JP2020033382A - Methods for controlling antigen affinity of antibodies, antibodies with modified antigen affinity and methods of making them - Google Patents

Abstract

To provide techniques for controlling affinity of an antibody to an antigen and antibodies having modified affinity to an antigen.SOLUTION: The above problem is solved by substituting at least three amino acid residues of framework region 3 defined by Chothia numbering in an antibody with charged amino acid residues according to the electric characteristics of the complementarity determining region (CDR) based on the amino acid sequence of the CDR.SELECTED DRAWING: None

Description

  The present invention relates to a method for controlling the affinity of an antibody for an antigen. The present invention also relates to an antibody having an altered affinity for an antigen and a method for producing the same.

  2. Description of the Related Art Conventionally, a technique for modifying the affinity of an antibody for an antigen by introducing a mutation into an amino acid sequence of the antibody has been known. For example, Patent Literature 1 describes a method for reducing the affinity of an antibody for an antigen by introducing a mutation into an amino acid sequence of a complementarity determining region (CDR) of the antibody.

  It is also known to alter the affinity for an antigen by introducing a mutation into the amino acid sequence of the framework region in the variable region instead of the CDR. For example, Non-Patent Documents 1 and 2 disclose amino acid residues at positions 60, 63, 65 and 67 located in framework region 3 of a single-chain antibody (scFv) that binds to troponin I. It is described that the amino acid was substituted with a lysine or arginine residue which is a basic amino acid. Troponin I is an antigen with a high content of charged amino acids. In Non-patent Document 1 and Patent Document 2, first, a single-chain antibody recognizing an acidic epitope having a pI of 3.57 and a single-chain antibody recognizing a basic epitope having a pI of 11.45 are prepared. Non Patent Literature 1 and Patent Literature 2 describe that the affinity for troponin I could be improved by utilizing the electric attraction caused by the introduction of a basic amino acid residue into these single-chain antibodies. ing.

US Patent Application Publication No. 2012/0329995 WO 2013/084371 pamphlet

Fukunaga A and Tsumoto K, Improving the affinity of an antibody for its antigen via long-range electrostatic interactions, Protein Eng.Des.Sel. Vol.26, no.12, p.773-780, 2013

  Non-Patent Document 1 and Patent Document 2 disclose that the above-described mutation is introduced into framework region 3 (FR3) of anti-troponin I antibody to increase the binding rate constant in the antibody-antigen reaction, Improves affinity. However, these documents do not describe whether antibodies other than the anti-troponin I antibody can modify the affinity for the antigen by the same technique.

  Further, Non-Patent Document 1 and Patent Document 2 only describe that the affinity for an antigen is improved. On the other hand, when an antibody is used as a reagent, not only an antibody having an improved affinity for an antigen but also an antibody having a reduced affinity may be required. For example, an antibody with reduced affinity for an antigen can be used as a suitable control for an antigen-antibody reaction. Therefore, establishment of a technique for controlling the affinity of an antibody for an antigen is desired.

  The present inventors have found that, by substituting the amino acid residue of FR3 of the antibody with a charged amino acid residue, the affinity for the antigen can be improved or reduced depending on the type of the antibody. Then, they have found that such a difference in the change in affinity is related to the electrical properties of the CDR determined based on the number of charged amino acid residues contained in the CDR, and completed the present invention.

  Thus, the present invention provides a method for controlling the affinity of an antibody for an antigen. In this method, at least three amino acid residues of FR3 defined by the Chothia method are replaced by charged amino acid residues in an antibody having a neutral or negative electric property of CDR based on the amino acid sequence of CDR.

  The present invention also provides a method for producing an antibody having an altered affinity for an antigen. This method comprises the steps of, in an antibody having a neutral or negative electric characteristic of CDR based on the amino acid sequence of CDR, replacing at least three amino acid residues of FR3 defined by the Chothia method with charged amino acid residues, Recovering the antibody obtained in the replacement step.

  Further, the present invention provides an antibody having an altered affinity for an antigen. In this antibody, the electrical properties of the CDR based on the amino acid sequence of the CDR are neutral or negatively charged, and at least three amino acid residues of FR3 defined by the Chothia method in the unmodified antibody are charged amino acid residues. Has been replaced by

  According to the present invention, there is provided an antibody having an altered affinity for an antigen.

It is a graph which shows the dissociation constant in the interaction with an antigen (insulin) and a wild-type anti-insulin antibody and its variant. 1 is a graph showing the dissociation constant in the interaction between a wild-type anti-thyroid stimulating hormone receptor (TSHR) antibody and its mutant and an antigen (TSHR). It is a figure which shows the surface charge distribution of a wild type anti-insulin antibody and its mutant form, and an antigen (insulin). FIG. 3 is a diagram showing the surface charge distribution of a wild-type anti-TSHR antibody and its mutant form, and an antigen (TSHR). 4 is a graph showing analysis peaks when the thermal stability of a wild-type anti-insulin antibody and its mutant is measured by a differential scanning calorimeter (DSC). 4 is a graph showing the dissociation constant in the interaction between a wild-type anti-lysozyme antibody and its mutant form and an antigen (lysozyme). It is a graph which shows the dissociation constant in the interaction with the antigen (HBsAg) and the wild-type anti-hepatitis-B surface antigen (HBsAg) antibody and its variant.

[1. Method for controlling affinity of antibody for antigen]
In the method of controlling the affinity of the antibody of the present embodiment for an antigen (hereinafter, also referred to as a `` control method ''), an antibody in which the electrical properties of a CDR based on the amino acid sequence of the CDR are neutral or negatively charged is converted to an antigen. To control the affinity of In the control method of the present embodiment, in an antibody having such electrical properties, by replacing at least three amino acid residues of FR3 defined by the Chothia method with charged amino acid residues, the affinity of the antibody for an antigen is To control the gender. Here, "controlling the affinity" refers to both improving the affinity of the antibody for the antigen and decreasing the affinity of the antibody for the antigen. Therefore, the control method of the present embodiment may be interpreted as a method of modifying the affinity of an antibody for an antigen.

  The original antibody whose affinity to the antigen is controlled in the control method of the present embodiment is also referred to as “unmodified antibody”. In the present specification, replacing an amino acid residue of FR3 defined by the Chothia method in an unmodified antibody with a charged amino acid residue is also referred to as “introducing a mutation”. Such substitutions are also referred to as "mutation" or simply "mutation." In addition, an antibody obtained by introducing a mutation into an unmodified antibody is also referred to as “an antibody with controlled affinity”.

In the present embodiment, the introduction of the mutation changes the surface charge distribution of the unmodified antibody, thereby controlling the affinity for the antigen. That is, the antibody whose affinity is controlled has improved or reduced affinity for the antigen as compared to the unmodified antibody. In the present embodiment, the affinity of the antibody whose affinity is controlled for the antigen may be evaluated by a kinetic parameter in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as an ELISA method. . The kinetic parameters, association rate constant (k _on), dissociation rate constant (k _off) and dissociation constant (K _D) and the like, preferably K _D. Kinetic parameters in the antigen-antibody reaction can be obtained by surface plasmon resonance (SPR) technology.

May improve affinity for the antibody antigen under the control method of this embodiment, for example, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 1/2, about 1/5, about 1/10, about 1/20, about 1/50, about 1/100 or about 1/1000. On the other hand, if the affinity of the antibody for the antigen is reduced, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 2-fold, about 5 fold, about 10 fold, about 20 fold, about 50 Times, about 100 times or about 1000 times.

  In the present embodiment, the unmodified antibody may be an antibody that recognizes any antigen. In the preferred embodiment, the unmodified antibody is an antibody whose nucleotide sequence of a gene encoding a light chain and a heavy chain variable region is known or whose nucleotide sequence can be confirmed. Specifically, it is an antibody in which the nucleotide sequence of the antibody gene is disclosed in a known database, or an antibody for which a hybridoma producing the antibody is available. Examples of such a database include GeneBank provided by the National Center for Biotechnology Information (NCBI). The class of the antibody may be any of IgG, IgA, IgM, IgD, and IgE, but is preferably IgG.

  In this embodiment, the unmodified antibody may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation is to be introduced. The antibody whose affinity is controlled may be in the form of an antibody fragment as long as it has a variable region containing the mutation-introduced FR3. Examples of such antibody fragments include Fab fragments, F (ab ') 2 fragments, Fab' fragments, Fd fragments, Fv fragments, dAb fragments, single-chain antibodies (scFv), and the like. Among them, Fab fragments are particularly preferred.

  Three CDRs are present in each of the variable regions of the light and heavy chains of the antibody, and constitute the antigen-binding site of the antibody. The three CDRs are called CDR1, CDR2 and CDR3, counting from the amino terminus of the antibody chain. Since the CDR is involved in the specificity of the antibody, in the present embodiment, the antibody whose affinity is controlled preferably has no mutation in the CDR. That is, the amino acid sequence of the CDR of the antibody whose affinity is controlled is preferably the same as the amino acid sequence of the CDR of the unmodified antibody.

