JP7245373B2 - Method for controlling affinity of antibody for antigen, antibody with altered affinity for antigen, and method for producing the same - Google Patents

Description

The present invention relates to methods for controlling the affinity of antibodies for antigens. The present invention also relates to antibodies with altered affinity for antigens and methods for producing the same.

Techniques for modifying the affinity of an antibody for an antigen by introducing mutations into the amino acid sequence of the antibody are conventionally known. For example, Patent Document 1 describes a method of introducing mutations into the amino acid sequence of the complementarity determining regions (CDRs) of an antibody to reduce the affinity of the antibody for an antigen.

It is also known to introduce mutations into the amino acid sequences of the framework regions in the variable region, instead of the CDRs, to alter the affinity for the antigen. For example, in Non-Patent Document 1 and Patent Document 2, the 60th, 63rd, 65th and 67th amino acid residues located in framework region 3 of a single-chain antibody (scFv) that binds to troponin I are Substitution with a lysine or arginine residue, which is a basic amino acid, is described. Troponin I is an antigen with a high content of charged amino acids. In Non-Patent Document 1 and Patent Document 2, first, a single-chain antibody recognizing an acidic epitope with a pI of 3.57 and a single-chain antibody recognizing a basic epitope with a pI of 11.45 were produced. Non-Patent Document 1 and Patent Document 2 describe that the affinity for troponin I could be improved by utilizing the electrical attraction generated by the introduction of a basic amino acid residue into these single-chain antibodies. ing.

U.S. Patent Application Publication No. 2012/0329995 International Publication No. 2013/084371 pamphlet

Fukunaga A and Tsumoto K, Improving the affinity of an antibody for its antigen via long-range electrostatic interactions, Protein Eng. Des. Sel. vol.26, no.12, p.773-780, 2013

In Non-Patent Document 1 and Patent Document 2, from the viewpoint of increasing the binding rate constant in the antibody-antigen reaction, the above-described mutations are introduced into the framework region 3 (FR3) of the anti-troponin I antibody to convert it to troponin I. It improves the affinity of However, these documents do not describe whether antibodies other than anti-troponin I antibodies can also be modified in affinity to antigens by the same technique.

In addition, Non-Patent Document 1 and Patent Document 2 only describe that the affinity to the antigen is improved. On the other hand, when an antibody is used as a reagent, not only an antibody with improved affinity to an antigen but also an antibody with reduced affinity may be required. For example, antibodies with reduced affinity for antigen can be used as suitable controls for antigen-antibody reactions. Therefore, it is desired to establish a technique for controlling the affinity of antibodies to antigens.

The present inventors have found that substitution of charged amino acid residues for FR3 amino acid residues in antibodies can improve or decrease the affinity for antigens, depending on the type of antibody. Then, the inventors have found that such a difference in affinity change is associated with the electrical properties of CDRs determined based on the number of charged amino acid residues contained in the CDRs, and completed the present invention.

Accordingly, the present invention provides a method of controlling the affinity of an antibody for an antigen. In this method, at least three amino acid residues of FR3 defined by the Chothia method are substituted with charged amino acid residues in an antibody having neutral or negatively charged CDR electrical properties based on the CDR amino acid sequence.

The present invention also provides methods for producing antibodies with altered affinity for antigens. This method comprises replacing at least three amino acid residues of FR3 defined by the Chothia method with charged amino acid residues in an antibody having neutral or negatively charged CDR electrical properties based on the CDR amino acid sequence; and recovering the antibody obtained in the replacement step.

Further, the present invention provides antibodies with altered affinity for antigens. In this antibody, the electrical properties of the CDRs based on the amino acid sequences of the CDRs are neutral or negatively charged, and at least three amino acid residues of FR3 defined by the Chothia method in the unmodified antibody are charged amino acid residues has been replaced by

According to the present invention, antibodies with altered affinity for antigens are provided.

1 is a graph showing dissociation constants in interactions between wild-type anti-insulin antibodies and mutants thereof and antigens (insulin). 1 is a graph showing dissociation constants in interactions between wild-type anti-thyroid stimulating hormone receptor (TSHR) antibodies and variants thereof and antigens (TSHR). FIG. 2 shows surface charge distributions of wild-type anti-insulin antibodies and their mutants, and antigens (insulin). FIG. 3 shows surface charge distributions of wild-type anti-TSHR antibodies and their mutants, and antigens (TSHR). 1 is a graph showing analytical peaks when the thermal stability of a wild-type anti-insulin antibody and its mutants is measured by a differential scanning calorimeter (DSC). 1 is a graph showing dissociation constants in interaction between a wild-type anti-lysozyme antibody and its mutants and an antigen (lysozyme). 1 is a graph showing dissociation constants in interactions between wild-type anti-hepatitis B surface antigen (HBsAg) antibodies and variants thereof and antigens (HBsAg).

[1. Method for Controlling Affinity of Antibody for Antigen]
In the method of controlling the affinity of the antibody for an antigen of the present embodiment (hereinafter also referred to as "control method"), an antibody whose CDR electrical properties are neutral or negative based on the CDR amino acid sequence to control the affinity of The control method of the present embodiment is achieved by substituting charged amino acid residues for at least three amino acid residues of FR3 defined by the Chothia method in an antibody having such electrical properties. It allows you to control your sexuality. Here, "controlling affinity" refers to both improving the affinity of an antibody for an antigen and reducing the affinity of the antibody for an antigen. Therefore, the control method of this embodiment may be interpreted as a method of modifying the affinity of an antibody for an antigen.

The original antibody whose affinity to the antigen is to be controlled in the control method of this embodiment is also referred to as an "unmodified antibody". As used herein, the substitution of charged amino acid residues for FR3 amino acid residues defined by the Chothia method in an unmodified antibody is also referred to as "mutation". Such substitutions are also referred to as "mutation introduction" or simply "mutation". Antibodies obtained by introducing mutations into unmodified antibodies are also referred to as “affinity-controlled antibodies”.

In this embodiment, the introduction of mutations alters the surface charge distribution of the unmodified antibody to control its affinity for the antigen. That is, an affinity controlled antibody has an increased or decreased affinity for an antigen compared to an unmodified antibody. In this embodiment, the affinity of the antibody whose affinity is controlled for the antigen may be evaluated by kinetic parameters in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as the ELISA method. . Kinetic parameters include an association rate constant (k _on ), a dissociation rate constant (k _off ) and a dissociation constant (K _D ), preferably K _D . Kinetic parameters in antigen-antibody reactions can be obtained by surface plasmon resonance (SPR) technology.

When the control method of the present embodiment improves the affinity of the antibody for the antigen, for example, the K _D value in the antigen-antibody reaction is about 1/2, about 1/5, about 1/10, about 1/20, about 1/50, about 1/100 or about 1/1000. On the other hand, when the affinity of the antibody for the antigen is reduced, the K _D value in the antigen-antibody reaction is about 2-fold, about 5-fold, about 10-fold, about 20-fold, about 50-fold compared to the unmodified antibody. times, about 100 times or about 1000 times.

In this embodiment, the unmodified antibody may be an antibody that recognizes any antigen. In a preferred embodiment, the unmodified antibody is an antibody in which the nucleotide sequences of genes encoding light and heavy chain variable regions are known or can be confirmed. Specifically, it is an antibody for which the nucleotide sequence of the antibody gene is disclosed in a known database, or an antibody for which a hybridoma producing the antibody is available. Such databases include, for example, GeneBank provided by the National Center for Biotechnology Information (NCBI). Further, the class of the antibody may be any of IgG, IgA, IgM, IgD and IgE, preferably IgG.

In this embodiment, the unmodified antibody may be in the form of an antibody fragment as long as it has a variable region containing FR3 to be mutated. Affinity-controlled antibodies may also be in the form of antibody fragments, as long as they have variable regions containing mutated FR3. Examples of such antibody fragments include Fab fragments, F(ab')2 fragments, Fab' fragments, Fd fragments, Fv fragments, dAb fragments, single chain antibodies (scFv) and the like. Among them, Fab fragments are particularly preferred.

Three CDRs are present in each of the variable regions of the light and heavy chains of an antibody, and constitute the antigen-binding site of the antibody. The three CDRs are called CDR1, CDR2 and CDR3 counting from the amino terminus of the antibody chain. Since the CDRs are responsible for the specificity of the antibody, it is preferred in this embodiment that the affinity controlled antibody does not have mutations in the CDRs. That is, the amino acid sequences of the CDRs of the affinity controlled antibody are preferably the same as the amino acid sequences of the CDRs of the unmodified antibody.

A framework region (FR) is a region other than the CDRs present in each variable region of the light chain and heavy chain of an antibody. FRs serve as scaffolds connecting the three CDRs and contribute to the structural stability of the CDRs. As such, the amino acid sequences of FRs are highly conserved among antibodies of the same species. FR3 is one of FRs and refers to the region between CDR2 and CDR3.

