JP7468842B2 - Pesticide composition for controlling plant diseases and method for controlling plant diseases using the same - Google Patents

Description

NPMD NITE P-02838 NPMD NITE P-02835 NPMD NITE P-02836 NPMD NITE P-02837

The present invention relates to an agricultural chemical composition for controlling plant diseases in target plants, which contains a filamentous fungus of the genus Thielavia.

Chemical pesticides have been used mainly to control pests in crop production, and have been very effective. In particular, soil fumigants are mainly used to control soil diseases that cause great economic damage and are difficult to control. However, there is a growing international movement to restrict the use of soil disinfectants, not only from the perspective of simplifying the farmland ecosystem through long-term continuous use, but also from the perspective of the impact on worker health and the surrounding environment, and in the future, efforts to reduce excessive use of disinfectants will become important in Japan as well. Against this background, there is a global trend to develop new control techniques to replace the use of chemical substances to control soil diseases, and biological control techniques using natural microorganisms are attracting attention as one such new control technique. Some biological control techniques have already been developed and commercialized as microbial pesticides, but there are still few registered microbial pesticides for soil diseases, and there is a strong demand in the field for more effective new control agents and microbial pesticides that can be used as control methods.

As described above, while chemical pesticides such as soil fumigants have been mainly used to control soil diseases of vegetables, biological control using microorganisms has been limited to a few diseases such as crown gall and soft rot, and has not been widely used. Here, as a serious soil-borne disease, for example, there is yellowing disease caused by infection of Chinese cabbage with Verticillium genus fungi. When Chinese cabbage is infected with yellowing disease, the outer leaves first wilt, turn yellow-brown in a V-shape, wither, and the leaves become easy to detach. After that, these symptoms progress rapidly, and the plant becomes wilted and grows poorly, and finally the head leaves open outward severely, resembling a cabbage cabbage, and the vascular parts of the stems and leaves change color from yellowish brown to blackish brown. Therefore, in the domestic cultivation of Brassicaceae plants such as Chinese cabbage, diseases caused by Verticillium genus fungi are known as one of the important diseases that should be controlled. In response to this, for example, Patent Document 1 (JP-A-2003-231606) discloses that a microorganism belonging to the genus Pseudomonas vietnamiensis has a control effect against Verticillium disease.
Furthermore, Patent Document 2 (JP 2006-176533 A) discloses that certain bacteria belonging to the genus Bacillus (Bacillus 111ts) have a control effect against soil-borne diseases, and Patent Document 3 (JP 2015-039359 A) discloses that photosynthetic bacteria, namely, Rhodopseudomonas and Bacillus genus bacteria, have a control effect against soil-borne diseases.
However, there are currently no microbial pesticides that utilize biological control techniques using microbial species and strains that can control diseases caused by Verticillium genus fungi, such as yellows disease, which is targeted at Brassicaceae plants such as Chinese cabbage.

JP 2003-231606 A JP 2006-176533 A JP 2015-039359 A

Verticillium disease is one of the soil diseases that is difficult to predict, so soil disinfection with soil fumigants is often performed on a schedule, but from the viewpoints of cost, labor, and environmental conservation, it is preferable to take measures without doing so as much as possible. In addition, for example, there is a known problem that there is no Chinese cabbage variety that shows complete resistance to Chinese cabbage yellowing disease, which is one of the Verticillium diseases, and there are few disease-resistant varieties. Furthermore, since Verticillium bacteria can survive in soil for a long time and parasitize many crops, once the disease occurs, crop rotation becomes difficult.
Therefore, an object of the present invention is to provide a microbial pesticide which is capable of effectively controlling soil-borne diseases while placing less strain on the environment.

In the course of various investigations aimed at solving the above problems, the inventors discovered that there is soil in which soil-borne diseases, particularly Chinese cabbage yellowing disease, are unlikely to occur. They then identified gene bands that appear specifically in that soil, and isolated a Thielavia filamentous fungus from the genetic information. They then discovered the unexpected effect that this isolated Thielavia filamentous fungus not only suppresses Chinese cabbage yellowing disease caused by filamentous fungi in the soil, but also contributes to promoting the growth of target plants, and as a result of their intensive research, they have completed the present invention.

