JP6474524B1 - Method for controlling affinity of antibody for antigen, antibody with modified affinity for antigen, and method for producing the same - Google Patents

Abstract

It is an object of the present invention to provide a technique for controlling the affinity of an antibody for an antigen and an antibody having a modified affinity for the antigen.
According to the electrical characteristics of CDR based on the amino acid sequence of complementarity determining region (CDR), at least three amino acid residues in framework region 3 defined by Chothia method in antibodies are charged amino acid residues. The above problem is solved by substituting.
[Selection figure] None

Description

  The present invention relates to a method for controlling the affinity of an antibody for an antigen. The present invention also relates to an antibody having a modified affinity for an antigen and a method for producing the same.

  Conventionally, a technique for modifying the affinity of an antibody for an antigen by introducing a mutation into the amino acid sequence of the antibody is known. For example, Patent Document 1 describes a method of introducing a mutation into the amino acid sequence of an antibody complementarity determining region (CDR) to reduce the affinity of the antibody for an antigen.

  It is also known that the affinity for an antigen is altered by introducing a mutation into the amino acid sequence of the framework region in the variable region instead of the CDR. For example, in Non-Patent Document 1 and Patent Document 2, the 60th, 63rd, 65th and 67th amino acid residues located in the framework region 3 of a single chain antibody (scFv) that binds to troponin I, It is described that a basic amino acid is substituted with a lysine or arginine residue. Troponin I is an antigen with a high content of charged amino acids. In Non-Patent Document 1 and Patent Document 2, firstly, a single-chain antibody that recognizes an acidic epitope whose pI is 3.57 and a single-chain antibody that recognizes a basic epitope whose pI is 11.45 are prepared. Non-Patent Document 1 and Patent Document 2 describe that affinity for troponin I could be improved by utilizing the electric attractive force generated by the introduction of basic amino acid residues into these single-chain antibodies. ing.

US Patent Application Publication No. 2012/0329995 International Publication No. 2013/084371 Pamphlet

Fukunaga A and Tsumoto K, Improving the affinity of an antibody for its antigen via long-range electrostatic interactions, Protein Eng. Des.Sel.vol.26, no.12, p.773-780, 2013

  In Non-Patent Document 1 and Patent Document 2, from the viewpoint of increasing the binding rate constant in the antibody-antigen reaction, a mutation as described above is introduced into the framework region 3 (FR3) of anti-troponin I antibody to troponin I. Improves affinity. However, these documents do not describe whether antibodies other than anti-troponin I antibodies can modify the affinity for antigens by the same technique.

  Further, Non-Patent Document 1 and Patent Document 2 only describe improvement in affinity for an antigen. On the other hand, when an antibody is used as a reagent, not only an antibody having improved affinity for an antigen but also an antibody having reduced affinity may be required. For example, an antibody with reduced affinity for an antigen can be used as a suitable control for an antigen-antibody reaction. Therefore, establishment of a technique for controlling the affinity of an antibody for an antigen is desired.

  The present inventors have found that when the amino acid residue of FR3 of an antibody is substituted with a charged amino acid residue, the affinity for an antigen can be improved or decreased depending on the type of antibody. Then, the inventors have found that such a difference in affinity change is related to the electrical characteristics of the CDR determined based on the number of charged amino acid residues contained in the CDR, thereby completing the present invention.

  Thus, the present invention provides a method for controlling the affinity of an antibody for an antigen. In this method, at least three amino acid residues of FR3 defined by the Chothia method are substituted with charged amino acid residues in an antibody whose CDR electrical characteristics based on the CDR amino acid sequence are neutral or negatively charged.

  The present invention also provides a method for producing an antibody with an altered affinity for an antigen. This method comprises the steps of substituting at least three amino acid residues of FR3 defined by Chothia method with charged amino acid residues in an antibody having a neutral or negative electric charge of CDR based on the amino acid sequence of CDR; Recovering the antibody obtained in the substitution step.

  Furthermore, the present invention provides antibodies with altered affinity for antigen. In this antibody, the electrical property of CDR based on the amino acid sequence of CDR is neutral or negative charge, and at least three amino acid residues of FR3 defined by Chothia method in an unmodified antibody are charged amino acid residues. Has been replaced.

  According to the present invention, an antibody having an altered affinity for an antigen is provided.

It is a graph which shows the dissociation constant in interaction with a wild-type anti-insulin antibody and its variant, and an antigen (insulin). It is a graph which shows the dissociation constant in interaction with a wild-type antithyroid stimulating hormone receptor (TSHR) antibody and its variant, and an antigen (TSHR). It is a figure which shows the surface charge distribution of a wild-type anti-insulin antibody and its variant, and an antigen (insulin). It is a figure which shows the surface charge distribution of a wild-type anti- TSHR antibody, its variant, and an antigen (TSHR). It is a graph which shows the analysis peak when the thermal stability of a wild-type anti-insulin antibody and its variant is measured with a differential scanning calorimeter (DSC). It is a graph which shows the dissociation constant in interaction with a wild-type anti-lysozyme antibody and its variant, and an antigen (lysozyme). It is a graph which shows the dissociation constant in interaction with a wild-type anti-hepatitis B surface antigen (HBsAg) antibody and its variant, and an antigen (HBsAg).

[1. Method for controlling affinity of antibody to antigen]
In the method for controlling the affinity of an antibody of the present embodiment for an antigen (hereinafter also referred to as “control method”), an antibody whose CDR electrical characteristics based on the CDR amino acid sequence are neutral or negatively charged is expressed as an antigen. It becomes a target to control the affinity. In the control method of this embodiment, in an antibody having such an electrical property, the affinity for the antigen of the antibody is substituted by substituting at least three amino acid residues of FR3 defined by the Chothia method with charged amino acid residues. Allows you to control gender. Here, “controlling the affinity” refers to both improving the affinity of the antibody for the antigen and decreasing the affinity of the antibody for the antigen. Therefore, the control method of this embodiment may be interpreted as a method of modifying the affinity of an antibody for an antigen.

  In the control method of this embodiment, the original antibody to be controlled for affinity to an antigen is also referred to as “unmodified antibody”. In the present specification, substituting an amino acid residue of FR3 defined by Chothia method in an unmodified antibody with a charged amino acid residue is also referred to as “introducing mutation”. Such substitution is also referred to as “mutation introduction” or simply “mutation”. An antibody obtained by introducing a mutation into an unmodified antibody is also referred to as an “antibody with controlled affinity”.

In this embodiment, the introduction of mutations changes the surface charge distribution of the unmodified antibody, thereby controlling the affinity for the antigen. That is, the affinity-controlled antibody has an improved or reduced affinity for the antigen as compared to the unmodified antibody. In this embodiment, the affinity of an antibody with controlled affinity for an antigen may be evaluated by a kinetic parameter in an antigen-antibody reaction, or may be evaluated by an immunological measurement method such as an ELISA method. . The kinetic parameters, association rate constant (k _on), dissociation rate constant (k _off) and dissociation constant (K _D) and the like, preferably K _D. Kinetic parameters in the antigen-antibody reaction can be obtained by surface plasmon resonance (SPR) technology.

May improve affinity for the antibody antigen under the control method of this embodiment, for example, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 1/2, about 1/5, about 1/10, about 1/20, about 1/50, about 1/100 or about 1/1000. On the other hand, if the affinity of the antibody for the antigen is reduced, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 2-fold, about 5 fold, about 10 fold, about 20 fold, about 50 Double, about 100 times or about 1000 times.

  In this embodiment, the unmodified antibody may be an antibody that recognizes any antigen. In a preferred embodiment, the unmodified antibody is an antibody whose base sequence of a gene encoding the light chain and heavy chain variable regions is known or capable of confirming the base sequence. Specifically, it is an antibody whose base sequence of an antibody gene is disclosed in a known database, or an antibody for which a hybridoma producing the antibody is available. Examples of such a database include GeneBank provided by the National Center for Biotechnology Information (NCBI). The antibody class may be any of IgG, IgA, IgM, IgD, and IgE, but is preferably IgG.

  In this embodiment, the unmodified antibody may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation is to be introduced. Further, an antibody with controlled affinity may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation has been introduced. Examples of such antibody fragments include Fab fragments, F (ab ′) 2 fragments, Fab ′ fragments, Fd fragments, Fv fragments, dAb fragments, single chain antibodies (scFv) and the like. Of these, Fab fragments are particularly preferred.

  Three CDRs exist in each variable region of the light chain and heavy chain of the antibody, and constitute the antigen-binding site of the antibody. The three CDRs are called CDR1, CDR2 and CDR3, counting from the amino terminus of the antibody chain. Since CDR is involved in the specificity of the antibody, in the present embodiment, it is preferable that the antibody whose affinity is controlled has no mutation in the CDR. That is, the CDR amino acid sequence of an antibody with controlled affinity is preferably the same as the CDR amino acid sequence of an unmodified antibody.

