JPH01128785A - 6-hydroxycaproic acid dehydrogenase and production thereof - Google Patents

Abstract

NEW MATERIAL:An enzyme, having the following characteristics and capable of dehydrogenating and converting 6-hydroxycaproic acid into 6-oxocaproic acid. Reaction optimum temperature; 35-55 deg.C in tris-hydrochloric acid buffer solution (0.05M) at pH7.5-9.5. Stable at pH5.0-10.5 in a buffer solution at 4 deg.C. mol.wt.; 35,000+ or -2,000 daltons measured by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis and 70,000+ or -2,000 daltons measured by gel filtration. Isoelectric point; pH5.0+ or -0.2. Exhibiting the N-terminal amino acid sequence expressed by the formula. USE:For producing 6-oxocaproic acid. PREPARATION:For example, a microorganism [Arthrobacter.oxydans AK65-6 (FERM P-9430)] belonging to the genus Arthrobacter is cultivated to separate an enzyme having the activity of dehydrogenating the converting 6- hydroxycaproic acid into 6-oxocaproic acid from the microbial cells.

Description

Detailed Description of the Invention (Industrial Application Field) The present invention relates to 6-hydroxycaproic acid dehydrogenase (hereinafter referred to as ROAD) that converts 6-hydroxycaproic acid to 6-octucaproic acid and a method for producing the same. It is something.

In this specification, amino acids and peptides are referred to as IUPACI
For example, the following abbreviations are used: In addition, when obtaining 1 optical isomer regarding amino acids, etc.,
Unless otherwise specified, the L-body is shown.

Gln: Glutamine residue Asp: Aspartic acid residue Pro Nibroline residue Tyr: Tyrosine residue Val: Valine residue Lys: Lysine residue Glu: Glutamic acid residue Ala: Alanine residue Asn: Asparagine residue Leu: Loin/residue Group Phe: Phenylalanine residue cty Nigericine residue His: Histidine residue Ser: Serine residue Thr: Threonine residue 11e: Isoleucine residue Trp: ) Liptophan residue Arg: Arginine residue Met: Methionine residue Cys Nigericine residue Group IL polydeoxyribonucleotides and oligonucleotides are designated by the sequence of deoxyribonucleotides represented by the abbreviations below.

A: 2'-deoxyadenylic acid residue C: 2'-deoxycytidylic acid residue G: 2'-deoxyguanylic acid residue T: Thymidylic acid residue Unless otherwise specified, the left end of the deoxyribonucleotide sequence is 5 ' end.

(Prior Art) 1 (CAD is a dehydrogenase that acts on 6-hydroxycaproic acid, and generates 6-oxocaproic acid from 1-hydroxycaproic acid using NAD as a coenzyme.

Conventionally, the reaction of converting 6-hydroxycaprone to 1t-6-oxocabro/acid has been carried out using Nocardia
) Microorganisms belonging to the genus CD, B, Norris, P.

W., Trudgill, Biochem, J., 121
．． 563-370 (1971)) and microorganisms belonging to the genus Acinetobacter CN, A., Donoghue, P. W., Trudgi
ll, Eur, J.

Biochem,,60. +-7 (+975): It was known that there was a problem with l.

(Problems to be Solved by the Invention) However, in the conventional reports, reactions were carried out using cell-free extracts, and the products were only qualitatively identified. Therefore, the existence of HCAD has not been confirmed, and the properties that can identify HCAD have not been known. Therefore, industrial use of HCAD has been impossible.

(Means for Solving the Problems) As a result of intensive research on microorganism-derived I (CAD), the present inventors discovered that Arthrobafter (Arthrobafter)
We discovered that HCAD, which had not been previously identified, existed in microorganisms belonging to the genus Arthrobacter, and further isolated this HCAD from microorganisms belonging to the genus Arthrobacter.

Please clarify the nature. Next, the HCAD gene was isolated from the microorganism, its entire base sequence was determined, and its entire amino acid sequence was determined. Thereafter, the gene was expressed and it was confirmed that HCAD could be obtained.

Based on the above findings, we have completed the present invention.