That is, the present invention is as follows.
[1] An agrochemical composition for controlling plant diseases in a target plant, comprising a filamentous fungus of the genus Thielavia.
[2] An agrochemical composition for controlling plant diseases and promoting plant growth in a target plant, comprising a filamentous fungus of the genus Thielavia.
[3] The pesticide composition according to [1] or [2] above, wherein the plant disease is caused by a plant pathogenic filamentous fungus.
[4] The pesticide composition according to [3] above, wherein the plant pathogenic filamentous fungus is selected from the group consisting of fungi of the genus Verticillium and fungi of the genus Fusarium.
[5] The pesticide composition according to any one of [1] to [4] above, wherein the plant disease is selected from the group consisting of yellows, verticillium wilt, verticillium wilt, and wilt.
[6] The pesticide composition according to any one of [1] to [5], which reduces the number of diseased plants of a target plant to 60% or less, based on 100% of the number of diseased plants in a case where the pesticide composition is not applied.
[7] A pesticide composition for promoting the growth of a target plant, comprising a filamentous fungus of the genus Thielavia, which brings about an increase in the yield of the target plant of 120% or more in mass terms, based on the yield of the target plant when the pesticide composition is not applied being 100%.
[8] The pesticide composition according to any one of [1] to [7] above, wherein the target plant is Chinese cabbage.
[9] A method for controlling plant diseases and/or promoting plant growth, comprising a step of applying the pesticide composition according to any one of [1] to [8] to soil or a medium.
[10] The method for controlling plant diseases and/or promoting plant growth according to [9] above, comprising a step of applying the pesticide composition to soil or a medium before planting a target plant.

The present invention can provide a novel pesticide composition that contains a microorganism as an active ingredient, which has a low environmental impact and can effectively control soil-borne diseases.

This is a photograph showing the fungal band patterns based on the PCR-DGGE method for each soil DNA sample from a field (area C) that shows disease suppression. As a control, the band patterns of samples derived from soil from a field (area A) where yellows disease occurs are also shown. M indicates the marker lane. (a) is a photograph showing the band position on DGGE of the filamentous fungus S69 strain, which corresponds to the characteristic band (Metrix 29.8) in the band pattern of the fungus isolated from the soil of the field exhibiting disease suppression, and (b) is a photograph showing a colony of the filamentous fungus S69 strain on PDA medium and ascospores on the colony. 1 shows a phylogenetic tree (NJ method) based on the base sequences in the ITS region of the rRNA gene of bacteria of the genera Chaetomium, Madurella, and Thielavia, and the S69 strain. (a) is a photograph showing the mycelium morphology of a dual culture of the yellow spot fungus and the S69 strain on PDA medium (after 15 days of culture). (b) is a photograph showing the mycelium morphology of the yellow spot fungus at the colony boundary of the yellow spot fungus and the S69 strain in dual culture on PDA medium (after 15 days of culture). Granular mycelium (arrow) stands out (the arrow indicates presumably dead cells). The phylogenetic tree (NJ method) based on the base sequences in the ITS region of the rRNA gene of other isolated strains exhibiting properties similar to those of the S69 strain is shown. These are photographs showing the bacterial colony morphology of the KT1-1 strain when cultured in confrontation with the J1 strain (right plate: black bacterial colony on the left) and the bacterial colony morphology when only the KT1-1 strain was cultured (left plate: control). 1 is a graph showing the bacterial colony diameter (after 5 days of culture) of the S69 strain on PDA plate medium at different culture temperatures. (a) and (b) show the effect of suppressing the onset of yellows in Chinese cabbage seedlings transplanted into pots containing S69 cultured bran ((b) shows the results of the meta-analysis of (a)). (c) shows the effect of promoting the growth of Chinese cabbage seedlings transplanted into pots containing S69 cultured bran (mean mass per Chinese cabbage leaf; bars indicate standard error).

The present invention relates to an agrochemical composition containing a Thielavia fungus, which is a live fungus that is effective in controlling plant diseases of target plants, particularly Brassicaceae plants. The agrochemical composition of the present invention can be used not only for controlling plant diseases but also for promoting plant growth.

<Thielavia genus fungi>
The Thielavia filamentous fungus contained in the agrochemical composition for controlling plant diseases of the present invention is not particularly limited in species, as long as it has the ability to suppress the infection or proliferation of plant pathogenic bacteria or fungi.For example, Thielavia terricola or Thielavia hyrcaniae and their related species can be mentioned.In addition, two or more kinds of Thielavia filamentous fungus may be used in combination.The biosafety level of Thielavia filamentous fungus is 1.