  The framework region (FR) is a region other than the CDR that exists in each variable region of the light chain and heavy chain of an antibody. FR acts as a scaffold that links three CDRs and contributes to the structural stability of CDRs. Therefore, the FR amino acid sequence is highly conserved among antibodies of the same species. FR3 is one of FRs and refers to a region between CDR2 and CDR3.

  In this technique, a method of numbering the amino acid residues of a CDR (hereinafter also referred to as “numbering method”) for defining the CDR boundary and length is known. Examples of such numbering methods include Chothia method (Chothia C. and Lesk AM., Canonical Structures for the Hypervariable Regions of Immunoglobulins., J Mol Biol., Vol. 196, p. 901-917, 1987), Kabat method. (Kabat EA., Et al., Sequences of Proteins of Immunological Interest., NIH publication No.91-3242), IMGT method (Lefranc MP., IMGT Unique Numbering for the Variable (V), Constant (C), and Groove (G) Domains of IG, TR, MH, IgSF, and MhSF., Cold Spring Harb Protoc. 2011 (6): 633-642, 2011), Honergger method (Honegger A. et al., Yet Another Numbering Scheme for Immunoglobulin Variable Domains: An Automatic Modeling and Analysis Tool., J Mol Biol., Vol. 309, p.657-670, 2001), ABM method, Contact method and the like are known. When a number is assigned to an amino acid residue of CDR, FR, which is a region other than CDR, is also numbered. In this embodiment, the boundary and length of CDR and FR3 are defined by the Chothia method, but can also be defined by other numbering methods.

  In the Chothia method, the light chain FR3 is defined as a region consisting of the 53rd to 90th amino acid residues, and the heavy chain FR3 is defined as a region consisting of the 56th to 95th amino acid residues. For comparison, Tables 1 and 2 show the FR3 numbers (positions of the amino acid residues at the start and end points of FR3) of the light and heavy chains as defined by the Chothia method and other numbering methods. The Vernier zone residue in the table is an amino acid residue that contributes to the structural stability of CDR among the amino acid residues contained in FR. Tables 1 and 2 also show the position of the Vernier zone residue in FR3 as defined by each numbering method. Table 1 also shows the positions where mutations were introduced into FR3 of the light chain in Example 1 as defined by each numbering method.

  In this embodiment, at least three mutations may be introduced into any amino acid residue of FR3 (hereinafter also simply referred to as “FR3”) defined by the Chothia method in an unmodified antibody. Preferably, at least three mutations are introduced from FR3 into amino acid residues in a region excluding amino acid residues that are folded inside the molecule and are not exposed on the surface (hereinafter also referred to as “non-exposed residues”). Since introduction of mutations into unexposed residues is not expected to affect the surface charge, it is preferable to exclude unexposed residues from positions where mutations should be introduced. The amino acid residue in the region excluding non-exposed residues from FR3 is specifically the 53rd to 81st amino acid residues of FR3 of the light chain and the 56th to 88th amino acids of FR3 of the heavy chain Residue.

  More preferably, at least three mutations are introduced into amino acid residues in the region of FR3 excluding unexposed residues and Vernier zone residues. This is because the Vernier zone residue contributes to the structural stability of CDR as described above. The amino acid residues in the region excluding non-exposed residues and Vernier zone residues from FR3 are specifically the residues of amino acids 53 to 63, 65, 67, 70 and 72 to 81 of FR3 of the light chain. The amino acid residues 56-66, 68, 70, 72, 74-77 and 79-88 of FR3 of the heavy chain.

  Particularly preferably, at least three mutations are introduced into amino acid residues whose side chains are directed to the molecular surface among amino acid residues in the region excluding unexposed residues and Vernier zone residues from FR3. By replacing the amino acid residue whose side chain faces the surface of the molecule with a charged amino acid residue, the contribution to the surface charge is further increased. Amino acid residues whose side chain in FR3 faces the molecular surface are the 53, 54, 56, 57, 60, 63, 65, 67, 70, 72, 74, 76, 77 and 79-81 of FR3 of the light chain 56, 57, 59, 61, 62, 64 to 66, 68, 70, 72, 74, 75, 77, 79, 81, 83, 84 and 86 to 88 of heavy chain FR3 Of amino acid residues.

  In this embodiment, at least three mutations may be introduced into either the light chain FR3 or the heavy chain FR3. From the viewpoint of the thermal stability of the antibody, it is preferable to introduce at least three mutations into the FR3 of the light chain. When both the light chain and heavy chain FR3 have mutations, it is preferable to introduce at least three mutations into the light chain FR3 and at least three mutations into the heavy chain FR3.

  In the present embodiment, the upper limit of the number of mutations introduced into FR3 is not particularly limited, but is preferably 16 amino acids or less. That is, the number of mutations in FR3 of an antibody with controlled affinity is specifically 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 It is.

  As described above, in the control method of the present embodiment, the surface charge distribution changes due to the introduction of the mutation into the unmodified antibody, and the affinity for the antigen changes. Thus, it is preferred that all at least three mutations are substitutions with charged amino acid residues having the same charge. That is, all of the at least three mutations are preferably substitutions with acidic amino acid residues or substitutions with basic amino acid residues.

  A charged amino acid residue refers to an aspartic acid residue, a glutamic acid residue, a lysine residue, an arginine residue, and a histidine residue. An acidic amino acid residue refers to an aspartic acid residue and a glutamic acid residue. Basic amino acid residues refer to lysine residues, arginine residues and histidine residues. In this embodiment, lysine residues and arginine residues are preferred as basic amino acid residues introduced into FR3 as mutations.

  In the present embodiment, the at least three mutations introduced into the unmodified antibody may be mutations that substitute neutral amino acid residues of FR3 with charged amino acid residues. Neutral amino acid residues are alanine, asparagine, isoleucine, glycine, glutamine, cysteine, threonine, serine, tyrosine, phenylalanine, and proline residues. Groups, valine residues, methionine residues, leucine residues and tryptophan residues.

  As described above, in the present embodiment, an antibody whose CDR electrical characteristics based on the CDR amino acid sequence are neutral or negatively charged is the target for controlling the affinity for the antigen. In this specification, the electrical characteristic of CDR is an index uniquely defined by the present inventors, and is determined based on the number of charged amino acid residues in the amino acid sequence of CDR. Specifically, the electrical characteristics of the CDR are determined by the following formula (I).

X = [number of basic amino acid residues in the amino acid sequence of CDR] − [number of acidic amino acid residues in the amino acid sequence of CDR] (I)
(Wherein, when X is -1, 0 or 1, the electrical characteristics of the CDR are neutral,
When X is 2 or more, the electrical characteristic of CDR is positive charge,
(When X is −2 or less, the electrical characteristics of the CDR are negative charges)

  The electrical properties of CDRs are preferably determined based on the amino acid sequences of both light and heavy chain CDRs. In this case, the CDR amino acid sequence in the formula (I) refers to all amino acid sequences of the light chain CDR1, CDR2, and CDR3 and the heavy chain CDR1, CDR2, and CDR3. In this embodiment, at least three amino acid residues of FR3 of the light chain are charged in an antibody whose electrical properties determined based on the amino acid sequences of both the light chain and heavy chain CDRs are neutral or negatively charged. Substitution with an amino acid residue is preferred.

  The electrical properties of the CDRs may be determined for each of the light chain and heavy chain CDRs. That is, when determining the electrical characteristics of the light chain CDR, the amino acid sequence of the CDR in formula (I) refers to all amino acid sequences of the light chain CDR1, CDR2, and CDR3. When determining the electrical characteristics of heavy chain CDR, the amino acid sequence of CDR in formula (I) refers to all amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain. In the present embodiment, in an antibody in which the light chain CDR has neutral or negative charge, it is preferable to substitute at least three amino acid residues of FR3 of the light chain with charged amino acid residues.

  The amino acid sequence of CDRs can be obtained from public databases that disclose antibody gene sequences. Alternatively, when there is a hybridoma that produces an unmodified antibody, the CDR amino acid sequence is obtained by obtaining a nucleic acid encoding a heavy chain and a light chain from the hybridoma by a known method, and sequencing the base sequence of the nucleic acid. Can be obtained.

  The electrical properties of CDRs vary from antibody to antibody. For example, as shown in Example 3 below, the light chain CDR of a wild-type (ie, unmodified) anti-insulin antibody has one basic amino acid residue (arginine) and an acidic amino acid residue. do not do. Thus, the CDR electrical properties of the wild-type anti-insulin antibody are defined as neutral (X = 1). The light chain CDR of the wild-type anti-TSHR antibody has 5 acidic amino acid residues (aspartic acid) and no basic amino acid residue. Thus, the CDR electrical properties of the wild-type anti-TSHR antibody are defined as negative charge (X = −5).

