JP7828636B2 - Diabetes improvement drugs - Google Patents

Description

This invention relates to a TNFα production inhibitor and diabetes treatment agent characterized by the combined use of a toothpaste containing barley, Rhodiola rosea, and Water Shield, and a mouthwash containing barley, Rhodiola rosea, and Water Shield.

Tumor Necrosis Factor α (TNFα) was identified as a cytokine with cytotoxic activity against cancer cells, but it is also known to have various other effects, including immune regulation, angiogenesis, and apoptosis induction (Non-Patent Literature 1). Because TNFα exhibits diverse physiological activities as an inflammatory mediator, it is thought to be involved in the pathogenesis of many diseases, and its involvement in diabetes is also known (Non-Patent Literature 2).

TNFα is produced by immune cells such as macrophages and hypertrophied adipocytes, and acts on muscles and the liver to impair insulin action, i.e., cause insulin resistance, which is involved in the development of diabetes (Non-Patent Literature 3). More recently, the relationship between periodontal disease and diabetes has been clarified, and it is thought that TNFα produced in periodontal tissues in patients with periodontal disease circulates in the bloodstream, inducing insulin resistance in various tissues and leading to the development of diabetes (Non-Patent Literature 4).

Since TNFα is widely involved in the development of various inflammatory diseases, including diabetes, foods and pharmaceuticals that suppress TNFα production have been proposed. For example, a composition for suppressing TNFα or IL-6 production containing turmeric extract (Patent Document 1) and a TNFα and IL-6 production inhibitor containing black ginger extract as an active ingredient (Patent Document 2) have been disclosed. Furthermore, a toothpaste combining barley, Rhodiola rosea, and Water Shield has been disclosed to exhibit excellent periodontal disease-improving effects, including TNFα production suppression (Patent Document 3).

We discovered an extremely effective effect in suppressing TNFα production in the oral cavity by using toothpaste containing barley, Rhodiola rosea, and Water Shield in combination with a mouthwash also containing barley, Rhodiola rosea, and Water Shield. Furthermore, we found an extremely effective blood glucose-lowering effect by using toothpaste containing barley, Rhodiola rosea, and Water Shield in combination with a mouthwash containing the same ingredients. While toothpaste containing barley, Rhodiola rosea, and Water Shield is known, it was completely unknown that using toothpaste and mouthwash containing these ingredients together suppresses TNFα production and lowers blood glucose levels. Moreover, it was completely unknown that this effect is significantly superior to using each ingredient individually.

Patent No. 6709001 Patent No. 6954960 Japanese Patent Publication No. 2017-222579

Japanese Journal of Pharmacology, 2003, 121, 163-173 Diabetes, 2011, 54(7), 476-479 Journal of the Japanese Society of Internal Medicine, 2016, 105(9), 1543-1557 Journal of the Japanese Society for Food Science and Technology, 2017, 50(5), 213-215

The present invention aims to provide a TNFα production inhibitor and diabetes treatment agent characterized by the combined use of a toothpaste containing barley, Rhodiola rosea, and Water Shield, and a mouthwash containing barley, Rhodiola rosea, and Water Shield.

The inventors of this invention have completed the present invention by discovering that using a toothpaste containing a combination of barley (belonging to the genus Barley of the grass family), Rhodiola rosea (belonging to the genus Bacillus of the oleander family), and Water lily (belonging to the genus Water lily of the water lily family) in combination with a mouthwash containing barley, Rhodiola rosea, and Water lily exhibits extremely excellent TNFα production inhibitory effects and blood glucose lowering effects.

The barley (Hordeum vulgare L.) used in this invention belongs to the genus Hordeum in the family Poaceae (grass family) and is an annual or perennial grass widely distributed mainly in the temperate regions of the Northern Hemisphere, South America, and South Africa. Barley is classified into two-row barley, four-row barley, six-row barley, naked barley, and wild barley based on differences in the shape of the inflorescence, but all of these can be used in this invention. Furthermore, barley with, for example, purple, black, or white (non-colored) glumes or caryophylls can also be used. In some cases, barley with colored stems and leaves can also be used in this invention. The parts of the barley used are not particularly limited, but examples include the entire plant, organs (flowers, leaves, stems, roots, bark, fruits, pericarp, or seeds, or mixtures thereof), and the use of stems, leaves, and seeds is particularly preferred.