The present invention has the following characteristics and is capable of dehydrogenating 6-hydroxycaproic acid to convert it into 6-oxocaproic acid.
The goal is to provide AD.

a, p) Tris-HCl buffer (0,
Optimum reaction temperature in 0.05M) is 35-50C 1) Optimum pH is 8.5-9.5 when measured in Tris-HCl buffer fL (0.05M) at 45C, 4C in buffer Stable in the pl (5,0-10.5) range d, pl (a, o in Tris-HCl buffer (0,05
Stable up to 25C in M), molecular weight is 55,000 ± 2,000 Daltons f as measured by SDS polyacrylamide helanomaphoresis, and molecular weight is 70,000 ± 2,000 Daltons as measured by gel permeation G1 isoelectric point The pH was 5.0 ± 0.2 h, and the N-terminal amino acid sequence was Met-
His-Ala-Phe-Ala-Va 1-Leu-
Pro-Asp-Asp-Pro-Thr-I 1e
-His-Asp-Leu -Glu-Leu-Pro
- 1,b-hydroxycaproate dehydrogenase activity is 1 m
1 to t0 per g. ooo unit Furthermore, the object of the present invention is to obtain an amino acid sequence Met-His-Ala-Phe-Ala-Val-L represented by the following formula.
eu-Pro-Asp −= e > (fund)
(capital) 6 φ −= ro ψω −−
m--・-~ -k-4>--cbo<<o
Engineering〉C← 01 1 1 1
1 1 1 1 1 1
．． 1 = -sen ko - seki 飄 ψ shame 0 -1 --00--
Iris --- 0<< -ω <(5-<:l:L(5=
> Jaw (1) > Ni − =
--Shameω ---・--C/) (L)
- Senjima -1 〇 < 0 <, -2
0> ← KuQ: 1−−Oψ −−−C
) ψψ −Sen ;C)> SEN SEN
〇 -〇〈C5〉E-1-１〉〇 ω −〇目 Q −m Q Q、 ---k
:I Ko・-■ ψ's 0 0
~ = 〇 −to country 〉＜＜ Σ
Σ 〉 E−1−0υ −ψ −−−
0>-(company) 飄-a)>+! ：＞Low
−Sen −−1 ω −E+l ← φ
-0〉 く cllllllllllll -〇 - tA〉 Ko --ro,
-φKoni -■ Fist--1 (L) >
Sen rA Sen XE-4L
-Country 0 4 ← (Kushi 01 1
'I I I I I I I
) l lQ! (L)
tA > Ch e
->Q>-2-飄-O-1～-1:LI E-4-tuogo>o<.

111111111tI Q, O--ko>QJ :l >>CD ψ -~ ~ --m-++4 -1<->>
Φ a-ooo −・−−sen −−m−
-knee 0 0 - to = -6<< ni -ku ← 工 ----の -flash -'l
C/) -C: Q) -1 (Ll >
0.1 ,,e (L)−ψ=−211 −
-high -flash ni ----<>, -5) t<>
A polypeptide with methionine attached to its N-terminus.

It also includes friend intermediates in which part or all of the signal peptide is bound to the amine terminus of the above amino acid sequence.

By natural or artificial mutation, it is possible to change part of the structure of the DNA encoding a polypeptide without changing the primary activity of the polypeptide. The polypeptide of the present invention is a homologous variant (Homolog) of the polypeptide having the above amino acid sequence.
Also included are polypeptides having a structure corresponding to ousvariant).

Furthermore, according to the present invention, H
DNA encoding CAD is provided.