  For unmodified antibodies with neutral CDR electrical properties, substitution of at least three amino acid residues of FR3 with acidic amino acid residues results in a negative surface charge over a wide range including the antigen binding site of the antibody. It becomes. In addition, for unmodified antibodies with neutral CDR electrical properties, the substitution of at least three amino acid residues of FR3 with basic amino acid residues results in a broad surface containing the antigen binding site of the antibody. The charge becomes positive. Such a change in surface charge causes an electrostatic interaction (attraction or repulsion) when the antibody and the antigen bind. In other words, in an unmodified antibody with neutral CDR electrical characteristics, the affinity of the antibody for antigen is compared with that of an unmodified antibody by substituting at least three amino acid residues of FR3 with acidic amino acid residues. Can be reduced. Furthermore, in an unmodified antibody with neutral CDR electrical characteristics, the affinity of the antibody for the antigen can be changed to that of an unmodified antibody by substituting at least three amino acid residues of FR3 with basic amino acid residues. It can be improved.

  In an antibody in which the electrical characteristics of CDR are negatively charged, substitution of at least three amino acid residues of FR3 with acidic amino acid residues makes the surface charge in a wide range including the antigen binding site of the antibody negative. Such a change in surface charge causes an electrostatic interaction (repulsive force) when the antibody and the antigen are bound. That is, in an unmodified antibody in which the electrical characteristics of the CDR are negatively charged, the affinity of the antibody for the antigen is compared with that of the unmodified antibody by substituting at least three amino acid residues of FR3 with acidic amino acid residues. Can be reduced.

  In this embodiment, a mutation can be introduced into FR3 of an unmodified antibody by a known method such as a DNA recombination technique and other molecular biological techniques. For example, when there is a hybridoma producing an unmodified antibody, as shown in Example 1 described later, using RNA extracted from the hybridoma, reverse transcription reaction and RACE (Rapid Amplification of cDNA ends) method, Each of the polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain is synthesized. These polynucleotides are amplified by PCR using primers for introducing mutations into at least three amino acid residues of FR3, and polynucleotides and heavy chains encoding light chains in which mutations are introduced into FR3 A polynucleotide encoding is obtained. The obtained polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding an antibody with controlled affinity. Here, the polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain may be incorporated into one expression vector or separately into the two expression vectors. The type of expression vector is not particularly limited, and may be an expression vector for mammalian cells or an expression vector for E. coli. By transducing or transfecting the obtained expression vector into an appropriate host cell (for example, mammalian cell or E. coli), an antibody with controlled affinity can be obtained.

  When obtaining an antibody with controlled affinity that is a single chain antibody (scFv), for example, as shown in Patent Document 2, RNA extracted from the above hybridoma is used to reverse the light chain by reverse transcription and PCR. Each of the polynucleotide encoding the variable region and the polynucleotide encoding the heavy chain variable region may be synthesized. These polynucleotides are linked by an overlap extension PCR method or the like to obtain a polynucleotide encoding an unmodified scFv. The obtained polynucleotide is amplified by PCR using primers for introducing mutations into at least three amino acid residues of FR3, thereby obtaining a polynucleotide encoding scFv having mutations introduced into FR3. . The obtained polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding an antibody with controlled affinity in the form of scFv. By transducing or transfecting the resulting expression vector into an appropriate host cell, an antibody with controlled affinity in the form of scFv can be obtained.

  If there is no hybridoma that produces an antibody that recognizes the antigen of interest, the antibody can be obtained by a known method such as the method described in Kohler and Milstein, Nature, vol. 256, p.495-497, 1975. A production hybridoma may be prepared. Alternatively, RNA obtained from the spleen of an animal such as a mouse immunized with the antigen of interest may be used. When RNA obtained from the spleen is used, for example, as shown in Non-Patent Document 1, an unmodified antibody having a desired affinity by a phage display method or the like from the obtained polynucleotide encoding an unmodified Fab. A polynucleotide encoding the Fab may be selected.

[2. Method for producing antibody with modified affinity for antigen]
The scope of the present invention also includes a method for producing an antibody with modified affinity for an antigen (hereinafter also referred to as “manufacturing method”). In the production method of the present embodiment, first, in an antibody in which the electrical characteristics of CDR based on the amino acid sequence of CDR are neutral or negatively charged, at least three amino acid residues of FR3 defined by Chothia method are charged amino acid residues. The process of substituting is performed.

  In the production method of the present embodiment, the above-described antibody in which the amino acid residue of FR3 is substituted is the same as the unmodified antibody in the control method of the present embodiment. Hereinafter, the original antibody to be modified for affinity to the antigen in the production method of the present embodiment is also referred to as “unmodified antibody”. Details of the electrical characteristics of the CDR are the same as those described for the control method of this embodiment. The CDR CDR characteristics of the antibody can be determined by the above formula (I). The FR3 defined by the Chothia method is the same as that described for the control method of the present embodiment, as shown in Tables 1 and 2.

  In the production method of the present embodiment, an antibody having an altered affinity for an antigen can be obtained by changing the surface charge distribution of the antibody by substitution of amino acid residues. That is, the above substitution step comprises substituting at least three amino acid residues of FR3 defined by the Chothia method with charged amino acid residues in an antibody with neutral or negative electrical characteristics of CDR, and This can be said to be a process of modifying affinity. For example, in the above substitution step, at least three amino acid residues of FR3 defined by Chothia method are substituted with acidic amino acid residues in an antibody with neutral CDR electrical characteristics, and the affinity of the antibody for the antigen is increased. It may be a step of reducing compared to an unmodified antibody. In addition, the substitution step described above replaces at least three amino acid residues of FR3 defined by Chothia method with basic amino acid residues in an antibody with neutral CDR electrical characteristics, and the affinity of the antibody for the antigen It may be a step of improving the antibody as compared with the unmodified antibody. Alternatively, the above substitution step replaces at least three amino acid residues of FR3 defined by the Chothia method with acidic amino acid residues in an antibody having a negative electrical property of CDR, thereby increasing the affinity of the antibody for the antigen. It may be a step of reducing compared to an unmodified antibody.

  In this embodiment, at least three amino acid residues of FR3 of the light chain are charged in an antibody whose electrical properties determined based on the amino acid sequences of both the light chain and heavy chain CDRs are neutral or negatively charged. Substitution with an amino acid residue is preferred. In an antibody in which the light chain CDR has neutral or negative electrical characteristics, it is preferable to substitute at least three amino acid residues of FR3 of the light chain with charged amino acid residues.

  Substitution of amino acid residues can be performed by known methods such as DNA recombination techniques and other molecular biological techniques. For example, when there is a hybridoma that produces an antibody whose CDR electrical characteristics are neutral or negatively charged, in the same manner as described for the control method of this embodiment, an antibody whose affinity for an antigen is modified is used. An expression vector containing the encoding polynucleotide can be obtained. The obtained expression vector can be transduced or transfected into an appropriate host cell to obtain a host cell that expresses the antibody.

  Next, in the production method of the present embodiment, the antibody obtained in the above substitution step is recovered. For example, a host cell that expresses an antibody with altered affinity for an antigen is dissolved in a solution containing an appropriate solubilizing agent, and the antibody is released into the solution. When the above host cell secretes an antibody having an altered affinity for an antigen into the medium, the culture supernatant is collected. The released antibody can be recovered by a method known in the art such as affinity chromatography. For example, when the produced antibody is IgG, it can be recovered by affinity chromatography using protein A or G. If necessary, the recovered antibody may be purified by a method known in the art such as gel filtration.

The affinity of the prepared antibody for the antigen may be evaluated by a kinetic parameter in the antigen-antibody reaction, or may be evaluated by an immunological measurement method such as an ELISA method. Antibody affinity is improved to an antigen, for example, the value K _D of the antigen-antibody reaction, as compared to the original antibody, about 1/2, about 1/5, about 1/10, about 1 / 20, about 1/50, about 1/100, or about 1/1000. Antibody affinity is lowered to an antigen, the value K _D of the antigen-antibody reaction, as compared to the original antibody, about 2-fold, about 5 fold, about 10 fold, about 20 fold, about 50-fold, It is about 100 times or about 1000 times.

[3. Antibody with modified affinity for antigen]
The scope of the present invention also includes an antibody with modified affinity for an antigen (hereinafter also referred to as “modified antibody”). The modified antibody of this embodiment is characterized in that the electrical characteristics of CDR based on the amino acid sequence of CDR are neutral or negative charge. Details of the electrical characteristics of the CDR are the same as those described for the control method of this embodiment. The CDR electrical properties of the modified antibody can be determined by the above formula (I).

  In the modified antibody of this embodiment, at least three amino acid residues of FR3 defined by the Chothia method in an unmodified antibody are substituted with charged amino acid residues. That is, the modified antibody of this embodiment has at least three mutations due to substitution with charged amino acid residues in FR3 defined by the Chothia method, compared to the amino acid sequence of an unmodified antibody. The modified antibody of this embodiment is the same as the above-mentioned “antibody with controlled affinity”. The FR3 defined by the Chothia method is the same as that described for the control method of the present embodiment, as shown in Tables 1 and 2.

