JP2020105113A - Agrochemical composition for controlling plant disease, and plant disease controlling method using the same - Google Patents

Abstract

To provide a microbial pesticide that causes less load to the environment and can effectively control soilborne diseases.SOLUTION: There is provided an agrochemical composition for controlling plant disease and/or enhancing plant growth of a target plant which contains genus Thielavia filamentous fungi. It is preferable that plant disease be caused by phytopathogenic filamentous fungi selected from a group consisting of bacterium of genus Verticillium and bacterium of genus Fusarium. Further, it is more preferable that plant disease be selected from a group consisting of yellowing disease, half body wilt, Verticillium wilt, and wilt.SELECTED DRAWING: Figure 8

Description

The present invention relates to an agrochemical composition for controlling plant diseases of a target plant, which contains a filamentous fungus of the genus Thielavia.

Chemical pesticides are mainly used for controlling pests in crop production, and they have been very effective. In particular, soil fumigants are mainly used for soil diseases that are economically difficult and difficult to control. However, there is an international movement to restrict the use of soil disinfectants from the viewpoint of not only simplifying the cultivated land ecosystem by long-term continuous use but also the health of workers and the effect on the surrounding environment. Efforts to reduce the use of disinfectants will become important in the future. Against this background, the development of new control technology to replace soil disease control using chemical substances is being aimed at globally, and as one of such new control technology, organisms using natural microorganisms are used. Pest control technology is receiving attention. Some biological control technologies have already been developed and commercialized as microbial pesticides, but the registration of microbial pesticides against soil sickness diseases is still low, and they are used as new effective control agents and control methods. A potential microbial pesticide is urgently needed in the field.

As described above, for the disease control against soil diseases of vegetables so far, chemical pesticides such as soil fumigants are mainly used, while biological control using microorganisms is performed with root cancer disease or. The target is limited to several kinds of diseases such as soft rot, and it is not widely spread. Here, as a serious soil-borne disease, for example, there is yellowing disease caused by infection of Chinese cabbage with Verticillium spp. In Chinese cabbage with yellowing disease, the outer leaves are first wilted, yellow-brown in a V shape, and withered, so that the leaves are easily detached. After that, these symptoms rapidly progressed, wilting and poor growth progressed, and finally the heading leaves violently opened to the outside, becoming like a button, and the vascular bundle part of the stem and leaves changed from yellow brown to black brown. Discolor. Therefore, in the cultivation of cruciferous plants such as Chinese cabbage in Japan, the disease caused by Verticillium is known as one of the important diseases to be controlled. On the other hand, for example, Patent Document 1 (Japanese Patent Laid-Open No. 2003-231606) discloses that a microorganism belonging to Pseudomonas vietnamiensis has a controlling effect on verticillium disease.
In addition, Patent Document 2 (JP 2006-176533 A) discloses that a specific bacterium belonging to the genus Bacillus (Baci111ts) has a controlling effect against soil-borne diseases, and Patent Document 3 (Japanese Patent Laid-Open Publication No. 2006-242242). No. 2035-03359), it is disclosed that photosynthetic bacteria of the genus Rhodopseudomonas and the bacterium of the genus Bacillus have control effects against soil-borne diseases.
However, microbial pesticides using biological control technology using microbial species and strains that can control diseases caused by Verticillium such as yellowing disease targeting cruciferous plants such as Chinese cabbage still exist. I haven't.

JP, 2003-231606, A JP, 2006-176533, A Japanese Unexamined Patent Publication No. 2035-0359

Verticillium disease is one of the soil diseases whose onset is difficult to predict, and therefore soil disinfection with soil fumigants is often performed on a scheduled basis, but from the viewpoint of cost, labor, and environmental conservation, it should be done as much as possible. It is preferable that measures be taken without doing so. In addition, for example, there are no Chinese cabbage varieties that exhibit complete resistance to Chinese cabbage yellowing disease, which is one of the verticillium diseases, and there are few disease-resistant varieties. Furthermore, since Verticillium spp. can survive in soil for a long period of time and parasitize many crops, once disease occurs, rotation also becomes difficult.
Therefore, an object of the present invention is to provide a microbial pesticide that has a low environmental load and can effectively control soil-borne diseases.

The present inventors have found that in the course of conducting various investigations to solve the above problems, there are soils in which soil-borne diseases, particularly Chinese cabbage yellowing disease, are unlikely to occur. Then, the band of the gene that specifically appeared in the soil was identified, and the filamentous fungus of the genus Thielavia was isolated from the gene information. Then, the isolated filamentous fungus of the genus Thielavia not only suppresses Chinese cabbage yellowing disease caused by the filamentous fungus in the soil, but also discovered an unexpected effect that it contributes to the growth promotion of the target plant, and earnestly studied. As a result of the research, the present invention was completed.