Just in case, the base sequence expressed by the following formula ATG CAT GCG TTCGCT GTCCTC
CCCGATGACCCCACCATT CAT GA
CCTG GAG CTTCCCACCG CCA
AGCCCT GAA GGCCGG CAGG
TCATCCTG AAA GTCGTG CG
G GCCGGCGTA TGCCACACCGAT
ACG CACCTG AGGGAA GGCGG
T TACGACGGGG CACTTG AGC
ATGATT CAG TACCCG ATGG
AG GTA GTCGGCGTCGGCGGGG
GACGTG ACCGGCGAT GTG
CGCCTGATCGGCTGCGGCGAA CGCGAA GGG CACGACCCCGAT
GAA AAG TACCTCGGCAGT
CGC AAG GACCGG GGC GTCCTCGGT CAC GTCGAG AAA GTC TCCGTCCGG GAA ATCTACCCCCTGG TGCCGG CAG TGC AACCGT TGT GCC" GGT GTG GCCCGC TACATCCTT GTT CTA GTG GACATC GAT GGA ATCGAT ACG CTG GCA TGCCACAGCG
CCGTG CTCGAA CCG GAC TTCGGCGCCGGA GCCATCGCG ATC CACCGCAACATT GCCGAA CGCAAC GACATG GGCGCC CCG AGCTGG GCT GCCTCA
GGT CTCACA GCCGACAAG
GTA CTCCCCGAG CCG GTG
GTCATCGGCCTT GGCCTA AC
GCTCCGCGCCCGG GGC TGCGCG GTG GAT GTCCTCA
CA CTG GCCCGCACCAGCAce
GTCCTC U<U ○ Togu<1 Natural■Due to the vortex, 1f? : By artificial mutation, it is possible to mutate part of the structure of the DNA and the structure of the polypeptide derived therefrom without changing the main activity. Therefore, the DNA of the present invention can also contain base sequences encoding polypeptides having structures corresponding to homologous variants of all of the above-mentioned polypeptides.

According to the degeneracy of the genetic code, at least one base in the base sequence of a gene can be replaced with another type of base without changing the amino acid sequence of the polypeptide produced from the gene. Therefore, it is also possible for the DNA of the present invention to have a base sequence altered by substitution based on fc, a genetic code. In this case, the amino acid sequence deduced from the base sequence obtained by the above substitution is defined previously, and the amino acid in formula (I) matches the sequence.

According to the present invention, there is provided a replicable recombinant DNA comprising the above DNA and a replicable expression vector. The recombinant DNA is capable of expressing polypeptides in microorganisms or cells transformed thereby.

Furthermore, according to one aspect of the present invention, there is provided a method for producing ICAD (using a microorganism belonging to the genus Arthrobacterium).

The present invention will be explained in detail below.

The materials used in the present invention can be obtained in the following manner.

[11 N-terminal DNA probe of HCAD This is an inosine-containing probe designed based on the N-terminal amino acid sequence of a purified enzyme (HCAD), and the sequence is as follows.

Probe synthesis was performed by Applied Biosystems (Ap
380A manufactured by plied Biosystems)
The obtained probe DNA was purified using a model DNA synthesizer according to the manufacturer's manual, and the obtained probe DNA was purified according to the manufacturer's manual.
), molecular cloning (Molecular
Cloning).

122, 1982], therefore, it is labeled with T, DNA kinase, and [r-32P]ATP.

(2) Plasmid PKK223-3 containing the taC promoter used for gene expression in E. coli was purchased from Pharmacia Japan Co., Ltd. (catalog number 27).
-4955-01).

(3) Escherichia coli JM-105 used for polypeptide expression
is purchased from Pharmacia Japan Co., Ltd. (Cat. No. 27-1sso-o1).

(4) All other reagents and enzymes used are commercially available.

The microorganism used in the present invention is a microorganism belonging to the genus Arthrobacter, such as Arthrobacter oxidans AK 65-6 (Arthrobacter
cteroxydans A K 65-6 (Feikoken Bacterial Serial No. 943o).

The mycological properties of Arthrobafter oxydans AK65-6 are as follows.

