 patients with hemophilia B. The disease is accompanied by frequent bleeding, which may require immediate clinical intervention and pose a threat to life, as well as lead to delayed effects (disorders in the joints, muscles, skeleton bones ) The risk of bleeding depends on the severity of hemophilia B:

the concentration of factor IX in the blood. In patients with a mild form (0.05-0.4 IU / ml), uncontrolled bleeding develops only in the case of surgical interventions, tooth extraction, and severe injuries. Patients with an average degree of hemophilia B (0.01-0.05 IU / ml) are characterized by prolonged bleeding with minor injuries. In patients with severe hemophilia (<0.01-0.05 IU / ml), bleeding develops spontaneously. Medium and severe forms are found in 60-70% of patients with hemophilia B (Thromb Haemost. 2011 Sep; 106 (3): 398-404. Epub 2011 Aug 11. Review).

The goal of hemophilia B treatment is to prevent and control bleeding episodes through FIX replacement therapy. Therefore, the optimal treatment option is the prophylactic administration of FIX drugs. Currently, both FIX preparations isolated from plasma and recombinant factor IX (Benefix) are used. The disadvantage of products derived from plasma is the risk of transmission of prion and viral diseases that are resistant to modern methods of inactivation. In this regard, it is preferable to use a recombinant product.

Unfortunately, in Russia, the high cost of recombinant blood coagulation factors serves as a deterrent to their widespread use. Therefore, the creation of an rhFIX producer, which allows one to obtain high-quality and relatively inexpensive protein that can be used in the production of a domestic drug, which will expand the arsenal of drugs for patients with hemophilia B, is a very urgent and important task.

Factor IX is synthesized in the form of a precursor consisting of 461 amino acids containing, in comparison with the mature form, an additional 46 amino acids at the N-terminus. The signal sequence (28 amino acids) is necessary for the secretion of the factor; its removal occurs in the endoplasmic reticulum. The Pro domain (of 18 amino acids) is the binding domain of a γ-carboxylase carboxylating a nearby Gla domain. Removal of the Pro domain occurs after carboxylation in the Golgi apparatus due to PACE activity (Paired basic Amino acid Cleaving Enzyme - “an enzyme that breaks down a protein in the place of paired basic amino acids”). Gamma-carboxylation and removal of the propeptide domain are indispensable for obtaining physiologically active FIX.

One of the main obstacles to obtaining large quantities of a fully functional recombinant FIX factor is associated with the presence of complex post-translational modifications, including, in addition to standard hydroxylation, the already mentioned ones: removal of the Pro domain and carboxylation of the Gla domain. The Gla-Domain contains glutamic acid residues that undergo post-translational modification by the addition of carboxyl groups. Modification of glutamic acid residues is the result of the action of a vitamin K-dependent enzyme known as γ-glutamyl carboxylase. Overexpression of the protein leads to the fact that both processes - carboxylation and cleavage of the Pro-domain are incomplete, and as a result, a mixture of the active protein with its inactive undercarboxylated or immature forms is obtained. It was shown that during protein expression in CHO cells, about 50% of factor IX retains the Pro domain (J. Biol. Chem., 1989, 264 (12): 6615-18) and only 1-2% of the protein is carboxylated (J. Biol. Chem., 1986, 261 (21): 9622-28). Moreover, the specific activity of the recombinant protein was on average three times less than the activity of FIX obtained from plasma. In other words, initial attempts to obtain a biologically active recombinant factor IX were associated with significant difficulties (Nature, 1985, v. 315: 683-685, Nature, 1985, v. 316: 271-273).

At first, low yields of active protein were tried to be explained by problems with gamma-carboxylation. On the one hand, it was obvious that gamma-carboxylation was necessary to obtain an active protein, on the other hand, it was not clear whether mammalian cells contained the necessary enzyme, carboxylase. Therefore, the first expression systems were constructed using cells known to contain the desired enzyme. So European patent EP 0195592 discloses two cell systems for the expression of factor IX: in the first, rat hepatoma cells H4-11-E-C3, known for their ability to produce gamma carboxylase, were used, in the second, dog kidney cells (MDCK). However, in the first case, noticeable yields were not achieved at all (analysis showed that only one plasmid was integrated into the cell genome). In the second case (a vector containing a promoter and a polyadenylation sequence from SV40 and a gentamicin resistance gene was used), two effective clones (593 and C6) were obtained, and the protein yield was 100 and 250 ng / ml / day. The specific activity of the protein was 100% and 91%, respectively.