The Apocynum venetum L. used in this invention belongs to the genus Apocynum in the family Apocynaceae and is a perennial herb that mainly grows wild in northwestern China. While any part of the Apocynum venetum, such as the leaves, stems, and roots, can be used, the leaves are particularly preferred.

The water shield (Brasenia schreberi J.F.G mel.) used in this invention belongs to the genus Brasenecio in the family Nymphaeaceae and is a perennial aquatic plant widely distributed from temperate to tropical regions. While any part of the water shield, such as the leaves, stems, or roots, can be used, it is particularly preferable to use buds or young leaves covered in a mucilaginous substance.

The barley, Rhodiola rosea, and Water Shield used in this invention may be used as whole plants or parts/organs of the plants, or they may be processed by drying, grinding, or shredding. Alternatively, an extract using a solvent may be used. For extraction, the whole plants or parts/organs of the plants may be used as is, or they may be dried, ground, or shredded before extraction. Examples of solvents for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used individually or in combination of two or more. Preferably, polar solvents such as water and lower alcohols are used, and water is particularly preferred.

The extract may be used as is, or, if necessary, after treatment such as concentration, dilution, filtration, decolorization with activated carbon, deodorization, or ethanol precipitation. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, or freeze-drying, and used as a dried product.

The content of the above extract in toothpaste and mouthwash varies depending on the intended use, age, weight, etc., but is generally 0.00001 to 10% by weight, more preferably 0.0001 to 1% by weight. Furthermore, the solid content of the extract is preferably 0.01 μg to 1 mg per day. In some cases, a smaller amount than the above range may be sufficient, while in other cases, it may be necessary to include a larger amount.

The toothpaste and mouthwash used in this invention may use the above extract as is, or may contain other components as long as they do not impair the effects of the extract. These other components may be solids, liquids, or semi-solids, and may include, for example, abrasives, foaming agents, humectants, moisturizers, and other medicinal components. Furthermore, in addition to vitamins, minerals, and amino acids, surfactants such as glycerin fatty acid esters and sucrose fatty acid esters, sweeteners such as sucrose, glucose, fructose, stevia, saccharin, and sucralose, and acidulants such as citric acid, malic acid, and gluconic acid may be appropriately included.

This invention provides an extremely effective TNFα production inhibitor and diabetes treatment agent.

Examples are given to illustrate the present invention in detail, but the present invention is not limited thereto. The percentages of content shown in the examples are in weight percentages.

The following shows examples of solvent extract preparation using barley, Rhodiola rosea, and Water Shield.

Production Example 1: Hot Water Extract of Barley 25 g of crushed barley seeds was added to 500 mL of purified water and extracted at 95-100°C for 2 hours. The filtrate was concentrated under reduced pressure and freeze-dried to obtain 2.1 g of hot water extract of barley.

Production Example 2: 50% Ethanol Extract of Barley 25 g of crushed barley seeds were mixed with 500 mL of 50 (v/v) ethanol and extracted at room temperature for 5 days. The filtrate was concentrated to dryness under reduced pressure to obtain 0.9 g of 50% ethanol extract of barley.

Manufacturing Example 3: Barley Ethanol Extract 100 g of crushed barley seeds was mixed with 1 L of ethanol and extracted at room temperature for 7 days. The filtrate was concentrated to dryness under reduced pressure to obtain 3.1 g of barley ethanol extract.

Production Example 4: Hot Water Extract of Apocynum venetum. 150 g of dried Apocynum venetum leaves were added to 10 L of purified water and extracted at 95-100°C for 2 hours. The filtrate was concentrated under reduced pressure and freeze-dried to obtain 11.5 g of hot water extract of Apocynum venetum.

Manufacturing Example 5: 50% Ethanol Extract of Apocynum venetum. 100 g of dried Apocynum venetum leaves were added to 3 L of 50 (v/v) ethanol and extracted at room temperature for 5 days. The filtrate was concentrated to dryness under reduced pressure to obtain 5.5 g of a 50% ethanol extract of Apocynum venetum.

