JP2019073519A - Method for controlling affinity of antibody for antigen, antibody whose affinity for antigen has been altered, and its production method - Google Patents

Abstract

To provide techniques for controlling affinity of an antibody for an antigen, and an antibody whose affinity for an antigen has been altered.SOLUTION: The problem is solved by substituting charged amino acid residues for at least 3 amino acid residues of a specific framework region defined by the Chothia method in an antibody in accordance with electrical characteristics of a complementarity determining region (CDR) based on the amino acid sequence of the CDR.SELECTED DRAWING: None

Description

  The present invention relates to a method of controlling the affinity of an antibody for an antigen. The present invention also relates to an antibody with altered affinity for an antigen and a method for producing the same.

  Conventionally, there is known a technique for altering the affinity of an antibody for an antigen by introducing a mutation into the amino acid sequence of the antibody. For example, Patent Document 1 describes a method for introducing a mutation into the amino acid sequence of the complementarity determining region (CDR) of an antibody to reduce the affinity of the antibody for the antigen.

  It is also known to introduce a mutation into the amino acid sequence of the framework region in the variable region rather than the CDRs to alter the affinity to the antigen. For example, Non-Patent Document 1 and Patent Document 2 disclose the 60th, 63rd, 65th and 67th amino acid residues located in the framework region 3 of a single chain antibody (scFv) binding to Troponin I, It is described that substitution was made to a basic amino acid, lysine or arginine residue. Troponin I is an antigen with a high content of charged amino acids. In Non-Patent Document 1 and Patent Document 2, first, a single-chain antibody that recognizes an acidic epitope with a pI of 3.57 and a single-chain antibody that recognizes a basic epitope with a pI of 11.45 are prepared. Non-Patent Document 1 and Patent Document 2 describe that the affinity to troponin I could be improved by utilizing the electric attraction generated by the introduction of basic amino acid residues into these single-chain antibodies. ing.

U.S. Patent Application Publication 2012/0329995 International Publication 2013/084 3rd brochure

Fukunaga A and Tsumoto K, improving the affinity of an antibody for its antigen via long-range electrostatic interactions, Protein Eng. Des. Sel. Vol. 26, no. 12, p. 773-780, 2013

  In Non-Patent Document 1 and Patent Document 2, from the viewpoint of increasing the binding rate constant in the antibody-antigen reaction, the mutation as described above is introduced into the framework region 3 (FR3) of the anti-troponin I antibody to The affinity of the is improved. However, these documents do not describe whether an antibody other than anti-troponin I antibody can also change the affinity to the antigen by the same method.

  Further, Non-Patent Document 1 and Patent Document 2 only describe that the affinity to the antigen is improved. On the other hand, when an antibody is used as a reagent, not only an antibody with improved affinity to an antigen but also an antibody with reduced affinity may be required. For example, an antibody with reduced affinity for an antigen can be used as a suitable control for an antigen-antibody reaction. Thus, it is desirable to establish a technique for controlling the affinity of an antibody for its antigen.

  The present inventors have found that substitution of the amino acid residue of FR3 of the antibody with a charged amino acid residue can improve or reduce the affinity to the antigen depending on the type of antibody. Then, the present inventors have completed the present invention by finding that such a difference in affinity change is associated with the electrical characteristics of CDRs determined based on the number of charged amino acid residues contained in the CDRs.

  Thus, the present invention provides a method of controlling the affinity of an antibody for an antigen. In this method, at least three amino acid residues of FR3 defined by the Chothia method are substituted with charged amino acid residues in an antibody in which the electrical properties of the CDRs based on the amino acid sequences of the CDRs are neutral or negatively charged.

  The present invention also provides a method of producing an antibody with altered affinity for an antigen. This method comprises the steps of substituting at least three amino acid residues of FR3 defined by Chothia method with charged amino acid residues in an antibody in which the electrical properties of CDRs based on the amino acid sequences of CDRs are neutral or negatively charged; And recovering the antibody obtained in the substitution step.

  Furthermore, the present invention provides antibodies with altered affinity for the antigen. In this antibody, the electrical property of the CDR based on the amino acid sequence of the CDR is neutral or negative charge, and at least three amino acid residues of FR3 defined by Chothia method in the unmodified antibody are charged amino acid residues Has been replaced by.

  According to the present invention, there is provided an antibody whose affinity to an antigen is altered.

It is a graph which shows the dissociation constant in interaction with a wild type anti-insulin antibody and its variant, and an antigen (insulin). It is a graph which shows the dissociation constant in interaction with a wild type antithyroid stimulating hormone receptor (TSHR) antibody and its variant, and an antigen (TSHR). It is a figure which shows the surface charge distribution of a wild type anti-insulin antibody and its variant, and an antigen (insulin). FIG. 2 shows the surface charge distribution of a wild-type anti-TSHR antibody and its variant, and an antigen (TSHR). It is a graph which shows the analysis peak when the thermal stability of a wild type anti-insulin antibody and its variant is measured by differential scanning calorimetry (DSC). It is a graph which shows the dissociation constant in interaction with a wild type anti-lysozyme antibody and its variant, and an antigen (lysozyme). It is a graph which shows the dissociation constant in interaction with a wild type anti-hepatitis B surface antigen (HBsAg) antibody and its variant, and an antigen (HBsAg).

[1. Method of controlling affinity of antibody for antigen]
In the method of controlling the affinity of the antibody of the present embodiment for an antigen (hereinafter also referred to as “control method”), an antibody whose neutral or negative charge is an electrical property of a CDR based on the amino acid sequence of the CDR To control the affinity of In the control method of this embodiment, in the antibody having such electrical properties, at least three amino acid residues of FR3 defined by the Chothia method are substituted with charged amino acid residues, whereby the affinity of the antibody for the antigen is raised. Allows you to control sex. Here, "control the affinity" refers to both improving the affinity of the antibody for the antigen and reducing the affinity of the antibody for the antigen. Therefore, the control method of the present embodiment may be interpreted as a method of modifying the affinity of an antibody for an antigen.

  The original antibody which is the target for controlling the affinity to the antigen in the control method of the present embodiment is also referred to as "unmodified antibody". In the present specification, substitution of a charged amino acid residue for an amino acid residue of FR3 as defined by the Chothia method in an unmodified antibody is also referred to as “introduction of a mutation”. Such substitutions are also referred to as "introduction of mutations" or simply "mutations". An antibody obtained by introducing a mutation into an unmodified antibody is also referred to as "affinity-controlled antibody".

In this embodiment, the introduction of a mutation changes the surface charge distribution of the unmodified antibody to control its affinity to the antigen. That is, the antibody whose affinity is controlled has an improved or decreased affinity for the antigen as compared to the unmodified antibody. In this embodiment, the affinity of the antibody with controlled affinity to the antigen may be evaluated by kinetic parameters in the antigen-antibody reaction, or may be evaluated by an immunological assay such as ELISA. . Kinetic parameters include association rate constant (k _on ), dissociation rate constant (k _off ) and dissociation constant (K _D ), preferably K _D. Kinetic parameters in antigen-antibody reactions can be obtained by surface plasmon resonance (SPR) techniques.