The Thielavia filamentous fungus contained in the agrochemical composition of the present invention may be, for example, one isolated by the following method. First, 1 g of soil showing suppressive properties against Chinese cabbage yellows disease is thoroughly suspended in 20 ml of 10 mM phosphate buffer (pH 7.0), serial dilutions of the suspension are smeared on a Rose Bengal agar plate, and then cultured at 25°C for one week. The filamentous fungal colonies that appear after culture are randomly separated, and some of them are further subjected to repeated single hyphae separation. The isolated strains obtained are cultured on a PDA plate containing 50 ppm kanamycin, and strains that are considered to be closely related to Thielavia fungi are selected based on the morphology of the ascospores and ascospores that appear. The DNA of each selected strain is extracted, and the species is identified based on the base sequence information of the rRNA gene ITS region of these strains according to a conventional method. Based on the base sequence information of each strain obtained, a phylogenetic analysis is performed by the neighbor-joining method (NJ method) based on the results of multiple alignment analysis using Mega (Ver. 6). As a result, among the selected strains, a strain belonging to the genus Thielavia can be appropriately used as the filamentous fungus of the genus Thielavia of the present invention.
Furthermore, for example, the Thielavia filamentous fungus of the present invention can be cultured in a confrontation with the yellowing fungus on PDA medium, and the degree of inhibition of hyphal growth of the yellowing fungus at the confrontation site can be confirmed, allowing the selection of a filamentous fungus with strong yellowing disease control ability.

In the present invention, it is particularly preferable to use the S69, I1, J1, and K1 strains selected by the method shown in the Reference Examples described below among the Thielavia filamentous fungi. All of the S69, I1, J1, and K1 strains have been deposited at the National Institute of Technology and Evaluation Patent Microorganisms Depositary Center, and receipts were issued for all strains on the same day (notification date: December 5, 2018), and the following accession numbers were assigned to each strain.
S69 strain: Accession number NITE P -02838
I1 strain: Accession number NITE P -02835
J1 strain: Accession number NITE P -02836
K1 strain: Accession number NITE P -02837
As shown in the Reference Examples below, these strains are presumed to be closely related to Thielavia terricola or Thielavia hyrcaniae.

The Thielavia filamentous fungus contained in the pesticide composition of the present invention can be obtained by culturing it by a conventionally known standard method. For example, the Thielavia filamentous fungus can be cultured in a medium in which it can grow, and the fungus can be collected by a means such as centrifugation. Specifically, the fungus can be obtained by culturing it by a conventionally known standard method such as culture on materials such as bran, stationary culture on a solid medium, liquid culture, reciprocating shaking culture, jar fermenter culture, culture in a culture tank, liquid culture, solid culture, etc. The medium for culturing the Thielavia filamentous fungus used in the present invention is not particularly limited as long as it allows the fungus to grow efficiently, but it is preferable that the growth amount reaches its maximum at 15 to 45 ° C, and more preferably that the growth amount reaches its maximum when cultured at 25 to 42 ° C. The growth time of the Thielavia filamentous fungus can be appropriately adjusted while checking the growth state of the fungus. Examples of media for culturing the Thielavia filamentous fungi used in the present invention include synthetic or natural media, such as bran medium, that contain glucose or sucrose as a carbon source, nitrates or ammonium salts as a nitrogen source, and sodium salts, potassium salts, or magnesium salts as inorganic salts. In addition, since Thielavia filamentous fungi have the characteristic of being able to grow even under temperature conditions exceeding 40°C, it is desirable to set the culture temperature to preferably 15 to 45°C, more preferably 25 to 42°C. The pH during culture is preferably in the range of 4.0 to 8.0, more preferably 5.0 to 7.0.

＜Prevention of plant diseases and promotion of plant growth＞
The plant diseases controlled by the agrochemical composition of the present invention include diseases caused by plant pathogenic fungi, specifically soil-borne fungi, and in particular diseases caused by Verticillium and Fusarium. More specifically, for example, diseases caused by the infection of various target plants with Verticillium include wilt disease (strawberry, Udo, soybean, etc.), half-leaf wilt disease (eggplant, pepper, tomato, okra, cucumber, thorny radish, melon, etc.), Verticillium wilt disease (cabbage, lettuce, etc.), Verticillium black spot disease (radish, etc.), and yellowing disease (Chinese cabbage). Other examples of diseases caused by infection of various target plants with Fusarium fungi include semi-blight (eggplant), vine split disease (cucumber, bottle gourd, loofah, melon, watermelon, sweet potato, etc.), yellows disease (cabbage, strawberry, radish, turnip, cabbage, komatsuna, udo, etc.), root rot disease (lettuce, kidney bean, etc.), dry rot disease (scallion, onion, garlic, Chinese chive, taro, carrot, etc.), stem blight (honeybee, etc.), wilt disease (burdock, leek, tomato, spinach, etc.), damping-off disease (asparagus, etc.), rot disease (lotus, etc.), brown rot disease (melon, yam), root rot wilt disease (tomato, leek), and seedling damping-off disease (rice, etc.).