U.S. Patent 4,770,999 provides an additional way to solve the low yield problem by adding Vitamin K to the cell culture medium. CHO DHFR (-) cells were used, and the vector contained the SV40 promoter and polyadenylation sequence, DHFR gene, and gentamicin resistance gene. Conducted co-expression of this vector with a plasmid expressing DHFR. The protein yield was 43.4 μg / ml. In the presence of vitamin K, a yield of 0.275 IU / ml / day / 10 ⁶ cells was achieved, but the specific activity was low - 16.5 IU / mg protein. That is only 9% of the activity of factor IX obtained from normal plasma.

The next step was an attempt to increase the yield of active factor IX by co-expression with γ-glutamyl carboxylase, however, a significant increase in cell line productivity was not achieved (Biochemistry, 2002, Dec 17; 41 (50): 15045-55). The authors of patent RU2372401 suggested that the problem was the presence of two equally strong promoters, and proposed a vector comprising sequences of a FIX protein and γ-glutamyl carboxylase containing two promoters of different strengths: a strong CMV promoter for FIX and a weaker SV40 for γ-glutamyl carboxylase, so that factor IX and γ-glutamyl carboxylase are expressed in a ratio of 5: 1 to 45: 1. With a ratio of 45: 1 and the same direction of the promoters, the yield of the active protein of 7.3 mg / L was obtained in CHO-S cells.

Using a different strategy - introducing a factor IX propeptide cleaving enzyme into the sequence vector, namely PACE (another name is furin), to increase protein yield is described in several articles (J. Biol Chem. 1986 Jul 25; 261 (21): 9622- 8; Proc Nati Acad Sci USA, 1993, May 15; 90 (10): 4611-5; Semin Hematol. 1998 Apr; 35 (2 Suppl 2): 4-10). These studies showed that co-expression with PACE leads to an increase in the yield of the active protein by a factor of 2–3, but the specific activity of such a protein is still lower than that obtained from plasma (35–75 IU / g and 150 IU / g, respectively).

US patent US 5460950 discloses expression systems comprising a vector containing the PACE sequence and the sequence of the desired protein, or two vectors, one for the expression of PACE, the second for the expression of the desired protein. The authors of the patent also showed that the presence of PACE increases the effectiveness of gamma-carboxylation. The expression system in CHO cells, containing a vector expressing PACE and a second vector expressing factor IX, in the presence of vitamin K gave a 2-3 times greater yield of active protein than a similar system without using PACE. The protein yield reached 20 μg / ml or 30 pg / cell.

The closest analogue of the present invention is the expression system proposed in international application WO 2008153366. The authors of the publication combined several previously used approaches and proposed a way for the simultaneous expression of a vector containing the PACE or γ-glutamyl carboxylase sequence together with a vector containing the factor IX sequence, this vector also includes the human β-globulin MAR sequence and the factor IX intron 1 sequence, to increase protein expression. Moreover, according to the authors of the patent, the main contribution to the increase in the expression level is made by intron 1, which makes it possible to increase the protein yield by 10 times in comparison with a vector in which this sequence is absent. As a result of co-expression, the yields of factor IX (the best clone) were reached up to 11.9 μg / ml or 14.3 μg / 10 ⁶ cells / day. The authors also note that the cultivation in the presence of soy and yeast hydrolysates can increase the yield of the final product an additional 2 times.

The disadvantage of this invention is the use of its own cassette with a separate promoter for the DHFR gene. This leads to the fact that during cell amplification in the genome, the copy number of mainly the cassette expressing DHFR rather than FIX increases due to the lack of a functional link between both transgenes. Such a system has low potential for the use of recombinant FIX-based drugs in industrial production, since the use of the described approach leads to a high probability of clone degeneration and, as a rule, leads to a significant decrease in the level of FIX production during prolonged cultivation of cell lines in the absence of selective pressure.

In this regard, it is worth noting that none of the above patent documents contains data on the stability of the obtained expression system (number of passages), which is one of the most important criteria for the applicability of the cell line for industrial protein production, along with a high level of expression. Therefore, there remains a need to create not only effective, but also stable expression systems of factor IX, which makes it possible to predictably obtain a biologically active protein in high yield.