  Here, the unmodified antibody refers to an antibody before the affinity for the antigen is modified. That is, the unmodified antibody is the original antibody of the modified antibody, and the FR3 amino acid residue defined by the Chothia method is not substituted with a charged amino acid residue. This unmodified antibody corresponds to the original antibody to be controlled for affinity to an antigen in the control method of the present embodiment. In this embodiment, the unmodified antibody has a CDR whose electrical properties are neutral or negatively charged.

  In the modified antibody of this embodiment, the surface charge distribution of the antibody changes due to the introduction of mutation. That is, the modified antibody has an improved or reduced affinity for the antigen as compared to the unmodified antibody. In the present embodiment, the affinity of the modified antibody for the antigen may be evaluated by a kinetic parameter in the antigen-antibody reaction, or may be evaluated by an immunoassay such as an ELISA method. The types and acquisition of kinetic parameters are the same as those described for the control method of this embodiment.

In the modified antibody with improved affinity for the antigen, for example, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 1/2, about 1/5, about 1/10, about 1 / 20, about 1/50, about 1/100, or about 1/1000. The modified antibody affinity is lowered to an antigen, for example, the value K _D of the antigen-antibody reaction, as compared to the unmodified antibody, about 2-fold, about 5 fold, about 10 fold, about 20 fold, about 50 Double, about 100 times or about 1000 times.

  The modified antibody may be an antibody that recognizes any antigen. The antibody class may be any of IgG, IgA, IgM, IgD, and IgE, but is preferably IgG. The modified antibody of this embodiment may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation has been introduced. The type of antibody fragment is the same as that described for the control method of this embodiment.

  The modified antibody of this embodiment preferably has no mutation in CDR. That is, the CDR amino acid sequence of the modified antibody is preferably the same as the CDR amino acid sequence of the unmodified antibody.

  In the modified antibody of this embodiment, at least three mutations may be introduced into any amino acid residue of FR3 defined by the Chothia method in an unmodified antibody. Preferably, at least three mutations are introduced at amino acid residues in the region of FR3 excluding unexposed residues. The amino acid residues in the region excluding unexposed residues from FR3 are the same as those described for the control method of this embodiment.

  More preferably, at least three mutations are introduced into amino acid residues in the region of FR3 excluding unexposed residues and Vernier zone residues. The amino acid residues in the region excluding non-exposed residues and Vernier zone residues from FR3 are the same as those described for the control method of this embodiment.

  Particularly preferably, at least three mutations are introduced into amino acid residues whose side chains are directed to the molecular surface among amino acid residues in the region excluding unexposed residues and Vernier zone residues from FR3. The amino acid residue in which the side chain in FR3 faces the molecular surface is the same as that described for the control method of this embodiment.

  In this embodiment, at least three amino acid residue mutations may be introduced into either FR3 of the light chain or FR3 of the heavy chain, but are preferably introduced into FR3 of the light chain. When both the light chain and heavy chain FR3 have mutations, at least 3 amino acid residue mutations are introduced into the light chain FR3, and at least 3 amino acid residue mutations are introduced into the heavy chain FR3. Preferably it is.

  In the present embodiment, the upper limit of the number of mutations in FR3 of the modified antibody is not particularly limited, but is preferably 16 amino acids or less. Specifically, the number of mutations in FR3 of the modified antibody is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.

  In the present embodiment, the at least three mutations possessed by the modified antibody may be mutations in which neutral amino acid residues of FR3 are replaced with charged amino acid residues. In the present embodiment, it is preferable that at least three mutations are all substituted with charged amino acid residues having the same charge. That is, all of the at least three mutations are preferably substitutions with acidic amino acid residues or substitutions with basic amino acid residues.

Examples of the modified antibody of the present embodiment include the following antibodies (1) to (3).
(1) The CDR has a neutral electrical property, and at least three amino acid residues of FR3 defined by Chothia method are substituted with acidic amino acid residues. Reduced antibodies,
(2) The CDR has a neutral electrical property, and at least three amino acid residues of FR3 defined by Chothia method are substituted with basic amino acid residues. Improved antibody, and
(3) The electrical characteristics of CDR are negatively charged, at least three amino acid residues of FR3 defined by Chothia method are replaced with acidic amino acid residues, and the affinity of the antibody for the antigen is compared with an unmodified antibody Reduced antibody.

  Specific examples of the modified antibody include anti-insulin antibody and modified antibody of anti-TSHR antibody. In such an anti-insulin antibody modified antibody, the electrical characteristics of the CDR are neutral, and amino acid residues 63, 65, 67, 70 and 72 in FR3 of the light chain are replaced with basic amino acid residues. The In this modified antibody, the affinity for insulin, which is an antigen, is improved as compared with an unmodified antibody. On the other hand, modified antibodies in which amino acid residues 63, 65, 67, 70 and 72 in FR3 of the light chain are substituted with acidic amino acid residues have an affinity for insulin as an antigen compared to unmodified antibodies. It is falling. In the modified antibody of anti-TSHR antibody, the electrical characteristics of CDR are negatively charged, and amino acid residues 63, 65, 67, 70 and 72 in FR3 of the light chain are substituted with acidic amino acid residues. In this modified antibody, the affinity for TSHR, which is an antigen, is lower than that of an unmodified antibody.

  The modified antibody of this embodiment can be prepared by a known method such as a DNA recombination technique and other molecular biological techniques. For example, when there is a hybridoma that produces an antibody whose CDR electrical characteristics are neutral or negatively charged, the residue of at least three amino acids of FR3 is the same as described for the control method and production method of this embodiment. An antibody in which a group is substituted with a charged amino acid residue can be produced.

  In this embodiment, the usage of the modified antibody is not particularly different from that of an unmodified antibody. The modified antibody can be used for various tests and researches as well as the unmodified antibody. Further, the modified antibody of the present embodiment may be modified with a labeling substance known in the art.

  The scope of the present invention includes isolated and purified polynucleotides that encode antibodies or fragments thereof with altered affinity for the antigens of this embodiment. The isolated and purified polynucleotide encoding the modified antibody fragment of the present embodiment preferably encodes a variable region containing FR3 into which a mutation has been introduced. The scope of the present invention also includes vectors containing the above polynucleotides. A vector is a polynucleotide construct designed for transduction or transfection. The type of the vector is not particularly limited, and can be appropriately selected from vectors known in the art, such as an expression vector, a cloning vector, and a virus vector. The scope of the present invention also includes host cells containing the vector. The type of host cell is not particularly limited, and can be appropriately selected from eukaryotic cells, prokaryotic cells, mammalian cells, and the like.

  EXAMPLES The present invention will be described in detail below by examples, but the present invention is not limited to these examples.

Example 1 Preparation of Antibody Introducing Charged Amino Acid Residues into FR3 Three or five amino acid residues of FR3 of anti-insulin antibody and antithyroid stimulating hormone receptor (TSHR) antibody were substituted with charged amino acid residues, Mutants of each antibody were prepared.

(1) Acquisition of wild-type anti-insulin antibody and wild-type anti-TSHR antibody gene
[reagent]
ISOGEN (Nippon Gene Co., Ltd.)
SMARTer® RACE 5 '/ 3' kit (clontech)
10x A-attachment mix (Toyobo Co., Ltd.)
pcDNATM 3.4 TOPOTM TA Cloning Kit (Thermo Fisher)
Competent high DH5α (Toyobo Co., Ltd.)
QIAprep Spin Miniprep kit (QIAGEN)
KOD plus neo (Toyobo Co., Ltd.)
Ligation high ver.2 (Toyobo Co., Ltd.)

(1.1) Acquisition of wild-type anti-insulin antibody gene
(1.1.1) Extraction of total RNA from antibody-producing hybridoma Wild-type mice using human insulin as an antigen by the method described in Kohler and Milstein, Nature, vol. 256, p.495-497, 1975 A hybridoma producing an anti-human insulin antibody was produced. The hybridoma culture (10 mL) was centrifuged at 1000 rpm for 5 minutes, and then the supernatant was removed. The obtained cells were lysed with ISOGEN (1 mL) and allowed to stand at room temperature for 5 minutes. Chloroform (200 μL) was added thereto, stirred for 15 seconds, and allowed to stand at room temperature for 3 minutes. Then, this was centrifuged at 12000 × G for 10 minutes at 4 ° C., and an aqueous phase (500 μL) containing RNA was recovered. Isopropanol (500 μL) was added to the recovered aqueous phase and mixed. The obtained mixture was allowed to stand at room temperature for 5 minutes, and then centrifuged at 12000 × G for 10 minutes at 4 ° C. The supernatant was removed, 70% ethanol (1 mL) was added to the resulting precipitate (total RNA), and centrifuged at 7500 × G for 10 minutes at 4 ° C. The supernatant was removed, the RNA was air dried and dissolved in RNase-free water (20 μL).