That is, the present invention is as follows.
[1] A pesticide composition for controlling a plant disease of a target plant, which comprises a filamentous fungus of the genus Thielavia.
[2] An agrochemical composition for controlling plant disease of a target plant and promoting plant growth, which comprises a filamentous fungus of the genus Thielavia.
[3] The agrochemical composition according to the above [1] or [2], wherein the plant disease is caused by a phytopathogenic filamentous fungus.
[4] The agrochemical composition according to [3], wherein the phytopathogenic filamentous fungus is selected from the group consisting of Verticillium genus and Fusarium genus.
[5] The agrochemical composition according to any one of [1] to [4] above, wherein the plant disease is selected from the group consisting of yellowing disease, wilt disease of the body, verticillium wilt disease, and wilt disease. Stuff.
[6] The number of disease-causing strains is 60% or less based on 100% of the number of disease-causing strains of the target plant when the agrochemical composition is not applied, according to any one of [1] to [5] above. Agrochemical composition.
[7] A pesticidal composition for enhancing plant growth of a target plant, which contains a filamentous fungus of the genus Thielavia, wherein the yield of the target plant when the pesticidal composition is not applied is 100% as a standard, An agrochemical composition that brings about a yield improvement of 120% or more in terms of mass.
[8] The pesticide composition according to any one of [1] to [7], wherein the target plant is Chinese cabbage.
[9] A method for controlling plant diseases and/or a method for enhancing plant growth, comprising the step of applying the agrochemical composition according to any one of [1] to [8] above to soil or a medium.
[10] The plant disease control and/or plant growth enhancing method according to the above [9], which comprises a step of applying the agrochemical composition to soil or a medium before planting the target plant.

INDUSTRIAL APPLICABILITY The present invention can provide a novel agrochemical composition containing a microorganism as an active ingredient, which has a low load on the environment and can effectively control soil-borne diseases.

It is a photograph which shows the filamentous fungal flora band pattern based on PCR-DGGE method of each soil DNA sample of the field (C area|region) which shows disease suppressive property. As a control, the band pattern of the soil-derived sample in the yellowing disease occurrence field (A area) is also shown. M indicates a marker lane. (A) is a photograph showing the band position on the DGGE of the filamentous fungus S69 strain corresponding to the characteristic band (Metrix 29.8) in the band pattern isolated from the soil of the field showing disease-deterrent. (B) is a photograph showing colonies of filamentous fungus S69 strain on PDA medium and ascospores on the colonies. The phylogenetic tree (NJ method) based on the nucleotide sequence in the ITS region of rRNA genes of Chaetomium genus, Madurella genus, Thielavia genus and S69 strain is shown. (A) is a photograph showing the microflora morphology (after 15 days of culture) of confronting culture of yellow rot fungus and S69 strain on PDA medium. (B) is a photograph showing the hypha morphology (after 15 days of culturing) of the yellow rot fungus and the S69 strain colony boundary bacterium in the confrontation culture on the PDA medium. The mycelia (arrows) in which the cells are granular are conspicuous (the arrow parts are presumed to be dead cells). The phylogenetic tree (NJ method) based on the nucleotide sequence in the rRNA gene ITS region of other isolates showing similar properties to the S69 strain is shown. Shows the flora morphology of the KT1-1 strain (right plate: black flora on the left side) in the case of confronting culture with the J1 strain and the flora morphology of the KT1-1 strain only (left plate: control). It is a photograph. It is a graph which shows the flora diameter (after 5 days of culture) according to the culture temperature of S69 strain on a PDA plate medium. (A) and (b) show the onset suppression effect of yellowing disease in Chinese cabbage seedlings transplanted in a pot mixed with S69 strain culture bran ((b) shows the result of the meta-analysis of (a)). (C) shows the growth promoting effect of Chinese cabbage seedlings transplanted in a pot mixed with S69 strain culture bran (mean value of mass per Chinese cabbage leaf, bar shows standard error).

TECHNICAL FIELD The present invention relates to an agrochemical composition containing a filamentous fungus of the genus Thielavia which is a viable bacterium effective for controlling plant diseases of target plants, particularly cruciferous plants. The pesticidal composition of the present invention can be used not only for controlling plant diseases but also for promoting plant growth.

<Thieravia filamentous fungus>
The filamentous fungus of the genus Thielavia contained in the agrochemical composition for controlling plant diseases of the present invention is not particularly limited as long as it has the ability to suppress infection or growth of phytopathogenic bacteria or filamentous fungi. Not done. Examples include Thielavia terricola or Thielavia hyrcaniae and their close species. Further, two or more species of the filamentous fungus of the genus Thielavia may be used in combination. The biosafety level of the filamentous fungus of the genus Thielavia is 1.