Methods for numbering amino acid residues of CDRs (hereinafter also referred to as "numbering methods") for defining boundaries and lengths of CDRs are known in the art. Examples of such numbering methods include Chothia method (Chothia C. and Lesk AM., Canonical Structures for the Hypervariable Regions of Immunoglobulins., J Mol Biol., vol.196, p.901-917, 1987), Kabat method (Kabat EA. et al., Sequences of Proteins of Immunological Interest., NIH publication No.91-3242), IMGT method (Lefranc MP., IMGT Unique Numbering for the Variable (V), Constant (C), and Groove (G) Domains of IG, TR, MH, IgSF, and MhSF., Cold Spring Harb Protoc. 2011(6):633-642, 2011), Honegger method (Honegger A. et al., Yet Another Numbering Scheme for Immunoglobulin Variable Domains: An Automatic Modeling and Analysis Tool., J Mol Biol., vol.309, p.657-670, 2001), ABM method, Contact method and the like are known. When the amino acid residues of the CDRs are numbered, the FRs, which are regions other than the CDRs, are also numbered. In this embodiment, the CDR and FR3 boundaries and lengths are defined by the Chothia method, but may be defined by other numbering methods.

According to the Chothia method, light chain FR3 is defined as a region consisting of amino acid residues 53-90, and heavy chain FR3 is defined as a region consisting of amino acid residues 56-95. Here, for comparison, Tables 1 and 2 show the FR3 numbers (positions of amino acid residues at the start and end points of FR3) of light and heavy chains as defined by the Chothia method and other numbering methods. The Vernier zone residues in the table are amino acid residues that contribute to the structural stability of the CDR among the amino acid residues contained in the FR. Tables 1 and 2 also show the positions of the Vernier zone residues in FR3 defined by each numbering scheme. Table 1 also shows the positions where mutations were introduced in the FR3 of the light chain in Example 1, as defined by each numbering method.

In this embodiment, at least three mutations may be introduced into any of the amino acid residues of FR3 defined by the Chothia method (hereinafter also simply referred to as "FR3") in the unmodified antibody. Preferably, at least three mutations are introduced into amino acid residues in a region of FR3 excluding amino acid residues that are folded inside the molecule and are not exposed on the surface (hereinafter also referred to as “non-exposed residues”). Since mutagenesis of non-exposed residues is not expected to affect the surface charge, non-exposed residues are preferably excluded from the positions to be mutated. The amino acid residues in the region excluding non-exposed residues from FR3 are specifically the 53rd to 81st amino acid residues of FR3 of the light chain and the 56th to 88th amino acids of FR3 of the heavy chain. is a residue.

More preferably, at least three mutations are introduced into amino acid residues in a region of FR3 excluding non-exposed residues and Vernier zone residues. This is because, as described above, Vernier zone residues contribute to the structural stability of CDRs. The amino acid residues in the region excluding non-exposed residues and Vernier zone residues from FR3 are specifically amino acid residues 53-63, 65, 67, 70 and 72-81 of FR3 of the light chain. Amino acid residues 56-66, 68, 70, 72, 74-77 and 79-88 of FR3 of the heavy chain.

More preferably, at least three mutations are introduced into amino acid residues whose side chains face the molecular surface among the amino acid residues in the region of FR3 excluding non-exposed residues and Vernier zone residues. Amino acid residues with side chains facing the molecular surface are replaced with charged amino acid residues, thereby contributing more to the surface charge. The amino acid residues with the side chain facing the molecular surface in FR3 are 53, 54, 56, 57, 60, 63, 65, 67, 70, 72, 74, 76, 77 and 79-81 of FR3 of the light chain. 56, 57, 59, 61, 62, 64-66, 68, 70, 72, 74, 75, 77, 79, 81, 83, 84 and 86-88 of FR3 of the heavy chain is an amino acid residue of

In this embodiment, at least three mutations may be introduced in either FR3 of the light chain or FR3 of the heavy chain. From the viewpoint of antibody thermostability, it is preferable to introduce at least three mutations into FR3 of the light chain. If both the light chain and heavy chain FR3 have mutations, it is preferred to introduce at least 3 mutations in the light chain FR3 and at least 3 mutations in the heavy chain FR3.

In this embodiment, the upper limit of the number of mutations to be introduced into FR3 is not particularly limited, but preferably 16 amino acids or less. That is, the number of mutations in FR3 of the affinity controlled antibody is specifically 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 is.

As described above, in the control method of this embodiment, introduction of mutations into an unmodified antibody changes the surface charge distribution, thereby changing the affinity for the antigen. Thus, it is preferred that all at least three mutations are substitutions with charged amino acid residues having the same charge. That is, preferably all of the at least three mutations are substitutions with acidic amino acid residues or substitutions with basic amino acid residues.

Charged amino acid residues refer to aspartic acid, glutamic acid, lysine, arginine and histidine residues. Acidic amino acid residues refer to aspartic acid residues and glutamic acid residues. Basic amino acid residues refer to lysine, arginine and histidine residues. In the present embodiment, lysine residues and arginine residues are preferred as the basic amino acid residues to be introduced into FR3 as mutations.

In this embodiment, the at least three mutations introduced into the unmodified antibody may be mutations that replace neutral amino acid residues in FR3 with charged amino acid residues. Neutral amino acid residues include alanine residues, asparagine residues, isoleucine residues, glycine residues, glutamine residues, cysteine residues, threonine residues, serine residues, tyrosine residues, phenylalanine residues, and proline residues. valine, methionine, leucine and tryptophan residues.

As described above, in the present embodiment, antibodies whose CDR electrical properties are neutral or negative based on the amino acid sequence of the CDRs are targeted for control of their affinity to antigens. As used herein, the electrical properties of CDRs are indices independently defined by the present inventors, and are determined based on the number of charged amino acid residues in the amino acid sequence of the CDRs. Specifically, the electrical properties of the CDR are determined by the following formula (I).

X = [number of basic amino acid residues in the CDR amino acid sequence] - [number of acidic amino acid residues in the CDR amino acid sequence] (I)
(Wherein, when X is -1, 0 or 1, the electrical properties of the CDR are neutral,
when X is 2 or more, the electrical properties of the CDR are positively charged;
When X is less than or equal to -2, the electrical properties of the CDR are negatively charged)

The electrical properties of the CDRs are preferably determined based on the amino acid sequences of both the light and heavy chain CDRs. In this case, the CDR amino acid sequences in formula (I) refer to all the amino acid sequences of the light chain CDR1, CDR2 and CDR3 and the heavy chain CDR1, CDR2 and CDR3. In this embodiment, at least three amino acid residues of FR3 of the light chain are charged in an antibody whose electrical properties are neutral or negatively charged as determined based on the amino acid sequences of the CDRs of both the light chain and the heavy chain. Substitution with an amino acid residue is preferred.

The electrical properties of the CDRs may be determined for each of the light chain CDRs and the heavy chain CDRs. That is, when determining the electrical properties of the light chain CDRs, the amino acid sequence of the CDRs in formula (I) refers to all the amino acid sequences of the light chain CDR1, CDR2 and CDR3. Also, when determining the electrical properties of the heavy chain CDRs, the amino acid sequence of the CDRs in formula (I) refers to all amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain. In this embodiment, in antibodies whose light chain CDRs are electrically neutral or negatively charged, at least three amino acid residues in FR3 of the light chain are preferably substituted with charged amino acid residues.

CDR amino acid sequences can be obtained from public databases that disclose the sequences of antibody genes. Alternatively, if there is a hybridoma that produces an unmodified antibody, the amino acid sequences of the CDRs can be obtained by obtaining nucleic acids encoding heavy and light chains from the hybridoma by known methods, and sequencing the base sequences of the nucleic acids. can be obtained by

The electrical properties of CDRs vary from antibody to antibody. For example, as shown in Example 3 below, the light chain CDR of a wild-type (i.e., unmodified) anti-insulin antibody has one basic amino acid residue (arginine) and the presence of acidic amino acid residues. do not. Therefore, the electrical properties of the CDRs of wild-type anti-insulin antibodies are defined as neutral (X=1). Also, the light chain CDRs of the wild-type anti-TSHR antibody have five acidic amino acid residues (aspartic acid) and no basic amino acid residues. Thus, the electrical properties of the CDRs of wild-type anti-TSHR antibodies are defined as negatively charged (X=-5).

In an unmodified antibody with neutral CDR electrical properties, substitution of at least three amino acid residues in FR3 with acidic amino acid residues results in a negative surface charge over a wide area, including the antigen-binding site of the antibody. becomes. In addition, in unmodified antibodies whose CDRs are neutral in electrical properties, substitution of at least three amino acid residues in FR3 with basic amino acid residues results in a wide range of surface area, including the antigen-binding site of the antibody. The charge becomes positive. Such changes in surface charge result in electrostatic interactions (attraction or repulsion) when antibody and antigen bind. That is, by substituting at least three amino acid residues in FR3 with acidic amino acid residues in an unmodified antibody whose CDR electrical properties are neutral, the affinity of the antibody for the antigen is reduced compared to that of the unmodified antibody. can be lowered. In an unmodified antibody whose CDR electrical properties are neutral, at least three amino acid residues in FR3 are substituted with basic amino acid residues to increase the affinity of the antibody for the antigen to that of the unmodified antibody. can be compared and improved.

In antibodies whose CDRs are negatively charged, substitution of at least three amino acid residues in FR3 with acidic amino acid residues results in a negative surface charge over a wide area including the antigen-binding site of the antibody. Due to such surface charge changes, an electrostatic interaction (repulsive force) occurs when an antibody and an antigen bind. That is, in an unmodified antibody whose CDR electrical properties are negatively charged, substituting at least three amino acid residues in FR3 with acidic amino acid residues increases the affinity of the antibody for the antigen compared to that of the unmodified antibody. can be lowered.