Among diseases caused by soil-borne fungi, diseases caused by Verticillium and Fusarium can cause fatal damage to vegetable cultivation as difficult-to-control diseases. Cruciferous vegetables that can cause fatal damage, such as turnip, bok choy, komatsuna, Chinese cabbage, cabbage, and radish, have a shorter harvest period than, for example, Solanaceae and Cucurbitaceae vegetables, and many production areas practice continuous cultivation. Therefore, damage caused by soil-borne diseases is fatal. However, when an appropriate amount of the pesticide composition of the present invention is contained in the soil (field) where the target plant is grown, it is possible to reduce the number of diseased plants to 60% or less, more preferably 40% or less, based on the number of diseased plants of the target plant when the pesticide composition is not applied being 100%. The target plants of the present invention are not particularly limited, but can be applied to Brassica vegetables such as turnip, bok choy, komatsuna, Chinese cabbage, cabbage, and radish that can be fatally damaged by diseases caused by Verticillium and Fusarium fungi, and are particularly effective in controlling Chinese cabbage yellows disease caused by Verticillium fungi. Since the incidence rate of Chinese cabbage yellows disease is low in soil containing Thielavia fungi, it is presumed that Thielavia fungi have the effect of inhibiting the activity of Verticillium fungi (filamentous fungi).
It has also been found that the pesticide composition of the present invention can be mixed with soil containing Verticillium genus fungi (filamentous fungi) to not only control disease caused by Verticillium genus fungi, but also promote the growth of target plants. Therefore, the pesticide composition containing Thielavia genus fungi improves the yield of the target plant by 110% or more, preferably 120% or more, more preferably 130% or more, in terms of mass, based on the yield of the target plant when the pesticide composition is not applied. Furthermore, the plant growth promotion effect of the Thielavia genus fungi used in the pesticide composition of the present invention was observed even when compared with plants grown in soil not containing Verticillium genus fungi (filamentous fungi), so it is presumed that it is not a secondary effect obtained by controlling plant diseases, but exists independently as a plant growth promotion effect. Thus, the Thielavia genus fungi in the present invention unexpectedly has both a plant disease control effect and a plant growth promotion effect on the target plant.

<Pesticide composition>
The Thielavia fungus contained in the pesticide composition of the present invention is a live fungus, and preferably, from the viewpoint of storage stability of the pesticide composition, it can be in the form of spores or a mixture with an organic medium such as bran.Therefore, in the method for culturing the Thielavia fungus in the pesticide composition, in order to increase the viable cell density of the microorganism to a certain level or higher at the end of the culture, it is preferable to culture the culture conditions such as the composition of the medium, the pH of the medium, the culture temperature, the culture humidity, and the oxygen concentration during culture so as to be adapted to the spore formation conditions.In particular, in the pesticide composition of the present invention, from the viewpoint of storage stability of the formulation, it is preferable to make the moisture content 35% by mass or less, more preferably 10% by mass or less.
The content of the Thielavia filamentous fungus in the pesticide composition of the present invention is not particularly limited as long as it does not impair the effects of the present invention, but is preferably 1% by mass or more and 50% by mass or less, and more preferably 10% by mass or more and 40% by mass or less, based on the total amount of the pesticide composition. The content of the Thielavia filamentous fungus in the pesticide composition is preferably ^1x103 cfu/g or more and ^1x1010 cfu/g or less, and more preferably ^1x106 cfu/g or more and ^1x109 cfu/g or less, calculated as colony forming units.

The pesticide composition of the present invention can be used alone in the present invention as the culture solution or dried product of the Thielavia filamentous fungus as described above, but the Thielavia filamentous fungus may be combined with other optional components and formulated in the same form as a normal pesticide formulation (for example, in the form of a dust, wettable powder, emulsion, liquid, flowable, coating, etc.) within the scope of the present invention. Optional components used in combination include, for example, solid carriers and adjuvants. Examples of solid carriers include organic powders such as bentonite, diatomaceous earth, talc, perlite, vermiculite, sodium carboxymethylcellulose (CMC), beer lees, sugarcane pomace (bacas), okara, bran, chitin, rice bran, and wheat flour, and examples of adjuvants include adhesives and thickeners such as gelatin, gum arabic, sugars, and gellan gum. These additives may be added to the microbial pesticide formulation in amounts conventionally known in the field of microbial pesticide formulations. In addition, the above additives may be used alone or in combination of two or more types.
In addition to the Thielavia fungus as an active ingredient, the pesticide composition of the present invention may contain other commonly used active ingredients as necessary, such as insecticides, nematicides, acaricides, herbicides, fungicides, mycicides, antiviral agents, fertilizers, soil conditioners (peat, etc.), and these ingredients other than the Thielavia fungus may be applied in admixture, or may be applied alternately or simultaneously without being mixed.