As the filamentous fungus of the genus Thielavia contained in the pesticide composition of the present invention, for example, those isolated by the following method can be used. First, 1 g of soil showing a cabbage yellowing disease suppressive property was well suspended in 20 ml of 10 mM phosphate buffer (pH 7.0), and a serial dilution of the suspension was spread on a Rose Bengal agar plate, After culturing at 25° C. for 1 week, the filamentous fungal colonies appearing after culturing are randomly separated, and a part of them is further separated by single hyphae. The isolated strain obtained is cultured on a PDA plate supplemented with 50 ppm kanamycin, and a strain which is considered to be closely related to the genus Thielavia is selected based on the morphology of the emerging ascospore and ascospores. The DNA of each selected strain is extracted, and the strain is identified based on the nucleotide sequence information of the rRNA gene ITS region of these strains according to a conventional method. Based on the obtained nucleotide sequence information of each strain, a phylogenetic analysis by the neighbor-joining method (NJ method) is performed based on the result of the multiple alignment analysis using Mega (Ver.6). As a result, among the selected strains, strains belonging to the genus Thielavia can be appropriately used as the filamentous fungus of the genus Thielabia of the present invention.
Further, for example, the filamentous fungus of the genus Thielavia of the present invention is a filamentous fungus having a strong yellowing disease control ability by confirming the degree of hyphal growth inhibition of the yellowing disease fungus at the facing site in a confrontation culture method with the yellowing disease fungus on a PDA medium. It is also possible to select bacteria.

In the present invention, among the filamentous fungi of the genus Thielavia, it is particularly preferable to use S69 strain, I1 strain, J1 strain, and K1 strain selected by the method described in Reference Example described later. The above-mentioned S69 strain, I1 strain, J1 strain, and K1 strain were all deposited at the Patent Microorganism Depositary Center, National Institute of Technology and Evaluation, National Institute of Technology and Evaluation, for all bacteria on the same day (notification date: December 5, 2018). A receipt is issued on the following day and the receipt number is given to each bacterium as follows.
S69 share: receipt number NITE AP-02838
I1 share: Receipt number NITE AP-02835
J1 share: Receipt number NITE AP-02836
K1 share: receipt number NITE AP-02837
It should be noted that these strains are presumed to be closely related to Thielavia tericola or Thielavia hyrcaniae, as shown in the following Reference Example.

The filamentous fungus of the genus Thielavia contained in the agricultural chemical composition of the present invention can be obtained by culturing by a conventionally known conventional method. Examples of such a culturing method include a method of culturing in a medium in which a filamentous fungus of the genus Thielavia can grow, and collecting the cells using a means such as centrifugation. Such as material culture, static culture on solid medium, liquid culture, liquid crystal culture such as reciprocal shaking culture, jarfamenter culture, culture tank culture, solid culture, etc. be able to. The medium for cultivating the filamentous fungus of the genus Thielavia used in the present invention is not particularly limited as long as the filamentous fungus can grow efficiently, but a medium that reaches the maximum growth amount at 15 to 45° C. is preferable. It is more preferable that the growth amount reaches the maximum when cultured at 25 to 42°C. The growth time of the filamentous fungus of the genus Thielavia can be appropriately adjusted while confirming the growth state of the bacterial cells. Examples of the medium for culturing Thielavia filamentous fungus used in the present invention include glucose and sucrose as carbon sources, nitrates and ammonium salts as nitrogen sources, inorganic salts as sodium salts, potassium salts and magnesium salts, The synthetic or natural mediums contained therein, for example, Buma's medium can be mentioned. Further, since the filamentous fungus of the genus Thielavia has a characteristic of being able to grow even under a temperature condition exceeding 40°C, it is desirable that the culture temperature is preferably 15 to 45°C, more preferably 25 to 42°C. The pH during culturing is preferably in the range of 4.0 to 8.0, more preferably 5.0 to 7.0.

<Control of plant diseases on target plants and promotion of plant growth>
The plant diseases controlled by the agrochemical composition of the present invention include plant pathogenic filamentous fungi, specifically, diseases caused by soil-borne fungi, particularly Verticillium spp. and Fusarium. ) Diseases caused by genus bacteria are mentioned. More specifically, for example, wilt disease caused by infection of various target plants of Verticillium spp. (strawberry, udo, soybean, etc.), half body wilt disease (eggplant, bell pepper, tomato, okra, cucumber, incontinence, melon) Etc.), verticillium wilt (cabbage, lettuce, etc.), verticillium black spot disease (radish, etc.), and yellowing disease (chinese cabbage). Further, for example, half-blight disease (eggplant) caused by infection of various target plants of Fusarium spp., eggplant, cucumber disease (cucumber, yugao, loofah, melon, watermelon, sweet potato, etc.), chlorosis (cabbage, strawberry, radish, Turnip, cabbage, komatsuna, uddo, etc., root rot (lettuce, green beans, etc.), dry rot (raccoon, onion, garlic, chive, taro, carrots, etc.), blight (mitsuba, etc.), wilt (burdock) , Green onions, tomatoes, spinach, etc., wilt (asparagus, etc.), rot (lotus, etc.), brown rot (melon, yam), root rot (tomato, leeks), seedling wilt (rice) Etc.) and the like.