When the control method of the present embodiment improves the affinity of the antibody to the antigen, for example, the value of K _D in the antigen-antibody reaction is about 1/2, about 1/5, about, as compared with the unmodified antibody. 1/10, about 1/20, about 1/50, about 1/100 or about 1/1000. On the other hand, when the affinity of the antibody to the antigen decreases, the value of K _D in the antigen-antibody reaction is about 2 times, about 5 times, about 10 times, about 20 times, about 50 as compared with the unmodified antibody. Times, about 100 times or about 1000 times.

  In the present embodiment, the unmodified antibody may be an antibody that recognizes any antigen. In a preferred embodiment, the unmodified antibody is an antibody whose nucleotide sequence of the gene encoding the variable region of the light chain and heavy chain is known or whose nucleotide sequence can be confirmed. Specifically, it is an antibody whose base sequence of antibody gene is disclosed in a known database, or an antibody for which a hybridoma that produces the antibody is available. Such database includes, for example, GeneBank provided by National Center for Biotechnology Information (NCBI). Also, the class of antibody may be any of IgG, IgA, IgM, IgD and IgE, preferably IgG.

  In this embodiment, the unmodified antibody may be in the form of an antibody fragment as long as it has a variable region containing FR3 to which a mutation is to be introduced. In addition, the antibody with controlled affinity may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation has been introduced. As such an antibody fragment, for example, Fab fragment, F (ab ') 2 fragment, Fab' fragment, Fd fragment, Fv fragment, dAb fragment, single chain antibody (scFv) and the like can be mentioned. Among them, Fab fragments are particularly preferred.

  There are three CDRs in each of the variable regions of the light chain and heavy chain of the antibody, and constitute the antigen binding site of the antibody. The three CDRs are referred to as CDR1, CDR2 and CDR3, counting from the amino terminus of the antibody chain. Since the CDRs are involved in the specificity of the antibody, in this embodiment, it is preferred that the affinity controlled antibody has no mutation in the CDRs. That is, it is preferable that the amino acid sequence of the CDR of the antibody with controlled affinity is the same as the amino acid sequence of the CDR of the unmodified antibody.

  Framework regions (FR) are regions other than CDRs present in the variable regions of the light and heavy chains of an antibody. FR plays a role of a scaffold linking three CDRs and contributes to the structural stability of CDRs. Therefore, the amino acid sequence of FR is highly conserved among antibodies of the same species. FR3 is one of the FRs and refers to the region between CDR2 and CDR3.

  In the art, a method of numbering amino acid residues of CDRs (hereinafter also referred to as "numbering method") is known to define the boundaries and length of CDRs. As such a numbering method, for example, Chothia method (Chothia C. and Lesk AM., Canonical Structures for the Hypervariable Regions of Immunoglobulins., J Mol Biol., Vol. 196, p. 901-917, 1987), Kabat method (Kabat EA. Et al., Sequences of Proteins of Immunological Interest., NIH publication No. 91-3242), IMGT method (Lefranc MP., IMGT Unique Numbering for the Variable (V), Constant (C), and Groove (G) Domains of IG, TR, MH, IgSF, and MhSF., Cold Spring Harb Protoc. 2011 (6): 633-642, 2011), Honergger method (Honegger A. et al., Yet Another Numbering Scheme for Immunoglobulin Variable Domains: An Automatic Modeling and Analysis Tool., J Mol Biol., Vol. 309, p. 657-670, 2001), ABM method, Contact method, etc. are known. When the amino acid residues of CDRs are numbered, the regions other than CDRs, FRs are also numbered. In the present embodiment, the boundaries and lengths of CDR and FR3 are defined by the Chothia method, but may be defined by other numbering methods.

  In the Chothia method, the light chain FR3 is defined as a region consisting of amino acid residues 53-90, and the heavy chain FR3 is defined as a region consisting of amino acid residues 56-95. Here, for comparison, FR3 numbers (positions of amino acid residues at the start and end of FR3) of the light chain and heavy chain as defined by the Chothia method and other numbering methods are shown in Tables 1 and 2. The Vernier zone residues in the table are amino acid residues that contribute to the structural stability of the CDRs among the amino acid residues included in the FR. Tables 1 and 2 also show the positions of Vernier zone residues in FR3 as defined by each numbering method. Table 1 also shows the positions at which mutations were introduced into FR3 of the light chain in Example 1 as defined by each numbering method.

  In the present embodiment, at least three mutations may be introduced into any amino acid residue of FR3 (hereinafter, also simply referred to as “FR3”) defined by the Chothia method in an unmodified antibody. Preferably, at least three mutations are introduced into the amino acid residue in the region excluding the amino acid residue (hereinafter also referred to as "non-exposed residue") which is folded inside the molecule and not exposed to the surface from FR3. Since introducing a mutation into a non-exposed residue is not expected to affect the surface charge, it is preferable to exclude the non-exposed residue from the position where the mutation should be introduced. Specifically, the amino acid residue in the region excluding the non-exposed residue from FR3 is the 53rd to 81st amino acid residue of FR3 of the light chain, and the 56th to 88th amino acid of FR3 of the heavy chain. It is a residue.

  More preferably, at least three mutations are introduced into amino acid residues in the region excluding the non-exposed residues and the Vernier zone residues from FR3. As mentioned above, the Vernier zone residues contribute to the structural stability of the CDRs. Specifically, amino acid residues in the region excluding FR3 and non-exposed residues and Vernier zone residues are residues 53 to 63, 65, 67, 70 and 72 to 81 of FR3 of the light chain. And the amino acid residues 56 to 66, 68, 70, 72, 74 to 77 and 79 to 88 of the heavy chain FR3.

  Particularly preferably, at least three mutations are introduced into the amino acid residues in which the side chain is directed to the molecular surface among the amino acid residues in the region excluding the non-exposed residues and the Vernier zone residues from FR3. The substitution of charged amino acid residues for amino acid residues whose side chains are directed to the molecular surface leads to a greater contribution to the surface charge. The amino acid residue whose side chain in FR3 is directed to the surface of the molecule is the 53, 54, 56, 57, 60, 63, 65, 67, 72, 74, 76, 77 and 79 to 81 of the light chain FR3. Amino acid residues of the heavy chain FR3 56, 57, 59, 59, 61, 62, 64-66, 68, 70, 72, 74, 75, 77, 79, 81, 83, 84 and 86-88 Amino acid residues of

  In this embodiment, at least three mutations may be introduced into either the light chain FR3 or the heavy chain FR3. From the viewpoint of antibody thermal stability, it is preferable to introduce at least three mutations into the light chain FR3. When both the light chain and heavy chain FR3 have mutations, it is preferred to introduce at least three mutations in the light chain FR3 and at least three mutations in the heavy chain FR3.