In this embodiment, mutations can be introduced into the FR3 of the unmodified antibody by known methods such as DNA recombination techniques and other molecular biological techniques. For example, when there is a hybridoma that produces an unmodified antibody, RNA extracted from the hybridoma is used to perform reverse transcription and RACE (Rapid Amplification of cDNA ends), as shown in Example 1 below. A polynucleotide encoding a light chain and a polynucleotide encoding a heavy chain are each synthesized. By amplifying these polynucleotides by PCR using primers for introducing mutations into at least three amino acid residues of FR3, polynucleotides encoding light chains and heavy chains into which mutations have been introduced into FR3 Obtaining a polynucleotide that encodes The resulting polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding the affinity-controlled antibody. Here, the light chain-encoding polynucleotide and the heavy chain-encoding polynucleotide may be incorporated into one expression vector, or may be separately incorporated into two expression vectors. The type of expression vector is not particularly limited, and may be an expression vector for mammalian cells or an expression vector for E. coli. Affinity-controlled antibodies can be obtained by transducing or transfecting the resulting expression vectors into suitable host cells (eg, mammalian cells or E. coli).

When obtaining an antibody with controlled affinity, which is a single chain antibody (scFv), for example, as shown in Patent Document 2, using RNA extracted from the above hybridoma, the light chain is obtained by reverse transcription and PCR. Each of the polynucleotide encoding the variable region and the polynucleotide encoding the heavy chain variable region may be synthesized. These polynucleotides are ligated by overlap extension PCR or the like to obtain a polynucleotide encoding an unmodified scFv. The resulting polynucleotide is amplified by PCR using primers for introducing mutations into at least three amino acid residues of FR3 to obtain a polynucleotide encoding scFv in which mutations have been introduced into FR3. . The resulting polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding the affinity controlled antibody in the form of scFv. Affinity-controlled antibodies in the form of scFv can be obtained by transducing or transfecting the resulting expression vector into a suitable host cell.

If there is no hybridoma that produces an antibody that recognizes the antigen of interest, the antibody can be detected by a known method such as the method described in Kohler and Milstein, Nature, vol.256, p.495-497, 1975. A production hybridoma may be produced. Alternatively, RNA obtained from the spleens of animals such as mice immunized with the antigen of interest may be used. When using RNA obtained from spleen, for example, as shown in Non-Patent Document 1, from among the obtained unmodified Fab-encoding polynucleotides, unmodified having desired affinity by phage display method or the like Polynucleotides encoding Fabs may be selected.

[2. Method for Producing Antibody with Altered Affinity for Antigen]
The scope of the present invention also includes methods for producing antibodies with altered affinity for antigens (hereinafter also referred to as “production methods”). In the production method of the present embodiment, first, in an antibody whose CDR electrical properties are neutral or negative based on the CDR amino acid sequence, at least three amino acid residues of FR3 defined by the Chothia method are replaced with charged amino acid residues. Perform the step of replacing with

The antibody described above in which the FR3 amino acid residue is substituted in the production method of this embodiment is the same as the unmodified antibody in the control method of this embodiment. Hereinafter, the original antibody whose affinity to the antigen is to be modified in the production method of the present embodiment is also referred to as "unmodified antibody". The details of the electrical characteristics of the CDR are the same as those described for the control method of this embodiment. The electrical properties of the CDRs of the antibody can be determined according to formula (I) above. FR3 defined by the Chothia method is the same as described for the control method of this embodiment, and is shown in Tables 1 and 2.

In the production method of the present embodiment, an antibody with altered affinity for an antigen can be obtained by changing the surface charge distribution of the antibody by substituting amino acid residues. That is, in the above substitution step, in an antibody with neutral or negatively charged CDR electrical properties, at least three amino acid residues of FR3 defined by the Chothia method are substituted with charged amino acid residues, and the antibody against the antigen It can be said to be a step of modifying the affinity. For example, in the above substitution step, in an antibody whose CDR electrical properties are neutral, at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues to increase the affinity of the antibody for the antigen. It may be a step of lowering compared to the unmodified antibody. In addition, in the above-described substitution step, in an antibody whose CDR electrical properties are neutral, at least three amino acid residues of FR3 defined by the Chothia method are substituted with basic amino acid residues to improve the affinity of the antibody for the antigen. is improved compared to the unmodified antibody. Alternatively, the above substitution step substitutes acidic amino acid residues for at least three amino acid residues of FR3 defined by the Chothia method in an antibody whose CDR electrical properties are negatively charged, thereby increasing the affinity of the antibody for the antigen. It may be a step of lowering compared to the unmodified antibody.

In this embodiment, at least three amino acid residues of FR3 of the light chain are charged in an antibody whose electrical properties are neutral or negatively charged as determined based on the amino acid sequences of the CDRs of both the light chain and the heavy chain. Substitution with an amino acid residue is preferred. Also, in antibodies in which the electrical properties of the light chain CDRs are neutral or negatively charged, it is preferred to replace at least three amino acid residues in FR3 of the light chain with charged amino acid residues.

Substitution of amino acid residues can be performed by known methods such as DNA recombination techniques and other molecular biological techniques. For example, when there is a hybridoma that produces an antibody whose CDR electrical properties are neutral or negatively charged, an antibody with altered affinity for the antigen is produced in the same manner as described for the control method of the present embodiment. An expression vector containing an encoding polynucleotide can be obtained. The resulting expression vector can then be transduced or transfected into a suitable host cell to obtain a host cell that expresses the antibody.

Next, in the production method of this embodiment, the antibody obtained in the replacement step is collected. For example, host cells expressing antibodies with altered affinity for an antigen are lysed in a solution containing a suitable solubilizing agent to release the antibodies into the solution. If the host cells secrete antibodies with altered affinity for the antigen into the medium, the culture supernatant is harvested. Released antibodies can be recovered by methods known in the art, such as affinity chromatography. For example, if the antibody produced is IgG, it can be recovered by affinity chromatography using protein A or G. If desired, the recovered antibody may be purified by methods known in the art such as gel filtration.

The affinity of the produced antibody for the antigen may be evaluated by kinetic parameters in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as the ELISA method. For antibodies with improved affinity for antigens, for example, the K _D value in the antigen-antibody reaction is about 1/2, about 1/5, about 1/10, about 1/1 compared to the original antibody. 20, about 1/50, about 1/100 or about 1/1000. Antibodies with reduced affinity for the antigen have a K _D value in the antigen-antibody reaction that is about 2-fold, about 5-fold, about 10-fold, about 20-fold, about 50-fold, About 100 times or about 1000 times.

[3. Antibodies with Altered Affinity for Antigens]
The scope of the present invention also includes antibodies with altered affinities for antigens (hereinafter also referred to as “altered antibodies”). The modified antibody of this embodiment is characterized in that the electrical properties of the CDRs based on the CDR amino acid sequences are neutral or negatively charged. The details of the electrical characteristics of the CDR are the same as those described for the control method of this embodiment. The electrical properties of the CDRs of the modified antibody can be determined according to formula (I) above.

In the modified antibody of this embodiment, at least three amino acid residues of FR3 defined by the Chothia method in the unmodified antibody are replaced with charged amino acid residues. That is, the modified antibody of this embodiment has at least three mutations by substitution with charged amino acid residues in FR3 defined by the Chothia method, compared with the amino acid sequence of the unmodified antibody. The modified antibody of this embodiment is the same as the above-described "affinity-controlled antibody". FR3 defined by the Chothia method is the same as described for the control method of this embodiment, and is shown in Tables 1 and 2.

Here, an unmodified antibody refers to an antibody before its affinity for an antigen has been modified. In other words, the unmodified antibody is the original antibody of the modified antibody, and the amino acid residues of FR3 defined by the Chothia method are not replaced with charged amino acid residues. This unmodified antibody corresponds to the original antibody whose affinity to the antigen is to be controlled in the control method of this embodiment. In this embodiment, the unmodified antibody has CDRs that are neutral or negatively charged in electrical properties.

In the modified antibody of this embodiment, the surface charge distribution of the antibody is changed by introducing mutations. That is, the modified antibody has improved or decreased affinity for the antigen compared to the unmodified antibody. In this embodiment, the affinity of the modified antibody for the antigen may be evaluated by kinetic parameters in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as the ELISA method. The types and acquisition of dynamic parameters are the same as those described for the control method of this embodiment.

Modified antibodies with improved affinity for antigens, for example, have an antigen-antibody reaction K _D value of about 1/2, about 1/5, about 1/10, or about 1/1, compared to an unmodified antibody. 20, about 1/50, about 1/100 or about 1/1000. Modified antibodies with reduced affinity for antigens have, for example, an antigen-antibody reaction K _D value of about 2-fold, about 5-fold, about 10-fold, about 20-fold, or about 50-fold compared to an unmodified antibody. times, about 100 times or about 1000 times.

A modified antibody may be an antibody that recognizes any antigen. Further, the class of the antibody may be any of IgG, IgA, IgM, IgD and IgE, preferably IgG. The modified antibody of this embodiment may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation has been introduced. The type of antibody fragment is the same as described for the control method of this embodiment.

The modified antibodies of this embodiment preferably have no mutations in the CDRs. That is, the CDR amino acid sequence of the modified antibody is preferably the same as the CDR amino acid sequence of the unmodified antibody.

In the modified antibody of this embodiment, at least three mutations may be introduced into any amino acid residue of FR3 defined by the Chothia method in the unmodified antibody. Preferably, at least three mutations are introduced to amino acid residues in a region of FR3 minus non-exposed residues. The amino acid residues in the region excluding non-exposed residues from FR3 are the same as those described for the control method of this embodiment.