  The framework regions (FR) are regions other than CDRs that exist in the variable regions of the light chain and heavy chain of an antibody. FRs serve as a scaffold that connects the three CDRs and contribute to the structural stability of the CDRs. Therefore, the amino acid sequence of FR is highly conserved among antibodies of the same species. FR3 is one of FRs and refers to a region between CDR2 and CDR3.

  In the art, a method of numbering amino acid residues of CDRs (hereinafter, also referred to as “numbering method”) for defining boundaries and lengths of CDRs is known. Such numbering methods include, for example, the Chothia method (Chothia C. and Les AM., Canonical Structures for the Hypervariable Regions of Immunoglobulins., J Mol Biol., Vol. 196, p. 901-917, 1987), Kabat method (Kabat EA. Et al., Sequences of Proteins of Immunological Interest., NIH publication No. 91-3242), IMGT method (Lefranc MP., IMGT Unique Numbering for the Variable (V), Constant (C), and Groove (G) Domains of IG, TR, MH, IgSF, and MhSF., Cold Spring Harb Protoc. 2011 (6): 633-642, 2011), Honerger method (Honegger A. et al., Yet Another Numbering Scheme for Immunoglobulin Variable Domains: An Automatic Modeling and Analysis Tool., J Mol Biol., Vol. 309, p. 657-670, 2001), ABM method, Contact method and the like are known. When the amino acid residues of the CDR are numbered, the FRs, which are regions other than the CDRs, are also numbered. In the present embodiment, the boundaries and lengths of CDR and FR3 are defined by the Chothia method, but may be defined by other numbering methods.

  In the Chothia method, the light chain FR3 is defined as a region consisting of amino acid residues 53 to 90, and the heavy chain FR3 is defined as a region consisting of amino acid residues 56 to 95. Here, for comparison, Tables 1 and 2 show FR3 numbers (positions of amino acid residues at the start and end points of FR3) of the light chain and heavy chain as defined by the Chothia method and other numbering methods. Vernier zone residues in the table are amino acid residues that contribute to the structural stability of CDR among the amino acid residues contained in FR. Tables 1 and 2 also show the positions of the Vernier zone residues in FR3 as defined by each numbering method. Table 1 also shows positions where mutations were introduced into FR3 of the light chain in Example 1 as defined by each numbering method.

  In the present embodiment, at least three mutations may be introduced into any amino acid residue of FR3 (hereinafter, also simply referred to as “FR3”) defined by the Chothia method in an unmodified antibody. Preferably, at least three mutations are introduced into FR3 from amino acid residues in the region excluding amino acid residues that are folded inside the molecule and not exposed on the surface (hereinafter, also referred to as “non-exposed residues”). Since it is expected that introducing a mutation into an unexposed residue does not affect the surface charge, it is preferable to remove the unexposed residue from the position where the mutation should be introduced. The amino acid residues in the region excluding the non-exposed residues from FR3 are, specifically, amino acid residues 53 to 81 of light chain FR3 and amino acids 56 to 88 of heavy chain FR3. Residue.

  More preferably, at least three mutations are introduced into the amino acid residues in the region excluding the unexposed residues and the Vernier zone residues from FR3. As described above, Vernier zone residues contribute to the structural stability of CDR. The amino acid residues in the region excluding the unexposed residues and the Vernier zone residues from FR3 are specifically the amino acid residues 53 to 63, 65, 67, 70 and 72 to 81 of FR3 of the light chain. And amino acid residues 56-66, 68, 70, 72, 74-77 and 79-88 of FR3 of the heavy chain.

  Particularly preferably, at least three mutations are introduced into the amino acid residues whose side chains face the molecular surface among the amino acid residues in the region excluding the unexposed residues and the Vernier zone residues from FR3. Substitution of charged amino acid residues for amino acids whose side chains face the molecule surface contributes more to the surface charge. Amino acid residues whose side chains face the molecular surface in FR3 are 53, 54, 56, 57, 60, 63, 65, 67, 70, 72, 74, 76, 77 and 79 to 81 of FR3 of the light chain. And the amino acid residues 56, 57, 59, 61, 62, 64-66, 68, 70, 72, 74, 75, 77, 79, 81, 83, 84 and 86-88 of the heavy chain FR3. Is an amino acid residue.

  In this embodiment, at least three mutations may be introduced into either the light chain FR3 or the heavy chain FR3. From the viewpoint of the thermostability of the antibody, it is preferable to introduce at least three mutations into the light chain FR3. If both the light and heavy chain FR3s have mutations, it is preferred to introduce at least three mutations in the light chain FR3 and at least three mutations in the heavy chain FR3.

  In the present embodiment, the upper limit of the number of mutations to be introduced into FR3 is not particularly limited, but is preferably 16 amino acids or less. That is, the number of mutations in FR3 of the antibody whose affinity is controlled is specifically 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 It is.

  As described above, in the control method of the present embodiment, the surface charge distribution changes due to the introduction of the mutation into the unmodified antibody, and the affinity for the antigen changes. Thus, it is preferred that all at least three mutations are substitutions with charged amino acid residues having the same charge. That is, all of the at least three mutations are preferably substitutions with acidic amino acid residues or substitutions with basic amino acid residues.

  Charged amino acid residues refer to aspartic acid residues, glutamic acid residues, lysine residues, arginine residues and histidine residues. Acidic amino acid residues refer to aspartic acid residues and glutamic acid residues. Basic amino acid residues refer to lysine residues, arginine residues and histidine residues. In the present embodiment, lysine residues and arginine residues are preferred as the basic amino acid residues introduced into FR3 as mutations.

  In this embodiment, the at least three mutations introduced into the unmodified antibody may be mutations that substitute a neutral amino acid residue of FR3 with a charged amino acid residue. Neutral amino acid residues include alanine residues, asparagine residues, isoleucine residues, glycine residues, glutamine residues, cysteine residues, threonine residues, serine residues, tyrosine residues, phenylalanine residues, and proline residues. Group, valine residue, methionine residue, leucine residue and tryptophan residue.

  As described above, in the present embodiment, an antibody in which the electrical properties of the CDR based on the amino acid sequence of the CDR are neutral or negatively charged is an object whose affinity to the antigen is controlled. In the present specification, the electrical characteristics of a CDR are indices uniquely defined by the present inventors, and are determined based on the number of charged amino acid residues in the amino acid sequence of the CDR. Specifically, the electrical characteristics of the CDR are determined by the following equation (I).

X = [number of basic amino acid residues in amino acid sequence of CDR] − [number of acidic amino acid residues in amino acid sequence of CDR] (I)
(Where X is −1, 0 or 1, the electrical properties of the CDR are neutral;
When X is 2 or more, the electrical property of the CDR is a positive charge,
When X is -2 or less, the electrical characteristics of the CDR are negative.)

  Preferably, the electrical properties of the CDRs are determined based on the amino acid sequences of both the light and heavy chain CDRs. In this case, the amino acid sequence of the CDR in the formula (I) refers to all amino acid sequences of CDR1, CDR2 and CDR3 of the light chain and CDR1, CDR2 and CDR3 of the heavy chain. In this embodiment, in an antibody having neutral or negative electric properties determined based on the amino acid sequences of both the light chain and heavy chain CDRs, at least three amino acid residues of FR3 of the light chain are charged. Substitution with an amino acid residue is preferred.

  The electrical properties of the CDR may be determined for each of the light and heavy chain CDRs. That is, when determining the electric characteristics of the light chain CDR, the amino acid sequence of the CDR in the formula (I) refers to all the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain. When determining the electrical characteristics of the heavy chain CDR, the amino acid sequence of the CDR in the formula (I) refers to all amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain. In the present embodiment, it is preferable to substitute at least three amino acid residues of FR3 of the light chain with a charged amino acid residue in an antibody in which the light chain CDR has neutral or negative electric properties.

  The amino acid sequence of the CDR can be obtained from public databases disclosing the sequence of the antibody gene. Alternatively, when there is a hybridoma producing an unmodified antibody, the amino acid sequence of the CDR is obtained by a known method, obtaining a nucleic acid encoding a heavy chain and a light chain from the hybridoma, and sequencing the nucleotide sequence of the nucleic acid. Can be obtained by:

  The electrical properties of CDRs vary from antibody to antibody. For example, as shown in Example 3 below, the light chain CDR of a wild-type (ie, unmodified) anti-insulin antibody has one basic amino acid residue (arginine) and no acidic amino acid residue. do not do. Thus, the electrical properties of the CDRs of the wild-type anti-insulin antibody are defined as neutral (X = 1). Further, the light chain CDR of the wild-type anti-TSHR antibody has five acidic amino acid residues (aspartic acid) and no basic amino acid residues. Thus, the electrical properties of the CDRs of the wild-type anti-TSHR antibody are defined as negative charge (X = -5).