  In the present embodiment, the upper limit of the number of mutations introduced into FR3 is not particularly limited, but is preferably 16 amino acids or less. That is, the number of mutations in the FR3 of the affinity-controlled antibody is specifically 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 It is.

  As described above, in the control method of the present embodiment, the introduction of a mutation into an unmodified antibody changes the surface charge distribution and changes the affinity for an antigen. Thus, it is preferred that all at least three mutations be substitutions with charged amino acid residues having the same charge. That is, it is preferable that all of the at least three mutations be substitution with an acidic amino acid residue or substitution with a basic amino acid residue.

  Charged amino acid residues refer to aspartate residues, glutamate residues, lysine residues, arginine residues and histidine residues. An acidic amino acid residue refers to an aspartic acid residue and a glutamic acid residue. Basic amino acid residues refer to lysine residues, arginine residues and histidine residues. In the present embodiment, a lysine residue and an arginine residue are preferable as the basic amino acid residue introduced into FR3 as a mutation.

  In this embodiment, the at least three mutations introduced into the unmodified antibody may be mutations that replace the neutral amino acid residue of FR3 with a charged amino acid residue. The neutral amino acid residue means alanine residue, asparagine residue, isoleucine residue, glycine residue, glutamine residue, cysteine residue, threonine residue, serine residue, tyrosine residue, phenylalanine residue, proline residue Group, valine residue, methionine residue, leucine residue and tryptophan residue.

  As described above, in the present embodiment, an antibody whose neutral or negative charge is the electrical property of the CDR based on the amino acid sequence of the CDR is a target for controlling the affinity to the antigen. In the present specification, the electrical property of a CDR is an index that the inventors have uniquely defined, and is determined based on the number of charged amino acid residues in the amino acid sequence of the CDR. Specifically, the electrical properties of CDRs are determined by the following formula (I).

X = [number of basic amino acid residues in amino acid sequence of CDR]-[number of acidic amino acid residues in amino acid sequence of CDR] ... (I)
Wherein the electrical properties of the CDRs are neutral when X is -1, 0 or 1.
When X is 2 or more, the electrical property of CDR is positive charge,
When X is -2 or less, the electrical property of CDR is negative charge)

  Preferably, the electrical properties of the CDRs are determined based on the amino acid sequences of both light and heavy chain CDRs. In this case, the amino acid sequences of the CDRs in formula (I) refer to all the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain and CDR1, CDR2 and CDR3 of the heavy chain. In this embodiment, at least three amino acid residues of the light chain FR3 are charged in an antibody whose electrical property determined based on the amino acid sequences of both light chain and heavy chain CDRs is neutral or negative. It is preferable to substitute for an amino acid residue.

  The electrical properties of the CDRs may be determined for each of the light chain CDRs and the heavy chain CDRs. That is, when determining the electrical properties of the light chain CDRs, the amino acid sequences of the CDRs in formula (I) refer to all the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain. Also, when determining the electrical properties of heavy chain CDRs, the amino acid sequences of the CDRs in formula (I) refer to all amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain. In this embodiment, at least three amino acid residues of FR3 of the light chain are preferably substituted with charged amino acid residues in an antibody in which the electrical properties of the light chain CDRs are neutral or negative.

  The amino acid sequences of the CDRs can be obtained from public databases disclosing the sequences of antibody genes. Alternatively, when there is a hybridoma that produces an unmodified antibody, the amino acid sequences of CDRs are obtained by nucleic acid encoding heavy chain and light chain from the hybridoma by a known method and sequencing the nucleotide sequence of the nucleic acid Can be obtained by

  The electrical properties of the CDRs vary by antibody. For example, as shown in Example 3 below, the light chain CDR of a wild-type (ie, unmodified) anti-insulin antibody has one basic amino acid residue (arginine) and an acidic amino acid residue is present. do not do. Thus, the electrical properties of the CDRs of the wild-type anti-insulin antibody are defined as neutral (X = 1). In addition, the light chain CDRs of the wild-type anti-TSHR antibody have five acidic amino acid residues (aspartic acid) and no basic amino acid residues. Thus, the electrical properties of the CDRs of the wild-type anti-TSHR antibody are defined as negative charge (X = -5).

  In unmodified antibodies in which the electrical properties of the CDRs are neutral, replacing at least three amino acid residues of FR3 with acidic amino acid residues results in a broad range of surface charges including the antigen binding site of the antibody being negative. It becomes. In addition, in an unmodified antibody in which the electrical properties of the CDRs are neutral, a wide range of surfaces including the antigen binding site of the antibody can be obtained by substituting at least three amino acid residues of FR3 with basic amino acid residues. The charge is positive. Such a change in surface charge causes an electrostatic interaction (attractive force or repulsive force) upon binding of the antibody to the antigen. That is, in an unmodified antibody in which the electrical properties of the CDRs are neutral, the affinity of the antibody for the antigen is compared to that of the unmodified antibody by replacing at least three amino acid residues of FR3 with acidic amino acid residues. It can be lowered. In addition, in the unmodified antibody in which the electrical properties of the CDRs are neutral, the affinity of the antibody to the antigen is not altered by replacing at least three amino acid residues of FR3 with basic amino acid residues. It can be improved compared.

  In antibodies in which the electrical properties of the CDRs are negatively charged, substituting at least three amino acid residues of FR3 with acidic amino acid residues results in a broad range of surface charges including the antigen binding site of the antibody. Such a change in surface charge causes an electrostatic interaction (repulsion) upon binding between the antibody and the antigen. That is, in an unmodified antibody in which the electrical properties of the CDRs are negatively charged, the affinity of the antibody for the antigen is compared to that of the unmodified antibody by replacing at least three amino acid residues of FR3 with acidic amino acid residues. It can be lowered.

  In this embodiment, mutations can be introduced into FR3 of the unmodified antibody by known methods such as DNA recombination technology and other molecular biological techniques. For example, when there is a hybridoma that produces an unmodified antibody, as shown in Example 1 described later, RNA extracted from the hybridoma is used to perform reverse transcription reaction and Rapid Amplification of cDNA ends (RACE) method. The polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain are synthesized respectively. A polynucleotide and heavy chain encoding a light chain mutated in FR3 by amplifying these polynucleotides by PCR using primers for introducing mutations in at least three amino acid residues of FR3 Get the polynucleotide encoding The obtained polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding an antibody with controlled affinity. Here, the polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain may be incorporated into one expression vector or may be separately incorporated into two expression vectors. The type of expression vector is not particularly limited, and may be a mammalian cell expression vector or an E. coli expression vector. An affinity-controlled antibody can be obtained by transducing or transfecting the obtained expression vector into an appropriate host cell (eg, mammalian cell or E. coli).