More preferably, at least three mutations are introduced into amino acid residues in a region of FR3 excluding unexposed residues and Vernier zone residues. The amino acid residues in the region excluding non-exposed residues and Vernier zone residues from FR3 are the same as those described in the control method of this embodiment.

More preferably, at least three mutations are introduced into amino acid residues whose side chains face the molecular surface among the amino acid residues in the region of FR3 excluding non-exposed residues and Vernier zone residues. The amino acid residue with the side chain facing the molecular surface in FR3 is the same as described for the control method of this embodiment.

In this embodiment, at least three amino acid residue mutations may be introduced into either FR3 of the light chain or FR3 of the heavy chain, preferably FR3 of the light chain. When both the FR3 of the light chain and the heavy chain have mutations, at least 3 amino acid residue mutations are introduced into the light chain FR3 and at least 3 amino acid residue mutations are introduced into the heavy chain FR3. preferably.

In this embodiment, the upper limit of the number of mutations in FR3 of the modified antibody is not particularly limited, but preferably 16 amino acids or less. Specifically, the number of mutations in FR3 of the modified antibody is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

In this embodiment, the at least three mutations in the modified antibody may be mutations in which neutral amino acid residues in FR3 are replaced with charged amino acid residues. Also, in this embodiment, it is preferred that all of the at least three mutations are substitutions with charged amino acid residues having the same charge. That is, preferably all of the at least three mutations are substitutions with acidic amino acid residues or substitutions with basic amino acid residues.

Modified antibodies of the present embodiment include, for example, the following antibodies (1) to (3).
(1) The electrical properties of the CDR are neutral, at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues, and the affinity of the antibody for the antigen is higher than that of an unmodified antibody. lowered antibodies,
(2) An antibody whose CDR electrical properties are neutral, at least three amino acid residues of FR3 defined by the Chothia method are substituted with basic amino acid residues, and the affinity of the antibody for the antigen is unmodified. improved antibodies compared to
(3) the electrical properties of the CDRs are negatively charged, at least three amino acid residues of FR3 defined by the Chothia method are replaced with acidic amino acid residues, and the affinity of the antibody for the antigen is lower than that of an unmodified antibody; Decreased antibodies.

Specific examples of modified antibodies include modified anti-insulin antibodies and anti-TSHR antibodies. In such a modified anti-insulin antibody, the CDRs have neutral electrical properties, and the 63rd, 65th, 67th, 70th and 72nd amino acid residues in FR3 of the light chain are substituted with basic amino acid residues. be. This modified antibody has improved affinity for the antigen, insulin, compared to the unmodified antibody. On the other hand, the modified antibody in which the 63rd, 65th, 67th, 70th and 72nd amino acid residues in the FR3 of the light chain were substituted with acidic amino acid residues had higher affinity for the insulin antigen than the unmodified antibody. declining. In addition, in the modified anti-TSHR antibody, the electrical properties of the CDRs are negatively charged, and the 63rd, 65th, 67th, 70th and 72nd amino acid residues in FR3 of the light chain are substituted with acidic amino acid residues. This modified antibody has a lower affinity for the antigen TSHR than the unmodified antibody.

The modified antibodies of this embodiment can be produced by known methods such as DNA recombination techniques and other molecular biological techniques. For example, when there is a hybridoma that produces an antibody whose CDR electrical properties are neutral or negatively charged, at least three amino acid residues of FR3 are Antibodies can be generated in which the groups are replaced with charged amino acid residues.

In this embodiment, the method of using modified antibodies is the same as that of unmodified antibodies. Modified antibodies, like unmodified antibodies, can be used in various tests and studies. In addition, the modified antibody of this embodiment may be modified with a labeling substance or the like known in the art.

The scope of the present invention includes isolated and purified polynucleotides encoding antibodies or fragments thereof with altered affinity for the antigen of the present embodiments. The isolated and purified polynucleotide encoding the modified antibody fragment of the present embodiment preferably encodes a variable region containing FR3 into which mutations have been introduced. Also included within the scope of the invention are vectors comprising the above polynucleotides. Vectors are polynucleotide constructs designed for transduction or transfection. The type of vector is not particularly limited, and can be appropriately selected from vectors known in the art, such as expression vectors, cloning vectors, and virus vectors. Also included within the scope of the invention is a host cell containing the vector. The type of host cell is not particularly limited, and can be appropriately selected from eukaryotic cells, prokaryotic cells, mammalian cells, and the like.

EXAMPLES The present invention will be described in detail below with reference to Examples, but the present invention is not limited to these Examples.

Example 1 Production of Antibodies with Charged Amino Acid Residues Introduced into FR3 Three or five amino acid residues of FR3 of anti-insulin antibody and anti-thyroid stimulating hormone receptor (TSHR) antibody were replaced with charged amino acid residues, Mutants of each antibody were generated.

(1) Acquisition of wild-type anti-insulin antibody and wild-type anti-TSHR antibody genes
[reagent]
ISOGEN (Nippon Gene Co., Ltd.)
SMARTer® RACE 5'/3' Kit (clontech)
10x A-attachment mix (Toyobo Co., Ltd.)
pcDNA™ 3.4 TOPO® TA Cloning Kit (Thermo Fisher)
Competent high DH5α (Toyobo Co., Ltd.)
QIAprep Spin Miniprep Kit (QIAGEN)
KOD plus neo (Toyobo Co., Ltd.)
Ligation high ver.2 (Toyobo Co., Ltd.)

(1.1) Acquisition of wild-type anti-insulin antibody gene
(1.1.1) Extraction of total RNA from antibody-producing hybridoma Using human insulin as an antigen, wild-type mice were extracted by the method described in Kohler and Milstein, Nature, vol. Hybridomas producing anti-human insulin antibodies were constructed. The hybridoma culture (10 mL) was centrifuged at 1000 rpm for 5 minutes and the supernatant was removed. The obtained cells were lysed with ISOGEN (1 mL) and allowed to stand at room temperature for 5 minutes. Chloroform (200 μL) was added thereto, stirred for 15 seconds, and then allowed to stand at room temperature for 3 minutes. Then, this was centrifuged at 12000×G for 10 minutes at 4° C. to recover the aqueous phase (500 μL) containing RNA. Isopropanol (500 μL) was added to the collected aqueous phase and mixed. The resulting mixture was allowed to stand at room temperature for 5 minutes and then centrifuged at 12000×G for 10 minutes at 4°C. The supernatant was removed, 70% ethanol (1 mL) was added to the resulting precipitate (total RNA), and the mixture was centrifuged at 7500×G for 10 minutes at 4°C. The supernatant was removed and the RNA was air dried and dissolved in RNase-free water (20 μL).

(1.1.2) Synthesis of cDNA Using each total RNA obtained in (1.1.1) above, an RNA sample having the following composition was prepared.
[RNA sample]
Total RNA (500 ng/μL) 1 μL
RT primer 1 μL
Deionized water 1.75 μL
Total 3.75 μL

The prepared RNA samples were heated at 72°C for 3 minutes and then incubated at 42°C for 2 minutes. Then, 12 μM SMARTerIIA oligonucleotide (1 μL) was added to the RNA sample to prepare a sample for cDNA synthesis. Using this sample for cDNA synthesis, a reverse transcription reaction solution having the following composition was prepared.
[Reverse transcription reaction solution]
2 μL of 5x First-Strand buffer
1 μL of 20 mM DTT
1 μL of 10 mM dNTP mix
RNAase inhibitor 0.25μL
SMARTScribe RT (100U/μL) 1μL
Sample for cDNA synthesis 4.75μL
Total 10 μL

The prepared reverse transcription reaction solution was allowed to react at 42°C for 90 minutes. Then, the reaction solution was heated at 70° C. for 10 minutes, and tricine-EDTA (50 μL) was added. Using the resulting solution as a cDNA sample, a 5'RACE reaction solution having the following composition was prepared.
[5'RACE reaction solution]
5 μL of 10x PCR buffer
dNTP mix 5μL
3.5 _μL of 25 mM _Mg2SO4
cDNA sample 2.5 μL
5 μL of 10x Universal Primer Mix
3'-Primer 1 μL
KOD plus neo (1U/μL) 1μL
Purified water 27 μL
Total 50 μL

The prepared 5'RACE reaction solution was subjected to RACE reaction under the following reaction conditions. "Y" below is 90 seconds for the light chain and 150 seconds for the heavy chain.
[Reaction conditions]
2 minutes at 94°C,
30 cycles of 98°C for 10 seconds, 50°C for 30 seconds, and 68°C for Y seconds, and
3 minutes at 68°C.

A solution having the following composition was prepared using the 5'RACE product obtained by the above reaction. The solution was reacted at 60°C for 30 minutes to add adenine to the end of the 5'RACE product.
9 μL of 5'RACE product
10x A-attachment mix 1μL
Total 10 μL

A TA cloning reaction solution having the following composition was prepared using the obtained adenine addition product and pcDNA™ 3.4 TOPO (registered trademark) TA cloning kit. The reaction was incubated at room temperature for 10 minutes and the adenine adduct was cloned into pCDNA3.4.
[TA cloning reaction solution]
Adenine adduct 4 μL
salt solution 1 μL
1 μL of pCDNA3.4
Total 6 μL

(1.1.3) Transformation, plasmid extraction, and sequence confirmation Add the TA cloning sample (3 μL) obtained in (1.1.2) above to DH5α (30 μL), leave on ice for 30 minutes, and mix. was heated at 42°C for 45 seconds for heat shock. After standing again on ice for 2 minutes, the entire amount was applied to an ampicillin-containing LB plate. The plates were incubated at 37°C for 16 hours. A single colony on the plate was picked into an ampicillin-containing LB liquid medium and cultured with shaking (250 rpm) at 37°C for 16 hours. The culture was centrifuged at 5000×G for 5 minutes to recover E. coli transformants. A plasmid was extracted from the collected E. coli using the QIAprep Spin Miniprep kit. Specific operations were performed according to the manual attached to the kit. The nucleotide sequence of the resulting plasmid was confirmed using pCDNA3.4 vector primers. Hereafter, this plasmid was used as a mammalian cell expression plasmid.