Disclosure of invention

The present invention solves the problem of constructing plasmid DNA containing the sequence of recombinant factor IX, and creating a cell line (strain producer), allowing to obtain recombinant factor IX in high yield at a constant level of about 23-45 mg / l / day and maintaining its performance over the course of a large number of passages (at least 60), which is important and necessary for the industrial production of protein.

The problem is solved by constructing recombinant plasmid DNA pAK380, consisting of 11236 bp and the cell line Cricetulus griseus CHO 1E6, allowing to obtain the coagulation factor with a consistently high yield, sufficient for industrial production.

The introduction of various genetic elements of the eukaryotic genome into the composition of recombinant constructs used for subsequent transfection of mammalian cells can have a positive effect on the stability of the transgene in the genome of the recipient cell, significantly improving the growth characteristics of the culture (SC Makrides Gene Transfer and Expression in Mammalian Cells, (2003) Elsevier Science, chapters 10-12). Similar elements, in particular MAR, are used to create industrial producer strains for which the critical parameter determining the possibility of its use in production is the stability of the level of production and the growth rate of the culture.

Elements of attachment to the nuclear matrix MAR (Matrix Attachment Regions) are fragments of eukaryotic DNA with a length of 300-3000 bp and play a key role in organizing nuclear and chromosomal architecture. At interphase, they fix chromatin with proteins that form the nuclear matrix, separating the eukaryotic genome into independent chromatin loops (Mirkovitch, J., Mirault, M.E., and Laemmli, U.K. (1984) Cell 39, 223-232.). Due to the colocalization of MAR elements with regions of active transcription and regulatory elements in the genome, the former positively affect the transgene transcription level by attracting transcription activators and controlling the availability of DNA in chromatin. In addition to these properties, MAR elements, such as the MAR lysozyme gene of birds, can prevent a gradual decrease in transgenic promoter activity, which significantly increases the stability of the transgene expression level (Allen, GC, Spiker, S., and Thompson, WF (2000) Plant Mol. Biol. 43, 361-376).

In the process of constructing the plasmid, we found that the use of MAR in a plasmid containing the rhFIX gene allows us to maintain the expression level of this protein with the greatest stability.

The advantages of the present invention also lie in the use of a chemical-enzymatic method for synthesizing the rhFIX gene, which makes it possible to select the optimal codon composition of the gene and to avoid the presence of DNA structures in the sequence that impede the translation process, cryptic splicing sites, and polyadenylation. Optimization of the primary gene structure and the use of CMV cytomegalovirus transcription enhancer, as well as a DNA fragment that secures attachment to the MAR nuclear matrix, can significantly increase the level of factor IX secretion into the culture medium.

Recombinant plasmid DNA pAK380 contains the following sequences: MAR — region of attachment of avian lysozyme gene to the nuclear matrix, enhancer and transcription promoter of the CMV virus, rhFIX cDNA, internal IRES translation initiation site, DHFR gene, SV40 polyadenylation signal, cassette containing all necessary elements for expression of the gene of aminoglycoside-3'-phosphotransferase (Neo), which ensures the resistance of the producer cell strain to geneticin, and cassettes for the expression of the β-lactamase gene, which ensures the ampicillin vivus. Plasmid pAK380 (Fig. 3) encoding a FIX factor polypeptide is characterized by the following features:

- consists of 11236 bp,

- has a molecular weight of 7.3 MDa,

- encodes a polypeptide of factor IX of human blood coagulability;

- ensures the resistance of bacterial cells transformed with this plasmid to ampicillin and mammalian cells transfected with the indicated plasmid to geneticin,

- contains unique recognition sites for the following restriction endonucleases: AhdI (6259 bp), ApaI (1784 bp), BamHI (5082 no), BbeI (4287 no), BglII (1548 bp), BlpI ( 15 bp), BssHII (4685 bp), BstBI (4969 bp), EcoRI (8942 bp), EcoRV (9876 no), KasI (4287 no), MluI (1332 no ), NarI (4287 no), PspOMI (1784 no), PspXI (2249 no), RsrII (4803 no). SalI (10153 n.o.), SfiI (4040 n.o.), SfoI (4287 n.o.), SpeI (10489 n.o.), StuI (4091 n.o.), TthlllI (4403 n.o.), XcmI (11229 n.o.), XoI (2250 n.o.)