  In an unmodified antibody in which the CDRs have neutral electrical properties, substitution of at least three amino acid residues of FR3 with acidic amino acid residues results in negative surface charge over a wide range including the antigen binding site of the antibody. Becomes In addition, in an unmodified antibody in which the electrical properties of the CDRs are neutral, by replacing at least three amino acid residues of FR3 with basic amino acid residues, a wide area including the antigen-binding site of the antibody can be obtained. The charge becomes positive. Such a change in surface charge causes an electrostatic interaction (attractive or repulsive) when the antibody and the antigen bind. That is, by replacing at least three amino acid residues of FR3 with an acidic amino acid residue in an unmodified antibody having a neutral CDR electrical property, the affinity of the antibody for the antigen is compared with that of the unmodified antibody. Can be reduced. Further, in an unmodified antibody in which the electrical properties of the CDRs are neutral, by replacing at least three amino acid residues of FR3 with basic amino acid residues, the affinity of the antibody for the antigen can be changed to that of the unmodified antibody. Can be improved.

  Substitution of at least three amino acid residues of FR3 with acidic amino acid residues in an antibody whose CDR has a negative electric property results in a negative surface charge over a wide range including the antigen binding site of the antibody. Such a change in surface charge causes an electrostatic interaction (repulsion) when the antibody and the antigen bind. That is, by replacing at least three amino acid residues of FR3 with an acidic amino acid residue in an unmodified antibody having a negatively charged electric property of CDR, the affinity of the antibody for antigen is higher than that of the unmodified antibody. Can be reduced.

  In the present embodiment, a mutation can be introduced into FR3 of an unmodified antibody by a known method such as a DNA recombination technique and other molecular biology techniques. For example, when there is a hybridoma producing an unmodified antibody, as shown in Example 1 below, using RNA extracted from the hybridoma, a reverse transcription reaction and a RACE (Rapid Amplification of cDNA ends) method are used. Each of the polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain is synthesized. By amplifying these polynucleotides by a PCR method using primers for introducing mutations into at least three amino acid residues of FR3, a polynucleotide encoding a light chain having a mutation introduced into FR3 and a heavy chain Is obtained. The obtained polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding an antibody with controlled affinity. Here, the polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain may be incorporated into one expression vector, or may be incorporated separately into two expression vectors. The type of the expression vector is not particularly limited, and may be a mammalian cell expression vector or an Escherichia coli expression vector. By transducing or transfecting the obtained expression vector into a suitable host cell (for example, a mammalian cell or Escherichia coli), an antibody with controlled affinity can be obtained.

  When obtaining an antibody whose affinity is controlled as a single-chain antibody (scFv), for example, as shown in Patent Document 2, using RNA extracted from the above-described hybridoma, light chain by reverse transcription reaction and PCR method Each of the polynucleotide encoding the variable region and the polynucleotide encoding the heavy chain variable region may be synthesized. These polynucleotides are ligated by an overlap extension PCR method or the like to obtain a polynucleotide encoding an unmodified scFv. The resulting polynucleotide is amplified by PCR using primers for introducing mutations into at least three amino acid residues of FR3 to obtain a polynucleotide encoding a scFv having a mutation introduced into FR3. . The resulting polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding an affinity-regulated antibody in the form of scFv. By transducing or transfecting the obtained expression vector into a suitable host cell, an antibody in the form of scFv with controlled affinity can be obtained.

  If there is no hybridoma producing an antibody that recognizes the antigen of interest, for example, by a known method such as the method described in Kohler and Milstein, Nature, vol. 256, p. 495-497, 1975, the antibody A production hybridoma may be prepared. Alternatively, RNA obtained from the spleen of an animal such as a mouse immunized with an antigen of interest may be used. When RNA obtained from the spleen is used, for example, as shown in Non-Patent Document 1, unmodified polynucleotide having a desired affinity is obtained from the obtained unmodified Fab-encoding polynucleotides by a phage display method or the like. May be selected.

[2. Method for producing antibody having modified affinity for antigen]
The scope of the present invention also includes a method for producing an antibody having modified affinity for an antigen (hereinafter, also referred to as “production method”). In the production method of the present embodiment, first, in an antibody having a neutral or negatively charged CDR electrical property based on the amino acid sequence of the CDR, at least three amino acid residues of FR3 defined by the Chothia method are charged amino acid residues. Is performed.

  The above-mentioned antibody in which the amino acid residue of FR3 is substituted in the production method of the present embodiment is the same as the unmodified antibody in the control method of the present embodiment. Hereinafter, the original antibody whose affinity for an antigen is to be modified in the production method of the present embodiment is also referred to as “unmodified antibody”. Details of the electrical characteristics of the CDR are the same as those described for the control method of the present embodiment. The electrical properties of the CDRs of an antibody can be determined according to formula (I) above. Further, FR3 defined by the Chothia method is the same as that described for the control method of the present embodiment, and is as shown in Tables 1 and 2.

  In the production method of the present embodiment, an antibody whose affinity for an antigen is altered can be obtained by changing the surface charge distribution of the antibody by substituting amino acid residues. That is, in the above-described substitution step, in an antibody having a neutral or negative charge in the electrical properties of CDR, at least three amino acid residues of FR3 defined by the Chothia method are substituted with charged amino acid residues, and the antibody reacts with the antigen of the antibody. This can be said to be a step of modifying affinity. For example, in the above-described substitution step, in an antibody having neutral CDR electrical properties, at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues, thereby increasing the affinity of the antibody for the antigen. It may be a step of lowering the antibody as compared with an unmodified antibody. In addition, the above-mentioned substitution step is a step of substituting at least three amino acid residues of FR3 defined by the Chothia method with basic amino acid residues in an antibody having neutral CDR electrical properties, thereby obtaining an affinity of the antibody for the antigen. May be improved as compared with an unmodified antibody. Alternatively, the above-described substitution step comprises substituting at least three amino acid residues of FR3 defined by the Chothia method with acidic amino acid residues in an antibody having a negatively charged CDR electric property, thereby increasing the affinity of the antibody for the antigen. It may be a step of lowering the antibody as compared with an unmodified antibody.

  In the present embodiment, in an antibody having a neutral or negative electric property determined based on the amino acid sequences of both the light chain and heavy chain CDRs, at least three amino acid residues of FR3 of the light chain are charged. Substitution with an amino acid residue is preferred. In an antibody in which the light chain CDR has neutral or negative electric properties, it is preferable that at least three amino acid residues of FR3 of the light chain are substituted with charged amino acid residues.

  Substitution of amino acid residues can be performed by a known method such as a DNA recombination technique and other molecular biology techniques. For example, if there is a hybridoma producing an antibody whose CDR electrical properties are neutral or negatively charged, the antibody whose affinity for the antigen has been modified in the same manner as described for the control method of the present embodiment. An expression vector containing the encoding polynucleotide can be obtained. Then, the obtained expression vector is transduced or transfected into a suitable host cell to obtain a host cell expressing the antibody.

  Next, in the production method of the present embodiment, the antibody obtained in the above-described substitution step is recovered. For example, a host cell expressing an antibody having altered affinity for an antigen is dissolved in a solution containing a suitable solubilizing agent to release the antibody in the solution. When the host cell secretes an antibody having an altered affinity for the antigen into the medium, the culture supernatant is collected. The released antibody can be recovered by a method known in the art such as affinity chromatography. For example, when the produced antibody is IgG, it can be recovered by affinity chromatography using protein A or G. If necessary, the recovered antibody may be purified by a method known in the art such as gel filtration.

The affinity of the prepared antibody for the antigen may be evaluated by a kinetic parameter in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as an ELISA method. Antibody affinity is improved to an antigen, for example, the value K _D of the antigen-antibody reaction, as compared to the original antibody, about 1/2, about 1/5, about 1/10, about 1 / 20, about 1/50, about 1/100 or about 1/1000. Antibody affinity is lowered to an antigen, the value K _D of the antigen-antibody reaction, as compared to the original antibody, about 2-fold, about 5 fold, about 10 fold, about 20 fold, about 50-fold, It is about 100 times or about 1000 times.

[3. Antibody with modified affinity for antigen]
The scope of the present invention also includes antibodies whose affinity for an antigen has been modified (hereinafter, also referred to as “modified antibodies”). The modified antibody of the present embodiment is characterized in that the electrical properties of the CDR based on the amino acid sequence of the CDR are neutral or negatively charged. Details of the electrical characteristics of the CDR are the same as those described for the control method of the present embodiment. The electrical properties of the CDRs of the modified antibody can be determined by formula (I) above.

  In the modified antibody of the present embodiment, at least three amino acid residues of FR3 defined by the Chothia method in the unmodified antibody are substituted with charged amino acid residues. That is, the modified antibody of the present embodiment has at least three mutations due to substitution with charged amino acid residues in FR3 defined by the Chothia method, as compared with the amino acid sequence of the unmodified antibody. The modified antibody of the present embodiment is the same as the above-mentioned “antibody with controlled affinity”. Further, FR3 defined by the Chothia method is the same as that described for the control method of the present embodiment, and is as shown in Tables 1 and 2.