(a) Morphological properties ■Cell shape and size: Short rod, 0.6 x O,
8 to 1 μ■ Presence or absence of cell pleomorphism: Pleomorphism (branching, etc.) ■ Presence or absence of motility: None ■ Presence or absence of spores: None ■ Durham staining: Positive ■ Acid-fast: Negative (b) Culture properties ■ Meat juice agar plate culture: Milky white, creamy, good growth■
Meat juice agar slant culture dual white, creamy, good growth ■ Meat juice liquid culture: white* 0D66G! =, 4% good growth■
Meat juice gelatin puncture culture: liquefaction ■ Lidomus milk: alkaline, 0 (C) Physiological properties ■ Nitrate reduction: negative ■ Denitrification reaction: negative ■ MR test: negative ■ VP test: negative (5) Indole formation : Negative: 6) Production of hydrogen sulfide: Positive ■ Starch hydrolysis dipositive ■ Utilization of citric acid: Positive ■ Utilization of inorganic nitrogen source: Positive [Phase] Production of pigment: Not produced ■ Urease: Negative [Strain] Catalase : Positive O growth temperature and pH = 20-3oc, pH 6.5-
8.0 or: Attitude towards IR element: Aerobic ◎ O-F test: Negative O Presence of generation of acid and gas from sugars: (1) L-arabinose - (2) D-xylose - (3) D-glucose (4) D-mannose (5) D-fructose (6) D-galactose - (7) Maltose - (8) Shochuan (9) Milk
− uO) trehalose − (11) D-nrubinotoshi αZD-mannitol ± (131 inosit − α brown glycerin − +151 starch − This bacterium was isolated from soil, and its chemical classification and physiological test results were as follows. Arthro-bac
ter oxydans).

That is, regarding the amino acid sequence of cell wall peptidoglycan, Uchienbuki et al.

The bacterial fatty acid composition and imprenoid quinone were determined according to the method of Isao Yomoto et al. [Experimental method for identification of actinomycetes 1
The physiological tests were performed using the method of the Japan Actinomycetes Research Society (1985).

Kazuo Komagata et al. [Classification and Identification of Microorganisms (1985)].

Shirling et al. (E, B, Shirling, Int.
, J, 5yst.

BaClerlO1, 16, 513-340 (196
6)], Stackebr et al.
andt, 5yst, Appl.

Microbiol, 4.470-486 (1,9
83)] method.

These results were combined with the test results of existing bacterial strains and literature description [K
,H,5chleifer, O,Kandler,
Bacteriol.

Rev, 34, 407 (1972), K, 5uz
Uki.

K, Komagata, Int, J, 5yst, Ba
cteriol, 33, 188 (1983),
Y, Yamada, G, Inoue, Y, Taha
ra.

H, Oyaizu, K, Komagata, J, G.
en, Appl, Microbiol.

22, 203-214 (1976), M, D, Co1
1ins, J., Appl.

Bacteriol, 52, 457-460 (198
2)], the results showed that Arthrobacter o
xydans and Arthrobac
It was named ter oxydans AK65-6 (
Tables 1 to 4).

Table 2 Physiological test x1 ordinary agar medium, x2 nitric acid, succinic acid medium, r:
Red coat 5 Organic compound assimilation test (Note) w: Weak growth Table 4 Production of acid from sugar Next, a method for producing HCAD using the microorganism will be explained.

The culture of microorganisms belonging to the genus Arthrobacter is carried out at a concentration of 20 to 40 C1, preferably 24 to 40 C1.
It is carried out in the range of 53C. The initial pH of the culture solution is 6.5.
~8.5. Preferably it is 6.8 to 7.5. Culture iK
The carbon source is cyclohexanol, cyclohexanone or their seven combinations, and the nitrogen source is ammonium salt, nitrate 1, for example, ammonium sulfate, ammonium hydrochloride, nitric acid
Inorganic salts such as ammonium phosphate, potassium nitrate, sodium nitrate, and/or nutrient sources such as polypeptone, casamino acids, yeast extract, corn steep liquor meat extract, etc. are added. Inorganic ions include sodium, potassium, magnesium, iron, manganese,
Add M, cobalt, calcium, phosphorus ('71... Chlor, sulfuric acid, etc.) All of these nutritional sources are often used in combination.

After culturing, collect the bacterial cells by centrifugation, filtration, etc.
After being exposed to a pH-adjusted buffer solution, etc.

Homogenize to obtain a centrifuged supernatant containing HCAD.