For protein production, the Cricetulus griseus CHO DHFR- cell line was selected. The baseline was purchased from the American Cell Culture Collection (ATCC), CRL 9096. The choice of cell line is due to the optimal glycosylation profile for the synthesis of human proteins, as well as the stability and safety of this cell line, which is an important parameter for the production of therapeutic proteins. Based on this cell line, the cell line Cricetulus griseus CHO 1E6 was produced - a producer of recombinant human blood coagulation factor IX, which is a derivative of the ovaries of the adult Chinese hamster Cricetulus griseus CHO and characterized by the following features:

Morphological characters: Cells have typical morphological characters of epithelial culture, and, initially, is an adherent culture. The line is hypodiploid (2n = 22), the modal number of chromosomes is 20.

Cultural traits: Cells are cultured in a monolayer on simple nutrient media, for example, DMEM in the presence of 2-10% fetal serum.

Physiological and biochemical characteristics: Cells grow at a temperature of 37 ° C, pH 6.7-7.3.

Antibiotic Resistance: Cells are resistant to geneticin at a concentration of 1 mg / ml.

The strain of the cell line Cricetulus griseus CHO 1E6 was deposited in the All-Russian Collection of Industrial Microorganisms at the State Research Institute of Genetics-VKPM under the number H-125, date of deposit 20.06. 2012 year

The claimed invention is illustrated in the following figures:

Figure 1 shows the amino acid sequence of human factor IX, SEQ ID NO: 1, consisting of 461 amino acid residues.

Figure 2 presents the optimized gene sequence of the factor IX, SEQ ID NO: 2, 1386 base pairs.

Figure 3 presents a map of recombinant plasmid DNA pAK380, used to create a producer strain of recombinant factor IX coagulation of human blood.

Figure 4 (a and b) shows the scheme for producing the pAK380 vector construct for expression of recombinant human blood coagulation factor IX.

Figure 5 presents the allocation scheme of recombinant factor IX coagulation of human blood.

The invention is illustrated by the following examples.

Example 1

Construction of recombinant plasmid DNA pAK380.

The nucleotide sequence corresponding to the cDNA of the human coagulation factor IX gene is obtained by enzymatic-chemical synthesis. To do this, the optimized gene sequence is divided into overlapping fragments of about 50 bp in size. The chemical synthesis of oligonucleotides corresponding to these fragments is carried out using the solid-phase phosphamidite method, for example, using the ASM-102U synthesizer (BIOSSET, Novosibirsk). The resulting oligonucleotides are subjected to 5'-terminal phosphorylation using T4 polynucleotide kinase (NEB, USA). Phosphorylated oligonucleotides are mixed in an equimolar ratio in 50 μl of a buffer containing 20 mM Tris-HCl, pH 7.56, 10 mM MgCl ₂ , 0.2 mM rATP, 10 mM dithiotreite, heated to 65 ° C, slowly cooled to 37 ° C for an hour and add T4 DNA ligase. The DNA ligation reaction is carried out for 12 hours at 37 ° C, 0.1 μl of the resulting solution is used as a matrix in the polymerase chain reaction (NDP) in the presence of thermostable Pfu DNA polymerase and specific primers:

F7_fwd 5'-TAGGCTAGCCGCCACCATGCAGCGCGTGAACATGAT-3 'and

F7_rev 5'-CGACGCGTTAGGTCAGCTTGGTCTTCTCCTTGAT-3 '.

The DNA fragment synthesized in this way contains the cDNA sequence of the human coagulation factor IX gene flanked by the restriction enzyme recognition sites NheI and MluI — SEQ ID NO: 2 (FIG. 2).

The amplification product is treated with T4 polynucleotide kinase, purified by electrophoresis on a 1% agarose gel, a DNA strip of about 1400 bp. isolated from the gel by electroelution, DNA is precipitated from the solution with ethanol and cloned into the plasmid vector pUC19 (New England Biolabs), pre-treated with HincII.