(1.2) Acquisition of Wild-type Anti-TSHR Antibody Gene Synthesis of the wild-type human anti-TSHR antibody gene was entrusted to GenScript Japan Co., Ltd., and the wild-type human anti-TSHR antibody gene was obtained.

(2) Acquisition of mutant genes for each antibody
(2.1) Primer design and PCR
In order to introduce mutations in the FR3 defined by the Chothia method in the light chain of each antibody, the plasmid containing the wild-type anti-insulin antibody gene obtained in (1.1.3) above, the wild-type obtained in (1.2) PCR was performed using the anti-TSHR antibody gene and the primers shown by the nucleotide sequences below. The D5 mutant is a mutant in which 5 amino acid residues of FR3 are mutated to aspartic acid residues, and the E5 mutant is a mutant in which 5 amino acid residues of FR3 are mutated to glutamic acid residues. A K5 mutant is a mutant in which 5 amino acid residues of FR3 are mutated to lysine residues, and an R5 mutant is a mutant in which 5 amino acid residues of FR3 are mutated to arginine residues. The R3 mutant is a mutant in which three amino acid residues of FR3 are mutated to arginine residues.

[Primer for anti-insulin antibody]
Sequence 1 D5 Mutant REV: 5' TTCGTATTCGGTCCCTTCCCCTTCGCCTTCAAAGCGAGCA 3' (SEQ ID NO: 1)
Sequence 2 E5 Mutant REV: 5' ATCGTAATCGGTCCCATCCCCATCGCCATCAAAGCGAGCA 3' (SEQ ID NO: 2)
Sequence 3 K5 Mutant REV: 5' CTTGTACTTGGTCCCCTTCCCCTTGCCCTTAAAGCGAGCA 3' (SEQ ID NO: 3)
Sequence 4 R5 Mutant REV: 5' TCTGTATCTGGTCCCTCTCCCTCTGCCTCTAAAGCGAGCA 3' (SEQ ID NO: 4)
Sequence 5 FOR: 5'CTCACAATCAGCTGATTG 3' (SEQ ID NO: 5)
Sequence 6 R3 Mutant REV: 5' TCTCCCTCTGCCTCTAAAGCGAGCA 3' (SEQ ID NO: 6)
Sequence 7 R3 Mutant FOR: 5' GGGACCAGATACAGA 3' (SEQ ID NO: 7)

The primer of sequence 5 was used as a forward primer common to the primers of sequences 1-4. In addition, the primer of sequence 7 was used as a forward primer for the primer of sequence 6.

[Anti-TSHR antibody primer]
Sequence 8 D5 Mutant FOR: 5' GGCACAGACGCCGACCTGGCAATCA 3' (SEQ ID NO: 8)
Sequence 9 D5 Mutant REV: 5' GTCCCGGTCTCCGTCAAACCGGTCG 3' (SEQ ID NO: 9)
Sequence 10 E5 Mutant FOR: 5' GGCACAGAGGCCGAGCTGGCAATCA 3' (SEQ ID NO: 10)
Sequence 11 E5 Mutant REV: 5' CTCCCGCTCTCCCTCAAACCGGTCG 3' (SEQ ID NO: 11)
Sequence 12 K5 Mutant FOR: 5' GGCACAAAGGCCAAGCTGGCAATCA 3' (SEQ ID NO: 12)
Sequence 13 K5 Mutant REV: 5' CTTCGCGCTTTCCCTTAAACCGGTCG 3' (SEQ ID NO: 13)
Sequence 14 R5 Mutant FOR: 5' GGCACAAGGGCCAGGCTGGCAATCA 3' (SEQ ID NO: 14)
Sequence 15 R5 Mutant REV: 5' CCTCGCGCCTTCCCCTAAACCGGTCG 3' (SEQ ID NO: 15)

Using the plasmid obtained in (1.3) above as a template, a PCR reaction solution having the following composition was prepared.
[PCR reaction solution]
5 μL of 10x PCR buffer
₃ µL of 25 mM _Mg2SO4
2mM dNTP mix 5μL
Forward primer 1 μL
Reverse primer 1 μL
Template plasmid (40 ng/μL) 0.5 μL
KOD plus neo (1U/μL) 1μL
Purified water 33.5 μL
Total 50 μL

The prepared PCR reaction solution was subjected to PCR reaction under the following reaction conditions.
[Reaction conditions]
2 minutes at 98°C,
30 cycles of 98°C for 10 seconds, 54°C for 30 seconds, and 68°C for 4 minutes, and
3 minutes at 68°C.

2 μL of DpnI (10 U/μL) was added to the resulting PCR product (50 μL) to fragment the PCR product. A ligation reaction solution having the following composition was prepared using the DpnI-treated PCR product. The reaction mixture was incubated at 16°C for 1 hour to carry out ligation reaction.
[Ligation reaction solution]
DpnI-treated PCR product 2 μL
Ligation high ver.2 5μL
1 μL of T4 Polynucleotide Kinase
Purified water 7 μL
Total 15 μL

(2.2) Transformation, Plasmid Extraction, and Sequence Confirmation The solution (3 μL) after the ligation reaction was added to DH5α (30 μL), and E. coli transformants were obtained in the same manner as in (1.1.3) above. A plasmid was extracted from the resulting E. coli using the QIAprep Spin Miniprep kit. The base sequence of each plasmid obtained was confirmed using pCDNA3.4 vector primers. These plasmids were hereinafter used as mammalian cell expression plasmids.

(3) Expression in mammalian cells
[reagent]
Expi293™ cells (Invitrogen)
Expi293™ Expression Medium (Invitrogen)
ExpiFectamine™ 293 Transfection Kit (Invitrogen)

(3.1) Transfection
Expi293 cells were grown in a shaking culture (150 rpm) at 37°C in a 5% CO2 atmosphere. A number of 30 mL cell cultures (3.0 x 106 cells/mL) was prepared according to the number of samples. Using a plasmid encoding each FR3 mutant and a plasmid encoding a wild-type antibody, a DNA solution having the following composition was prepared and allowed to stand for 5 minutes.
[DNA solution]
Amount (μL) equivalent to 15 μg of light chain plasmid solution
Amount (μL) equivalent to 15 μg of heavy chain plasmid solution
Opti-MEM (trademark) Appropriate volume (mL)
1.5 mL total

A transfection reagent having the following composition was prepared and allowed to stand for 5 minutes.
ExpiFectamine Reagent 80μL
Plasmid solution 1420μL
1.5 mL total

The prepared DNA solution and transfection reagent were mixed and allowed to stand for 20 minutes. The resulting mixture (3 mL) was added to the cell culture (30 mL) and cultured with shaking (150 rpm) at 37° C. for 20 hours in a 5% CO ₂ atmosphere. After 20 hours, each culture was added with 150 μL and 1.5 mL of ExpiFectamine™ transfection enhancer 1 and 2, respectively, and cultured with shaking (150 rpm) at 37° C. in a 5% CO ₂ atmosphere for 6 days. bottom.

(3.2) Recovery and Purification of Antibody Each cell culture was centrifuged at 3000 rpm for 5 minutes to recover the culture supernatant. The culture supernatant contains each antibody secreted from the transfected Expi293™ cells. The obtained culture supernatant was again centrifuged at 15000×G for 10 minutes to collect the supernatant. To the resulting supernatant (30 mL), 100 μL of antibody purification carrier Ab-Capcher Mag (Protenova) was added and allowed to react at room temperature for 2 hours. The carrier was magnetically collected, the supernatant was removed, and PBS (1 mL) was added to wash the carrier. 400 μL of 100 mM Gly-HCl (pH 2.8) was added to the carrier to elute the antibody (IgG) captured by the carrier. This elution operation was performed three times in total. The resulting eluate was neutralized with 100 mM Tris-HCl (pH 8.0) to obtain an antibody solution.

(4) Results The 63rd, 65th, 67th, 70th and 72nd serine residues of the light chain FR3 defined by the Chothia method in the wild-type anti-insulin antibody and the wild-type anti-TSHR antibody were replaced with charged amino acid residues. An antibody substituted with (aspartic acid residue, glutamic acid residue, lysine residue or arginine residue) was obtained. Also, an antibody was obtained in which the 63rd, 65th and 67th serine residues of the light chain FR3 defined by the Chothia method in the wild-type anti-insulin antibody were replaced with charged amino acid residues (arginine residues).

Example 2 Measurement of Affinity of Antibodies with Charged Amino Acid Residues Introduced into FR3 It was examined how the affinities of the mutants prepared in Example 1 for antigens would change compared to the wild type.