(1.1.2) Synthesis of cDNA Using each total RNA obtained in (1.1.1) above, an RNA sample having the following composition was prepared.
[RNA sample]
Total RNA (500 ng / μL) 1 μL
RT primer 1μL
Deionized water 1.75μL
Total 3.75μL

The prepared RNA sample was heated at 72 ° C. for 3 minutes and then incubated at 42 ° C. for 2 minutes. A sample for cDNA synthesis was prepared by adding 12 μM SMARTerIIA oligonucleotide (1 μL) to the RNA sample. Using this cDNA synthesis sample, a reverse transcription reaction solution having the following composition was prepared.
[Reverse transcription reaction solution]
2x 5x First-Strand buffer
20 mM DTT 1 μL
10 mM dNTP mix 1 μL
RNAase inhibitor 0.25μL
SMARTScribe RT (100 U / μL) 1 μL
Sample for cDNA synthesis 4.75μL
10μL total

The prepared reverse transcription reaction solution was reacted at 42 ° C. for 90 minutes. Then, the reaction solution was heated at 70 ° C. for 10 minutes, and tricine-EDTA (50 μL) was added. Using the obtained solution as a cDNA sample, a 5′RACE reaction solution having the following composition was prepared.
[5'RACE reaction solution]
10x PCR buffer 5 μL
dNTP mix 5μL
25 mM Mg ₂ SO ₄ 3.5 μL
cDNA sample 2.5μL
10x Universal Primer Mix 5μL
3'-primer 1μL
KOD plus neo (1 U / μL) 1μL
Purified water 27μL
50μL total

The prepared 5′RACE reaction solution was subjected to RACE reaction under the following reaction conditions. The “Y” below is 90 seconds for the light chain and 150 seconds for the heavy chain.
[Reaction conditions]
2 minutes at 94 ° C
30 cycles of 98 ° C for 10 seconds, 50 ° C for 30 seconds, and 68 ° C for Y seconds, and
3 minutes at 68 ° C.

Using the 5′RACE product obtained in the above reaction, a solution having the following composition was prepared. The solution was reacted at 60 ° C. for 30 minutes to add adenine to the end of the 5 ′ RACE product.
5'RACE product 9μL
10x A-attachment mix 1μL
10μL total

Using the resulting adenine addition product and pcDNA ™ 3.4 TOPO ™ TA cloning kit, a TA cloning reaction solution having the following composition was prepared. The reaction was incubated at room temperature for 10 minutes and the adenine addition product was cloned into pCDNA3.4.
[TA cloning reaction solution]
Adenine addition product 4μL
salt solution 1μL
pCDNA3.4 1μL
6μL total

(1.1.3) Transformation, plasmid extraction and sequence confirmation The TA cloning sample (3 μL) obtained in (1.1.2) above was added to DH5α (30 μL) and left on ice for 30 minutes. Was heated at 42 ° C. for 45 seconds and subjected to heat shock. After standing again on ice for 2 minutes, the entire amount was applied to an ampicillin-containing LB plate. The plate was incubated at 37 ° C. for 16 hours. A single colony on the plate was taken in ampicillin-containing LB liquid medium, and cultured with shaking (250 rpm) at 37 ° C. for 16 hours. The culture was centrifuged at 5000 × G for 5 minutes to recover E. coli transformants. Plasmids were extracted from the recovered E. coli using the QIAprep Spin Miniprep kit. The specific operation was performed according to the manual attached to the kit. The nucleotide sequence of the obtained plasmid was confirmed using pCDNA3.4 vector primer. Hereinafter, this plasmid was used as a plasmid for mammalian cell expression.

(1.2) Acquisition of wild-type anti-TSHR antibody gene Genscript Japan Co., Ltd. was commissioned to synthesize the wild-type human anti-TSHR antibody gene to obtain the wild-type human anti-TSHR antibody gene.

(2) Acquisition of mutant genes for each antibody
(2.1) Primer design and PCR
In order to introduce mutation in FR3 defined by Chothia method in the light chain of each antibody, a plasmid containing the gene of wild type anti-insulin antibody obtained in (1.1.3) above, wild type obtained in (1.2) PCR was performed using an anti-TSHR antibody gene and primers represented by the following nucleotide sequences. The D5 mutant is a mutant in which five amino acid residues of FR3 are mutated to aspartic acid residues. The E5 mutant is a mutant in which five amino acid residues of FR3 are mutated to glutamic acid residues. K5 mutant is a mutant in which five amino acid residues of FR3 are mutated to lysine residues. R5 mutant is a mutant in which five amino acid residues of FR3 are mutated to arginine residues. The R3 mutant is a mutant in which three amino acid residues of FR3 are mutated to arginine residues.

[Primer for anti-insulin antibody]
Sequence 1 D5 variant REV: 5 'TTCGTATTCGGTCCCTTCCCCTTCGCCTTCAAAGCGAGCA 3' (SEQ ID NO: 1)
Sequence 2 E5 variant REV: 5 'ATCGTAATCGGTCCCATCCCCATCGCCATCAAAGCGAGCA 3' (SEQ ID NO: 2)
Sequence 3 K5 variant REV: 5 'CTTGTACTTGGTCCCCTTCCCCTTGCCCTTAAAGCGAGCA 3' (SEQ ID NO: 3)
Sequence 4 R5 variant REV: 5 'TCTGTATCTGGTCCCTCTCCCTCTGCCTCTAAAGCGAGCA 3' (SEQ ID NO: 4)
Sequence 5 FOR: 5'CTCACAATCAGCTGATTG 3 '(SEQ ID NO: 5)
Sequence 6 R3 variant REV: 5 'TCTCCCTCTGCCTCTAAAGCGAGCA 3' (SEQ ID NO: 6)
Sequence 7 R3 variant FOR: 5 'GGGACCAGATACAGA 3' (SEQ ID NO: 7)

  The primer of sequence 5 was used as a forward primer common to the primers of sequences 1 to 4. The primer of sequence 7 was used as a forward primer for the primer of sequence 6.

[Primer of anti-TSHR antibody]
Sequence 8 D5 mutant FOR: 5 'GGCACAGACGCCGACCTGGCAATCA 3' (SEQ ID NO: 8)
Sequence 9 D5 variant REV: 5 'GTCCCGGTCTCCGTCAAACCGGTCG 3' (SEQ ID NO: 9)
Sequence 10 E5 variant FOR: 5 'GGCACAGAGGCCGAGCTGGCAATCA 3' (SEQ ID NO: 10)
Sequence 11 E5 variant REV: 5 'CTCCCGCTCTCCCTCAAACCGGTCG 3' (SEQ ID NO: 11)
Sequence 12 K5 variant FOR: 5 'GGCACAAAGGCCAAGCTGGCAATCA 3' (SEQ ID NO: 12)
Sequence 13 K5 variant REV: 5 'CTTCCGCTTTCCCTTAAACCGGTCG 3' (SEQ ID NO: 13)
Sequence 14 R5 variant FOR: 5 'GGCACAAGGGCCAGGCTGGCAATCA 3' (SEQ ID NO: 14)
Sequence 15 R5 variant REV: 5 'CCTCCGCCTTCCCCTAAACCGGTCG 3' (SEQ ID NO: 15)

A PCR reaction solution having the following composition was prepared using the plasmid obtained in (1.3) above as a template.
[PCR reaction solution]
10x PCR buffer 5 μL
25 mM Mg ₂ SO _{4 3} μL
2mM dNTP mix 5μL
Forward primer 1μL
Reverse primer 1μL
Template plasmid (40 ng / μL) 0.5 μL
KOD plus neo (1 U / μL) 1μL
Purified water 33.5μL
50μL total

The prepared PCR reaction solution was subjected to PCR reaction under the following reaction conditions.
[Reaction conditions]
2 minutes at 98 ° C
30 cycles of 98 ° C for 10 seconds, 54 ° C for 30 seconds, and 68 ° C for 4 minutes, and
3 minutes at 68 ° C.

2 μL of DpnI (10 U / μL) was added to the obtained PCR product (50 μL) to fragment the PCR product. Using the DpnI-treated PCR product, a ligation reaction solution having the following composition was prepared. The reaction solution was incubated at 16 ° C. for 1 hour to perform a ligation reaction.
[Ligation reaction solution]
2 μL of DpnI-treated PCR product
Ligation high ver.2 5μL
T4 polynucleotide kinase 1μL
Purified water 7μL
15μL total

(2.2) Transformation, plasmid extraction and sequence confirmation The solution after ligation reaction (3 μL) was added to DH5α (30 μL), and a transformant of E. coli was obtained in the same manner as in (1.1.3) above. Plasmids were extracted from the resulting E. coli using the QIAprep Spin Miniprep kit. The base sequence of each obtained plasmid was confirmed using pCDNA3.4 vector primer. Hereinafter, these plasmids were used as plasmids for mammalian cell expression.