  Here, the unmodified antibody refers to the antibody before the affinity for the antigen is modified. That is, the unmodified antibody is the original antibody of the modified antibody, and the amino acid residue of FR3 defined by the Chothia method is not substituted with a charged amino acid residue. The unmodified antibody corresponds to the original antibody whose affinity to the antigen is to be controlled in the control method of the present embodiment. In this embodiment, the unmodified antibody has a CDR whose electrical properties are neutral or negatively charged.

  In the modified antibody of the present embodiment, the surface charge distribution of the antibody is changed by the introduction of the mutation. That is, the modified antibody has improved or decreased affinity for the antigen as compared with the unmodified antibody. In the present embodiment, the affinity of the modified antibody for the antigen may be evaluated by a kinetic parameter in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as an ELISA method. Kinds and acquisitions of the kinetic parameters are the same as those described for the control method of the present embodiment.

In the modified antibody with improved affinity for the antigen, for example, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 1/2, about 1/5, about 1/10, about 1 / 20, about 1/50, about 1/100 or about 1/1000. The modified antibody affinity is lowered to an antigen, for example, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 2-fold, about 5 fold, about 10 fold, about 20 fold, about 50 Times, about 100 times or about 1000 times.

  The modified antibody may be an antibody that recognizes any antigen. The class of the antibody may be any of IgG, IgA, IgM, IgD, and IgE, but is preferably IgG. The modified antibody of the present embodiment may be in the form of an antibody fragment as long as it has a variable region containing a mutation-introduced FR3. The type of the antibody fragment is the same as that described for the control method of the present embodiment.

  The modified antibody of the present embodiment preferably has no mutation in CDR. That is, the amino acid sequence of the CDR of the modified antibody is preferably the same as the amino acid sequence of the CDR of the unmodified antibody.

  In the modified antibody of the present embodiment, at least three mutations may be introduced into any amino acid residue of FR3 defined by the Chothia method in the unmodified antibody. Preferably, at least three mutations are introduced into amino acid residues in the region of FR3 minus the unexposed residues. The amino acid residues in the region excluding the unexposed residues from FR3 are the same as those described for the control method of the present embodiment.

  More preferably, at least three mutations are introduced into amino acid residues in the region of FR3 excluding unexposed residues and Vernier zone residues. The amino acid residues in the region excluding the unexposed residues and the Vernier zone residues from FR3 are the same as those described for the control method of the present embodiment.

  Particularly preferably, at least three mutations are introduced into the amino acid residues whose side chains face the molecular surface among the amino acid residues in the region excluding the unexposed residues and the Vernier zone residues from FR3. The amino acid residues whose side chains face the molecular surface in FR3 are the same as those described for the control method of the present embodiment.

  In this embodiment, the mutation of at least three amino acid residues may be introduced into FR3 of the light chain and FR3 of the heavy chain, but is preferably introduced into FR3 of the light chain. When both the light chain and heavy chain FR3s have mutations, at least three amino acid residue mutations are introduced into the light chain FR3, and at least three amino acid residue mutations are introduced into the heavy chain FR3. Is preferred.

  In the present embodiment, the upper limit of the number of mutations in FR3 of the modified antibody is not particularly limited, but is preferably 16 amino acids or less. The number of mutations in FR3 of the modified antibody is specifically 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.

  In this embodiment, at least three mutations of the modified antibody may be mutations in which a neutral amino acid residue of FR3 is replaced with a charged amino acid residue. In this embodiment, it is preferable that all of at least three mutations are substitutions with charged amino acid residues having the same charge. That is, all of the at least three mutations are preferably substitutions with acidic amino acid residues or substitutions with basic amino acid residues.

Examples of the modified antibodies of the present embodiment include the following antibodies (1) to (3).
(1) The electrical properties of CDR are neutral, at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues, and the affinity of the antibody for the antigen is greater than that of the unmodified antibody. Reduced antibodies,
(2) the electrical properties of the CDR are neutral, at least three amino acid residues of FR3 defined by the Chothia method are replaced by basic amino acid residues, and the affinity of the antibody for the antigen is unmodified. Improved antibodies, and
(3) the electrical properties of the CDR are negatively charged, at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues, and the affinity of the antibody for the antigen is greater than that of the unmodified antibody. Reduced antibodies.

  Specific examples of the modified antibodies include modified antibodies of anti-insulin antibody and anti-TSHR antibody. In such modified anti-insulin antibodies, the electrical properties of the CDRs are neutral, and the amino acid residues 63, 65, 67, 70 and 72 in FR3 of the light chain are replaced with basic amino acid residues. You. This modified antibody has improved affinity for insulin, which is an antigen, as compared with the unmodified antibody. On the other hand, the modified antibody in which the amino acid residues at positions 63, 65, 67, 70 and 72 in FR3 of the light chain have been substituted with acidic amino acid residues has a higher affinity for the insulin insulin antigen than the unmodified antibody. Is declining. In the modified anti-TSHR antibody, the electrical properties of the CDR are negatively charged, and the amino acid residues at positions 63, 65, 67, 70 and 72 in FR3 of the light chain are replaced with acidic amino acid residues. This modified antibody has a lower affinity for the antigen, TSHR, than the unmodified antibody.

  The modified antibody of the present embodiment can be produced by a known method such as a DNA recombination technique and other molecular biology techniques. For example, when there is a hybridoma producing an antibody having a neutral or negative charge in the electrical properties of the CDR, at least three amino acid residues of FR3 are determined in the same manner as described for the control method and the production method of the present embodiment. Antibodies in which the groups are substituted with charged amino acid residues can be made.

  In the present embodiment, the usage of the modified antibody is not particularly different from that of the unmodified antibody. The modified antibody can be used for various tests and studies, like the unmodified antibody. In addition, the modified antibody of the present embodiment may be modified with a labeling substance known in the art.

  The scope of the present invention includes isolated and purified polynucleotides encoding antibodies or fragments thereof having altered affinity for the antigen of the present embodiment. The isolated and purified polynucleotide encoding the fragment of the modified antibody of the present embodiment preferably encodes a variable region containing a mutation-introduced FR3. The scope of the present invention also includes a vector containing the above-mentioned polynucleotide. Vectors are polynucleotide constructs designed for transduction or transfection. The type of the vector is not particularly limited, and can be appropriately selected from vectors known in the art, such as an expression vector, a cloning vector, and a virus vector. The scope of the present invention also includes host cells containing the vector. The type of host cell is not particularly limited, and can be appropriately selected from eukaryotic cells, prokaryotic cells, mammalian cells, and the like.

  Hereinafter, the present invention will be described in detail with reference to examples, but the present invention is not limited to these examples.

Example 1 Preparation of Antibodies Introducing Charged Amino Acid Residues into FR3 Three or five amino acid residues of FR3 of anti-insulin antibody and anti-thyroid stimulating hormone receptor (TSHR) antibody were substituted with charged amino acid residues. Mutants of each antibody were made.

(1) Acquisition of genes for wild-type anti-insulin antibody and wild-type anti-TSHR antibody
[reagent]
ISOGEN (Nippon Gene Co., Ltd.)
SMARTer® RACE 5 '/ 3' kit (clontech)
10x A-attachment mix (Toyobo Co., Ltd.)
pcDNA® 3.4 TOPO® TA Cloning Kit (Thermo Fisher)
Competent high DH5α (Toyobo Co., Ltd.)
QIAprep Spin Miniprep Kit (QIAGEN)
KOD plus neo (Toyobo Co., Ltd.)
Ligation high ver.2 (Toyobo Co., Ltd.)

(1.1) Acquisition of wild-type anti-insulin antibody gene
(1.1.1) Extraction of total RNA from antibody-producing hybridomas Using human insulin as an antigen, wild-type mice were obtained by the method described in Kohler and Milstein, Nature, vol. 256, p. 495-497, 1975. A hybridoma producing an anti-human insulin antibody was produced. After the hybridoma culture (10 mL) was centrifuged at 1000 rpm for 5 minutes, the supernatant was removed. The obtained cells were lysed with ISOGEN (1 mL) and allowed to stand at room temperature for 5 minutes. Chloroform (200 μL) was added thereto, and the mixture was stirred for 15 seconds, and then allowed to stand at room temperature for 3 minutes. Then, this was centrifuged at 12000 × G for 10 minutes at 4 ° C. to collect an aqueous phase (500 μL) containing RNA. Isopropanol (500 μL) was added to the recovered aqueous phase and mixed. After the obtained mixture was allowed to stand at room temperature for 5 minutes, it was centrifuged at 12000 × G for 10 minutes at 4 ° C. The supernatant was removed, 70% ethanol (1 mL) was added to the obtained precipitate (total RNA), and the mixture was centrifuged at 7,500 × G for 10 minutes at 4 ° C. The supernatant was removed, the RNA was air-dried, and dissolved in RNase-free water (20 μL).