<Method of applying the pesticide composition>
The present invention also relates to a method for controlling plant diseases and/or promoting plant growth, comprising a step of applying the above-mentioned agrochemical composition to soil or a medium. When applying the agrochemical composition to the soil (field) or medium in which a target plant such as a Brassicaceae plant, particularly Chinese cabbage, is grown, a conventionally known method is appropriately selected according to various conditions such as the type of plant disease to be controlled, the type of plant to be applied, and the formulation of the Thielavia fungus. Specifically, the agrochemical composition may be applied by various treatments such as above-ground spraying, application in a facility, soil incorporation application, and soil irrigation application. As a more specific application method, the agrochemical composition containing the above-mentioned Thielavia fungus in various formulations may be irrigated into the soil in which the plant is grown, or mixed into the soil in which the plant is grown, thereby bringing the agrochemical composition into contact with the surface of the plant pathogenic fungus that causes the plant disease.
Here, the pesticide composition of the present invention is preferably mixed with soil or a medium before planting of a target plant, and the Thielavia fungus suppresses or kills the activity of pathogenic fungi such as Verticillium fungus and Fusarium fungus. Preferably, the pesticide composition is spread or sprayed on soil (field) or the like 7 to 1 day before planting of a target plant, and more preferably, the soil (field) is tilled after the pesticide composition is spread or sprayed, so that the Thielavia fungus acts on the pathogenic fungi in the soil, and plant diseases can be controlled more efficiently. In addition, when using the pesticide composition, it is preferable that the moisture content of the soil is 15 to 60% and the soil temperature is 15 to 25°C.
The application rate of the Thielavia fungus to plants in the present invention is appropriately determined depending on various conditions such as the type of plant disease to be controlled, the occurrence state of the plant disease, and the formulation of the pesticide composition. For example, when the pesticide composition is a liquid formulation, the viable cell concentration of the Thielavia fungus in the liquid formulation is about 1×10 ^3-10 cfu/mL, preferably about 1×10 ^6-9 cfu/mL, and the application rate of the liquid formulation is preferably 100-300 L/10a. When the pesticide composition is a powder formulation and is mixed with the cultivation soil, the viable cell concentration of the Thielavia fungus in the powder formulation is usually about 1×10 ^3-10 cfu/g, preferably about 1×10 ^6-9 cfu/g, and the application rate of the powder formulation is preferably 20-50 kg/10a, more preferably 30-40 kg/10a.

The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

<Reference Example 1: Isolation of S69 strain and examination of its taxonomic group>
We discovered that there is soil in Gunma Prefecture that is resistant to Chinese cabbage yellows disease. Based on the microbial community structure analysis information based on DNA in the soil that shows disease suppression properties for Chinese cabbage yellows disease, we searched for and selected new disease-suppressing microbial strains according to standard methods.
First, DNA was extracted from soil where Chinese cabbage yellows disease was unlikely to occur using a commercially available kit (FastDNA SPIN Kit for Soil, Q-Biogene). Next, a primer set targeting the 16S rRNA gene (SEQ ID NO: 1: CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAACGCGAAGAACCTTAC and SEQ ID NO: 2: CGGTGTGTACAAGGCCCGGGAACG) was used as a primer for analyzing the general bacterial flora to obtain a PCR product. Similarly, a primer set targeting the 18S rRNA gene (SEQ ID NO: 3: GTAGTCATATGCTTGTCTC and SEQ ID NO: 4: CGCCGCCGCGCCCGCGCCCGGCCCGCCCCGCCCCATTCCCCGTTACCCGTTG) was used as a primer for analyzing filamentous fungi to obtain a PCR product. The obtained PCR product was subjected to denaturing gradient gel electrophoresis (DGGE method) to barcode and detect the microbial flora (see FIG. 1). Then, the DGGE bands of the filamentous fungal species that appeared characteristically in the soil were identified, as shown in Figure 1. Next, a filamentous fungus having a band located at the same Rf value as the characteristic DGGE band was isolated from the soil using a selective medium for filamentous fungi, and designated as S69 strain.
Next, the base sequence of the ITS region of the rRNA gene of the S69 strain was determined by direct sequencing of the PCR product obtained by PCR using the ITS1 and ITS4 primer set (SEQ ID NO: 5: TCCGTAGGTGAACCTGCGC and SEQ ID NO: 6: TCCTCCGCTTATTGATATGC) after extracting the genomic DNA. Based on the obtained base sequence information, multiple alignment analysis was performed using Mega (Ver. 6), and phylogenetic analysis was performed by the neighbor-joining method (NJ method) and the cultural properties of the S69 strain led to the identification of the S69 strain as a member of the genus Thielavia (see Figures 2 and 3).