Among the diseases caused by the soil-borne fungi, the diseases caused by Verticillium spp. and Fusarium spp. can cause fatal damage in vegetable cultivation as difficult control diseases. And in cruciferous vegetables that can be fatally damaged, such as turnip, bok choy, komatsuna, Chinese cabbage, cabbage, radish, for example, the harvest period is shorter than that of Solanaceae and Cucurbitaceae vegetables, and the production area is continuous. There are also many. Therefore, the damage caused by soil-borne diseases is fatal. However, when the pesticide composition of the present invention is contained in an appropriate amount in the soil (field) in which the target plant is grown, the number of disease-causing strains is based on 100% of the number of diseased strains of the target plant when the pesticide composition is not applied. Can be 60% or less, more preferably 40% or less. The target plant of the present invention is not particularly limited, but can be applied to cruciferous vegetables such as turnip, bok choy, komatsuna, Chinese cabbage, cabbage, radish, etc., which can cause fatal damage by diseases caused by Verticillium and Fusarium. In particular, it has a high effect on the control of Chinese cabbage yellowing disease by Verticillium fungi. Since the incidence of Chinese cabbage yellowing disease is low in soils containing the filamentous fungus of the genus Thielavia, it is presumed that the filamentous fungus of the genus Thielabia has an effect of inhibiting the activity of the genus Verticillium (filamentous fungus).
Moreover, by mixing the pesticidal composition of the present invention with soil containing Verticillium sp. (filamentous fungi), not only the effect of controlling the disease caused by Verticillium sp. It has been found that can improve. Therefore, the pesticidal composition containing the filamentous fungus of the genus Thielavia is, on the basis of 100% of the yield of the target plant when the pesticidal composition is not applied, 110% or more, preferably 120% or more, in terms of mass. Preferably it provides a yield improvement of 130% or more. Furthermore, the plant growth enhancing action by the Thielavia filamentous fungus used in the pesticide composition of the present invention was confirmed even when compared to plants grown in soil containing no Verticillium fungus (filamentous fungus), It is presumed to exist independently as a plant growth promoting action, not as a by-product obtained by controlling plant diseases. As described above, the filamentous fungus of the genus Thielavia in the present invention unexpectedly has both a plant disease control action on a target plant and a plant growth promoting action.

<Agricultural chemical composition>
The filamentous fungus of the genus Thielavia contained in the pesticidal composition of the present invention is a live bacterium, and preferably, in view of storage stability of the pesticidal composition, it may be a spore form or a mixture with an organic medium such as bran. Therefore, in the method for cultivating the filamentous fungus of the genus Thielavia in the above-mentioned pesticide composition, in order to increase the viable cell density of the microorganism to a certain level or more in the final stage of the culture, the composition of the medium, the pH of the medium, the culture temperature, the culture humidity, It is preferable that the culture conditions such as oxygen concentration during the culture are adapted to the spore formation conditions. In particular, in the pesticidal composition of the present invention, the water content is preferably 35% by mass or less, more preferably 10% by mass or less, from the viewpoint of storage stability of the preparation.
The content of the Thielavia filamentous fungus contained in the agrochemical composition of the present invention is not particularly limited as long as it does not impair the effects of the present invention, for example, 1% by mass or more and 50% by mass or less based on the total amount of the agrochemical composition. Is preferable, and more preferably 10% by mass or more and 40% by mass or less. In addition, the content of the filamentous fungus of the genus Thielavia in the agrochemical composition is, in terms of colony forming units, 1×10 ³ cfu/g or more and 1× ^{10 10} cfu/g or less, preferably 1×10 ⁶ cfu/g or more and 1×10 ⁹ cfu/g or less. Is preferred.