(3) Expression in mammalian cells
[reagent]
Expi293TM cells (Invitrogen)
Expi293TM Expression medium (Invitrogen)
ExpiFectamineTM 293 transfection kit (Invitrogen)

(3.1) Transfection
Expi293 cells were grown by shaking culture (150 rpm) at 37 ° C. in a 5% CO 2 atmosphere. A number of 30 mL cell cultures (3.0 × 10 6 cells / mL) corresponding to the number of samples was prepared. Using a plasmid encoding each mutant of FR3 and a plasmid encoding a wild type antibody, a DNA solution having the following composition was prepared and allowed to stand for 5 minutes.
[DNA solution]
Amount equivalent to 15 μg of light chain plasmid solution (μL)
Amount equivalent to 15 μg of heavy chain plasmid solution (μL)
Opti-MEM (trademark) appropriate amount (mL)
1.5 mL total

A transfection reagent having the following composition was prepared and allowed to stand for 5 minutes.
ExpiFectamine reagent 80μL
Plasmid solution 1420 μL
1.5 mL total

The prepared DNA solution and transfection reagent were mixed and allowed to stand for 20 minutes. The obtained mixture (3 mL) was added to the cell culture (30 mL), and cultured with shaking (150 rpm) at 37 ° C. for 20 hours in a 5% CO ₂ atmosphere. After 20 hours, 150 μL and 1.5 mL of ExpiFectamine ™ transfection enhancer 1 and 2 were added to each culture, respectively, and cultured with shaking at 37 ° C. for 6 days (150 rpm) in a 5% CO ₂ atmosphere. did.

(3.2) Antibody recovery and purification Each cell culture was centrifuged at 3000 rpm for 5 minutes to recover the culture supernatant. The culture supernatant contains each antibody secreted from the transfected Expi293 ™ cells. The obtained culture supernatant was centrifuged again at 15000 × G for 10 minutes, and the supernatant was collected. To the obtained supernatant (30 mL), 100 μL of antibody purification carrier Ab-Capcher Mag (Protenova) was added and reacted at room temperature for 2 hours. The carrier was magnetized to remove the supernatant, and PBS (1 mL) was added to wash the carrier. 400 μL of 100 mM Gly-HCl (pH 2.8) was added to the carrier, and the antibody (IgG) captured on the carrier was eluted. This elution operation was performed three times in total. The obtained eluate was neutralized with 100 mM Tris-HCl (pH 8.0) to obtain an antibody solution.

(4) Results The 63rd, 65th, 67th, 70th and 72nd serine residues of the light chain FR3 defined by Chothia method in wild type anti-insulin antibody and wild type anti-TSHR antibody are charged amino acid residues. An antibody substituted with (aspartic acid residue, glutamic acid residue, lysine residue or arginine residue) was obtained. Further, an antibody was obtained in which the 63rd, 65th and 67th serine residues of the light chain FR3 defined by the Chothia method in the wild type anti-insulin antibody were substituted with charged amino acid residues (arginine residues).

Example 2 Measurement of Affinity of Antibody Introduced with Charged Amino Acid Residue into FR3 It was examined how the affinity of each variant prepared in Example 1 for the antigen changes compared to the wild type.

(1) Antibody fragmentation
Each antibody obtained in Example 1 was converted into a Fab fragment using Pierce (trademark) Mouse IgG1 Fab and F (ab ') 2 Preparation Kit (Thermo Fisher). The specific operation was performed according to the manual attached to the kit. The obtained reaction solution was purified by gel filtration using Superdex 200 Increase 10/300 GL (GE Healthcare). The 50 kDa elution fraction was collected, and the obtained fraction was used as a Fab fragment-containing solution in subsequent experiments.

(2) Affinity measurement
(2.1) Measurement of affinity by SPR technique The affinity of the wild-type anti-insulin antibody and its mutants for the antigen was measured by the SPR technique as follows. As the antigen of the anti-insulin antibody, 100 units of Humarin R injection (Eli Lilly) was used. Antigen was immobilized on Biacore (registered trademark) sensor chip Series S Sensor Chip CM5 (GE Healthcare) (immobilization: 100RU). Solutions containing Fab fragments of anti-insulin antibody were diluted to prepare solutions of 50 nM, 25 nM, 12.5 nM, 6.25 nM and 3.13 nM. The Fab fragment-containing solution at each concentration was sent to Biacore (registered trademark) T200 (GE Healthcare) (association time 120 seconds and dissociation time 1200 seconds). The measured data was analyzed using Biacore® Evaluation software to obtain data on the affinity of the anti-insulin antibody.

(2.2) Evaluation of affinity by ELISA method The affinity of the wild-type anti-TSHR antibody and its mutants for the antigen was measured by ELISA as follows.

(2.2.1) Immobilization of capture antibody 4E31 antibody (RSR), which is a mouse monoclonal anti-TSHR antibody, was used as a capture antibody. 4E31 antibody (5 μg) was diluted with PBS to obtain an antibody solution. 100 μL of this antibody solution was added to each well of a NUNC-immuno module (Cat No. 469949, manufactured by NUNC, hereinafter referred to as “plate”). This plate was allowed to stand at room temperature for 3 hours to immobilize 4E31 antibody in the well. The antibody solution was removed, and 300 μL of blocking solution (PBS containing 1% BSA) was added to each well of the plate. Blocking was performed at 4 ° C. for 20 hours or more.

(2.2.2) Primary reaction Detergent solubilized cell membrane preparation containing the TSHR (RSR) was used as an anti-TSHR antibody antigen. This antigen was diluted 500 times with PBS containing 1% BSA to obtain an antigen solution. The blocking solution was removed from the 4E31 antibody-immobilized plate, and 50 μL of the antigen solution was added to each well. The plate was shaken at room temperature for 60 minutes to carry out an antigen-antibody reaction.

(2.2.3) Secondary reaction Wild type anti-TSHR antibody, D5 mutant and R5 mutant were used as detection antibodies. Each antibody was serially diluted with PBS containing 1% BSA to obtain antibody solutions having concentrations of 1000 pM, 100 pM, 10 pM, 1 pM and 0.1 pM. In addition, an HRP-labeled anti-human IgG (Fc specific) antibody was used as a secondary antibody. This secondary antibody was diluted with PBS containing 1% BSA to obtain a secondary antibody solution having a concentration of 0.2 μg / mL. The antibody solution (50 μL) at each concentration and the secondary antibody solution (50 μL) were mixed to obtain an antibody mixture. The antigen solution was removed from the plate, and 300 μL of a washing solution (PBS containing 1% BSA) was added to each well. Then, the washing solution was removed from the plate, and washing was performed by adding 300 μL of the washing solution to each well. This washing operation was repeated three times. The washing solution was removed from the plate, and 100 μL of the above antibody mixture was added to each well. The plate was shaken at room temperature for 60 minutes to carry out an antigen-antibody reaction. After the reaction, the above washing operation was repeated three times.

(2.2.4) Detection As a substrate solution, 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was used. The washing solution was removed from the plate and the substrate solution was added at 100 μL / well. The plate was left at room temperature for 5 minutes. After 5 minutes, 100 μL of stop solution (0.1 MH ₂ SO ₄ ) was added to each well of the plate to stop the reaction. Then, the absorbance at 450 nm was measured for each well of the plate.

(3) Results The dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and the dissociation rate constant (k _off ) obtained for the anti-insulin antibody. Further, the dissociation constant (K _D ) was calculated from the measured value of ELISA method using anti-TSHR antibody. The kinetic parameters of each antibody are shown in Tables 3 and 4 and FIGS. 1A and 1B. In the figure, "positively charged" indicates the K _D values of R5 variants, "negative charge" indicates the K _D values of D5 variants. In Table 3, the value obtained by global fitting is “average value ± standard error”.

From Table 3 and Figure 1A, R3 variants of anti-insulin antibodies, K _D values of R5 variants and K5 mutants was lower than _the K _D value of the wild-type. Further, _the K _D value of D5 variants and E5 mutant was higher than _the K _D value of the wild-type. Therefore, it was found that an anti-insulin antibody can be produced by mutating three or five amino acid residues of FR3 to a basic amino acid residue, thereby producing an antibody with improved affinity for the antigen compared to the wild type. In addition, it was found that by mutating five amino acid residues of FR3 to acidic amino acid residues, an antibody having a reduced affinity for the antigen can be produced compared to the wild type.

From Table 4 and FIG. 1B, the K _D values of D5 variants of the anti-TSHR antibody, was higher than _the K _D value of the wild-type. As for the anti-TSHR antibody, it was found that by mutating 5 amino acid residues of FR3 to acidic amino acid residues, an antibody having a reduced affinity for the antigen as compared with the wild type can be produced. On the other hand, _the K _D value of R5 variants of the anti-TSHR antibody was K _D values comparable to the wild type. That is, for the anti-TSHR antibody, it is suggested that the affinity does not change even when 5 amino acid residues of FR3 are mutated to basic amino acid residues.