To obtain vector DNA pAK380 used a series of consecutive stages of cloning (figure 4). Initially, using the XbaI and NotI restriction sites, the mouse dihydrofolate reductase gene obtained by PCR using genomic DNA isolated from mouse SP2 / 0 myeloma cells and specific primers was cloned into the pIRES vector (Clontech, USA)

DHFR_rwd 5'-

CCTCTAGATGGTTGTGGCCATATTATCATCGTGTTTTTCAAAG-3 'and

DHFR rev 5'-GGAAGCGGCCGCTTAGTCTTTCTTCTCGTAGACTTCA-3 '

followed by site-directed mutagenesis to optimize the consensus sequence surrounded by the initiator codon of the IRES element using the QuikChange® II XL kit (Stratagene, USA) and the following oligonucleotides:

D3_fwd

5'-CCTTTGAAAAACACGATGATAATATGGCCACAACCATGGTTCGACCA

TTGAACTGCATC-3 'and

D3_rev

5'- GATGCAGTTCAATGGTCGAACCATGGTTGTGGCCATATTATCATCGT

GTTTTTCAAAGG-3 '.

The previously synthesized cDNA sequence of the factor IX gene was cloned into the obtained plasmid pAP225 at the NheI and MluI restriction sites.

The primary structure of the intermediate vector construct pAK379 in the region of the initiator codon of the IRES element was confirmed by Sanger sequencing.

Plasmid pAK379 was further sequentially treated with BgHI restriction endonuclease and T4 DNA polymerase, and the resulting vector was used in a dotting reaction with a PCR product obtained using MAR-specific primers

MAR_fwd 5'-GGGGATCCGTAATACAATTGTACCAGGTTTTTGGTTTATTAC-3 '

and MAR_rev 5'-

GAAAACAATATATTTCCAAATGAAAAAAAAAATCTGATAAAAAG-3 '

The selection of bacterial cells XL-10 Gold obtained after transformation of the ligase mixture was carried out in such a way as to reveal plasmid DNA pAK380 containing the MAR sequence in the genomic orientation with respect to the promoter.

Subsequently, the primary sequence of the obtained plasmid DNA was confirmed by the Sanger sequencing method. According to sequencing data, a plasmid was selected whose nucleotide sequence of the NheI-MM fragment encodes an amino acid sequence completely identical to the hFIX sequence, which was used in further work.

Example 2

Obtaining a cell line of Cricetulus griseus CHO 1E6, a producer of recombinant human coagulability factor IX.

To obtain the CHO DHFR- (1E6) cell line, a producer of recombinant human blood coagulation factor IX (rhFIX), cells of the Cricetulus griseus CHO DHFR- line (ATCC, CRL 9096), were transfected with p380 plasmid DNA linearized at the BspHI restriction site, for example, by lipofection using jetPEI ™ reagent (Polyplus Transfection Inc., USA).

Cricetulus griseus CHO DHFR-cells are seeded on a Petri dish (for example, 10 cm in diameter) with a density of 2 × 10 ⁴ cells / cm ² in 12 ml of DMEM medium containing 10% bovine fetal serum and incubated for 24 hours at 37 ° C in CO ₂ incubators.

Next, transfection is performed using 15 μg of linearized at the Bsp HI restriction site plasmid pAK380 and 20 μl of jetPEI ™ reagent per well according to the manufacturer's recommendations (N / P ratio = 5). 48 hours after transfection, selection of the transfected culture is started in order to obtain stable transfectants by changing the medium to selective:

EMEM medium supplemented with 10% dialyzed serum in the presence of a geneticin antibiotic at a concentration of 1 mg / ml. Change of selective medium is carried out regularly every 3-4 days. Starting from the 7th day, the wells are analyzed for clones of actively dividing cells. At the end of the selection procedure (the end of the selection was determined by the complete death of the non-transfected population of cells also under antibiotic pressure) and the viability of the pool of stable transfectants was restored, its productivity was determined.

Clone productivity is evaluated by enzyme-linked immunosorbent assay (ELISA) using, for example, a kit (AssayPro, USA) or enzyme-linked immunosorbent assay (using monoclonal or polyclonal antibodies specific for human coagulation factor FIX. For this, in plates where cells reached 80- 90% confluent, the culture medium was replaced with fresh supplemented with vitamin K1 (5 mg / ml) and incubated for 24, 48 and 72 hours at 37 ° C in a CO ₂ incubator. The supernatant was used in the ELISA-test. Productivity pool stable transfektan s is not less than 4 mg / l.

To increase the expression level of recombinant human blood coagulation factor IX (rhFIX), a human pool of stable transfectants was amplified by increasing concentrations of methotrexate (MTX).