<Reference Example 2: Isolation of I1, J1, and K1 strains and examination of their taxonomic group assignment>
We attempted to isolate further related strains from the soil of the field where the S69 strain was isolated. 1 g of soil exhibiting the above-mentioned disease suppressive properties was thoroughly suspended in 20 ml of 10 mM phosphate buffer (pH 7.0), serial dilutions of the suspension were smeared on Rose Bengal agar plates, and then cultured at 25°C for one week. The filamentous fungal colonies that appeared after the culture were randomly isolated, and some of them were further subjected to repeated single hyphae isolation, resulting in a total of about 200 isolated strains. From the morphology of the ascospores and ascospores that appeared on the PDA plate containing 50 ppm kanamycin, 9 strains that were considered to be closely related to the genus Thielavia were selected, and the species of these strains were identified based on the base sequence information of the rRNA gene ITS region of the strains. The base sequence of the ITS region of the rRNA gene was determined by direct sequencing of the PCR product obtained by PCR using the primer set of ITS1 and ITS4 (SEQ ID NO: 5: TCCGTAGGTGAACCTGCGC and SEQ ID NO: 6: TCCTCCGCTTATTGATATGC) after extracting the genomic DNA of each test bacterium. Based on the obtained base sequence information of each strain, phylogenetic analysis was performed by the neighbor-joining method (NJ method) based on the results of multiple alignment analysis using Mega (Ver. 6). As a result, it was shown that the sequences of three of the test strains, I1, J1 and K1, are closely related to the sequence of S69 (see FIG. 5). As a result of a homology search using BLAST against GenBank/DDBJ/EMBL based on the base sequences of these three strains, I1, J1 and K1 were found to be closely related to Thielavia terricola, T. hyrcaniae and T. It was shown that it is closely related to S. hyrcaniae (Table 1).

Example 1: Concurrent culture of a Thielavia strain (S69 strain) and Chinese cabbage yellows fungus (Verticillium longisporum KT1-1 strain)
The Thielavia genus S69 strain isolated from soil and Chinese cabbage yellows fungus (KT1-1 strain) were cultured in a confrontational manner on a potato-sucrose-agar (PDA) plate medium to evaluate the inhibitory effect on the growth of the KT1-1 strain's mycobiota. First, a piece of the KT1-1 strain's mycobiota was placed on one side of the PDA plate and cultured at 25°C for 8 days, and then a piece of the S69 strain's mycobiota was placed 5 cm away from the part of the KT1-1 strain's mycobiota and cultured at 25°C for 12 days. As a control, only the KT1-1 strain's mycobiota was grown. After the culture, the radius of the KT1-1 strain's mycobiota on each plate was measured, and the antagonistic ability of each test strain was evaluated by comparing the radius of the mycobiota when the S69 strain was confronted with the radius of the control mycobiota. As a result, the bacterial flora radius of the KT1-1 strain when confronted with the S69 strain was 70.8% compared to when not confronted (see FIG. 4(a)).
Furthermore, when the mycelial morphology of both strains was observed in the area where the mycelium of the S69 strain and the mycelium of the KT1-1 strain faced each other, granular cell formation was observed in many of the mycelia of the KT1-1 strain, suggesting the possibility that the cells had died (see FIG. 4(b)).

Example 2: Concurrent culture of Thielavia spp. strains (I1, J1, K1 strains) and Chinese cabbage yellows fungus (Verticillium longisporum KT1-1 strain)
In addition to the S69 strain, the effects of Thielavia genus strains (I1, J1, and K1 strains) isolated from soil on the growth of the bacterial flora of the KT1-1 strain were also evaluated. As a result, the bacterial flora radius of the KT1-1 strain when confronted with the I1, J1, and K1 strains was 84.7 to 81.9% of that when not confronted.

Example 3: Examination of optimal temperature for S69 strain
In order to investigate the growth characteristics of the S69 strain obtained above, the degree of mycelial growth at each culture temperature was investigated. That is, pieces of the pre-cultured S69 strain flora (approximately 5 mm square) were placed on a PDA plate and cultured for 5 days under dark conditions at 5, 10, 15, 20, 25, 30, 37, 42, 45, and 47°C. After the culture, the diameter of the flora grown on each plate was measured three times, and the average value of the measured values was used to evaluate the degree of growth at each temperature. As a result, mycelial growth of the S69 strain was observed in the range of 15 to 45°C, and it grew most vigorously at 37°C (see FIG. 7). This suggested that the S69 strain is a thermophilic filamentous fungus that can grow even at a temperature of 45°C.