The pesticide composition of the present invention can be used in the present invention by itself as a culture solution or a dried product of the above-mentioned Thielavia filamentous fungus, but within a range not impairing the purpose of the present invention, the Thielavia filamentous fungus is It may be formulated into a form similar to a usual agrochemical formulation (eg, powder, wettable powder, emulsion, solution, flowable agent, coating agent, etc.) in combination with other optional components. Examples of the optional components used in combination include solid carriers and auxiliary agents. Examples of the solid carrier include bentonite, diatomaceous earth, talc, perlite, vermiculite, sodium carboxymethyl cellulose (CMC), beer meal, sugar cane squeezing meal (bacus), okara, fusuma, chitin, rice bran, organic powders such as wheat flour, and the like. Examples of the auxiliary agent include fixing agents such as gelatin, gum arabic, sugars, gellan gum, and thickeners. These additives may be added to the microbial pesticide formulation in conventionally known amounts in the field of microbial pesticide formulation. Further, the above additives may be used alone or in combination of two or more kinds.
Further, the pesticide composition of the present invention, in addition to the filamentous fungus of the genus Thielabia as an active ingredient, other active ingredients usually used as necessary, for example, insecticides, nematicides, acaricides, herbicides. , Fungicides, fungicides, antiviral agents, fertilizers, soil conditioners (peat, etc.), and these ingredients other than the filamentous fungus of the genus Thielavia can be mixed and applied or mixed. It is also possible to apply alternately or simultaneously without using.

<Method of applying pesticide composition>
The present invention also relates to a method for controlling plant diseases and/or a method for promoting plant growth, which comprises a step of applying the agrochemical composition to soil or a medium. When the pesticide composition is applied to target plants such as cruciferous plants, particularly to soil (field) in which Chinese cabbage is grown or medium, the type of plant disease to be controlled, the type of plant to be applied, and the genus Thielavia A conventionally known method is appropriately selected according to various conditions such as the dosage form of the filamentous fungus. Specifically, it can be carried out by each treatment such as above-ground application, in-facility application, soil admixture application, soil irrigation application and the like. As a more specific application method, a treatment of irrigating a pesticidal composition containing the above-mentioned Thielavia filamentous fungus in various dosage forms into a cultivated soil of a plant, a treatment of admixing with a cultivated soil of a plant is performed, whereby the pesticide composition May be brought into contact with the surface of a phytopathogenic filamentous fungus that causes plant diseases.
Here, the pesticidal composition of the present invention is mixed with soil or a medium before planting of a target plant, a filamentous fungus of the genus Thielavia suppresses the activity of pathogenic bacteria such as Verticillium and Fusarium, or It is preferable to keep it dead. Preferably, the filamentous fungus of the genus Thielavia acts on pathogenic bacteria in the soil by cultivating the pesticide composition 7 to 1 day before planting the target plant, more preferably in the soil (field) after spraying or spraying the pesticide composition. Therefore, plant diseases can be controlled more efficiently. Further, when the present pesticide composition is used, it is preferable that the water content in the soil is 15 to 60% and the soil temperature is 15 to 25°C.
The application rate of the filamentous fungus of the genus Thielavia in the present invention to a plant is appropriately determined according to various conditions such as the type of plant disease to be controlled, the occurrence status of the plant disease, and the dosage form of the agrochemical composition. For example, when the agrochemical composition is a liquid agent, the viable cell concentration of the Thielavia filamentous fungus in the liquid agent is about 1×10 ^{3 to 10} cfu/mL, preferably about 1×10 ^{6 to 9} cfu/mL, The application amount of the liquid agent is preferably 100 to 300 L/10a. When the pesticide composition is a dust and is mixed with cultivated soil, the viable cell concentration of the filamentous fungus of the genus Thielavia in the dust is usually about 1×10 ^{3 to 10 10} cfu/g, preferably about 1 ×10 ^{6 to 9} cfu/g, and the application amount of the powder is preferably 20 to 50 kg/10a, more preferably 30 to 40 kg/10a.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples.