This centrifuged supernatant liquid is used as a crude enzyme solution, and from this, general enzyme separation and purification methods such as ammonium sulfate method, nucleic acid removal method, ion exchange resin, reverse phase partitioning, affinity, chromatography such as gel filtration, electrolysis, etc. Electrophoresis.

1 (CAD) can be purified by combining an fca reduction method using an ultrapolar membrane or the like.

Next, the properties of HCA'D obtained above will be described.

(a) Action When HCAD acts on 6-hydroxycaproic acid in the presence of a coenzyme, 6-oxocaproic acid is produced. That is, it catalyzes the following reactions.

翰 Optimum pH and pH stability Effect of HCAD measured using buffer solutions of various pH
The H range is pH 6.5 to 10.5. Optimum pH is 8.5~
It is 9.5. HCAD at 4C, each p
When treated with H for 24 hours, pH 5.0-10.5.
Preferably I) H5,5 to 9.5 tD range is stable.

(C) Optimum temperature and temperature stability The working temperature of HCAD measured at various temperatures is 5-60C
, the optimum temperature is 35-50C. HCAD to pH8
, 0 in a buffer solution at each temperature for 20 minutes, it is stable up to 25C.

(d) Molecular weight high performance liquid chromatography (5hodex 803F
) The molecular weight of HCAD determined by gel filtration method is 70,000±2,000. Determined by electrophoresis (containing sodium) -HCAD has a molecular weight of 35,000±2,000.

(e) Isoelectric point, etc. The isoelectric point of HCAD determined by single-point electrophoresis is pH 5.0 ± 0.2.

(f) N-terminal amino acid sequence The N-terminal amino acid sequence of 7jHCAD determined by Edman degradation method is as follows.

Met-His-Ala-Phe-Ala-VaI-L
eu-Pro-Asp-Asp-Pro-Thr-I
1e-)(i 5-Asp-Leu -Glu-Leu
-Pro- (ω) Enzyme activity measurement method The enzymatic activity of HCAD is measured by monitoring the increase in absorbance at 340 nm of the amount of NADHO produced using 6-hydroxycaproic acid as a substrate in the presence of NAD. , 15mM 6-hydroxycaprone 50μj, -L6mNAD S OpL, 50 m
M Tris-HCl buffer (pH 8.5) 235μt and appropriately diluted enzyme solution 5μt were mixed thoroughly and heated at 30C.
The reaction was carried out at The enzymatic activity of CHCAD is 1-10,000 u''''C/11 ng.

Next, a method for cloning and expressing the HCAD gene will be explained.

(11 Earth 0 Bacter (Arthrobacter)
) from microorganisms belonging to the genus (S D S
, 1 ysozyme.

(using RNase A, protein K) and prepare total DNA.

(2) A synthetic probe is designed from the already determined N-terminal amino acid sequence of HCAD, and the probe is synthesized using a DNA synthesizer.

(3) Cut the total DNA obtained in step 11 above with each restriction enzyme, and use the 5-other blotting method,
When the synthetic probe obtained in (2) above was 71 ipridized, it was confirmed that a single band was detected in each lane.

(4) Cut the DNA obtained in (11) above with PstI.

It was inserted into pUC18 vector and packed into Escherichia coli (E, cOli) transformed with the recombinant DNA.

Perform colony hybridization using the above probe.

(5) Analyze the base sequence of the region where HCAD is thought to be encoded on the clone fragment obtained above, and the amino acid sequence determined in advance
'Confirm that the CN-terminal a-terminal amino acid matches.

(6) Next, the DNA encoding HCAD is inserted into an expression vector, the recombinant DNA is expressed in the host, and the HCAD
Check the enzymatic activity of AD.

(Example) The present invention will be explained in more detail below with reference to Examples.

Example 1 Arthrobafter Oxydans AK65-6 (Arth
culture solution 2 with the composition shown in Table S.
Inoculate a jar fermenter with a capacity of 3 containing T.

Culture was carried out at 30C for 24 hours with stirring at 600 rpm.