  When obtaining an antibody whose affinity is controlled, which is a single-chain antibody (scFv), for example, as described in Patent Document 2, light chain is obtained by reverse transcription reaction and PCR using RNA extracted from the above-mentioned hybridoma. Each of a polynucleotide encoding a variable region and a polynucleotide encoding a heavy chain variable region may be synthesized. These polynucleotides are linked by overlap extension PCR or the like to obtain a polynucleotide encoding an unmodified scFv. The resulting polynucleotide is amplified by PCR using primers for introducing mutations into at least three amino acid residues of FR3 to obtain a polynucleotide encoding a scFv in which mutations are introduced into FR3. . The obtained polynucleotide is incorporated into an expression vector known in the art to obtain an expression vector containing a polynucleotide encoding an antibody with controlled affinity in the form of scFv. By transducing or transfecting the obtained expression vector into an appropriate host cell, it is possible to obtain an antibody whose affinity is controlled in the form of scFv.

  If there is no hybridoma that produces an antibody that recognizes the antigen of interest, the antibody may be obtained by a known method such as the method described in Kohler and Milstein, Nature, vol. 256, p. 495-497, 1975, for example. A production hybridoma may be prepared. Alternatively, RNA obtained from the spleen of an animal such as a mouse immunized with an antigen of interest may be used. In the case of using RNA obtained from spleen, for example, as shown in Non-Patent Document 1, among the obtained polynucleotides encoding unmodified Fab, unmodified with the desired affinity by phage display method etc. The polynucleotide encoding the Fab may be selected.

[2. Method of producing antibody whose affinity to antigen is altered]
The scope of the present invention also includes a method for producing an antibody (hereinafter, also referred to as “production method”) in which the affinity to an antigen is altered. In the production method of the present embodiment, first, at least three amino acid residues of FR3 defined by the Chothia method are charged amino acid residues in an antibody in which the electrical properties of the CDR based on the amino acid sequence of the CDR are neutral or negative. Perform the process of replacing

  The above-mentioned antibody to which the amino acid residue of FR3 is to be substituted in the production method of the present embodiment is the same as the unmodified antibody in the control method of the present embodiment. Hereinafter, the original antibody to be a target for which the affinity to the antigen is altered in the production method of the present embodiment is also referred to as “unmodified antibody”. The details of the electrical characteristics of the CDRs are the same as those described for the control method of this embodiment. The electrical properties of the CDRs of the antibody can be determined by formula (I) above. Further, FR3 defined by the Chothia method is the same as that described for the control method of this embodiment, and is as shown in Tables 1 and 2.

  In the production method of the present embodiment, the surface charge distribution of the antibody can be changed by substitution of amino acid residues to obtain an antibody with altered affinity to the antigen. That is, in the above antibody substitution process, at least three amino acid residues of FR3 defined in Chothia method are substituted with charged amino acid residues in an antibody in which the electrical properties of CDRs are neutral or negatively charged, and the antibody is directed against the antigen It can be said that it is a process of modifying the affinity. For example, in the above antibody substitution process, at least three amino acid residues of FR3 defined by Chothia method are substituted with acidic amino acid residues in an antibody having neutral electrical properties of CDRs, and the affinity of the antibody for the antigen is determined. It may be a step of reducing as compared to the unmodified antibody. Further, the above substitution step substitutes basic amino acid residues for at least three amino acid residues of FR3 defined by Chothia method in an antibody having neutral electrical properties of CDRs, and the affinity of the antibody for the antigen is achieved. It may be a step of improving the antibody as compared to the unmodified antibody. Alternatively, the above-mentioned substitution process substitutes at least three amino acid residues of FR3 defined in Chothia method with acidic amino acid residues in an antibody in which the electrical properties of CDRs are negatively charged, and the affinity of the antibody for the antigen is obtained. It may be a step of reducing as compared to the unmodified antibody.

  In this embodiment, at least three amino acid residues of the light chain FR3 are charged in an antibody whose electrical property determined based on the amino acid sequences of both light chain and heavy chain CDRs is neutral or negative. It is preferable to substitute for an amino acid residue. In addition, in an antibody in which the electrical properties of the light chain CDRs are neutral or negative, at least three amino acid residues of FR3 of the light chain are preferably substituted with charged amino acid residues.

  Substitution of amino acid residues can be carried out by known methods such as DNA recombination technology and other molecular biological technology. For example, in the case where there is a hybridoma producing an antibody in which the electrical properties of the CDRs are neutral or negative, an antibody with altered affinity to the antigen is described in the same manner as described in the control method of this embodiment. An expression vector comprising the encoding polynucleotide can be obtained. The resulting expression vector can then be transduced or transfected into an appropriate host cell to obtain a host cell that expresses the above antibody.

  Next, in the production method of the present embodiment, the antibody obtained in the above substitution step is recovered. For example, host cells that express an antibody with altered affinity for an antigen are dissolved in a solution containing an appropriate solubilizing agent to release the antibody in the solution. When the above-mentioned host cells secrete into the culture medium an antibody with altered affinity to the antigen, the culture supernatant is recovered. The released antibody can be recovered by methods known in the art, such as affinity chromatography. For example, when the produced antibody is IgG, it can be recovered by affinity chromatography using protein A or G. If necessary, the recovered antibody may be purified by methods known in the art such as gel filtration.

The affinity of the produced antibody for the antigen may be evaluated by kinetic parameters in the antigen-antibody reaction, or may be evaluated by an immunological assay such as ELISA. In an antibody with improved affinity for an antigen, for example, the value of K _D in an antigen-antibody reaction is about 1/2, about 1/5, about 1/10, about 1/1, as compared to the original antibody. 20, about 1/50, about 1/100 or about 1/1000. For antibodies with reduced affinity for the antigen, the K _D value in the antigen-antibody reaction is about 2-fold, about 5-fold, about 10-fold, about 20-fold, about 50-fold, as compared to the original antibody. It is about 100 times or about 1000 times.

[3. Antibody whose affinity for antigen has been altered]
Also included within the scope of the present invention are antibodies whose affinity to antigens has been altered (hereinafter also referred to as "altered antibodies"). The modified antibody of this embodiment is characterized in that the electrical properties of the CDRs based on the amino acid sequences of the CDRs are neutral or negative charge. The details of the electrical characteristics of the CDRs are the same as those described for the control method of this embodiment. The electrical properties of the CDRs of the modified antibody can be determined by formula (I) above.

  In the modified antibody of this embodiment, at least three amino acid residues of FR3 defined by the Chothia method in the unmodified antibody are substituted with charged amino acid residues. That is, the modified antibody of the present embodiment has at least three mutations due to substitution with charged amino acid residues in FR3 defined by the Chothia method, as compared with the amino acid sequence of the unmodified antibody. The modified antibody of the present embodiment is the same as the above-described "affinity-controlled antibody". Further, FR3 defined by the Chothia method is the same as that described for the control method of this embodiment, and is as shown in Tables 1 and 2.