<Reference Example 1: Isolation of S69 strain and examination of belonging taxon>
It was discovered that there are soils in China that are unlikely to cause Chinese cabbage yellowing disease. Then, based on the information on the microbial community structure analysis based on the DNA in the soil that exhibits disease-deterrent for Chinese cabbage yellowing disease, a new disease-inhibiting microbial strain was searched and selected according to a conventional method.
First, DNA was extracted from soil in which Chinese cabbage yellowing disease is unlikely to occur, using a commercial kit (FastDNA SPIN Kit for Soil, Q-Biogene). Next, a PCR product was obtained using a primer set targeting the 16S rRNA gene (SEQ ID NO: 1 CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAACGCGAAGAACCTTAC and SEQ ID NO: 2 CGGTGTGTACAAGGCCCGGGAACG) as a primer for analysis of general bacterial flora. Similarly, a PCR product was similarly obtained using a primer set targeting the 18S rRNA gene (SEQ ID NO: 3: GTAGTCATATGCTTGTCTC and SEQ ID NO: 4: CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCATTCCCCGTTACCCGTTG) as a primer for analysis of filamentous fungi. The obtained PCR product was subjected to denaturing agent gradient gel electrophoresis (DGGE method) to detect the microflora by barcode (see FIG. 1). Then, the DGGE band of the filamentous fungal species characteristically appearing in the soil shown in FIG. 1 was identified. Next, from the soil, a filamentous fungus having a band located at the same Rf value as the above-mentioned characteristic DGGE band was isolated using a selective medium for filamentous fungus, and designated as S69 strain.
Next, the nucleotide sequence of the ITS region of the rRNA gene of S69 strain was obtained by PCR after extracting its genomic DNA and using the primer set of ITS1 and ITS4 (SEQ ID NO: 5: TCCGTAGGTGAACCTGCGC and SEQ ID NO: 6: TCCTCCGCTTATTGATATGC). The product was determined using the direct sequencing method. Based on the obtained nucleotide sequence information, multiple alignment analysis was performed using Mega (Ver.6), the result of phylogenetic analysis by the neighbor binding method (NJ method), and from the culture characteristics of the S69 strain, The S69 strain was identified as a Thielavia spp. (see FIGS. 2 and 3).

<Reference Example 2: Isolation of I1 strain, J1 strain and K1 strain and examination of belonging taxon>
An attempt was made to further isolate related strains from the soil such as the field where the S69 strain was isolated. 1 g of the above-mentioned disease-inhibiting soil was well suspended in 20 ml of 10 mM phosphate buffer (pH 7.0), and a serial dilution of the suspension was spread on a Rose Bengal agar plate, and then at 25°C for 1 week. After culturing, the fungal colonies appearing after the culturing were randomly separated, and a part of them were further separated by single hyphae to obtain a total of about 200 isolated strains. 9 strains that were considered to be closely related to Thielavia spp. were selected based on the ascospores and ascospore morphology of these isolated strains appearing on 50 ppm kanamycin-containing PDA plates, and the rRNA gene ITS region of these strains was selected. The bacterial species was identified based on the nucleotide sequence information. The base sequence of the ITS region of the rRNA gene is the PCR product obtained by PCR using the primer sets of ITS1 and ITS4 (SEQ ID NO: 5: TCCGTAGGTGAACCTGCGC and SEQ ID NO: 6: TCCTCCGCTTATTGATATGC) after extracting the genomic DNA of each test bacterium. It was determined by the direct sequencing method. Based on the obtained nucleotide sequence information of each strain, a phylogenetic analysis by the neighbor-joining method (NJ method) was performed based on the result of the multiple alignment analysis using Mega (Ver.6). As a result, it was shown that among the test strains, the sequences of 3 strains, I1, J1 and K1 strains are closely related to the sequence of S69 strain (see FIG. 5). As a result of homology search for GenBank/DDBJ/EMBL using BLAST based on the nucleotide sequences of these three strains, the I1, J1 and K1 strains were respectively Thielavia terricola, T. hyrcaniae, T.; It was shown to be closely related to hyrcaniae (Table 1).

<Example 1: Face-to-face culture of Thieravia sp. strain (S69 strain) and Chinese cabbage yellowing disease strain (Verticillium longisporum KT1-1 strain)>
Suppression of growth of the KT1-1 strain by opposing culture of the Thielavia genus S69 strain and Chinese cabbage yellowing fungus (KT1-1 strain) isolated from soil on a potato-sucrose-agar (PDA) plate medium. The effect was evaluated. First, on one side of a PDA plate, a KT1-1 strain flora piece was placed and cultured at 25° C. for 8 days, and then a S69 strain flora piece was placed at a distance of 5 cm from the KT1-1 strain flora piece placement portion. The cells were opened, placed on the floor, and cultured at 25° C. for 12 days. As a control, only the bacterial lawn of the KT1-1 strain was grown. After culturing, the radius of the KT1-1 strain on each plate was measured, and the antagonism of each test strain was evaluated by comparing the microbial radius when the S69 strain was confronted with the control microbial radius. .. As a result, the bacterial lawn radius of the KT1-1 strain when facing the S69 strain was 70.8% compared to when it was not facing (see FIG. 4(a)).
In addition, as a result of observing the hyphae morphology of both strains of the S69 strain and the KT1-1 strain, the granulation of the cells was observed in many of the KT1-1 strain hyphae, It was suggested that they might have died (see FIG. 4(b)).

<Example 2: Face-to-face culture of Thielavia spp. (I1, J1 and K1 strains) and Chinese cabbage yellowing fungus (Verticillium longisporum KT1-1 strain)>
In addition to the S69 strain, the inhibitory effect on the growth of the lawn of the KT1-1 strain of the Thielavia strains (I1, J1, K1 strains) isolated from soil was also evaluated in the same manner. As a result, the bacterial lawn radius of the KT1-1 strain when facing the I1 strain, J1 strain, and K1 strain was 84.7 to 81.9% of the growth compared to when it was not facing.