(1) Antibody fragmentation
Each antibody obtained in Example 1 was converted into Fab fragments using Pierce™ Mouse IgG1 Fab and F(ab')2 Preparation Kit (Thermo Fisher). Specific operations were performed according to the manual attached to the kit. The resulting reaction solution was purified by gel filtration using Superdex 200 Increase 10/300 GL (GE Healthcare). The 50 kDa eluted fraction was collected, and the resulting fraction was used as the Fab fragment-containing solution for subsequent experiments.

(2) Affinity measurement
(2.1) Measurement of Affinity by SPR Technique The affinity of the wild-type anti-insulin antibody and its mutants to the antigen was measured by the SPR technique as follows. Humanin R Injection 100 units (Eli Lilly) was used as an anti-insulin antibody antigen. An antigen was immobilized on a sensor chip Series S Sensor Chip CM5 (GE Healthcare) for Biacore (registered trademark) (immobilization: 100 RU). The anti-insulin antibody Fab fragment containing solution was diluted to prepare 50 nM, 25 nM, 12.5 nM, 6.25 nM and 3.13 nM solutions. Each concentration of Fab fragment-containing solution was sent to Biacore (registered trademark) T200 (GE Healthcare) (association time: 120 seconds and dissociation time: 1200 seconds). The measurement data were analyzed using Biacore® Evaluation software to obtain data on the affinity of anti-insulin antibodies.

(2.2) Evaluation of Affinity by ELISA The affinity of the wild-type anti-TSHR antibody and its mutants to the antigen was measured by ELISA as follows.

(2.2.1) Immobilization of Capturing Antibody As a capturing antibody, 4E31 antibody (RSR), which is a mouse monoclonal anti-TSHR antibody, was used. 4E31 antibody (5 μg) was diluted with PBS to obtain an antibody solution. 100 μL of this antibody solution was added to each well of a NUNC-immunomodule (Cat No. 469949, manufactured by NUNC, hereinafter referred to as “plate”). This plate was allowed to stand at room temperature for 3 hours to immobilize the 4E31 antibody on the wells. After removing the antibody solution, 300 μL of blocking solution (PBS containing 1% BSA) was added to each well of the plate. Blocking was performed at 4°C for 20 hours or longer.

(2.2.2) Primary Reaction Detergent solubilized cell membrane preparation containing the TSHR (RSR) was used as an anti-TSHR antibody antigen. This antigen was diluted 500-fold with PBS containing 1% BSA to obtain an antigen solution. The blocking solution was removed from the 4E31 antibody-immobilized plate, and 50 μL of the antigen solution was added to each well. The plate was shaken at room temperature for 60 minutes for antigen-antibody reaction.

(2.2.3) Secondary Reaction Wild-type anti-TSHR antibody, D5 mutant and R5 mutant were used as detection antibodies. Each antibody was serially diluted with PBS containing 1% BSA to obtain antibody solutions with concentrations of 1000 pM, 100 pM, 10 pM, 1 pM and 0.1 pM. As a secondary antibody, an HRP-labeled anti-human IgG (Fc-specific) antibody was used. This secondary antibody was diluted with PBS containing 1% BSA to obtain a secondary antibody solution with a concentration of 0.2 μg/mL. An antibody solution (50 μL) of each concentration and a secondary antibody solution (50 μL) were mixed to obtain a mixture of antibodies. After removing the antigen solution from the plate, 300 μL of washing solution (1% BSA-containing PBS) was added to each well. Then, the washing solution was removed from the plate, and washing was performed by adding 300 μL of the washing solution to each well. This washing operation was repeated three times. After removing the washing solution from the plate, 100 μL of the antibody mixture was added to each well. The plate was shaken at room temperature for 60 minutes for antigen-antibody reaction. After the reaction, the above washing operation was repeated three times.

(2.2.4) Detection As a substrate solution, 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was used. The wash solution was removed from the plate and substrate solution was added at 100 μL/well. The plate was left at room temperature for 5 minutes. After 5 minutes, 100 μL of stop solution (0.1 MH ₂ SO ₄ ) was added to each well of the plate to terminate the reaction. The absorbance at 450 nm was then measured for each well of the plate.

(3) Results A dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and dissociation rate constant (k _off ) obtained for the anti-insulin antibody. Also, the dissociation constant (K _D ) was calculated from the measured value by ELISA using the anti-TSHR antibody. Kinetic parameters for each antibody are shown in Tables 3 and 4, and Figures 1A and 1B. In the figure, "positive charge" indicates the K _D value of the R5 mutant, and "negative charge" indicates the K _D value of the D5 mutant. In Table 3, the values obtained by global fitting are "average±standard error".

_From Table 3 and FIG. 1A, the K _D values of the R3 mutant, R5 mutant and K5 mutant of the anti-insulin antibody were lower than that of the wild type. Also _, the K _D values of the D5 mutant and the E5 mutant were higher than that of the wild type. Therefore, with respect to anti-insulin antibodies, it was found that by mutating three or five amino acid residues of FR3 to basic amino acid residues, antibodies with improved affinity for antigens compared to wild-type antibodies can be produced. In addition, it was found that by mutating five amino acid residues of FR3 to acidic amino acid residues, an antibody with lower affinity for the antigen than that of the wild type can be produced.

From _Table 4 and FIG. 1B, the K _D value of the D5 mutant of the anti-TSHR antibody was higher than that of the wild type. As for the anti-TSHR antibody, it was found that by mutating five amino acid residues of FR3 to acidic amino acid residues, an antibody with lower affinity for the antigen than the wild type can be produced. _On the other hand, the K _D value of the R5 mutant of the anti-TSHR antibody was comparable to that of the wild type. That is, it is suggested that the affinity of the anti-TSHR antibody does not change even if the five amino acid residues of FR3 are mutated to basic amino acid residues.

Example 3 Relationship between electrical properties of CDR amino acid sequences and affinity for antigen From Example 2, it was possible to improve and decrease the affinity of the anti-insulin antibody by introducing mutations into FR3. On the other hand, the affinity of the anti-TSHR antibody could be reduced by introducing mutations into FR3, but it could not be improved. Therefore, we examined the effects of FR3 mutations on the surface charge of the antigen-binding site of antibodies.

(1) Investigation of changes in antibody surface charge due to mutagenesis The surface charge distribution of the various Fab fragments produced in Example 1 was analyzed using Discovery Studiou (Dassault Systèmes Biovia, Inc.). FIG. 2A shows the surface charge distribution map of the Fab fragment of the anti-insulin antibody and insulin as an antigen. A surface charge distribution map of the Fab fragment of the anti-TSHR antibody and TSHR as an antigen is shown in FIG. 2B. In the figure, the arrow indicates the antigen-binding site, and PI indicates the isoelectric point. Here, the antigen binding site is the same as the CDR. In the figure, the surface charge distribution is indicated by color, blue indicates positive charge, red indicates negative charge, and white indicates electrically neutral.

From FIG. 2A, it was found that the wild-type anti-insulin antibody has a neutral surface charge at the antigen-binding site. Mutants (positive charge mutations) in which basic amino acid residues were introduced into FR3 had a positive surface charge over a wide range including the antigen-binding site. Here, insulin, which is an antigen, is a negatively charged protein, and as shown in FIG. 1A, the affinity for the antigen of the mutant type antigen introduced with a positive charge mutation was improved. On the other hand, in the mutant type (negative charge mutation) in which an acidic amino acid was introduced into FR3, the surface charge in a wide range including the antigen-binding site was negative. As shown in FIG. 1A, the affinity for the antigen of the mutant with the negative charge mutation was decreased. These results show that in the wild-type anti-insulin antibody, the charged amino acid residues introduced into FR3 contribute extensively to the surface charge.

From FIG. 2B, it was found that the wild-type anti-TSHR antibody has a negative surface charge at the antigen-binding site. Mutants (positive charge mutations) in which a basic amino acid was introduced into FR3 had a positive surface charge except for the antigen-binding site, but the surface charge of the antigen-binding site did not change much. Here, the antigen, TSHR, is a negatively charged protein, but as shown in FIG. 1B, there was no change in the affinity for the antigen of the mutant with the positive charge mutation introduced. On the other hand, in the mutant type (negative charge mutation) in which an acidic amino acid was introduced into FR3, the surface charge in a wide range including the antigen-binding site was negative. As shown in FIG. 1B, the affinity for the antigen of the mutant with negative charge mutation was decreased. These results show that in the wild-type anti-TSHR antibody, the acidic amino acid residues introduced into FR3 contribute extensively to the surface charge. On the other hand, even if a basic amino acid residue is introduced into FR3 of the wild-type anti-TSHR antibody, the surface charge is locally different.

(2) Relation between electrical properties of CDR amino acid sequences and control of affinity , thought to be related to the electrical properties of the CDRs of the antibody. Here, the inventors defined the electrical properties of the CDR by the following formula (I).

X = [number of basic amino acid residues in the CDR amino acid sequence] - [number of acidic amino acid residues in the CDR amino acid sequence] (I)
(Wherein, when X is -1, 0 or 1, the electrical properties of the CDR are neutral,
when X is 2 or more, the electrical properties of the CDR are positively charged;
When X is less than or equal to -2, the electrical properties of the CDR are negatively charged)

Table 5 shows the amino acid sequences of the light chain CDRs of wild-type anti-TSHR antibodies (SEQ ID NOs: 16 and 17). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

Since CDRs of anti-insulin antibodies have one basic amino acid residue (arginine) and no acidic amino acid residues, the electrical properties of CDRs are defined as neutral (X=1). As shown in Table 5, the CDRs of the anti-TSHR antibody have five acidic amino acid residues (aspartic acid) and no basic amino acid residues, so the electrical properties of the CDRs are negatively charged (X = -5). As can be seen from Figures 2A and B, the electrical properties of the CDRs of the anti-insulin and anti-TSHR antibodies determined by formula (I) are consistent with the surface charges of the antigen binding sites analyzed in Discovery Studio. Thus, it was found that the electrical properties of the CDRs and the surface charges of the antigen-binding sites are biased depending on the antibody.