  Here, an unmodified antibody refers to an antibody before the affinity for the antigen is altered. That is, the unmodified antibody is the original antibody of the modified antibody, and the amino acid residue of FR3 defined by the Chothia method is not substituted for the charged amino acid residue. Note that this unmodified antibody corresponds to the original antibody to be controlled for affinity to the antigen in the control method of the present embodiment. In this embodiment, the unmodified antibody has CDRs that have neutral or negative electrical characteristics.

  In the modified antibody of this embodiment, the introduction of a mutation changes the surface charge distribution of the antibody. That is, the modified antibody has improved or decreased affinity for the antigen as compared to the unmodified antibody. In the present embodiment, the affinity of the modified antibody for the antigen may be evaluated by kinetic parameters in an antigen-antibody reaction, or may be evaluated by an immunological measurement such as ELISA. The type and acquisition of kinetic parameters are the same as described for the control method of this embodiment.

In modified antibodies with improved affinity for antigen, for example, the value of K _D in the antigen-antibody reaction is about 1/2, about 1/5, about 1/10, about 1/1, as compared to the unmodified antibody. 20, about 1/50, about 1/100 or about 1/1000. For example, in the case of a modified antibody having a reduced affinity for an antigen, the value of K _D in the antigen-antibody reaction is about 2-fold, about 5-fold, about 10-fold, about 20-fold, about 50 as compared to the unmodified antibody. Times, about 100 times or about 1000 times.

  The modified antibody may be an antibody that recognizes any antigen. Also, the class of antibody may be any of IgG, IgA, IgM, IgD and IgE, preferably IgG. The modified antibody of the present embodiment may be in the form of an antibody fragment as long as it has a variable region containing FR3 into which a mutation has been introduced. The type of antibody fragment is the same as that described for the control method of this embodiment.

  Preferably, the modified antibody of the present embodiment has no mutation in the CDRs. That is, the amino acid sequences of the CDRs of the modified antibody are preferably the same as the amino acid sequences of the CDRs of the unmodified antibody.

  In the modified antibody of this embodiment, at least three mutations may be introduced into any amino acid residue of FR3 defined by the Chothia method in the unmodified antibody. Preferably, at least three mutations are introduced into the amino acid residues in the region excluding the non-exposed residues from FR3. The amino acid residues in the region excluding the non-exposed residues from FR3 are the same as those described for the control method of this embodiment.

  More preferably, at least three mutations are introduced into the amino acid residues in the region excluding the non-exposed residues and the Vernier zone residues from FR3. The amino acid residues in the region excluding the non-exposed residues and the Vernier zone residues from FR3 are the same as those described for the control method of this embodiment.

  Particularly preferably, at least three mutations are introduced into the amino acid residues in which the side chain is directed to the molecular surface, among the amino acid residues in the region excluding the non-exposed residues and the Vernier zone residues from FR3. The amino acid residues whose side chains in FR3 face the molecular surface are the same as those described for the control method of this embodiment.

  In this embodiment, mutations of at least three amino acid residues may be introduced into either the light chain FR3 or the heavy chain FR3 but are preferably introduced into the light chain FR3. When both the light chain and heavy chain FR3 have mutations, at least three amino acid residue mutations are introduced into the light chain FR3 and at least three amino acid residue mutations are introduced into the heavy chain FR3. Is preferred.

  In the present embodiment, the upper limit of the number of mutations in FR3 of the modified antibody is not particularly limited, but is preferably 16 amino acids or less. The number of mutations in FR3 of the modified antibody is specifically 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

  In this embodiment, at least three mutations possessed by the modified antibody may be mutations in which the neutral amino acid residue of FR3 is substituted with a charged amino acid residue. Moreover, in the present embodiment, it is preferable that all of the at least three mutations be substitutions with charged amino acid residues having the same charge. That is, it is preferable that all of the at least three mutations be substitution with an acidic amino acid residue or substitution with a basic amino acid residue.

Examples of the modified antibody of the present embodiment include the following (1) to (3) antibodies.
(1) The electrical properties of the CDRs are neutral, and at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues, and the affinity of the antibody for its antigen is lower than that of the unmodified antibody. Reduced antibody,
(2) to an antibody of which the electrical properties of the CDRs are neutral, at least three amino acid residues of FR3 defined by the Chothia method are substituted with basic amino acid residues, and the affinity of the antibody to the antigen is unmodified Improved antibodies, and
(3) The electrical properties of the CDRs are negatively charged, and at least three amino acid residues of FR3 defined by the Chothia method are substituted with acidic amino acid residues, and the affinity of the antibody for its antigen is lower than that of the unmodified antibody. Reduced antibody.

  Specific examples of the altered antibody include altered antibodies of anti-insulin antibody and anti-TSHR antibody. In such an anti-insulin antibody modified antibody, the electrical characteristics of the CDRs are neutral, and the 63rd, 65th, 67th, 70th and 72nd amino acid residues in FR3 of the light chain are substituted with basic amino acid residues. Ru. In this modified antibody, the affinity for the antigen insulin is improved as compared to the unmodified antibody. On the other hand, in the modified antibody in which the 63rd, 65th, 67th, 70th and 72nd amino acid residues in FR3 of the light chain have been substituted with acidic amino acid residues, the affinity for the antigen insulin is higher than that of the unmodified antibody. It has fallen. In addition, in the modified antibody of the anti-TSHR antibody, the electrical properties of the CDRs are negatively charged, and the 63rd, 65th, 67th, 70th and 72nd amino acid residues in FR3 of the light chain are substituted with acidic amino acid residues. In this modified antibody, the affinity for the antigen TSHR is lower than that of the unmodified antibody.

  The modified antibody of the present embodiment can be produced by known methods such as DNA recombination technology and other molecular biological technology. For example, when there is a hybridoma that produces an antibody in which the electrical properties of the CDRs are neutral or negative, at least three amino acid residues of FR3 remain as in the control method and production method of this embodiment. Antibodies can be generated in which groups are substituted for charged amino acid residues.

  In this embodiment, the usage of the modified antibody is not particularly different from that of the unmodified antibody. Modified antibodies, like unmodified antibodies, can be used for various tests and studies. In addition, the modified antibody of the present embodiment may be modified with a labeling substance or the like known in the art.

  Included within the scope of the present invention is an isolated and purified polynucleotide encoding an antibody or fragment thereof that has altered affinity for the antigen of this embodiment. Preferably, the isolated and purified polynucleotide encoding a fragment of the modified antibody of this embodiment encodes a variable region containing FR3 into which a mutation has been introduced. Also included within the scope of the present invention is a vector comprising the polynucleotide described above. A vector is a polynucleotide construct designed for transduction or transfection. The type of vector is not particularly limited, and can be appropriately selected from vectors known in the art, such as expression vectors, cloning vectors, and viral vectors. Also within the scope of the present invention is a host cell comprising the vector. The type of host cell is not particularly limited, and can be appropriately selected from eukaryotic cells, prokaryotic cells, mammalian cells and the like.