<Example 3: Examination of optimum temperature of S69 strain>
In order to examine the growth characteristics of the S69 strain obtained above, the degree of hyphal growth at each culture temperature was examined. That is, a piece of pre-cultured S69 strain microflora pieces (about 5 mm square) was placed on a PDA plate under dark conditions of 5, 10, 15, 20, 25, 30, 37, 42, 45, and 47°C. Each was cultured for 5 days. After culturing, the diameter of the flora grown on each plate was measured three times, and the average value of the measured values was used to evaluate the degree of growth at each temperature. As a result, hyphae growth of the S69 strain was observed in the range of 15 to 45°C, and was most vigorously grown at 37°C (see Fig. 7). From this, it was suggested that the S69 strain is a thermophilic filamentous fungus capable of growing even at a temperature of 45°C.

<Example 4: Pot test/Examination of control effect of Chinese cabbage yellowing disease and promotion effect of Chinese cabbage growth>
In order to examine the control effect of Chinese cabbage yellowing disease and the promotion effect of Chinese cabbage growth by the S69 strain obtained above, a test was conducted in the following manner.
First, the culture bran of S69 strain was produced. 300 g of a bran soil mixture, which was a mixture of sand soil that had been passed through a 5 mm sieve and commercial bran, at a ratio of 4:1 was placed in a glass petri dish having a diameter of 18 cm, and autoclaved at 121° C. for 20 minutes. To the sterilized bran soil mixture, 50 ml of culture solution of S69 strain (in a 300 ml Erlenmeyer flask containing 50 ml of PD liquid medium, allowed to stand at 25°C for 12 days, and then centrifuged (6,000 xg, 5 minutes) (Prepared by suspending the bacterial cells collected by the above method in 50 ml of sterilized water), and statically culturing for 30 days at 25° C. in the dark. After culturing, the bran soil mixture in which the S69 strain was sufficiently grown was well crushed in a mortar to obtain a cultured bran of the S69 strain.
In addition, as a control, 50 ml of sterilized water was added instead of the cultured bacterial cell fluid of S69 strain, and uncultured bran bran treated in the same manner as the above-mentioned cultured bran was prepared.

≪Test 1≫
Next, the obtained culture bran: commercial horticultural cultivation soil (product name: Nippi gardening cultivation soil No. 1)=1:9 (mass ratio) was mixed and mixed in a 4 cm diameter pot, and Chinese cabbage seedlings were placed therein. Five pots were prepared by transplanting (about 4 true leaves). After 6 days, 10 ml of a micro sclerotium suspension (Verticillium longisporum) (1.1×10 5 cells/ml) was irrigated.
As a control sample, 4 pots prepared by the same operation as above except that uncultured bran was used instead of the cultured bran were prepared.

<<Tests 2 and 3>>
A mixed soil was prepared by mixing 405 g of a commercially available horticultural cultivating soil (product name: Nippi Horticulture cultivating soil No. 1) with a micro sclerotium suspension of Verticillium longisporum at 130 sclerotium/g. One day after that, mixed soil prepared by mixing 45 g of culture bran was filled in a 4 cm diameter pot, and Chinese cabbage seedlings (about 4 true leaves) were transplanted in 6 pots in Test 2 and 12 in Test 3 I prepared a pot.
Further, as a control sample, the same operation as above was performed except that uncultured bran was used instead of the cultured bran. 6 pots were prepared as a control sample of test 2 and 12 pots were prepared as a control sample of test 3.