(3) Results The analyzes of Examples 2 and 3 suggest that the introduction of charged amino acid residues into FR3 makes a large contribution to antibodies with neutral CDR electrical properties. In addition, it is suggested that in an antibody whose CDRs have neutral electrical properties, the orientation of the antigen-binding site can be controlled by the electrostatic interaction caused by the introduction. On the other hand, it is suggested that the introduction of basic amino acid residues into FR3 of antibodies whose CDRs are negatively charged has local effects due to electrostatic interaction. However, it is suggested that introduction of an acidic amino acid residue into FR3 of an antibody whose CDRs are negatively charged can reduce the affinity for the antigen due to electrostatic repulsion.

Example 4 Examination of Thermal Stability of Antibodies with Charged Amino Acid Residues Introduced into FR3 How the thermal stability of each mutant of the anti-insulin antibody prepared in Example 1 changes compared to the wild type It was investigated.

(1) Replacement of buffer by gel filtration The solvent of the Fab fragment-containing solution obtained in Example 2 is subjected to gel filtration as a buffer (phosphate buffered saline: PBS) used for measurement with a differential scanning calorimeter (DSC). replaced with The conditions for gel filtration are as follows.
[Gel filtration conditions]
Buffer: PBS
Column used: Superdex 200 Increase 10/300 (GE Healthcare)
Column volume (CV): 24 mL
Sample volume: 500 μL
Flow rate: 1.0 mL/min
Elution volume: 1.5 CV
Fraction volume: 500 μL

(2) Measurement of denaturation temperature (Tm)
Fractions containing Fab fragments were diluted with PBS to prepare Fab fragment-containing samples (5 μM final concentration). MicroCal VP-Capillary DSC (Malvern Instruments Ltd) was used to measure the Tm of each Fab fragment. Measurement conditions are as follows.
[DSC measurement conditions]
Sample volume: 400 μL
Measurement range: 30°C to 90°C
Heating rate: 60°C/hour

(3) Results
The Tm values and analytical peaks obtained by DSC measurement are shown in Table 6 and Figure 3, respectively.

The D5 mutant showed the lowest thermostability compared to the wild type, but the decrease was only about 13%. In most of the mutants, thermostability was found to be almost unchanged from wild type. Therefore, it is suggested that the introduction of charged amino acid residues into FR3 has little effect on antibody thermal stability.

Example 5 Control of affinity of anti-lysozyme antibody for antigen
Mutations were introduced into the FR3 of the anti-lysozyme antibody based on the electrical properties of the CDRs, and the affinity of the obtained mutants to lysozyme was confirmed.

(1) Electrical Characteristics of Anti-Lysozyme Antibody CDR Genscript Japan Co., Ltd. was commissioned to synthesize anti-lysozyme antibody genes, and plasmid DNA containing wild-type anti-lysozyme antibody genes was obtained. Based on the nucleotide sequence of the gene, the amino acid sequence of the anti-lysozyme antibody was determined. Table 7 shows the amino acid sequences of the light chain and heavy chain CDRs of the wild-type anti-lysozyme antibody (SEQ ID NOS: 18-23). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

As shown in Table 7, there are two basic amino acid residues and three acidic amino acid residues in the CDRs of the light and heavy chains of the anti-lysozyme antibody. Therefore, the electrical properties of the CDRs of anti-lysozyme antibodies are defined as neutral (X=-1).

(2) Production of anti-lysozyme antibody mutant Genscript Japan Co., Ltd. was entrusted with the synthesis of the R5 and D5 mutant genes of the anti-lysozyme antibody, and the plasmid DNA containing the anti-lysozyme antibody mutant gene was generated. Acquired. Here, the R5 mutant of the anti-lysozyme antibody is the 63rd, 65th and 67th serine residues of the light chain FR3 defined by the Chothia method in the wild-type antibody, the 70th aspartic acid residue, and the 72nd is an antibody in which the threonine residue of is substituted with an arginine residue. In addition, the D5 mutant of the anti-lysozyme antibody is the 63rd, 65th and 67th serine residues of the light chain FR3 defined by the Chothia method in the wild-type antibody, the 70th aspartic acid residue, and the 72nd An antibody in which threonine residues are substituted with aspartic acid residues.

Using the resulting plasmid, each antibody was expressed in Expi293 (trademark) cells in the same manner as in Example 1, the resulting culture supernatant was purified, and the anti-lysozyme antibody wild type, R5 mutant and A solution of each of the D5 mutants was obtained.

(3) Measurement of Affinity of Mutant to Antigen As the antigen for the anti-lysozyme antibody, a solution (200 ng/mL) of hen egg white-derived lysozyme (Sigma-Aldrich) dissolved in 10 mM sodium acetate solution (pH 5.0) was used. board. Antigens were immobilized (41 RU or 33 RU) on Biacore (registered trademark) sensor chip Series S Sensor Chip CM5 (GE Healthcare). A solution of each antibody was diluted with HBS EP+buffer (GE Healthcare) to prepare solutions of various concentrations. These solutions were sent to Biacore (registered trademark) T200 (GE Healthcare). The antibody concentration and measurement conditions in each solution are as follows. The measurement data were analyzed using Biacore (registered trademark) Evaluation software to obtain data on the affinity of each antibody.

[Antibody concentration]
Wild type: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
D5 variants: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
R5 variants: 2 nM, 1 nM, 0.5 nM, 0.25 nM and 0.125 nM

[Measurement condition]
Association: 30 μL/min, 60 sec, 120 sec
Dissociation: 30 μL/min, 60 sec, 1200 sec
Regeneration: Gly-HCl (pH 2.0) / 60 μL/min, 40 sec

(4) Results A dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and dissociation rate constant (k _off ) obtained for the wild-type and mutant anti-lysozyme antibodies. Kinetic parameters for each antibody are shown in Table 8 and FIG. In the figure, "negative charge" indicates the K _D value of the D5 mutant, and "positive charge" indicates the K _D value of the R5 mutant.

_From Table 8 and FIG. 4, the K _D value of the R5 mutant of the anti-lysozyme antibody was lower than that of the wild type. _Also , the K _D value of the D5 mutant was higher than that of the wild type. Therefore, it was found that by mutating five neutral amino acid residues of FR3 to basic amino acid residues, an anti-lysozyme antibody with improved affinity for an antigen can be produced compared to the wild type. It was also found that by mutating the five neutral amino acid residues of FR3 to acidic amino acid residues, an antibody with lower affinity for the antigen than the wild type can be produced. These results were similar to the anti-insulin antibody variants of Example 2. Therefore, it is suggested that the orientation of the antigen-binding site can be regulated by electrostatic interactions caused by the introduction of charged amino acid residues into FR3 in antibodies with neutral CDR electrical properties.

Example 6 Control of affinity of anti-HBsAg antibody for antigen
Mutations were introduced into the FR3 of the anti-HBsAg antibody based on the electrical properties of the CDRs, and the affinity of the obtained mutants for lysozyme was confirmed.

(1) Electrical Characteristics of CDRs of Anti-HBsAg Antibody Using recombinant HBsAg as an antigen, mouse anti-HBsAg antibody was generated by the method described in Kohler and Milstein, Nature, vol.256, p.495-497, 1975. A hybridoma producing Plasmid DNA containing the wild-type anti-HBsAg antibody gene was obtained from the RNA of this hybridoma in the same manner as in Example 1. Based on the nucleotide sequence of the gene, the amino acid sequence of the anti-HBsAg antibody was determined. It was found that there are 2 basic amino acid residues and 10 acidic amino acid residues in the light chain and heavy chain CDRs defined by the Chothia method in the wild-type anti-HBsAg antibody. Therefore, the electrical properties of the CDRs of anti-HBsAg antibodies are defined as negative charge (X=-8).

(2) Generation of anti-HBsAg antibody mutants
In order to introduce mutations into the light chain FR3 defined by the Chothia method, the wild-type anti-HBsAg antibody gene obtained in (1) above and the primers having the following base sequences were used in the same manner as in Example 1. PCR was performed.

[Anti-HBsAg antibody primer]
D5 Mutant FOR: 5' GGGACCGATTATGATCTCACAATCAGTCGAATGGAG 3' (SEQ ID NO: 24)
D5 Mutant REV: 5' ATCCCCATCGGCATCGAAACGAACAGGGACTCCAGAAGC 3' (SEQ ID NO: 25)

Using the obtained PCR products, in the same manner as in Example 1, a plasmid containing a gene encoding a mutant or wild-type light chain and a plasmid containing a gene encoding a wild-type heavy chain were obtained. . Using these plasmids, each antibody was expressed in Expi293 (trademark) cells in the same manner as in Example 1, and the resulting culture supernatant was purified to obtain wild-type and D5 mutant anti-HBsAg antibodies, respectively. A solution of Here, the D5 mutant of the anti-HBsAg antibody has the 63rd, 65th, 67th and 70th serine residues of the light chain FR3 defined by the Chothia method in the wild-type antibody, and the 72nd phenylalanine residue. , an antibody substituted with aspartic acid residues.