  EXAMPLES Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples.

Example 1 Preparation of antibody having charged amino acid residue introduced into FR3 Three or five amino acid residues of FR3 of anti-insulin antibody and anti-thyroid stimulating hormone receptor (TSHR) antibody are substituted with charged amino acid residues, Variants of each antibody were generated.

(1) Acquisition of wild-type anti-insulin antibody and wild-type anti-TSHR antibody genes
[reagent]
ISOGEN (Nippon Gene Inc.)
SMARTer (R) RACE 5 '/ 3' kit (clontech)
10x A-attachment mix (Toyobo Co., Ltd.)
pcDNA (trademark) 3.4 TOPO (registered trademark) TA cloning kit (Thermo Fisher)
Competent high DH5α (Toyobo Co., Ltd.)
QIAprep Spin Miniprep Kit (QIAGEN)
KOD plus neo (Toyobo Co., Ltd.)
Ligation high ver. 2 (Toyobo Co., Ltd.)

(1.1) Acquisition of gene for wild-type anti-insulin antibody
(1.1.1) Extraction of Total RNA from Antibody-Producing Hybridomas Using human insulin as an antigen, wild-type mice were prepared by the method described in Kohler and Milstein, Nature, vol. 256, p. 495-497, 1975. A hybridoma producing an anti-human insulin antibody was produced. The hybridoma culture (10 mL) was centrifuged at 1000 rpm for 5 minutes, and the supernatant was removed. The resulting cells were lysed with ISOGEN (1 mL) and allowed to stand at room temperature for 5 minutes. Chloroform (200 μL) was added thereto, and the mixture was stirred for 15 seconds and then allowed to stand at room temperature for 3 minutes. Then, this was centrifuged at 12000 × G for 10 minutes at 4 ° C. to recover an aqueous phase (500 μL) containing RNA. Isopropanol (500 μL) was added to the collected aqueous phase and mixed. The resulting mixture was allowed to stand at room temperature for 5 minutes and then centrifuged at 12000 × G for 10 minutes at 4 ° C. The supernatant was removed, and 70% ethanol (1 mL) was added to the obtained precipitate (total RNA), and centrifuged at 7500 × G for 10 minutes at 4 ° C. The supernatant was removed and the RNA was air dried and dissolved in RNase free water (20 μL).

(1.1.2) Synthesis of cDNA An RNA sample of the following composition was prepared using each total RNA obtained in the above (1.1.1).
[RNA sample]
Total RNA (500 ng / μL) 1 μL
RT primer 1 μL
1.75 μL of deionized water
Total 3.75 μL

The prepared RNA sample was heated at 72 ° C. for 3 minutes and then incubated at 42 ° C. for 2 minutes. Then, 12 μM SMARTerIIA oligonucleotide (1 μL) was added to the RNA sample to prepare a sample for cDNA synthesis. Using this sample for cDNA synthesis, a reverse transcription reaction solution of the following composition was prepared.
[Reverse transcription reaction solution]
5x First-Strand buffer 2μL
20 mM DTT 1 μL
10 mM dNTP mix 1 μL
RNAase inhibitor 0.25 μL
SMARTScribe RT (100 U / μL) 1 μL
Sample for cDNA synthesis 4.75 μL
10 μL in total

The prepared reverse transcription reaction solution was reacted at 42 ° C. for 90 minutes. Then, the reaction solution was heated at 70 ° C. for 10 minutes, and tricine-EDTA (50 μL) was added. The resulting solution was used as a cDNA sample to prepare a 5 'RACE reaction solution having the following composition.
[5 'RACE reaction solution]
10x PCR buffer 5μL
dNTP mix 5μL
25 mM Mg ₂ SO ₄ 3.5 μL
cDNA sample 2.5 μL
10x Universal Primer Mix 5μL
3'-primer 1 μL
KOD plus neo (1 U / μL) 1 μL
Purified water 27 μL
50 μL in total

The prepared 5 'RACE reaction solution was subjected to RACE reaction under the following reaction conditions. The following "Y" is 90 seconds for the light chain and 150 seconds for the heavy chain.
[Reaction conditions]
2 minutes at 94 ° C,
30 cycles of 98 ° C. for 10 seconds, 50 ° C. for 30 seconds, and 68 ° C. for Y seconds, and
3 minutes at 68 ° C.

Using the 5 'RACE product obtained by the above reaction, a solution of the following composition was prepared. The solution was allowed to react at 60 ° C. for 30 minutes to add adenine to the end of the 5 'RACE product.
9 μL of 5 'RACE product
10x A-attachment mix 1μL
10 μL in total

A TA cloning reaction solution having the following composition was prepared using the obtained adenine addition product and pcDNA (trademark) 3.4 TOPO (registered trademark) TA cloning kit. The reaction was incubated at room temperature for 10 minutes to clone the adenine addition product into pCDNA3.4.
[TA cloning reaction solution]
Adenine adduct 4 μL
salt solution 1μL
pCDNA 3.4 1 μL
6 μL in total

(1.1.3) Transformation, plasmid extraction and confirmation of sequence The TA cloning sample (3 μL) obtained in (1.1.2) above was added to DH5α (30 μL), and allowed to stand on ice for 30 minutes, and then the mixture Was heated at 42 ° C. for 45 seconds to perform a heat shock. After standing again on ice for 2 minutes, the whole was applied to an LB plate containing ampicillin. The plate was incubated at 37 ° C. for 16 hours. Single colonies on the plate were picked up in LB broth containing ampicillin and cultured with shaking (250 rpm) at 37 ° C. for 16 hours. The culture was centrifuged at 5000 × G for 5 minutes to recover E. coli transformants. The plasmid was extracted from the recovered E. coli using QIAprep Spin Miniprep kit. The specific operation was performed according to the manual attached to the kit. The nucleotide sequence of the obtained plasmid was confirmed using pCDNA3.4 vector primer. Hereinafter, this plasmid was used as a mammalian cell expression plasmid.

(1.2) Acquisition of gene of wild-type anti-TSHR antibody The gene synthesis of the gene of wild-type human anti-TSHR antibody was entrusted to Genscript Japan Ltd. to acquire the gene of wild-type human anti-TSHR antibody.