Table 5 Bactodrypton 10? Yeast extract 57 Salt 5t Cyclohexanol 0.52 Water
1. The pH during culturing is 7 with IN hydrochloric acid.
．． Controlled to 2. At the same time, cyclohexanol was added in accordance with the consumption of cyclohexanol. The total amount of cyclohexanol added is 8? Atsushi. Bacterial cells were collected from the culture solution by centrifugation, and about 502 wet microbial cells were obtained. 5
2 cells in Tris-HCl buffer (pH 8,0) 15m
The cells were suspended at 1K and disrupted for 1 minute at 4.00 Orpm using a Brown cell homogenizer with 1 equivalent volume of glass beads. Centrifuge the crushed material for 30 minutes at 4C and 10,000 l to obtain a supernatant.

After adding streptomycin sulfate to a final concentration of 2% to remove nucleic acids, 50mMIJ-HCl buffer (pH 8) was added.
, 0) overnight to obtain a crude enzyme solution. After concentrating the crude enzyme solution using Seven Tricon (manufactured by Amicon), somM! High performance liquid chromatography (DEAE-5PW) using HCl buffer (pH 8,0)
: 2,2 t-rrIX 15 crn manufactured by Toyo Soda Co., Ltd.) at a flow rate of 5 rnt/min at 280 nm.
HCAD was eluted by a linear concentration gradient of 0 to 0.5 M NaCl while tracking the absorbance of HCAD. Collect the active fraction,
After concentration using 7hodex P (manufactured by Amicon), Sarani and high performance liquid chromatography (5hodex P
H814: 7.511+1 X 7,5 CIIM,
(manufactured by Showa Denko).

When eluted with a linear concentration gradient of ammonium sulfate from 1.8 to OM using 5'OmM Tris-HCl buffer (pH 8.0), the enzyme activity of HCAD was eluted at a position where the ammonium sulfate concentration was approximately OM. When this active fraction was subjected to electrophoresis containing sodium dodecyl sulfate, the molecular weight was approximately 5.
5,000 single bands were observed. In addition, these two fractions were subjected to high performance liquid chromatography (5hodex 80
3F: 8; ox 30z, manufactured by Showa Denko), the active fraction of HCAD had a molecular weight of approximately 70,000.
The enzyme activity was eluted at 125 u/+
The N-terminal amino acid sequence of the purified enzyme of the present invention was analyzed using an amino acid sequencer (manufactured by Applied Biosystems), and the sequence was found to be as shown below.

Met-His-Ala-Phe-Ala-Val-L
eu-Pro-Asp-Asp-Pro-Thr-I
I e-) (i 5-Asp-Leu -Glu-L
eu-Pro Example 2 Arthrobafter Oxydans AK65-6 (Feikoken Bibori No. 9430) was added to 1007 cyclohexanol 5
With a culture solution having the composition shown in Table 5 of Example 1 containing 0 μ2,
The cells were cultured at 60C for 18 hours to obtain bacterial cells. After washing the bacterial cells,
Bacteria were lysed using 160 m9 of lysozyme, 2 mty of protease, and 10% sD3 solution, and phenol extraction, phenol/chloroform extraction, and inopropatol extraction were repeated.

Finally, ethanol precipitation was performed to obtain total DNA.

N-terminal amino acid sequence from 1st to 11th of HCAD (Met
-HIs-AJa-Phe-AJa-Val-Leu-
Based on the DNA synthesis material (Pro-Asp-Asp-Pro), a synthetic glove with the following sequence containing inosine was added to the DNA synthetic material (Pro-Asp-Asp-Pro).
Applied Biosystems) and purified using high performance liquid chromatography.

T T ATGCA GCITT GCIGTI TICC
IGATGATCCCCCCCC (Note) I: Inosine probe is T, -kinase and "-"[))ATp
was used for experiments after labeling at 32p.

The total DNA obtained as above was digested with four types of restriction enzymes (Hindlll, EcoRI, BamHI, P
stI) and hybridization was performed using the above probe, a single band was detected in each lane. The total DNA was cut with Pstl, subjected to 1-thiagarose gel electrophoresis, and 3-dK was extracted from the gel.
DNA near b was collected, integrated into the Pst■ site of pUC-18, and introduced into E. coli (MB6S).