(1.1.2) Synthesis of cDNA Using each total RNA obtained in (1.1.1) above, an RNA sample having the following composition was prepared.
[RNA sample]
Total RNA (500 ng / μL) 1 μL
RT primer 1μL
1.75 μL of deionized water
3.75 μL in total

After heating the prepared RNA sample at 72 ° C. for 3 minutes, it was incubated at 42 ° C. for 2 minutes. Then, a sample for cDNA synthesis was prepared by adding 12 μM SMARTerIIA oligonucleotide (1 μL) to the RNA sample. Using this cDNA synthesis sample, a reverse transcription reaction solution having the following composition was prepared.
[Reverse transcription reaction solution]
2μL 5x First-Strand buffer
20 mM DTT 1 μL
10 mM dNTP mix 1 μL
RNAase inhibitor 0.25 μL
SMARTScribe RT (100 U / μL) 1 μL
4.75 μL of cDNA synthesis sample
10 μL total

The prepared reverse transcription reaction solution was reacted at 42 ° C. for 90 minutes. Then, the reaction solution was heated at 70 ° C. for 10 minutes, and Tricine-EDTA (50 μL) was added. Using the obtained solution as a cDNA sample, a 5′RACE reaction solution having the following composition was prepared.
[5'RACE reaction solution]
5 μL of 10x PCR buffer
dNTP mix 5μL
25 mM Mg ₂ SO ₄ 3.5 μL
2.5 μL cDNA sample
10x Universal Primer Mix 5μL
3'-primer 1μL
KOD plus neo (1 U / μL) 1μL
Purified water 27μL
50 μL in total

The prepared 5'RACE reaction solution was subjected to a RACE reaction under the following reaction conditions. The following “Y” is 90 seconds for the light chain and 150 seconds for the heavy chain.
[Reaction conditions]
2 minutes at 94 ° C,
30 cycles of 98 seconds at 10 seconds, 50 seconds at 30 seconds, and 68 seconds at Y seconds
3 minutes at 68 ° C.

Using the 5′RACE product obtained in the above reaction, a solution having the following composition was prepared. The solution was reacted at 60 ° C. for 30 minutes to add adenine to the end of the 5′RACE product.
9 μL of 5'RACE product
10x A-attachment mix 1μL
10 μL total

A TA cloning reaction solution having the following composition was prepared using the obtained adenine-added product and pcDNA (registered trademark) 3.4 TOPO (registered trademark) TA cloning kit. The reaction was incubated at room temperature for 10 minutes, and the adenine adduct was cloned into pCDNA3.4.
[TA cloning reaction solution]
Adenine adduct 4 μL
salt solution 1μL
pCDNA3.4 1μL
6 μL in total

(1.1.3) Transformation, plasmid extraction, and confirmation of sequence Add the TA cloning sample (3 μL) obtained in (1.1.2) above to DH5α (30 μL), and allow to stand on ice for 30 minutes. Was heated at 42 ° C. for 45 seconds to perform heat shock. After standing still on ice again for 2 minutes, the whole amount was applied to an LB plate containing ampicillin. The plate was incubated at 37 ° C. for 16 hours. A single colony on the plate was picked up in an LB liquid medium containing ampicillin, and cultured with shaking (250 rpm) at 37 ° C. for 16 hours. The culture was centrifuged at 5000 × G for 5 minutes to recover a transformant of Escherichia coli. Plasmids were extracted from the recovered E. coli using a QIAprep Spin Miniprep kit. The specific operation was performed according to the manual attached to the kit. The nucleotide sequence of the obtained plasmid was confirmed using the pCDNA3.4 vector primer. Hereinafter, this plasmid was used as a plasmid for mammalian cell expression.

(1.2) Acquisition of Gene of Wild-type Anti-TSHR Antibody The synthesis of the gene of wild-type human anti-TSHR antibody was entrusted to GenScript Japan Co., Ltd. to acquire the gene of wild-type human anti-TSHR antibody.

(2) Acquisition of mutant genes of each antibody
(2.1) Primer design and PCR
In each antibody light chain, to introduce a mutation in FR3 defined by the Chothia method, a plasmid containing the wild-type anti-insulin antibody gene obtained in (1.1.3) above, the wild-type obtained in (1.2) PCR was performed using the anti-TSHR antibody gene and primers represented by the following nucleotide sequences. The D5 mutant is a mutant in which five amino acid residues of FR3 are mutated to aspartic acid residues, and the E5 mutant is a mutant in which five amino acid residues of FR3 are mutated to glutamic acid residues K5 mutant is a mutant in which five amino acid residues of FR3 are mutated to lysine residues, and R5 mutant is a mutant in which five amino acid residues of FR3 are mutated to arginine residues The R3 mutant is a mutant in which three amino acid residues of FR3 are mutated to arginine residues.

[Anti-insulin antibody primer]
Sequence 1 D5 mutant REV: 5 'TTCGTATTCGGTCCCTTCCCCTTCGCCTTCAAAGCGAGCA 3' (SEQ ID NO: 1)
Sequence 2 E5 mutant REV: 5 ′ ATCGTAATCGGTCCCATCCCCATCGCCATCAAAGCGAGCA 3 ′ (SEQ ID NO: 2)
Sequence 3 K5 mutant REV: 5 ′ CTTGTACTTGGTCCCCTTCCCCTTGCCCTTAAAGCGAGCA 3 ′ (SEQ ID NO: 3)
Sequence 4 R5 mutant REV: 5 ′ TCTGTATCTGGTCCCTCTCCCTCTGCCTCTAAAGCGAGCA 3 ′ (SEQ ID NO: 4)
Sequence 5 FOR: 5'CTCACAATCAGCTGATTG 3 '(SEQ ID NO: 5)
Sequence 6 R3 mutant REV: 5 ′ TCTCCCTCTGCCTCTAAAGCGAGCA 3 ′ (SEQ ID NO: 6)
Sequence 7 R3 mutant FOR: 5 ′ GGGACCAGATACAGA 3 ′ (SEQ ID NO: 7)

  The primer of sequence 5 was used as a forward primer common to the primers of sequences 1-4. The primer of sequence 7 was used as a forward primer for the primer of sequence 6.

[Anti-TSHR antibody primer]
Sequence 8 D5 mutant FOR: 5 ′ GGCACAGACGCCGACCTGGCAATCA 3 ′ (SEQ ID NO: 8)
Sequence 9 D5 mutant REV: 5 ′ GTCCCGGTCTCCGTCAAACCGGTCG 3 ′ (SEQ ID NO: 9)
Sequence 10 E5 mutant FOR: 5 ′ GGCACAGAGGCCGAGCTGGCAATCA 3 ′ (SEQ ID NO: 10)
Sequence 11 E5 mutant REV: 5 'CTCCCGCTCTCCCTCAAACCGGTCG 3' (SEQ ID NO: 11)
Sequence 12 K5 mutant FOR: 5 ′ GGCACAAAGGCCAAGCTGGCAATCA 3 ′ (SEQ ID NO: 12)
Sequence 13 K5 mutant REV: 5 ′ CTTCCGCTTTCCCTTAAACCGGTCG 3 ′ (SEQ ID NO: 13)
Sequence 14 R5 mutant FOR: 5 ′ GGCACAAGGGCCAGGCTGGCAATCA 3 ′ (SEQ ID NO: 14)
Sequence 15 R5 mutant REV: 5 'CCTCCGCCTTCCCCTAAACCGGTCG 3' (SEQ ID NO: 15)

Using the plasmid obtained in the above (1.3) as a template, a PCR reaction solution having the following composition was prepared.
[PCR reaction solution]
5 μL of 10x PCR buffer
25 mM Mg ₂ SO _{4 3} μL
2mM dNTP mix 5μL
Forward primer 1 μL
Reverse primer 1μL
0.5 μL template plasmid (40 ng / μL)
KOD plus neo (1 U / μL) 1μL
Purified water 33.5μL
50 μL in total

The prepared PCR reaction solution was subjected to a PCR reaction under the following reaction conditions.
[Reaction conditions]
2 minutes at 98 ° C,
30 cycles of 10 seconds at 98 ° C, 30 seconds at 54 ° C, and 4 minutes at 68 ° C, and
3 minutes at 68 ° C.

To the obtained PCR product (50 μL), 2 μL of DpnI (10 U / μL) was added to fragment the PCR product. A ligation reaction solution having the following composition was prepared using the DpnI-treated PCR product. The reaction solution was incubated at 16 ° C. for 1 hour to perform a ligation reaction.
[Ligation reaction solution]
2 μL of DpnI-treated PCR product
Ligation high ver.2 5μL
T4 polynucleotide kinase 1 μL
Purified water 7μL
15 μL in total

(2.2) Transformation, plasmid extraction, and confirmation of sequence The ligation solution (3 μL) was added to DH5α (30 μL), and an E. coli transformant was obtained in the same manner as in (1.1.3) above. Plasmids were extracted from the obtained Escherichia coli using a QIAprep Spin Miniprep kit. The nucleotide sequence of each of the obtained plasmids was confirmed using the pCDNA3.4 vector primer. Hereinafter, these plasmids were used as plasmids for mammalian cell expression.