(2) Acquisition of mutant genes of each antibody
(2.1) Primer design and PCR
In order to introduce a mutation into FR3 defined by Chothia method in the light chain of each antibody, a plasmid containing the gene of the wild type anti-insulin antibody obtained in the above (1.1.3), the wild type obtained in (1.2) PCR was performed using the anti-TSHR antibody gene and the primers shown in the following nucleotide sequences. The D5 variant is a variant in which five amino acid residues of FR3 are mutated to an aspartic acid residue, and the E5 variant is a variant in which five amino acid residues of FR3 are mutated to a glutamic acid residue A K5 mutant is a mutant in which five amino acid residues of FR3 are mutated to lysine residues, and a R5 mutant is a mutation in which five amino acid residues of FR3 are arginine residues The R3 mutant is a mutant in which three amino acid residues of FR3 are mutated to arginine residues.

[Primer for anti-insulin antibody]
Sequence 1 D5 variant REV: 5 'TTCGTATTCGGTCCCTCTCCTCTGCCCTTCAAAGCGAGCA 3' (SEQ ID NO: 1)
Sequence 2 E5 variant REV: 5 'ATCGTAATCGGTCCCATCCCCATCGCCATCAAAGCGAGCCA 3' (SEQ ID NO: 2)
Sequence 3 K5 variant REV: 5 'CTTGTACTTGGTCCCCCTTCCCCTTGCCCTTAAAGCGAGCA 3' (SEQ ID NO: 3)
Sequence 4 R5 variant REV: 5 'TCTGTATCTGGTCCCTCCTCCCTCTGCTCTAAAGCGAGCA 3' (SEQ ID NO: 4)
Sequence 5 FOR: 5 'CTCACAATCAGCTGATTG 3' (SEQ ID NO: 5)
Sequence 6 R3 variant REV: 5 'TCTCCCCTCTGCTCTAAAGCGAGCA 3' (SEQ ID NO: 6)
Sequence 7 R3 variant FOR: 5 'GGGACCAGATACAGA 3' (SEQ ID NO: 7)

  The primer of sequence 5 was used as a forward primer common to the primers of sequences 1 to 4. In addition, the primer of sequence 7 was used as a forward primer for the primer of sequence 6.

[Primer for anti-TSHR antibody]
Sequence 8 D5 variant FOR: 5 'GGCACAGACGCCGACCTGGCAATCA 3' (SEQ ID NO: 8)
Sequence 9 D5 variant REV: 5 'GTCCCGGTCTCCCGTCAAACCGGGTCG 3' (SEQ ID NO: 9)
Sequence 10 E5 variant FOR: 5 'GGCACAGAGGCCCAGCTGGCAATCA 3' (SEQ ID NO: 10)
Sequence 11 E5 variant REV: 5 'CTCCCGCTCTCCCTCCAAACCGGTCG 3' (SEQ ID NO: 11)
Sequence 12 K5 variant FOR: 5 'GGCACAAAGGCCAAGCTGGCAATCA 3' (SEQ ID NO: 12)
Sequence 13 K5 variant REV: 5 'CTTCCGCTTTCCTTAAACGGGTCG 3' (SEQ ID NO: 13)
Sequence 14 R5 variant FOR: 5 'GGCACAAGGGCAGGCTGGCAATCA 3' (SEQ ID NO: 14)
Sequence 15 R5 variant REV: 5 'CCTCCCGCCTTCCCTAAACGGGTCG 3' (SEQ ID NO: 15)

The PCR reaction solution having the following composition was prepared using the plasmid obtained in (1.3) above as a template.
[PCR reaction solution]
10x PCR buffer 5μL
₃ μL of 25 mM Mg ₂ SO ₄
2 mM dNTP mix 5 μL
Forward primer 1 μL
Reverse primer 1 μL
Template plasmid (40 ng / μL) 0.5 μL
KOD plus neo (1 U / μL) 1 μL
Purified water 33.5 μL
50 μL in total

The prepared PCR reaction solution was subjected to PCR reaction under the following reaction conditions.
[Reaction conditions]
2 minutes at 98 ° C,
30 cycles of 10 seconds at 98 ° C, 30 seconds at 54 ° C, and 4 minutes at 68 ° C, and
3 minutes at 68 ° C.

The PCR product was fragmented by adding 2 μL of DpnI (10 U / μL) to the obtained PCR product (50 μL). A ligation reaction solution of the following composition was prepared using DpnI-treated PCR product. The reaction solution was incubated at 16 ° C. for 1 hour to carry out a ligation reaction.
[Ligation reaction solution]
2 μL of DpnI-treated PCR product
Ligation high ver.2 5μL
1 μL of T4 polynucleotide kinase
7 μL of purified water
15 μL in total

(2.2) Transformation, plasmid extraction and sequence confirmation The solution (3 μL) after the ligation reaction was added to DH5α (30 μL) to obtain a transformant of E. coli in the same manner as in (1.1.3) above. The plasmid was extracted from the resulting E. coli using QIAprep Spin Miniprep kit. The nucleotide sequence of each of the obtained plasmids was confirmed using a pCDNA3.4 vector primer. Hereinafter, these plasmids were used as plasmids for mammalian cell expression.

(3) Expression in mammalian cells
[reagent]
Expi293TM cells (Invitrogen)
Expi293TM Expression Medium (Invitrogen)
ExpiFectamineTM 293 Transfection Kit (Invitrogen)

(3.1) Transfection
Expi 293 cells were grown by shaking culture (150 rpm) at 37 ° C. in a 5% CO 2 atmosphere. A number of 30 mL cell cultures (3.0 × 10 6 cells / mL) was prepared according to the number of samples. A DNA solution of the following composition was prepared using a plasmid encoding each mutant of FR3 and a plasmid encoding a wild-type antibody, and allowed to stand for 5 minutes.
[DNA solution]
Amount (μL) equivalent to 15 μg of light chain plasmid solution
Amount (μL) equivalent to 15 μg of heavy chain plasmid solution
Opti-MEMTM appropriate amount (mL)
1.5 mL in total

A transfection reagent of the following composition was prepared and allowed to stand for 5 minutes.
ExpiFectamine reagent 80 μL
Plasmid solution 1420 μL
1.5 mL in total

The prepared DNA solution and transfection reagent were mixed and allowed to stand for 20 minutes. The resulting mixture (3 mL) was added to the cell culture (30 mL), and shake culture (150 rpm) was performed at 37 ° C. for 20 hours under a 5% CO ₂ atmosphere. After 20 hours, add 150 μL and 1.5 mL of ExpiFectamineTM transfection enhancer 1 and 2, respectively, to each culture, and shake culture (150 rpm) at 37 ° C for 6 days under a 5% CO ₂ atmosphere. did.

(3.2) Recovery and Purification of Antibody Each cell culture was centrifuged at 3000 rpm for 5 minutes to recover a culture supernatant. Culture supernatants contain each antibody secreted from transfected Expi293TM cells. The obtained culture supernatant was again centrifuged at 15000 × G for 10 minutes to recover the supernatant. 100 μL of a carrier for antibody purification Ab-Capcher Mag (Protenova) was added to the obtained supernatant (30 mL), and allowed to react at room temperature for 2 hours. The carrier was collected to remove the supernatant, and PBS (1 mL) was added to wash the carrier. 400 μL of 100 mM Gly-HCl (pH 2.8) was added to the carrier to elute the antibody (IgG) trapped on the carrier. This elution operation was performed a total of three times. The obtained eluate was neutralized with 100 mM Tris-HCl (pH 8.0) to obtain an antibody solution.