For biotechnological purposes, the dihydrofolate reductase gene (DHFR) integrated into the expression vector is often used as a selection marker in the recombinant gene amplification system. The DHFR enzyme catalyzes the conversion of folic acid to tetrahydrofolate, which is necessary for eukaryotic cells to synthesize glycine, thymidine monophosphate and purine bases. In this regard, CHO cells in which the DHFR gene is inactivated by mutation (CHO DHFR-) do not grow on nucleoside-free media and acquire this ability after transfection with a plasmid vector expressing DHFR.

Growing transfectants are further selected on the basis of amplification of the DHFR gene against the background of increasing concentrations of methotrexate, a DHFR inhibitor, in a nutrient medium, since an increase in the number of copies of the gene will give cells resistance to the inhibitor in high concentrations. After conducting multiple rounds of selection, a population of cells containing up to several hundred copies of the DHFR gene is obtained.

For this stably transfected pool, 3 consecutive rounds of methotrexate amplification were performed. For this purpose, cells are cultured on MEM medium free of glycine, hypoxanthine and thymidine in the presence of 10% dialyzed fetal serum with the addition of increasing amounts of methotrexate (Table 1). The duration of each round was approximately 10-14 days.

Table 1 MTX Concentration Productivity, PCG / cells / 24 h Productivity, mg / L Without MTX 3,5 4.0 100 nM 5,0 5.2 500 nM 9.8 4.6 1 μM twenty 7.3

Next, the amplified pool of stable transfectants is plated on a Clone Media-CHO semi-liquid medium with a density of 1000 cells per Petri dish and, after clone formation is completed, subcloning is carried out, for example, using the ClonePix automated system. A total of 133 clones were analyzed by ELISA; the expression level range was 1-14 mg / L. For further work on the ratio of the level of expression of the target protein and growth properties, 3 leader clones were selected (Table 2).

table 2 Monolayer culture, EMEM + 10% serum 1E6 2H4 1A10 Mg / L 10,4 11.8 13.5 pkg / cells / day 45 80 31

The cell line Cricetulus griseus CHO 1E6, a producer of recombinant human blood coagulation factor IX (rhFIX), has been successfully adapted to suspension serum-free culture conditions. The characteristics of this line are presented in Table 3:

Table 3 Culture medium: FM4CHO (Hyclone), suspension cultivation Productivity, mg / l / 24h (according to ELISA) 23-45 The amount of FIXa (coagulometry), mg / l / 24h 4-6.5 Specific production, PCG / cell / 24 h 15-31 Doubling time 30 hours

For this clone, stability of the producing ability and growth characteristics were analyzed. For this purpose, cells are cultured for 50-100 generations, periodically evaluating both the level of rhFIX expression and the growth characteristics of the clones.

Thus, one of the most productive and stable clones of Cricetulus griseus CHO 1E6 was obtained, which was then used to create a master bank and the subsequent production of recombinant human coagulation factor IX (rhFIX).

Example 3. Isolation of FIX using pseudo-affinity chromatography on Q-Sepharose.

Q-Sepharose is a strong anion-exchange sorbent that binds biomolecules with a negative charge under application conditions and allows separation of molecules with different surface charges. The presence of a calcium-binding cluster in the FIX molecule, which carries a significant local negative charge (the Gla domain containing the residues of γ-carboxylated glutamic acid), allowed us to use Q-Sepharose in the pseudo-affinity version.

Elution of rhFIX was performed with a buffer containing 10 mm calcium chloride. The use of Q-sepharose in the process of FIX isolation led to the quantitative capture of protein from the culture fluid, and made it possible to efficiently purify neutral and positively charged impurities, as well as substances remaining bound to the sorbent in the presence of calcium ions. This stage made it possible to remove inactive forms of FIX, and at the same time, to concentrate the protein before the next chromatographic stage.

Example 4. Isolation of rhFIX using pseudo-affinity chromatography on Heparin Sepharose FF

Heparin-Sepharose is a bifunctional sorbent with cation-exchange properties, as well as pseudo-affinity properties with respect to heparin-binding proteins. Heparin-Sepharose binds biomolecules with a positive charge under application conditions, or having an affinity for heparin.

The eluate with Q-Sepharose was applied to a Heparin-Sepharose column without additional sample preparation. FIX was eluted with a high ionic strength buffer solution containing 600 mM sodium chloride. The use of Heparin-Sepharose in the process of FIX isolation led to the removal of residual proteins of the producer strain, and ensured the concentration and transfer of the protein to a suitable buffer for the subsequent chromatographic step.