(3) Measurement of affinity of mutant for antigen
(3.2) Immobilization of capture antibody In the same manner as in Example 2, except that a mouse anti-HBsAg antibody produced from a hybridoma different from the hybridoma obtained in (1) above was used as the capture antibody. This capturing antibody was immobilized on each well of a plate (NUNC-immunomodule, Cat No. 469949, manufactured by NUNC). Also, in the same manner as in Example 2, each well of the plate was blocked with a blocking solution (1% BSA-containing PBS).

(3.3) Primary reaction HISCL (registered trademark) HBsAg calibrator (HBsAg concentration 0.025 IU/mL, Sysmex Corporation) was used as an antigen for the anti-HBsAg antibody. The blocking solution was removed from the plate on which the capture antibody had been immobilized, and 50 µL of the antigen solution was added to each well. The plate was shaken at room temperature for 60 minutes for antigen-antibody reaction.

(3.3) Secondary reaction and detection Wild-type and D5 mutant anti-HBsAg antibodies were used as detection antibodies. Each antibody was serially diluted with PBS containing 1% BSA to obtain antibody solutions with concentrations of 400 nM, 80 nM, 16 nM, 3.2 nM, 640 pM, 128 pM, 25.6 pM and 5.12 pM. As a secondary antibody, an HRP-labeled anti-mouse IgG (Fc-specific) antibody was used. An antigen-antibody reaction was performed in the same manner as in Example 2 using these. Then, using 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) as a substrate solution, the absorbance at 450 nm was measured for each well of the plate in the same manner as in Example 2.

(4) Results The dissociation constant (K _D ) was calculated from the measured values of the ELISA method using the wild-type anti-HBsAg antibody and the D5 mutant. The results are shown in Table 9 and FIG. In the figure, "negative charge" indicates the K _D value of the D5 mutant.

From _Table 9 and FIG. 5, the K _D value of the D5 mutant of the anti-HBsAg antibody was higher than that of the wild type. _Also , the K _D value of the D5 mutant was higher than that of the wild type. Therefore, with regard to anti-HBsAg antibodies, it was found that by mutating five neutral amino acid residues of FR3 to acidic amino acid residues, antibodies with lower affinity for antigens than wild-type antibodies can be produced. These results were similar to the D5 and E5 variants of the anti-TSHR antibody in Example 2. Therefore, it is suggested that the electrostatic repulsion generated by the introduction of an acidic amino acid residue into FR3 can reduce the affinity for an antigen in antibodies whose CDRs are negatively charged.

Claims (6)

A method for improving the affinity of an antibody for an antigen, comprising:
The antibody is an antibody whose CDR electrical properties are neutral based on the amino acid sequence of the complementarity determining region (CDR), and in the antibody, 3 of the light chain framework regions 3 (FR3) defined by the Chothia method arginine residues or lysine residues for 3 to 5 amino acid residues, thereby increasing the affinity of the antibody for the antigen, and improved compared to the previous antibody,
In the antibody before said 3 or more and 5 or less amino acid residues are arginine residues or lysine residues, said 3 or more and 5 or less amino acid residues are neutral or acidic amino acid residues,
At least the 3 or more and 5 or less amino acid residues are selected from the group consisting of the 72nd light chain amino acid residue, the 63rd light chain, the 65th light chain, the 67th light chain, and the 70th light chain. containing two residues and
When the 3 or more and 5 or less amino acid residues include residues other than light chain 63rd, light chain 65th, light chain 67th, light chain 70th and light chain 72nd, said residues are an amino acid residue selected from the group consisting of 53rd light chain to 62nd light chain and 73rd light chain to 81st light chain;
The method, wherein the electrical properties of the CDR are determined by the following formula (I):
X = [number of basic amino acid residues in the CDR amino acid sequence] - [number of acidic amino acid residues in the CDR amino acid sequence] (I)
(Wherein, when X is -1, 0 or 1, the electrical properties of the CDR are neutral,
when X is 2 or more, the electrical properties of the CDR are positively charged;
When X is less than or equal to -2, the electrical properties of the CDR are negatively charged). A method for producing an antibody with improved affinity for an antigen, comprising:
Based on the amino acid sequence of the complementarity determining region (CDR) 3 or more and 5 or less amino acid residues of the light chain framework region 3 (FR3) defined by the Chothia method in antibodies whose CDR electrical properties are neutral is an arginine residue or a lysine residue;
and recovering the antibody obtained in the above step,
The affinity of the recovered antibody for the antigen is improved compared to the antibody before the 3 or more and 5 or less amino acid residues are arginine residues or lysine residues,
In the antibody before said 3 or more and 5 or less amino acid residues are arginine residues or lysine residues, said 3 or more and 5 or less amino acid residues are neutral or acidic amino acid residues,
At least the 3 or more and 5 or less amino acid residues are selected from the group consisting of the 72nd light chain amino acid residue, the 63rd light chain, the 65th light chain, the 67th light chain, and the 70th light chain 2 residues and
When the 3 or more and 5 or less amino acid residues include residues other than light chain 63rd, light chain 65th, light chain 67th, light chain 70th and light chain 72nd, said residues are an amino acid residue selected from the group consisting of 53rd light chain to 62nd light chain and 73rd light chain to 81st light chain;
The method, wherein the electrical properties of the CDR are determined by the following formula (I):
X = [number of basic amino acid residues in CDR amino acid sequence] - [number of acidic amino acid residues in CDR amino acid sequence] (I)
(Wherein, when X is -1, 0 or 1, the electrical properties of the CDR are neutral,
when X is 2 or more, the electrical properties of the CDR are positively charged;
When X is less than or equal to -2, the electrical properties of the CDR are negatively charged). A method for improving the affinity of an antibody for an antigen, comprising:
The antibody is an antibody whose CDR electrical properties are neutral based on the amino acid sequence of the complementarity determining region (CDR), and in the antibody, 3 of the light chain framework regions 3 (FR3) defined by the Chothia method arginine residues or lysine residues for 3 to 5 amino acid residues, thereby increasing the affinity of the antibody for the antigen, and improved compared to the previous antibody,
In the antibody before said 3 or more and 5 or less amino acid residues are arginine residues or lysine residues, said 3 or more and 5 or less amino acid residues are neutral or acidic amino acid residues,
When the three amino acid residues of FR3 are an arginine residue or a lysine residue, the three amino acid residues are the 72nd amino acid residue of the light chain, the 63rd light chain, the 65th light chain, and the light chain. 2 residues selected from the group consisting of 67th and 70th light chain;
When the four amino acid residues of FR3 are arginine residues or lysine residues, the four amino acid residues are the 72nd amino acid residue of the light chain, the 63rd light chain, the 65th light chain, and the light chain. 3 residues selected from the group consisting of 67th and 70th light chain;
When the five amino acid residues of FR3 are arginine residues or lysine residues, the five amino acid residues are light chain 63rd, light chain 65th, light chain 67th, light chain 70th and light chain is the 72nd residue,
The method, wherein the electrical properties of the CDR are determined by the following formula (I):
X = [number of basic amino acid residues in the CDR amino acid sequence] - [number of acidic amino acid residues in the CDR amino acid sequence] (I)
(Wherein, when X is -1, 0 or 1, the electrical properties of the CDR are neutral,
when X is 2 or more, the electrical properties of the CDR are positively charged;
When X is less than or equal to -2, the electrical properties of the CDR are negatively charged). A method for producing an antibody with improved affinity for an antigen, comprising:
Based on the amino acid sequence of the complementarity determining region (CDR) 3 or more and 5 or less amino acid residues of the light chain framework region 3 (FR3) defined by the Chothia method in antibodies whose CDR electrical properties are neutral is an arginine residue or a lysine residue;
and recovering the antibody obtained in the above step,
The affinity of the recovered antibody for the antigen is improved compared to the antibody before the 3 or more and 5 or less amino acid residues are arginine residues or lysine residues,
In the antibody before said 3 or more and 5 or less amino acid residues are arginine residues or lysine residues, said 3 or more and 5 or less amino acid residues are neutral or acidic amino acid residues,
When the three amino acid residues of FR3 are an arginine residue or a lysine residue, the three amino acid residues are the 72nd amino acid residue of the light chain, the 63rd light chain, the 65th light chain, and the light chain. 2 residues selected from the group consisting of 67th and 70th light chain;
When the four amino acid residues of FR3 are arginine residues or lysine residues, the four amino acid residues are the 72nd amino acid residue of the light chain, the 63rd light chain, the 65th light chain, and the light chain. 3 residues selected from the group consisting of 67th and 70th light chain;
When the five amino acid residues of FR3 are arginine residues or lysine residues, the five amino acid residues are light chain 63rd, light chain 65th, light chain 67th, light chain 70th and light chain is the 72nd residue,
The method, wherein the electrical properties of the CDR are determined by the following formula (I):
X = [number of basic amino acid residues in the CDR amino acid sequence] - [number of acidic amino acid residues in the CDR amino acid sequence] (I)
(Wherein, when X is -1, 0 or 1, the electrical properties of the CDR are neutral,
when X is 2 or more, the electrical properties of the CDR are positively charged;
When X is less than or equal to -2, the electrical properties of the CDR are negatively charged). A method according to any one of claims 1 to 4, wherein said antibody is in the form of an antibody fragment. 6. The method of claim 5, wherein said antibody fragment is a Fab fragment.

Images