<Example 4: Pot test/examination of the effect of controlling Chinese cabbage yellowing disease and the effect of promoting Chinese cabbage growth>
In order to examine the effect of the S69 strain obtained above in controlling Chinese cabbage yellows disease and in promoting the growth of Chinese cabbage, tests were carried out as follows.
First, the cultured bran of the S69 strain was prepared. 300 g of a bran soil mixture, which was a mixture of sandy soil passed through a 5 mm sieve and commercially available bran in a ratio of 4:1, was placed in a glass petri dish with a diameter of 18 cm and sterilized by autoclave at 121 ° C for 20 minutes. 50 ml of cultured bacterial liquid of the S69 strain (prepared by leaving the bacterial cells in a 300 ml Erlenmeyer flask containing 50 ml of PD liquid medium at 25 ° C for 12 days, and then suspending the bacterial cells collected by centrifugation (6,000 × g, 5 minutes) in 50 ml of sterilized water) was added to the sterilized bran soil mixture, and the mixture was cultured at 25 ° C for 30 days under dark conditions. After the culture, the bran soil mixture in which the S69 strain had grown sufficiently was thoroughly crushed in a mortar to prepare cultured bran of the S69 strain.
As a control, uncultured bran was prepared in the same manner as the cultured bran described above, except that 50 ml of sterilized water was added instead of the cultured cell fluid of the S69 strain.

Test 1
Next, the resulting cultured bran and commercially available horticultural soil (product name: Nippi horticultural soil No. 1) were mixed at a ratio of 1:9 (mass ratio) and filled into pots with a diameter of 4 cm, and Chinese cabbage seedlings (about four true leaves) were transplanted into the pots to prepare five pots. Six days later, 10 ml of a suspension of microsclerotia of Verticillium longisporum (1.1 x 105/ml) was irrigated.
As control samples, four pots were prepared in the same manner as above, except that uncultured bran was used instead of the cultured bran.

Tests 2 and 3
A mixture was prepared by mixing a suspension of microsclerotia of Verticillium longisporum with 405 g of commercially available horticultural soil (product name: Nippi horticultural soil No. 1) to obtain a concentration of 130 sclerotia per gram. One day later, 45 g of cultured bran was mixed to prepare the mixture, which was then filled into pots with a diameter of 4 cm. Chinese cabbage seedlings (about four true leaves) were then transplanted into the pots. Six pots were prepared in Test 2, and 12 pots were prepared in Test 3.
As control samples, the same procedure as above was carried out except that uncultured bran was used instead of the cultured bran. Six pots were prepared as control samples for Test 2, and 12 pots were prepared as control samples for Test 3.

Test 4
A sandy soil mixture was prepared by mixing a suspension of microsclerotia of Verticillium longisporum at 100 sclerotia/g with a mixture of sandy soil and commercially available horticultural soil (product name: Nippi horticultural soil No. 1) at a ratio of 4:1 (mass ratio). One day later, the mixture was mixed with cultured bran at a ratio of 1:9 (mass ratio) and filled into 4 cm diameter pots. Chinese cabbage seedlings (about four true leaves) were transplanted into the pots to prepare 11 pots.
In addition, 10 pots were prepared as control samples in the same manner as above, except that uncultured bran was used instead of the cultured bran.
Test 5
A mixture was prepared by mixing 405 g of commercially available horticultural soil (product name: Nippi horticultural soil No. 1) with a suspension of microsclerotia of Verticillium longisporum at 130 sclerotia per gram. One day later, 45 g of cultured bran was mixed to prepare the mixture, which was then filled into pots with a diameter of 4 cm, and Chinese cabbage seedlings (about four true leaves) were transplanted therein to prepare 12 pots.
In addition, as control samples, 12 pots were prepared in the same manner as above, except that uncultured bran was used instead of the cultured bran.
Test 6
A sandy soil mixture was prepared by mixing a suspension of microsclerotia of Verticillium longisporum at 100 sclerotia/g with a mixture of sandy soil and commercially available horticultural soil (product name: Nippi horticultural soil No. 1) at a ratio of 4:1 (mass ratio). One day later, the mixture was mixed with cultured bran at a ratio of 1:9 (mass ratio) and filled into 4 cm diameter pots. Chinese cabbage seedlings (about four true leaves) were transplanted into the pots to prepare 9 pots.
In addition, as control samples, six pots were prepared in the same manner as above, except that uncultured bran was used instead of the cultured bran.
As a blank sample, a pot was prepared in which Chinese cabbage seedlings were grown in a soil mixture made by mixing uncultured bran with a sandy soil mixture not containing microsclerotia of the yellow spot disease bacterium. This was done to evaluate the possibility that the nutritional components of the bran affect the growth of the seedlings. That is, one pot was prepared by carrying out the same procedure as above, except that uncultured bran was used instead of cultured bran and the yellow spot disease bacterium was not mixed in.