(3) Expression in mammalian cells
[reagent]
Expi293TM cells (Invitrogen)
Expi293TM Expression Medium (Invitrogen)
ExpiFectamineTM 293 Transfection Kit (Invitrogen)

(3.1) Transfection
Expi293 cells were grown by shaking culture (150 rpm) at 37 ° C. in a 5% CO 2 atmosphere. A 30 mL cell culture (3.0 × 10 6 cells / mL) was prepared in a number corresponding to the number of samples. Using a plasmid encoding each mutant of FR3 and a plasmid encoding a wild-type antibody, a DNA solution having the following composition was prepared and allowed to stand for 5 minutes.
[DNA solution]
Light chain plasmid solution Amount equivalent to 15 μg (μL)
Heavy chain plasmid solution Amount equivalent to 15 μg (μL)
Opti-MEM (TM) qs (mL)
1.5 mL total

A transfection reagent having the following composition was prepared and allowed to stand for 5 minutes.
ExpiFectamine reagent 80μL
Plasmid solution 1420μL
1.5 mL total

The prepared DNA solution and transfection reagent were mixed and allowed to stand for 20 minutes. The obtained mixture (3 mL) was added to the cell culture (30 mL), followed by shaking culture (150 rpm) at 37 ° C. in a 5% CO ₂ atmosphere for 20 hours. Twenty hours later, each culture was added with 150 μL and 1.5 mL of ExpiFectamine® Transfection Enhancer 1 and 2, respectively, and shake-cultured at 37 ° C. for 6 days in a 5% CO ₂ atmosphere (150 rpm). did.

(3.2) Recovery and Purification of Antibody Each cell culture was centrifuged at 3000 rpm for 5 minutes to recover a culture supernatant. The culture supernatant contains each antibody secreted from the transfected Expi293 ™ cells. The obtained culture supernatant was centrifuged again at 15000 × G for 10 minutes, and the supernatant was collected. To the obtained supernatant (30 mL), 100 μL of an antibody purification carrier Ab-Capcher Mag (Protenova) was added, and reacted at room temperature for 2 hours. The carrier was collected, the supernatant was removed, and PBS (1 mL) was added to wash the carrier. 400 μL of 100 mM Gly-HCl (pH 2.8) was added to the carrier to elute the antibody (IgG) captured by the carrier. This elution operation was performed three times in total. The obtained eluate was neutralized with 100 mM Tris-HCl (pH 8.0) to obtain an antibody solution.

(4) Results The serine residues 63, 65, 67, 70 and 72 of the light chain FR3 defined by the Chothia method in the wild-type anti-insulin antibody and the wild-type anti-TSHR antibody were replaced with charged amino acid residues. (Aspartic acid residue, glutamic acid residue, lysine residue or arginine residue). In addition, an antibody was obtained in which the serine residues 63, 65 and 67 of the light chain FR3 defined by the Chothia method in the wild-type anti-insulin antibody were replaced with charged amino acid residues (arginine residues).

Example 2 Measurement of Affinity of Antibody in which Charged Amino Acid Residue was Introduced into FR3 It was examined how the affinity of each mutant prepared in Example 1 for an antigen changes as compared to the wild type.

(1) Antibody fragmentation
Each antibody obtained in Example 1 was converted into a Fab fragment using Pierce (trademark) Mouse IgG1 Fab and F (ab ') 2 Preparation Kit (Thermo Fisher). The specific operation was performed according to the manual attached to the kit. The resulting reaction solution was subjected to gel filtration purification using Superdex 200 Increase 10/300 GL (GE Healthcare). The 50 kDa elution fraction was collected, and the obtained fraction was used as a Fab fragment-containing solution in subsequent experiments.

(2) Affinity measurement
(2.1) Measurement of Affinity by SPR Technique The affinity of wild-type anti-insulin antibody and its mutant for antigen was measured by the SPR technique as follows. Humulin R Injection 100 units (Eli Lilly) was used as an anti-insulin antibody antigen. The antigen was immobilized on a Biacore (registered trademark) sensor chip Series S Sensor Chip CM5 (GE Healthcare) (immobilization: 100 RU). The solution containing the Fab fragment of the anti-insulin antibody was diluted to prepare solutions of 50 nM, 25 nM, 12.5 nM, 6.25 nM and 3.13 nM. The Fab fragment-containing solution of each concentration was sent to Biacore (registered trademark) T200 (GE Healthcare) (association time 120 seconds and dissociation time 1200 seconds). The measurement data was analyzed using Biacore (registered trademark) Evaluation software, and data on the affinity of the anti-insulin antibody was obtained.

(2.2) Evaluation of affinity by ELISA method The affinity of the wild-type anti-TSHR antibody and its mutant for the antigen was measured by the ELISA method as follows.

(2.2.1) Immobilization of Capture Antibody Immobilized As a capture antibody, a mouse monoclonal anti-TSHR antibody, 4E31 antibody (RSR) was used. The 4E31 antibody (5 μg) was diluted with PBS to obtain an antibody solution. 100 μL of this antibody solution was added to each well of a NUNC-immuno module (Cat No. 469949, manufactured by NUNC; hereinafter, referred to as “plate”). The plate was allowed to stand at room temperature for 3 hours to immobilize the 4E31 antibody on the wells. After removing the antibody solution, 300 μL of a blocking solution (PBS containing 1% BSA) was added to each well of the plate. Blocking was performed at 4 ° C. for 20 hours or more.

(2.2.2) Primary reaction Detergent solubilized cell membrane preparation containing the TSHR (RSR) was used as an anti-TSHR antibody antigen. This antigen was diluted 500-fold with PBS containing 1% BSA to obtain an antigen solution. The blocking solution was removed from the plate on which the 4E31 antibody was immobilized, and 50 μL of the antigen solution was added to each well. This plate was shaken at room temperature for 60 minutes to perform an antigen-antibody reaction.

(2.2.3) Secondary reaction As an antibody for detection, a wild-type anti-TSHR antibody, a D5 mutant and an R5 mutant were used. Each antibody was serially diluted with PBS containing 1% BSA to obtain antibody solutions at concentrations of 1000 pM, 100 pM, 10 pM, 1 pM and 0.1 pM. In addition, an HRP-labeled anti-human IgG (Fc-specific) antibody was used as a secondary antibody. This secondary antibody was diluted with PBS containing 1% BSA to obtain a secondary antibody solution having a concentration of 0.2 μg / mL. Each concentration of the antibody solution (50 μL) and the secondary antibody solution (50 μL) were mixed to obtain an antibody mixture. The antigen solution was removed from the plate, and 300 μL of a washing solution (PBS containing 1% BSA) was added to each well. Then, the washing solution was removed from the plate, and washing was performed by adding 300 μL of the washing solution to each well. This washing operation was repeated three times. The washing solution was removed from the plate, and 100 μL of the above antibody mixture was added to each well. This plate was shaken at room temperature for 60 minutes to perform an antigen-antibody reaction. After the reaction, the above washing operation was repeated three times.

(2.2.4) Detection 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was used as a substrate solution. The washing solution was removed from the plate, and the substrate solution was added at 100 μL / well. The plate was left at room temperature for 5 minutes. Five minutes later, 100 μL of a stop solution (0.1 MH ₂ SO ₄ ) was added to each well of the plate to stop the reaction. Then, the absorbance at 450 nm was measured for each well of the plate.

(3) Results The dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and dissociation rate constant (k _off ) obtained for the anti-insulin antibody. Further, the dissociation constant (K _D ) was calculated from the measured value of the ELISA method using the anti-TSHR antibody. The kinetic parameters of each antibody are shown in Tables 3 and 4, and FIGS. 1A and 1B. In the figure, "positively charged" indicates the K _D values of R5 variants, "negative charge" indicates the K _D values of D5 variants. In Table 3, the values obtained by global fitting are “mean ± standard error”.

From Table 3 and Figure 1A, R3 variants of anti-insulin antibodies, K _D values of R5 variants and K5 mutants was lower than _the K _D value of the wild-type. Further, _the K _D value of D5 variants and E5 mutant was higher than _the K _D value of the wild-type. Therefore, it was found that, by mutating three or five amino acid residues of FR3 to basic amino acid residues, an antibody having an improved affinity for the antigen as compared with the wild type can be produced for the anti-insulin antibody. In addition, it was found that by mutating the five amino acid residues of FR3 to acidic amino acid residues, an antibody with reduced affinity for the antigen as compared to the wild type could be produced.

From Table 4 and FIG. 1B, the K _D values of D5 variants of the anti-TSHR antibody, it was higher than _the K _D value of the wild-type. As for the anti-TSHR antibody, it was found that by mutating five amino acid residues of FR3 to acidic amino acid residues, an antibody having reduced antigen affinity as compared with the wild type could be produced. On the other hand, _the K _D value of R5 variants of the anti-TSHR antibody was K _D values comparable to the wild type. That is, it is suggested that the affinity of the anti-TSHR antibody does not change even if the five amino acid residues of FR3 are mutated to basic amino acid residues.