In order to obtain a clone containing the target DNA fragment and the friend plasmid, hybridization was performed using the above probe into a colony, which resulted in approximately 8 oo.

Fifteen target clones were obtained from each colony.

Analysis of this clone revealed that approximately 3.2 Kb of Ps
ti fragment, of which Hindll[, 5tu(
It was found that the fragment contained a region that hybridized with the probe. The method of Sanger et al. [:S
angel F, etc.

al,, Proc, Natl, Acad, Sci, U
S A 74, 5463 (1977)) KL, and therefore the DNA base sequence was determined. The amino acid sequence obtained in this way and translated from the friend base sequence and the N-terminal amino acid sequence of HCA obtained in Example 1 completely matched, and this base sequence encodes HCAD. It was confirmed that it was DNA.

Example 3 The purpose was to express a polypeptide having the amino acid sequence of HCAD from DNA encoding HCAD in Escherichia coli using tac as a promoter.

Construct the plasmid.

As shown in Figure 1, plasmid 1) AHCAD 20
μ2 with 10 units of Hlndllll and BamHI
Digested at 37C for 2 hours, 1.0% Low Melt
Bin encoding h-PCI with approximately 1.3 base pairs was detected by agarose (manufactured by BRL) electrophoresis of ing Port.
d [[-Isolate the BamHI fragment. A fragment of about 4 μm is electrically eluted from the gel. Furthermore, a 1.2 Kb base pair was isolated by partial digestion with BstN (approximately 2 μ?
).

By a method similar to that described above, two deoxyoligonucleotides shown in FIG.
TGCACCGCCACCACCCC-3' and 5'-
GGGGGTGGTGGCGGTGCATG-3' is synthesized, and the 5' end of about 100 Pmol of each deoxyoligonucleotide is phosphorylated using T4 kinase. After completion of the reaction, the reaction mixture is extracted with phenol and then with chloroform, and the oligomer is combined with a SmaI fragment of about 2 base pairs of about 1 μm.

Under commonly used conditions, 10 units of T,
The above fragments are ligated with DNA ligase by reacting overnight at 4C. After the reaction completed solution was precipitated with ethanol, 20 units of ECORI was used to produce 37 tons? , digested for 3 hours, 1% L
ow Melting Point agarose electrophoresis to isolate fragments of approximately 1 to 1 base pair pair. Using the commercially available plasmid PKK225-31/jr with EcoRi
, Bam) II, phenol extraction, 'chloroform extraction, and ethanol precipitation to prepare a 0.5 μt vector, a fragment containing EcoRI sites at both ends containing the HCAD structural gene of about IK base pairs was added to T4D.
Bind using NA IJ gauze. Experiment book [Method in Enzymology]
nzymology) Volume 101, Page 20.

Academic Press
E. coli strain JM105 was transformed according to the method published by J.D.), and cultured on an agar medium containing 50 .mu.2/- ampicillin to obtain about 300 colonies. Plasmid DNA was prepared from 50 of these transformants and digested with EcoRj, resulting in 6 of them containing the desired EcoR of about 1 base pair.
It contained the I fragment. For analysis of base sequences.

These six plasmids are identical; the tac promoter,
It was confirmed that the synthetic NA and cDNA had the desired nucleotide sequence in that order.

E. coli strain Esch containing the plasmid obtained above
Erichia coli pAHCAD at 50μF/
- Cultured overnight at 37C in LB medium 50 - containing ampicillin, transferred to 1 t of the same medium, and further cultured for 2 hours. Isopropyl β-lowthiogalactopyranoside (Sigma) was added to a final concentration of 1 mM, culture was continued for an additional 8 hours, cooled to 1 L, and the bacterial strain was collected by centrifugation. The bacterial cells are collected by cold centrifugation, suspended in 0.04 MIJ hydrochloric acid buffer (pH 7,8) 500-S, then disrupted by ultrasonication, and subjected to cold centrifugation to obtain a bacterial protein solution. In addition.