Example 5. Isolation of FIX using chromatography on Ceramic Hydroxyapatite type I (CHT I)

At the third stage of isolation, the sorbent CHT I was used, which is a synthetic macroporous granule of calcium phosphate (hydroxyapatite), and allows proteins to be separated in a wide range of their surface charges and isoelectric points. The FIX-containing eluate was applied to hydrosciapatite granules at neutral pH and then eluted with potassium phosphate at a concentration of 600 mM. The use of hydroxyapatite in the isolation process allowed to remove the fraction of inactive FIX protein and residual impurities, as well as increase the concentration of FIX.

Example 6. Isolation of FIX using chromatography on Source 30Q

At the next stage of isolation, Source 30Q was used as a strong high-resolution anion-exchange sorbent, which allows efficient separation, including isoforms of one protein. By a gradient increase in the concentration of the eluent, ammonium acetate, to a value of 600 mM, FIX was separated from related impurities. The FIX substance obtained in this way was used to transfer to the finished product buffer by diafiltration.

Example 7. Measurement of the activity of the substance FIX

FIX activity was measured by coagulometric analysis. The method is based on the fact that the coagulation time of a mixture of a diluted FIX test sample and plasma, FIX-deficient substrate, depends only on the FIX activity in the test sample.

The analysis was carried out in plastic cuvettes, thermostatically controlled at 37 ° C. A solution of the FIX test sample, a plasma solution of FIX-deficient substrate, a mullet-kaolin mixture, and calcium chloride solution were added to the cuvette. The end point of coagulation of the reaction mixture — clot formation — was recorded using a hemostasis analyzer (coagulometer). Calculation of activity was carried out according to a calibration constructed using standardized normal plasma. The FIX substance obtained by the method described in the previous examples showed a high specific activity in the range of 250-350 IU / mg.

Thus, the present invention allows to obtain a recombinant coagulation factor of human blood IX with properties identical to those of a natural polypeptide. The resulting rhFIX can then be used for the manufacture of drugs.

Claims (4)

1. Recombinant plasmid DNA pAK380 encoding a polypeptide with a sequence of human coagulation factor IX, having a size of 11236 bp, with a physical map shown in figure 3, and consisting of the following elements:
an optimized sequence encoding a human blood coagulation factor IX polypeptide, SEQ ID NO: 2,
- MAR - areas of attachment to the nuclear matrix of the lysozyme gene of birds,
- CMV virus transcription enhancer,
- internal site of initiation of translation of the IRES of the encephalomyocarditis virus,
- mouse DHFR gene,
- SV40 polyadenylation signal,
- aminoglycoside-3'-phosphotransferase, which ensures the resistance of the producer cell strain to geneticin (Neo),
- cassettes for the expression in bacteria cells of the β-lactamase gene, which provides resistance to ampicillin,
- Unique recognition sites of the following restriction endonucleases:
AhdI (6259 bp), ApaI (1784 bp), BamHI (5082 bp), BbeI (4287 bp), BglII (1548 bp), BipI (15 bp o.), BssHII (4685 bp), BstBI (4969 bp), EcoRI (8942 bp), EcoRV (9876 bp), KasI (4287 bp), MluI (1332 bp), NarI (4287 bp), PspOMI (1784 bp), PspXI (2249 bp), RsrII (4803 bp). SalI (10153 bp), SfiI (4040 bp), SfoI (4287 bp), SpeI (10489 bp), StuI (4091 bp), Tth111I (4403 bp) o.), XcmI (11229 bp), XoI (2250 bp). 2. The cell line Cricetulus griseus CHO 1E6 is a producer of recombinant human coagulability factor IX obtained by transforming the cell line Cricetulus griseus CHO DHFR - recombinant plasmid DNA pAK380 according to claim 1. 3. A method for producing a polypeptide having factor IX activity, comprising growing a CHO 1E6 cell line according to claim 2 and isolating a polypeptide having factor coagulation blood factor IX activity, characterized in that it comprises the following sequence of operations:
1) pseudo-affinity chromatography on Q-Sepharose with elution with 10 mm CaCl2,
2) pseudo-affinity chromatography on Heparin-Sepharose FF with elution 600 mm NaCl,
3) chromatography on hydroxyapatite type I with elution of 600 mm K3RO3 and
4) chromatography on Source 30Q with elution with 600 mm ammonium acetate. 4. The method according to claim 3, where the cell line CHO 1E6 adapted to serum-free medium.

Images