<Evaluation Results>
The results are shown in Figure 8. The occurrence of yellows was evaluated by the presence or absence of browning of vascular bundles in cross sections at the base of the seedlings after one month of growing in a greenhouse or growth chamber (under 12 hours of light and 12 hours of darkness) set at 23°C. The promotion of growth was evaluated by measuring the fresh weight of the aboveground part of the seedlings after one month and dividing the value by the number of leaves to obtain the fresh weight per leaf.
As shown in Figure 8(a), the incidence of yellows disease was suppressed in Chinese cabbage seedlings transplanted into pots containing S69 strain cultured bran. In addition, a meta-analysis was performed by integrating the data from Tests 1 to 4, and it was found that the relative risk of yellows disease incidence could be reduced to 0.6 or less when the pesticide composition of the present invention was used, as shown in Figure 8(b).
FIG. 8(c) shows the growth promotion effect of Chinese cabbage seedlings transplanted into pots containing S69 cultured bran (the average mass per Chinese cabbage leaf is shown; the bars indicate standard error). The dashed line data in Test 6 is the result of growing Chinese cabbage in pots containing only Thielavia fungi, but not the yellows fungus. The results of Test 6 demonstrated that Thielavia fungi have the effect of promoting Chinese cabbage growth, independent of the presence or absence of the yellows fungus.

The present invention is expected to be used in fields related to soil disease control, such as by agricultural chemical manufacturers. While there are only a few types of microbial pesticides developed for soil diseases, there is a high demand in cultivation sites for the development of new technologies to combat soil diseases, so there is a high possibility that new microbial pesticides developed based on the present invention will be used.

Claims (10)

A pesticide composition for controlling plant diseases of a target plant, comprising a filamentous fungus of the genus Thielavia,
The filamentous fungus of the genus Thielavia includes Thielavia terricola or Thielavia hyrcaniae, or S69 strain (accession number NITE P-02838), I1 strain (accession number NITE P-02835), J1 strain (accession number NITE P-02836), or K1 strain (accession number NITE P-02837),
An agricultural chemical composition (excluding those containing a porous calcium carbonate substrate) wherein the target plant is a cruciferous vegetable. A pesticide composition for controlling plant diseases and promoting plant growth of a target plant, comprising a filamentous fungus of the genus Thielavia,
The filamentous fungus of the genus Thielavia includes Thielavia terricola or Thielavia hyrcaniae, or S69 strain (accession number NITE P-02838), I1 strain (accession number NITE P-02835), J1 strain (accession number NITE P-02836), or K1 strain (accession number NITE P-02837),
An agricultural chemical composition (excluding those containing a porous calcium carbonate substrate) wherein the target plant is a cruciferous vegetable. The pesticide composition according to claim 1 or 2, wherein the plant disease is caused by a plant pathogenic filamentous fungus. The pesticide composition according to claim 3, wherein the plant pathogenic filamentous fungus is selected from the group consisting of fungi of the genus Verticillium and Fusarium. The pesticide composition according to any one of claims 1 to 4, wherein the plant disease is selected from the group consisting of yellows, verticillium wilt, verticillium wilt, and wilt. The pesticide composition according to any one of claims 1 to 5, which reduces the number of diseased plants of a target plant to 60% or less, based on the number of diseased plants of a target plant that would be affected if the pesticide composition were not applied being 100%. A pesticide composition for promoting the growth of a target plant, comprising a filamentous fungus of the genus Thielavia, which improves the yield of the target plant by 120% or more in mass terms, based on the yield of the target plant when the pesticide composition is not applied, and
The filamentous fungus of the genus Thielavia includes Thielavia terricola or Thielavia hyrcaniae, or S69 strain (accession number NITE P-02838), I1 strain (accession number NITE P-02835), J1 strain (accession number NITE P-02836), or K1 strain (accession number NITE P-02837),
An agricultural chemical composition (excluding those containing a porous calcium carbonate substrate) wherein the target plant is a cruciferous vegetable. The pesticide composition according to any one of claims 1 to 7, wherein the target plant is Chinese cabbage. A method for controlling plant diseases and/or promoting plant growth, comprising a step of applying the pesticide composition according to any one of claims 1 to 8 to soil or a medium. The method for controlling plant diseases and/or promoting plant growth according to claim 9, comprising a step of applying the pesticide composition to soil or a medium before planting a target plant.

Images