Since Escherichia coli pAHCAD is outside the range of microorganisms that can be deposited, we received a letter of refusal to accept the deposit.

Plasmid PKK223- which does not have HCAD DNA
E. coli containing 3 was cultured in the same manner, and using the resulting bacterial protein solution as a control, it was assayed whether this bacterial cell had HCAD i-prime activity. That is, 15mM6
-Hydroxycaproic acid 30μi, 1.6mM N
AD 50 μl, 50mM Tris-HCl buffer (
+) H8,5) 235μt and 5μt of bacterial cell protein solution were mixed well, reacted at 50C, and
The absorption enhancement port at 0 nm was measured.

As a result, no enzyme activity was detected in the control bacterial protein solution, but strong enzyme activity was detected in the bacterial protein solution prepared from E. coli containing the t plasmid obtained above.

[Brief explanation of the drawing]

Figure 1 shows high performance liquid chromatography (high performance liquid chromatography) of the enzyme of the present invention.
FIG. 2 is a schematic diagram showing the results of electrophoresis of the enzyme of the present invention containing dodecyl sulfate (DEAE-5PW). FIG. 3 is a flow sheet showing a method for preparing pHCAD, a recombinant DNA encoding the HCAD polypeptide of the present invention. Standard protein phosphorylase b -1 - Live blood groove albuminosis - Ovalbumycin - Carponic acid) Hydrolase - - Major trypsysis inhibitor - Calcium - Lactoalbumin') To 1 Fig. Purified protein - Monomolecular weight 35,000

Claims (5)

[Claims] (1) Enzyme a, which has the following properties and dehydrogenates 6-hydroxycaproic acid to convert it to 6-oxocaproic acid, in a Tris-HCl buffer (0.0
The optimum reaction temperature in 5M) is 35-50°C b, and the optimum pH is 8.5-9.5 when measured in Tris-HCl buffer (0.05M) at 45°C, in buffer at 4°C. Stable in the pH range of 5.0 to 10.5d, Stable up to 25°C in Tris-HCl buffer (0.05M) at pH 8.0, Molecular weight 35,000± as measured by SDS polyacrylamide electrophoresis 2,000 Dalton f, molecular weight measured by gel filtration is 70,000 ± 2,000 Dalton g, isoelectric point is pH 5.0 ± 0.2 h, N-terminal amino acid sequence is as shown below [gene sequence is available] ] i,6-hydroxycaproic acid dehydrogenase activity is 1mg
1 to 10,000 units per unit (2) Amino acid sequence represented by the following formula [There is a gene sequence] The enzyme according to claim 1, which has the following. (3) DNA consisting of a base sequence encoding 6-hydroxycaproic acid dehydrogenation having the amino acid sequence represented by the following formula (there is a gene sequence). (4) The DNA according to claim 5, which comprises at least one base sequence selected from the group consisting of a base sequence represented by the following formula (there is a gene sequence) and a base sequence complementary to the base sequence. (5) A microorganism belonging to the genus Arthrobacter is cultivated, and an enzyme having the following characteristics and capable of dehydrogenating 6-hydroxycaproic acid and converting it into 6-oxocaproic acid is collected from the bacterial cell. A method for producing 6-hydroxycaproic acid hydrogen enzyme. a, Tris-HCl buffer (0.0
Optimum reaction temperature in 5M) is 35-50°C b, optimal pH measured in Tris-HCl buffer (0.05M) at 45°C is 8.5-9.5c, buffer at 4°C stable in the pH range of 5.0 to 10.5, stable up to 25°C in pH 8.0 Tris-HCl buffer (0.05M), molecular weight 35,000 as measured by SDS polyacrylamide gel electrophoresis. ±2,000 Dalton f, molecular weight measured by gel filtration is 70,000 ±2,000 Dalton g, isoelectric point is pH5.0±0.2 h, N-terminal amino acid sequence is as shown below [gene sequence is Yes. ] i,6-hydroxycaproic acid dehydrogenase activity is 1mg
1 to 10,000 units per unit