Example 3 Relationship between Electrical Characteristics of CDR Amino Acid Sequence and Affinity for Antigen From Example 2, the anti-insulin antibody was able to improve and decrease the affinity by introducing mutation into FR3. On the other hand, although the anti-TSHR antibody was able to reduce the affinity even when the mutation was introduced into FR3, it could not improve the affinity. Therefore, the effect of the introduction of mutations into FR3 on the surface charge of the antigen binding site of the antibody was examined.

(1) Examination of change in surface charge of antibody due to mutagenesis The surface charge distribution of various Fab fragments prepared in Example 1 was analyzed using Discovery Studiou (Dassault Systèmes Biovia). FIG. 2A shows a surface charge distribution diagram of an anti-insulin antibody Fab fragment and insulin as an antigen. The surface charge distribution diagram of the anti-TSHR antibody Fab fragment and TSHR as the antigen is shown in FIG. 2B. In the figure, the arrow indicates the antigen binding site, and PI indicates the isoelectric point value. Here, the antigen binding site is the same as CDR. In the figure, the surface charge distribution is indicated by color, and the blue portion indicates positive charge, the red portion indicates negative charge, and the white portion indicates electrically neutral.

  From FIG. 2A, it was found that the surface charge of the antigen binding site was neutral in the wild-type anti-insulin antibody. In the mutant type (positive charge mutation) in which a basic amino acid residue was introduced into FR3, a wide range of surface charges including the antigen binding site were positive. Here, insulin, which is an antigen, is a negatively charged protein. From FIG. 1A, the affinity for a mutant antigen into which a positively charged mutation was introduced was improved. On the other hand, in the mutant type in which an acidic amino acid was introduced into FR3 (negative charge mutation), a wide range of surface charges including the antigen binding site were negative. From FIG. 1A, the affinity for a mutant antigen into which a negative charge mutation was introduced was reduced. From these facts, it can be seen that in the wild-type anti-insulin antibody, the contribution to the surface charge by the charged amino acid residue introduced into FR3 is extensive.

  From FIG. 2B, it was found that the surface charge of the antigen binding site was negative in the wild-type anti-TSHR antibody. In the mutant type (positive charge mutation) in which a basic amino acid was introduced into FR3, the surface charge in the range excluding the antigen binding site became positive, but the surface charge at the antigen binding site did not change much. Here, although the antigen TSHR is a negatively charged protein, as shown in FIG. 1B, there was no change in the affinity for a mutant antigen into which a positively charged mutation was introduced. On the other hand, in the mutant type in which an acidic amino acid was introduced into FR3 (negative charge mutation), a wide range of surface charges including the antigen binding site were negative. From FIG. 1B, the affinity for the mutant antigen into which the negative charge mutation was introduced was reduced. From these facts, it can be seen that in the wild-type anti-TSHR antibody, the acidic amino acid residue introduced into FR3 contributes widely to the surface charge. On the other hand, even when a basic amino acid residue is introduced into FR3 of the wild-type anti-TSHR antibody, the surface charge is locally different.

(2) Relationship between electrical characteristics of CDR amino acid sequence and control of affinity The present inventors have determined how the affinity for an antigen is changed by introducing a charged amino acid residue into FR3 of an antibody. It was thought that the CDR electrical characteristics of the antibody were related. Here, the present inventors defined the electrical characteristics of CDR by the following formula (I).

X = [number of basic amino acid residues in the amino acid sequence of CDR] − [number of acidic amino acid residues in the amino acid sequence of CDR] (I)
(Wherein, when X is -1, 0 or 1, the electrical characteristics of the CDR are neutral,
When X is 2 or more, the electrical characteristic of CDR is positive charge,
(When X is −2 or less, the electrical characteristics of the CDR are negative charges)

  Table 5 shows the amino acid sequence of the light chain CDR of the wild-type anti-TSHR antibody (SEQ ID NOs: 16 and 17). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

  Since the CDR of an anti-insulin antibody has one basic amino acid residue (arginine) and no acidic amino acid residue, the electrical property of CDR is defined as neutral (X = 1). As shown in Table 5, since the CDR of the anti-TSHR antibody has 5 acidic amino acid residues (aspartic acid) and no basic amino acid residue, the electrical characteristics of the CDR are negative (X = -5). As can be seen from FIGS. 2A and B, the CDR electrical properties determined by Formula (I) are consistent with the surface charge of the antigen binding site analyzed by Discovery Studiou. Thus, it was found that the electrical characteristics of CDR and the surface charge of the antigen binding site are biased depending on the antibody.

(3) Results The analysis of Example 2 and Example 3 suggests that the antibody with neutral CDR electrical characteristics contributes greatly to the introduction of charged amino acid residues into FR3. Further, it is suggested that an antibody having neutral CDR electrical characteristics can control the orientation of the antigen-binding site by electrostatic interaction caused by the introduction. On the other hand, it is suggested that an antibody having a negative electrical property of CDR has a local effect of electrostatic interaction even when a basic amino acid residue is introduced into FR3. However, in the case of an antibody whose CDR has a negative electrical property, when an acidic amino acid residue is introduced into FR3, it is suggested that the affinity for an antigen can be reduced by electrostatic repulsion.

Example 4 Examination of Thermal Stability of Antibody Introduced with Charged Amino Acid Residue into FR3 How does the thermal stability of each variant of the anti-insulin antibody prepared in Example 1 change compared to the wild type? It was investigated.

(1) Replacement of buffer by gel filtration The solvent of the Fab fragment-containing solution obtained in Example 2 was used for measurement with a differential scanning calorimeter (DSC) by gel filtration (slow phosphate phosphate: PBS). Replaced with The conditions for gel filtration are as follows.
[Gel filtration conditions]
Buffer: PBS
Column used: Superdex 200 Increase 10/300 (GE Healthcare)
Column volume (CV): 24 mL
Sample volume: 500 μL
Flow rate: 1.0 mL / min
Elution volume: 1.5 CV
Fraction volume: 500μL

(2) Measurement of denaturation temperature (Tm)
The fraction containing the Fab fragment was diluted with PBS to prepare a Fab fragment-containing sample (final concentration 5 μM). Tm of each Fab fragment was measured using MicroCal VP-Capillary DSC (Malvern Instruments Ltd). The measurement conditions are as follows.
[DSC measurement conditions]
Sample volume: 400μL
Measuring range: 30 ℃ ~ 90 ℃
Temperature increase rate: 60 ° C / hour

(3) Results
The Tm value and analysis peak obtained by DSC measurement are shown in Table 6 and FIG. 3, respectively.

  The D5 mutant had the lowest thermal stability compared to the wild type, but the decrease was only about 13%. In most mutants, the thermostability was found to change little from the wild type. Therefore, it is suggested that introduction of a charged amino acid residue into FR3 hardly affects the thermal stability of the antibody.

Example 5 Control of affinity of anti-lysozyme antibody for antigen
Based on the electrical characteristics of CDR, mutation was introduced into FR3 of the anti-lysozyme antibody, and the affinity of the obtained mutant for lysozyme was confirmed.

(1) CDR electrical properties of anti-lysozyme antibody Genscript Japan Co., Ltd. was commissioned to synthesize the gene of anti-lysozyme antibody, and plasmid DNA containing the gene of wild-type anti-lysozyme antibody was obtained. Based on the nucleotide sequence of the gene, the amino acid sequence of the anti-lysozyme antibody was determined. Table 7 shows the amino acid sequences of the light chain and heavy chain CDRs of the wild-type anti-lysozyme antibody (SEQ ID NOs: 18 to 23). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

  As shown in Table 7, the light chain and heavy chain CDRs of the anti-lysozyme antibody have two basic amino acid residues and three acidic amino acid residues. Thus, the CDR electrical properties of anti-lysozyme antibodies are defined as neutral (X = -1).

(2) Production of anti-lysozyme antibody variants Enzyme Japan was entrusted with the synthesis of anti-lysozyme antibody R5 and D5 variant genes, and plasmid DNA containing the anti-lysozyme antibody variant gene was prepared. I got it. Here, the R5 mutant of the anti-lysozyme antibody includes the 63rd, 65th and 67th serine residues, the 70th aspartic acid residue, and the 72nd position of the light chain FR3 defined by the Chothia method in the wild type antibody. In which the threonine residue is substituted with an arginine residue. In addition, the D5 mutant of the anti-lysozyme antibody includes the 63rd, 65th and 67th serine residues, the 70th aspartic acid residue, and the 72nd aspartic acid residue of the light chain FR3 defined by Chothia method in the wild type antibody An antibody in which a threonine residue is substituted with an aspartic acid residue.

  Using the obtained plasmid, each antibody was expressed in Expi293 ™ cells in the same manner as in Example 1, and the obtained culture supernatant was purified to obtain a wild-type anti-lysozyme antibody, R5 mutant and Each solution of D5 mutant was obtained.