Example 3 Relationship between Electrical Properties of Amino Acid Sequence of CDR and Affinity for Antigen From Example 2, anti-insulin antibody was able to improve and decrease affinity by introducing mutation into FR3. On the other hand, the anti-TSHR antibody could reduce the affinity even if a mutation was introduced into FR3, but could not improve the affinity. Therefore, the effect of introducing a mutation into FR3 on the surface charge of the antigen-binding site of the antibody was examined.

(1) Examination of Change in Surface Charge of Antibody Due to Mutagenesis The surface charge distribution of various Fab fragments prepared in Example 1 was analyzed using Discovery Studiou (Dassault Systèmes Biovia). FIG. 2A shows a surface charge distribution diagram of the Fab fragment of the anti-insulin antibody and insulin as an antigen. FIG. 2B shows the surface charge distribution of the Fab fragment of the anti-TSHR antibody and TSHR as the antigen. In the figure, the arrow indicates the antigen binding site, and PI indicates the value of the isoelectric point. Here, the antigen binding site is the same as the CDR. In the figure, the surface charge distribution is indicated by color, where a blue portion indicates a positive charge, a red portion indicates a negative charge, and a white portion indicates an electrically neutral.

  From FIG. 2A, it was found that the surface charge of the antigen-binding site was neutral in the wild-type anti-insulin antibody. In the mutant in which a basic amino acid residue was introduced into FR3 (positive charge mutation), the surface charge over a wide range including the antigen binding site was positive. Here, although insulin, which is an antigen, is a protein with a negative charge, the affinity for the mutant antigen into which the positive charge mutation was introduced was improved from FIG. 1A. On the other hand, in the mutant in which an acidic amino acid was introduced into FR3 (negative charge mutation), the surface charge over a wide range including the antigen binding site was negative. As shown in FIG. 1A, the affinity for the mutant antigen into which the negative charge mutation was introduced was reduced. From these results, it is understood that the contribution of the charged amino acid residue introduced into FR3 to the surface charge is wide in the wild-type anti-insulin antibody.

  FIG. 2B shows that the wild-type anti-TSHR antibody has a negative surface charge at the antigen binding site. In the mutant in which a basic amino acid was introduced into FR3 (positive charge mutation), the surface charge in the range excluding the antigen binding site became positive, but the surface charge at the antigen binding site did not change much. Here, TSHR, which is an antigen, is a protein with a negative charge, but from FIG. 1B, there was no change in affinity for the antigen of the mutant type into which the positive charge mutation was introduced. On the other hand, in the mutant in which an acidic amino acid was introduced into FR3 (negative charge mutation), a wide range of surface charges including the antigen binding site was negative. From FIG. 1B, the affinity for the antigen of the mutant type into which the negative charge mutation was introduced was reduced. These results indicate that the contribution of the acidic amino acid residues introduced into FR3 to the surface charge is wide in wild-type anti-TSHR antibodies. On the other hand, even if a basic amino acid residue is introduced into FR3 of the wild-type anti-TSHR antibody, the surface charge is found to be locally different.

(2) Relationship between the electrical properties of the amino acid sequence of CDR and the control of affinity The inventors of the present invention determined how the introduction of a charged amino acid residue into FR3 of an antibody changes the affinity for an antigen. It was thought that the electrical properties of the CDRs of the antibody were relevant. Here, the present inventors defined the electrical characteristics of the CDR by the following formula (I).

X = [number of basic amino acid residues in amino acid sequence of CDR] − [number of acidic amino acid residues in amino acid sequence of CDR] (I)
(Where X is −1, 0 or 1, the electrical properties of the CDR are neutral;
When X is 2 or more, the electrical property of the CDR is a positive charge,
When X is -2 or less, the electrical characteristics of the CDR are negative.)

  Table 5 shows the amino acid sequence of the light chain CDR of the wild type anti-TSHR antibody (SEQ ID NOs: 16 and 17). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

  Since the CDR of the anti-insulin antibody has one basic amino acid residue (arginine) and no acidic amino acid residue, the CDR electrical properties are defined as neutral (X = 1). As shown in Table 5, since the CDR of the anti-TSHR antibody has five acidic amino acid residues (aspartic acid) and no basic amino acid residue, the electric characteristics of the CDR are negatively charged (X = -5) is defined. As can be seen from FIGS. 2A and 2B, the electrical properties of the CDRs of the anti-insulin and anti-TSHR antibodies determined by Formula (I) are consistent with the surface charge of the antigen binding site analyzed by Discovery Studiou. As described above, it was found that the electrical properties of CDR and the surface charge of the antigen binding site were biased depending on the antibody.

(3) Results The analysis in Examples 2 and 3 suggests that antibodies having neutral CDR electrical properties make a large contribution by introducing charged amino acid residues into FR3. In addition, it is suggested that the orientation of the antigen-binding site can be controlled by the electrostatic interaction caused by the introduction of an antibody having neutral electrical properties of CDR. On the other hand, it is suggested that an antibody having a negative electric charge of CDR has a local effect of electrostatic interaction even when a basic amino acid residue is introduced into FR3. However, it is suggested that, in an antibody whose CDR has negative electric properties, introduction of an acidic amino acid residue into FR3 can reduce affinity for an antigen due to electrostatic repulsion.

Example 4 Investigation of the Thermal Stability of Antibodies Introducing Charged Amino Acid Residues into FR3 How the Thermal Stability of Each Mutant of the Anti-Insulin Antibody Prepared in Example 1 Changes Compared to Wild-Type It was investigated.

(1) Replacement of Buffer by Gel Filtration The solvent of the Fab fragment-containing solution obtained in Example 2 was subjected to gel filtration in a buffer (Phosphate phosphate saline: PBS) used for measurement with a differential scanning calorimeter (DSC). Was replaced with The conditions for gel filtration are as follows.
[Gel filtration conditions]
Buffer: PBS
Column used: Superdex 200 Increase 10/300 (GE Healthcare)
Column volume (CV): 24 mL
Sample volume: 500μL
Flow rate: 1.0 mL / min
Elution volume: 1.5 CV
Fraction volume: 500 μL

(2) Measurement of denaturation temperature (Tm)
The fraction containing the Fab fragment was diluted with PBS to prepare a Fab fragment-containing sample (final concentration 5 μM). The Tm of each Fab fragment was measured using MicroCal VP-Capillary DSC (Malvern Instruments Ltd). The measurement conditions are as follows.
[DSC measurement conditions]
Sample volume: 400μL
Measuring range: 30 ℃ ~ 90 ℃
Heating rate: 60 ° C / hour

(3) Result
The Tm values and analysis peaks obtained by the DSC measurement are shown in Table 6 and FIG. 3, respectively.

  The D5 mutant had the most decreased thermostability compared to the wild type, but the decrease was only about 13%. In most mutants, thermostability was found to be little changed from wild type. Therefore, it is suggested that introduction of a charged amino acid residue into FR3 hardly affects the thermal stability of the antibody.

Example 5 Control of affinity of anti-lysozyme antibody for antigen
Mutations were introduced into FR3 of the anti-lysozyme antibody based on the electrical properties of the CDR, and the affinity of the obtained mutant for lysozyme was confirmed.

(1) Electrical Characteristics of CDR of Anti-Lysozyme Antibody The synthesis of the anti-lysozyme antibody gene was outsourced to Genscript Japan Co., Ltd., and a plasmid DNA containing the wild-type anti-lysozyme antibody gene was obtained. The amino acid sequence of the anti-lysozyme antibody was determined based on the nucleotide sequence of the gene. Table 7 shows the amino acid sequences of the light chain and heavy chain CDRs of the wild-type anti-lysozyme antibody (SEQ ID NOs: 18 to 23). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

  As shown in Table 7, the CDRs of the light and heavy chains of the anti-lysozyme antibody have two basic amino acid residues and three acidic amino acid residues. Thus, the electrical properties of the CDRs of the anti-lysozyme antibody are defined as neutral (X = -1).

(2) Preparation of anti-lysozyme antibody mutants GenScript Japan, Inc. was commissioned to synthesize the anti-lysozyme antibody R5 mutant and D5 mutant genes, and the plasmid DNA containing the anti-lysozyme antibody mutant gene was obtained. I got it. Here, the R5 mutant of the anti-lysozyme antibody is the light chain FR3 defined by the Chothia method in the wild-type antibody, the 63rd, 65th and 67th serine residues, the 70th aspartic acid residue, and the 72nd Is an antibody in which the threonine residue is replaced with an arginine residue. Further, the D5 mutant of the anti-lysozyme antibody is a light chain FR3 defined by the Chothia method in the wild-type antibody, the 63rd, 65th and 67th serine residues, the 70th aspartic acid residue, and the 72nd This is an antibody in which a threonine residue is substituted with an aspartic acid residue.

  Using the obtained plasmid, each antibody was expressed in Expi293 (TM) cells in the same manner as in Example 1, and the obtained culture supernatant was purified to obtain a wild-type anti-lysozyme antibody, an R5 mutant and Each solution of the D5 mutant was obtained.