Manufacturing Example 6: Ethanol Extract of Rhodiola rosea. 200 g of dried Rhodiola rosea leaves were added to 1 L of ethanol and extracted at room temperature for 7 days. The filtrate was concentrated to dryness under reduced pressure to obtain 8.3 g of ethanol extract of Rhodiola rosea.

Manufacturing Example 7: Hot Water Extract of Water Shield 2000 g of dried young leaves of water shield were added to 20 L of purified water and extracted at 95-100°C for 2 hours. The filtrate was concentrated under reduced pressure and freeze-dried to obtain 35.2 g of hot water extract of water shield.

Production Example 8: 50% Ethanol Extract of Water Shield 1000 g of dried young leaves of water shield were added to 8 L of 50 (v/v) ethanol and extracted at room temperature for 5 days. The filtrate was concentrated to dryness under reduced pressure to obtain 15.7 g of 50% ethanol extract of water shield.

Manufacturing Example 9: Ethanol Extract of Water Shield 200 g of dried young leaves of water shield were added to 1 L of ethanol and extracted at room temperature for 7 days. The filtrate was concentrated to dryness under reduced pressure to obtain 2.7 g of water shield ethanol extract.

Next, examples of toothpaste and mouthwash formulations according to the present invention are given, but the present invention is not limited thereto.

Prescription Example 1: Toothpaste Prescription Content (%)
1. Calcium hydrogen phosphate 22.0
2. Sodium lauryl sulfate 1.5
3. Tranexamic acid 0.03
4. Dipotassium glycyrrhizinate 0.02
5. Isopropylmethylphenol 0.1
6. Cetylpyridinium chloride 0.05
7. Hot water extract of barley (production example 1) 0.001
8. Hot water extract of Apocynum venetum (Production Example 4) 0.001
9. Hot water extract of water shield (production example 7) 0.001
10. Glycerin 20.0
11. Carrageenan 0.9
12. Sodium saccharin 0.001
13. Fragrance 1.0
14. Sodium benzoate 0.5
15. Dilute the total volume with water to 100. [Manufacturing Method] After thoroughly mixing ingredients 3 to 15, add ingredients 1 to 2 and knead, then remove foam and fill into tubes to obtain toothpaste. Use 1g at a time, 3 times a day.

In the conventional toothpaste formulation example 1, the hot water extracts of barley, rhodiola rosea, and water shield were all removed, and the total volume was adjusted to 100% with water to create the conventional toothpaste.

Prescription Example 2: Mouthwash - Formula - Content (%)
1. Barley hot water extract (production example 1) 0.01
2. Hot water extract of Apocynum venetum (Production Example 4) 0.01
3. Hot water extract of water shield (production example 7) 0.01
4. Tranexamic acid 0.03
5. Dipotassium glycyrrhizinate 0.02
6. Cetylpyridinium chloride 0.05
7. Glycerin 10.0
8. Sodium saccharin 0.1
9. Fragrance 0.1
10. Polyoxyethylene hydrogenated castor oil (60 E.O.) 1.5
11. Ethyl parahydroxybenzoate 0.1
12. Dilute the total volume with water to 100. [Manufacturing method] Dissolve components 1 to 11 in component 12 and mix well to obtain mouthwash. Use 10 mL at a time, three times a day.

In the conventional mouthwash formulation example 2, the hot water extracts of barley, rhodiola rosea, and water shield were all removed, and the total volume was adjusted to 100% with water to create the conventional mouthwash.

Test Example 1: TNFα Production Inhibition Test Human gingival fibroblasts (HGF) were cultured in αMEM containing 10% fetal bovine serum. To the confluent HGF, periodontal disease bacteria-derived lipopolysaccharide (PG-LPS) was added to a concentration of 1 μg/mL. Simultaneously with the addition of PG-LPS, a hot water extract of barley (Production Example 1), apocynum venetum (Production Example 4), aquatic plantago-aquatica (Production Example 7), or an equal mixture of barley, apocynum venetum, and aquatic plantago-aquatica was added to a concentration of 300 μg/mL. After culturing, the cells were harvested and TNFα gene expression was evaluated by real-time PCR. Glyceraldehyde-3-phosphonate dehydrogenese (GAPDH) was used as the internal standard. The gene expression levels of barley, Rhodiola rosea, and Water Shield were set to 1, and the gene expression ratios were calculated.