≪Test 4≫
Sand soil: Commercial horticultural cultivating soil (product name: Nippi horticultural cultivating soil No. 1) = 4:1 (mass ratio) in the soil mixed with 100 micro sclerotium suspensions of Verticillium longisporum sclerotium/g A mixed sand soil was prepared by mixing so that One day after that, a mixed soil in which the culture bran was mixed so that the culture bran:mixed soil=1:9 (mass ratio) was filled in a 4 cm diameter pot, and Chinese cabbage seedlings (about 4 true leaves) were transplanted therein. 11 pots of stuff were prepared.
As a control sample, 10 pots prepared in the same manner as above except that uncultured bran were used instead of cultured bran were prepared.
≪Test 5≫
A mixed soil was prepared by mixing 405 g of a commercially available horticultural cultivating soil (product name: Nippi Horticulture cultivating soil No. 1) with a micro sclerotium suspension of Verticillium longisporum at 130 sclerotium/g. One day after that, a mixed soil prepared by mixing 45 g of culture bran was filled in a pot having a diameter of 4 cm, and Chinese cabbage seedlings (about 4 true leaves) were transplanted therein to prepare 12 pots.
As a control sample, 12 pots prepared by the same operation as above except that uncultured bran was used instead of the cultured bran were prepared.
≪Test 6≫
Sand soil: Commercial horticultural cultivating soil (product name: Nippi horticultural cultivating soil No. 1) = 4:1 (mass ratio) in the soil mixed with 100 micro sclerotium suspensions of Verticillium longisporum sclerotium/g A mixed sand soil was prepared by mixing so that One day after that, a mixed soil in which the culture bran was mixed so that the culture bran:mixed soil=1:9 (mass ratio) was filled in a 4 cm diameter pot, and Chinese cabbage seedlings (about 4 true leaves) were transplanted therein. 9 pots of stuff were prepared.
As a control sample, 6 pots prepared in the same manner as above except that uncultured bran were used instead of the cultured bran were prepared.
In addition, as a blank sample, a pot in which Chinese cabbage seedlings were grown was prepared in a mixed soil prepared by mixing uncultured bran into mixed sand soil in which microscopic sclerotium of yellow mold was not mixed. This was carried out to evaluate the possibility that the nutritional components of bran affect the growth of seedlings. That is, one pot was prepared in the same manner as above except that uncultivated bran was used in place of the cultured bran and that yellowing fungus was not mixed.

≪Evaluation result≫
The results are shown in Fig. 8. Whether or not yellowing disease has occurred depends on whether the seedlings in the above-mentioned pots were grown in a greenhouse or a gross chamber (12 hours light-12 hours dark condition) set at 23° C. for 1 month. The presence or absence of browning of the vascular bundle in the cross section was used as an index. In addition, whether or not the growth was promoted was determined by measuring the aboveground fresh weight of the seedlings after one month and dividing the value by the number of leaves as the fresh weight per sheet.
As shown in FIG. 8(a), the Chinese cabbage seedlings transplanted into the pot mixed with the S69 strain culture bran were suppressed in the onset of yellowing disease. In addition, in the result of performing the meta-analysis by integrating the data of the above-mentioned tests 1 to 4, as shown in FIG. 8(b), the relative risk of yellowing disease occurrence when the pesticide composition of the present invention was used was determined. It was found that it can be reduced to 0.6 or less.
Further, FIG. 8(c) shows the growth promoting effect of Chinese cabbage seedlings transplanted in a pot mixed with S69 strain culture bran (mean value of mass per leaf of Chinese cabbage, bar shows standard error). The data of the broken line in the test 6 is the result of growing Chinese cabbage in a pot containing only the filamentous fungus of the genus Thielavia without the yellow fungus. From the results of Test 6, it was found that the filamentous fungus of the genus Thielavia has an action of enhancing the growth of Chinese cabbage, independently of the presence or absence of the yellow bacterium.

The present invention is expected to be used in fields related to soil disease control such as agricultural chemical manufacturers. While there are few types of microbial pesticides that have been developed against soil diseases, there is a high need for new technology development for soil disease countermeasures at cultivation sites, so new microbial pesticides developed based on the present invention, etc. Is highly available.

Claims (10)

An agrochemical composition for controlling a plant disease of a target plant, which comprises a filamentous fungus of the genus Thielavia. An agrochemical composition for controlling a plant disease of a target plant and promoting plant growth, which comprises a filamentous fungus of the genus Thielavia. The agrochemical composition according to claim 1 or 2, wherein the plant disease is caused by a phytopathogenic filamentous fungus. The agrochemical composition according to claim 3, wherein the phytopathogenic filamentous fungus is selected from the group consisting of Verticillium spp. and Fusarium spp. The agrochemical composition according to any one of claims 1 to 4, wherein the plant disease is selected from the group consisting of yellowing disease, semi-body wilt disease, verticillium wilt disease, and wilt disease. The pesticide composition according to any one of claims 1 to 5, wherein the number of diseased strains of the target plant when the pesticide composition is not applied is 100%, and the number of diseased strains is 60% or less. A pesticidal composition for promoting plant growth of a target plant, which contains a filamentous fungus of the genus Thielavia, wherein the yield of the target plant when the pesticidal composition is not applied is 100% on a mass conversion basis. A pesticidal composition which provides a yield improvement of 120% or more. The agrochemical composition according to any one of claims 1 to 7, wherein the target plant is Chinese cabbage. A method for controlling plant diseases and/or a method for enhancing plant growth, comprising the step of applying the agrochemical composition according to any one of claims 1 to 8 to soil or a medium. The plant disease control and/or plant growth enhancement method according to claim 9, comprising a step of applying the agrochemical composition to soil or a medium before planting the target plant.