(3) Measurement of affinity of mutant for antigen As a lysozyme antibody antigen, a solution (200 ng / mL) of chicken egg white-derived lysozyme (Sigma-Aldrich) dissolved in 10 mM sodium acetate solution (pH 5.0) was used. Was. The antigen was immobilized on a Biacore (registered trademark) sensor chip Series S Sensor Chip CM5 (GE Healthcare) (41 RU or 33 RU). Solutions of each antibody were diluted with HBS EP + buffer (GE Healthcare) to prepare solutions of various concentrations. These solutions were sent to Biacore® T200 (GE Healthcare). The antibody concentration and measurement conditions in each solution are as follows. The measurement data was analyzed using Biacore (registered trademark) Evaluation software, and data on the affinity of each antibody was obtained.

[Antibody concentration]
Wild type: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
D5 mutant: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
R5 mutant: 2 nM, 1 nM, 0.5 nM, 0.25 nM and 0.125 nM

[Measurement condition]
Association: 30μL / min, 60 sec, 120 sec
Dissociation: 30μL / min, 60 sec, 1200 sec
Regeneration: Gly-HCl (pH 2.0) / 60μL / min, 40 sec

(4) Results The dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and dissociation rate constant (k _off ) obtained for the wild-type and mutant anti-lysozyme antibodies. The kinetic parameters of each antibody are shown in Table 8 and FIG. In the figure, "negative charge" indicates the K _D values of the D5 variant, "positively charged" refers to a K _D values of R5 variants.

From Table 8 and FIG. 4, the K _D values of R5 variants of the anti-lysozyme antibody, it was lower than the K _D values of the wild-type. Further, _the K _D value of D5 mutants was higher than the K _D values of the wild-type. Therefore, for the anti-lysozyme antibody, it was found that by mutating the five neutral amino acid residues of FR3 to basic amino acid residues, an antibody with improved affinity for the antigen as compared to the wild type could be produced. In addition, it was found that by mutating the five neutral amino acid residues of FR3 to acidic amino acid residues, an antibody with reduced affinity for the antigen as compared to the wild type could be produced. These results were similar to the anti-insulin antibody mutant of Example 2. Therefore, it is suggested that in an antibody having a neutral CDR electrical property, the orientation of an antigen binding site can be controlled by an electrostatic interaction caused by introduction of a charged amino acid residue into FR3.

Example 6 Control of affinity of anti-HBsAg antibody for antigen
Mutations were introduced into FR3 of the anti-HBsAg antibody based on the electrical properties of the CDRs, and the affinity of the obtained mutants for lysozyme was confirmed.

(1) Electrical properties of CDR of anti-HBsAg antibody Using a recombinant HBsAg as an antigen, a mouse anti-HBsAg antibody was obtained by the method described in Kohler and Milstein, vol. 256, p. 495-497, 1975. Was produced. In the same manner as in Example 1, a plasmid DNA containing a wild-type anti-HBsAg antibody gene was obtained from the RNA of this hybridoma. The amino acid sequence of the anti-HBsAg antibody was determined based on the nucleotide sequence of the gene. Light and heavy chain CDRs defined by the Chothia method in a wild-type anti-HBsAg antibody were found to have two basic amino acid residues and ten acidic amino acid residues. Therefore, the electrical properties of the CDRs of the anti-HBsAg antibody are defined as negative charges (X = -8).

(2) Preparation of mutant of anti-HBsAg antibody
In order to introduce a mutation into the light chain FR3 defined by the Chothia method, using the wild-type anti-HBsAg antibody gene obtained in (1) above and primers represented by the following nucleotide sequence, the same procedure as in Example 1 was carried out. PCR was performed.

[Anti-HBsAg antibody primer]
D5 mutant FOR: 5 'GGGACCGATTATGATCTCACAATCAGTCGAATGGAG 3' (SEQ ID NO: 24)
D5 mutant REV: 5 'ATCCCCATCGGCATCGAAACGAACAGGGACTCCAGAAGC 3' (SEQ ID NO: 25)

  Using the obtained PCR products, a plasmid containing a gene encoding a mutant or wild-type light chain and a plasmid containing a gene encoding a wild-type heavy chain were obtained in the same manner as in Example 1. . Using these plasmids, each antibody was expressed in Expi293 (TM) cells in the same manner as in Example 1, and the resulting culture supernatant was purified to obtain the anti-HBsAg antibody wild-type and D5 mutant, respectively. Was obtained. Here, the D5 mutant of the anti-HBsAg antibody has the 63rd, 65th, 67th and 70th serine residues and the 72nd phenylalanine residue of the light chain FR3 defined by the Chothia method in the wild type antibody. , An antibody substituted with an aspartic acid residue.

(3) Measurement of affinity of mutant for antigen
(3.2) Immobilization of antibody for capture As in Example 2, except that a mouse anti-HBsAg antibody produced from a hybridoma different from the hybridoma obtained in (1) above was used as the antibody for capture, This capturing antibody was immobilized on each well of a plate (NUNC-Immuno Module, Cat No. 469949, manufactured by NUNC). In the same manner as in Example 2, each well of the plate was blocked with a blocking solution (PBS containing 1% BSA).

(3.3) Primary reaction As an antigen of the anti-HBsAg antibody, a HISCL (registered trademark) HBsAg calibrator (HBsAg concentration: 0.025 IU / mL, Sysmex Corporation) was used. The blocking solution was removed from the plate on which the antibody for capture was immobilized, and 50 μL of the antigen solution was added to each well. This plate was shaken at room temperature for 60 minutes to perform an antigen-antibody reaction.

(3.3) Secondary reaction and detection Wild-type and D5 mutant anti-HBsAg antibodies were used as detection antibodies. Each antibody was serially diluted with PBS containing 1% BSA to obtain antibody solutions at concentrations of 400 nM, 80 nM, 16 nM, 3.2 nM, 640 pM, 128 pM, 25.6 pM and 5.12 pM. Also, an HRP-labeled anti-mouse IgG (Fc-specific) antibody was used as a secondary antibody. Using these, an antigen-antibody reaction was performed in the same manner as in Example 2. Then, using a 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) as a substrate solution, the absorbance at 450 nm was measured for each well of the plate in the same manner as in Example 2.

(4) Results The dissociation constant (K _D ) was calculated from the measured values of the ELISA method using the wild type and D5 mutant of the anti-HBsAg antibody. The results are shown in Table 9 and FIG. In the figure, "negative charge" indicates the K _D values of D5 variants.

From Table 9 and Figure 5, is _the K _D value of D5 variants of the anti-HBsAg antibody was higher than _the K _D value of the wild-type. Further, _the K _D value of D5 mutants was higher than the K _D values of the wild-type. Therefore, for the anti-HBsAg antibody, it was found that by mutating the five neutral amino acid residues of FR3 to acidic amino acid residues, an antibody with reduced affinity for the antigen as compared to the wild type could be produced. These results were similar to those of the anti-TSHR antibody D5 mutant and E5 mutant of Example 2. Therefore, it is suggested that in an antibody whose electric properties of CDR are negatively charged, affinity for an antigen can be reduced by electrostatic repulsion generated by introduction of an acidic amino acid residue into FR3.

Claims (7)

A method for improving the affinity of an antibody for an antigen, wherein at least three amino acid residues of framework region 3 (FR3) defined by the Chothia method are arginine residues or lysine residues in the antibody. Improving the affinity of the antibody for the antigen as compared to the antibody before the at least three amino acid residues are arginine residues or lysine residues,
The at least three amino acid residues are at least two amino acid residues selected from the group consisting of the amino acid residue at position 72 in the light chain and the position 63, light chain 65, light chain 67 and light chain 70 of the light chain. The above method. A method for producing an antibody having improved affinity for an antigen,
In the antibody, at least three amino acid residues of the framework region 3 (FR3) defined by the Chothia method as an arginine residue or a lysine residue,
Recovering the antibody obtained in the replacement step,
The affinity of the recovered antibody for the antigen is improved as compared to the antibody before the at least three amino acid residues are arginine residues or lysine residues,
The at least three amino acid residues are at least two amino acid residues selected from the group consisting of the amino acid residue at position 72 in the light chain and the position 63, light chain 65, light chain 67 and light chain 70 of the light chain. The above production method, comprising:   3. The method according to claim 1, wherein the antibody is in the form of an antibody fragment.   The method according to claim 3, wherein the antibody fragment is a Fab fragment. A modified antibody,
In the antibody, at least three amino acid residues of the framework region 3 (FR3) defined by the Chothia method are arginine residues or lysine residues,
The affinity of the antibody for the antigen is improved as compared to the antibody before the at least three amino acid residues are arginine residues or lysine residues,
The at least three amino acid residues are at least two amino acid residues selected from the group consisting of the amino acid residue at the 72nd position of the light chain and the 63rd position of the light chain, the 65th position of the light chain, the 67th position of the light chain, and the 70th position of the light chain. The above antibody, comprising:   The antibody according to claim 5, which is in the form of an antibody fragment.   The antibody according to claim 6, wherein the antibody fragment is a Fab fragment.