Primer set for TNFα GCAGGTCTACTTTGGGATCATTG (sequence 1)
GCGTTGGGAAGGTGGAT (array 2)
Primer set for GAPDH TGGAGAAACCTGCCAAGTATG (sequence 3)
CCCTCAGATGCCTGCTTCA (array 4)

The results of Test Example 1 are shown in Table 1. The TNFα gene expression elevated by PG-LPS was suppressed by the addition of barley hot water extract (Production Example 1), Apocynum venetum hot water extract (Production Example 4), and Water Shield hot water extract (Production Example 7), but the effect was limited. In contrast, the combination of barley hot water extract, Apocynum venetum hot water extract, and Water Shield hot water extract significantly suppressed the TNFα gene expression elevated by PG-LPS.

Test Example 2 Human Efficacy Study 72 individuals with normal high-normal fasting blood glucose levels (100 mg/dL to 125 mg/dL) or borderline diabetes were divided into 6 groups of 12. The Example group used toothpaste from Formula Example 1 and mouthwash from Formula Example 2 in combination. Comparative Example 1 group used conventional toothpaste and conventional mouthwash in combination. Comparative Example 2 group used toothpaste from Formula Example 1 and conventional mouthwash in combination. Comparative Example 3 group used conventional toothpaste and mouthwash from Formula Example 2 in combination. Comparative Example 4 group used toothpaste from Formula Example 1, and then used the same toothpaste again immediately afterward. Comparative Example 5 group used mouthwash from Formula Example 2, and then used the same mouthwash again immediately afterward. Toothpaste was used three times a day, after each meal, and mouthwash was used immediately after using toothpaste. Comparative Example 4 group used toothpaste three times a day, twice consecutively after each meal. Comparative Example 5 group used mouthwash three times a day, twice consecutively after each meal. Saliva and blood samples were collected before the start of the study and three months later, and salivary TNFα levels and blood glucose levels were measured. The TNFα results are shown as a percentage of the pre-study value (set as 100%). The blood glucose results show the change (mg/dL) from pre-study to three months later.

Table 2 shows the results of Test Example 2. In Comparative Example 1, which did not contain the extract, there was only a slight change in both salivary TNFα levels and blood glucose levels. In Comparative Examples 2 and 3, which contained the extract in either the toothpaste or the mouthwash, a decrease in salivary TNFα levels and a reduction in blood glucose levels were observed, but the effect was limited. In Comparative Example 4, which used toothpaste containing the extract twice in succession, a decrease in salivary TNFα levels and a reduction in blood glucose levels were observed, but the effect was limited. In Comparative Example 5, which used mouthwash containing the extract twice in succession, there was only a slight change in both salivary TNFα levels and blood glucose levels. On the other hand, in the Example group, which used both toothpaste and mouthwash containing the extract in combination, a significant decrease in salivary TNFα levels and a significant reduction in blood glucose levels were observed. From these results, it became clear that the excellent reduction in salivary TNFα and the excellent reduction in blood glucose levels are only achieved when mouthwash containing the extract is used immediately after toothpaste containing the extract.

From the above, the combined use of toothpaste containing barley, Rhodiola rosea, and Water Shield with a mouthwash containing barley, Rhodiola rosea, and Water Shield demonstrated extremely excellent TNFα production inhibitory effects and blood glucose level lowering effects. Therefore, it was found that the present invention can be used as a TNFα production inhibitor in the oral cavity and blood, and further as a diabetes treatment agent.

Claims (2)

A combination agent for inhibiting TNFα production, comprising toothpaste containing barley, Rhodiola rosea, and Water Shield, and a mouthwash containing barley, Rhodiola rosea, and Water Shield. A combination agent for improving diabetes, comprising toothpaste containing barley, rhodiola rosea, and water shield, and a mouthwash containing barley, rhodiola rosea, and water shield.