(3) Measurement of affinity of mutant for antigen Anti-lysozyme antibody antigen used is a solution (200 ng / mL) of chicken egg white lysozyme (Sigma Aldrich) dissolved in 10 mM sodium acetate solution (pH 5.0). It was. The antigen was immobilized on Biacore (registered trademark) sensor chip Series S Sensor Chip CM5 (GE Healthcare) (41 RU or 33 RU). Each antibody solution was diluted with HBS EP + buffer (GE Healthcare) to prepare solutions of various concentrations. These solutions were sent to Biacore (registered trademark) T200 (GE Healthcare). The antibody concentration and measurement conditions in each solution are as follows. The measurement data was analyzed using Biacore® Evaluation software to obtain data on the affinity of each antibody.

[Antibody concentration]
Wild type: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
D5 variants: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
R5 variants: 2 nM, 1 nM, 0.5 nM, 0.25 nM and 0.125 nM

[Measurement condition]
Association: 30μL / min, 60 sec, 120 sec
Dissociation: 30μL / min, 60 sec, 1200 sec
Regeneration: Gly-HCl (pH 2.0) / 60μL / min, 40 sec

(4) Results The dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and the dissociation rate constant (k _off ) obtained for the wild type and mutants of the anti-lysozyme antibody. The kinetic parameters of each antibody are shown in Table 8 and FIG. In the figure, "negative charge" indicates the K _D values of the D5 variant, "positively charged" refers to a K _D values of R5 variants.

From Table 8 and FIG. 4, the K _D values of R5 variants of the anti-lysozyme antibody, was lower than the K _D values of the wild-type. Further, _the K _D value of D5 mutants was higher than the K _D values of the wild-type. Therefore, it was found that an anti-lysozyme antibody can be prepared by mutating five neutral amino acid residues of FR3 to basic amino acid residues to produce an antibody with improved affinity for the antigen compared to the wild type. In addition, it was found that by mutating five neutral amino acid residues of FR3 to acidic amino acid residues, an antibody having a reduced affinity for the antigen as compared with the wild type can be produced. These results were similar to the anti-insulin antibody mutant of Example 2. Therefore, it is suggested that an antibody having neutral CDR electrical characteristics can control the orientation of the antigen binding site by electrostatic interaction caused by the introduction of a charged amino acid residue into FR3.

Example 6 Control of affinity of anti-HBsAg antibody for antigen
Based on the electrical characteristics of CDR, mutation was introduced into FR3 of the anti-HBsAg antibody, and the affinity of the obtained mutant for lysozyme was confirmed.

(1) CDR electrical characteristics of anti-HBsAg antibody Using recombinant HBsAg as an antigen, mouse anti-HBsAg antibody by the method described in Kohler and Milstein, Nature, vol. 256, p.495-497, 1975 Was produced. In the same manner as in Example 1, plasmid DNA containing the wild-type anti-HBsAg antibody gene was obtained from the RNA of this hybridoma. Based on the base sequence of the gene, the amino acid sequence of the anti-HBsAg antibody was determined. It was found that the light chain and heavy chain CDRs defined by the Chothia method in the wild-type anti-HBsAg antibody have 2 basic amino acid residues and 10 acidic amino acid residues. Therefore, the CDR electrical property of the anti-HBsAg antibody is defined as negative charge (X = -8).

(2) Preparation of anti-HBsAg antibody mutant
In order to introduce a mutation into the light chain FR3 defined by the Chothia method, the wild-type anti-HBsAg antibody gene obtained in (1) above and the primer represented by the following base sequence were used in the same manner as in Example 1. PCR was performed.

[Primers of anti-HBsAg antibody]
D5 mutant FOR: 5 'GGGACCGATTATGATCTCACAATCAGTCGAATGGAG 3' (SEQ ID NO: 24)
D5 mutant REV: 5 'ATCCCCATCGGCATCGAAACGAACAGGGACTCCAGAAGC 3' (SEQ ID NO: 25)

  Using the obtained PCR product, a plasmid containing a gene encoding a mutant or wild-type light chain and a plasmid containing a gene encoding a wild-type heavy chain were obtained in the same manner as in Example 1. . Using these plasmids, each antibody was expressed in Expi293 ™ cells in the same manner as in Example 1, and the resulting culture supernatant was purified to obtain each of the wild type and D5 mutants of the anti-HBsAg antibody. A solution of was obtained. Here, the D5 mutant of the anti-HBsAg antibody contains the 63rd, 65th, 67th and 70th serine residues, and the 72nd phenylalanine residue of the light chain FR3 defined by the Chothia method in the wild type antibody. An antibody substituted with an aspartic acid residue.

(3) Measuring the affinity of the mutant for antigen
(3.2) Immobilization of capture antibody In the same manner as in Example 2 except that a mouse anti-HBsAg antibody produced from a hybridoma different from the hybridoma obtained in (1) above was used as the capture antibody. This capture antibody was immobilized on each well of a plate (NUNC-Immunomodule, Cat No. 469949, manufactured by NUNC). In the same manner as in Example 2, each well of the plate was blocked with a blocking solution (PBS containing 1% BSA).

(3.3) Primary reaction HISCL (registered trademark) HBsAg calibrator (HBsAg concentration 0.025 IU / mL, Sysmex Corporation) was used as an antigen of the anti-HBsAg antibody. The blocking solution was removed from the plate on which the capture antibody was immobilized, and 50 μL of the antigen solution was added to each well. The plate was shaken at room temperature for 60 minutes to carry out an antigen-antibody reaction.

(3.3) Secondary reaction and detection Anti-HBsAg antibody wild type and D5 mutant were used as detection antibodies. Each antibody was serially diluted with PBS containing 1% BSA to obtain antibody solutions having concentrations of 400 nM, 80 nM, 16 nM, 3.2 nM, 640 pM, 128 pM, 25.6 pM and 5.12 pM. In addition, an HRP-labeled anti-mouse IgG (Fc specific) antibody was used as a secondary antibody. Using these, antigen-antibody reaction was carried out in the same manner as in Example 2. Then, using 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) as a substrate solution, the absorbance at 450 nm was measured for each well of the plate in the same manner as in Example 2.

(4) Results The dissociation constant (K _D ) was calculated from the measured values obtained by ELISA using wild-type anti-HBsAg antibody and D5 mutant. The results are shown in Table 9 and FIG. In the figure, "negative charge" indicates the K _D values of D5 variants.

From Table 9 and Figure 5, is _the K _D value of D5 variants of the anti-HBsAg antibody was higher than _the K _D value of the wild-type. Further, _the K _D value of D5 mutants was higher than the K _D values of the wild-type. Therefore, it was found that an anti-HBsAg antibody can be prepared by mutating five neutral amino acid residues of FR3 to acidic amino acid residues to produce an antibody having a reduced affinity for the antigen as compared to the wild type. These results were the same as the D5 mutant and the E5 mutant of the anti-TSHR antibody of Example 2. Therefore, it is suggested that in the case of an antibody whose CDR has a negative charge, affinity for an antigen can be reduced by electrostatic repulsion caused by introduction of an acidic amino acid residue into FR3.

Claims (2)

In an antibody with neutral CDR electrical characteristics based on the amino acid sequence of the complementarity determining region (CDR), in the light chain of the antibody, the 63rd, 65th, 67th, 70th and 72th as defined by the Chothia method A method for reducing the affinity of an antibody for an antigen compared to an unmodified antibody by substituting the second amino acid residue with an aspartic acid residue or a glutamic acid residue,
The 63rd, 65th, 67th, 70th and 72nd amino acid residues in the light chain of the unmodified antibody are neutral amino acid residues,
The method, wherein the electrical properties of the CDR are determined by the following formula (I):
X = [number of basic amino acid residues in the amino acid sequence of CDR] − [number of acidic amino acid residues in the amino acid sequence of CDR] (I)
(Wherein, when X is -1, 0 or 1, the electrical characteristics of the CDR are neutral,
When X is 2 or more, the electrical characteristic of CDR is positive charge,
When X is −2 or less, the electrical characteristics of the CDR are negative charges). In an antibody with neutral CDR electrical characteristics based on the amino acid sequence of the complementarity determining region (CDR), in the light chain of the antibody, the 63rd, 65th, 67th, 70th and 72th as defined by the Chothia method Substituting the second amino acid residue with an aspartic acid residue or a glutamic acid residue;
A method for producing an antibody having a reduced affinity for an antigen as compared to an unmodified antibody, comprising a step of recovering the antibody obtained in the substitution step,
The 63rd, 65th, 67th, 70th and 72nd amino acid residues in the light chain of the unmodified antibody are neutral amino acid residues,
The manufacturing method, wherein electrical characteristics of the CDR are determined by the following formula (I):
X = [number of basic amino acid residues in the amino acid sequence of CDR] − [number of acidic amino acid residues in the amino acid sequence of CDR] (I)
(Wherein, when X is -1, 0 or 1, the electrical characteristics of the CDR are neutral,
When X is 2 or more, the electrical characteristic of CDR is positive charge,
When X is −2 or less, the electrical characteristics of the CDR are negative charges).