(4) Results 63rd, 65th, 67th, 70th and 72nd serine residues of light chain FR3 defined by Chothia method in wild type anti-insulin antibody and wild type anti-TSHR antibody, charged amino acid residues An antibody substituted with (aspartic acid residue, glutamic acid residue, lysine residue or arginine residue) was obtained. In addition, the 63rd, 65th and 67th serine residues of light chain FR3 defined by the Chothia method in a wild type anti-insulin antibody were substituted with charged amino acid residues (arginine residues) to obtain an antibody.

Example 2 Measurement of Affinity of Antibody in which Charged Amino Acid Residue was Introduced into FR3 It was examined how the affinity of each mutant prepared in Example 1 for the antigen changes as compared to the wild type.

(1) Fragmentation of antibody
Each antibody obtained in Example 1 was turned into Fab fragments using the Pierce (registered trademark) Mouse IgG1 Fab and F (ab ') 2 Preparation kit (Thermo Fisher). The specific operation was performed according to the manual attached to the kit. The resulting reaction solution was gel-filtered and purified using Superdex 200 Increase 10/300 GL (GE Healthcare). The 50 kDa eluted fraction was collected, and the obtained fraction was used in the subsequent experiments as a solution containing a Fab fragment.

(2) Measurement of affinity
(2.1) Measurement of Affinity by SPR Technique The affinity of the wild type anti-insulin antibody and its variant to the antigen was measured by SPR technique as follows. As an anti-insulin antibody antigen, 100 units of Humulin R (Eli Lilly) were used. The antigen was immobilized on a sensor chip Series S Sensor Chip CM5 (GE Healthcare) for Biacore (registered trademark: 100 RU). The Fab fragment-containing solution of anti-insulin antibody was diluted to prepare solutions of 50 nM, 25 nM, 12.5 nM, 6.25 nM and 3.13 nM. The solution containing each concentration of Fab fragment was sent to Biacore (registered trademark) T200 (GE Healthcare) (association time 120 seconds and dissociation time 1200 seconds). Measured data were analyzed using Biacore (R) Evaluation software to obtain data on the affinity of anti-insulin antibodies.

(2.2) Evaluation of Affinity by ELISA Method The affinity of the wild type anti-TSHR antibody and its variant to the antigen was measured by ELISA as follows.

(2.2.1) Immobilization of Capture Antibody As a capture antibody, 4E31 antibody (RSR), which is a mouse monoclonal anti-TSHR antibody, was used. The 4E31 antibody (5 μg) was diluted with PBS to obtain an antibody solution. The antibody solution was added in an amount of 100 μL to each well of NUNC-immuno module (Cat No. 469949, manufactured by NUNC, hereinafter referred to as “plate”). The plate was allowed to stand at room temperature for 3 hours to immobilize the 4E31 antibody on the wells. The antibody solution was removed and 300 μl of blocking solution (PBS containing 1% BSA) was added to each well of the plate. Blocking was performed at 4 ° C. for 20 hours or more.

(2.2.2) Primary reaction Detergent solubilized cell membrane preparation containing the TSHR (RSR) was used as an antigen of the anti-TSHR antibody. This antigen was diluted 500 times with PBS containing 1% BSA to obtain an antigen solution. The blocking solution was removed from the plate on which the 4E31 antibody was immobilized, and 50 μL of the antigen solution was added to each well. The plate was shaken at room temperature for 60 minutes to carry out an antigen-antibody reaction.

(2.2.3) Secondary reaction A wild-type anti-TSHR antibody, a D5 mutant and an R5 mutant were used as antibodies for detection. Each antibody was serially diluted in PBS containing 1% BSA to obtain antibody solutions at concentrations of 1000 pM, 100 pM, 10 pM, 1 pM and 0.1 pM. In addition, HRP labeled anti-human IgG (Fc specific) antibody was used as a secondary antibody. The secondary antibody was diluted with PBS containing 1% BSA to obtain a secondary antibody solution at a concentration of 0.2 μg / mL. The antibody solution (50 μL) of each concentration and the secondary antibody solution (50 μL) were mixed to obtain a mixed solution of antibodies. The antigen solution was removed from the above plate, and 300 μL of a washing solution (PBS containing 1% BSA) was added to each well. Then, the washing solution was removed from the plate, and washing was performed by adding 300 μL of the washing solution to each well. This washing operation was repeated three times. The washing solution was removed from the plate, and 100 μL of the above antibody mixture was added to each well. The plate was shaken at room temperature for 60 minutes to carry out an antigen-antibody reaction. After the reaction, the above washing operation was repeated three times.

(2.2.4) Detection As a substrate solution, 1-Step UltraTMB-ELISA Substrate Solution (Thermo Fisher Scientific) was used. The wash was removed from the plate and substrate solution was added at 100 μL / well. The plate was allowed to stand at room temperature for 5 minutes. After 5 minutes, 100 μL each of stop solution (0.1 MH ₂ SO ₄ ) was added to each well of the plate to stop the reaction. The absorbance at 450 nm was then measured for each well of the plate.

(3) Results The dissociation constant (K _D ) was calculated from the binding rate constant (k _on ) and the dissociation rate constant (k _off ) obtained for the anti-insulin antibody. In addition, the dissociation constant (K _D ) was calculated from the measurement value of the ELISA method using an anti-TSHR antibody. The kinetic parameters of each antibody are shown in Tables 3 and 4 and FIGS. 1A and 1B. In the figure, "positively charged" indicates the K _D values of R5 variants, "negative charge" indicates the K _D values of D5 variants. In Table 3, the values obtained by global fitting are “mean value ± standard error”.

From Table 3 and Figure 1A, R3 variants of anti-insulin antibodies, K _D values of R5 variants and K5 mutants was lower than _the K _D value of the wild-type. Further, _the K _D value of D5 variants and E5 mutant was higher than _the K _D value of the wild-type. Thus, it was found that, for the anti-insulin antibody, by mutating three or five amino acid residues of FR3 to basic amino acid residues, it is possible to produce an antibody with improved affinity to the antigen as compared to the wild type. In addition, it was found that by mutating the five amino acid residues of FR3 to acidic amino acid residues, it is possible to produce an antibody with reduced affinity for the antigen as compared to the wild type.

From Table 4 and FIG. 1B, the K _D values of D5 variants of the anti-TSHR antibody, was higher than _the K _D value of the wild-type. For the anti-TSHR antibody, it was found that by mutating the five amino acid residues of FR3 to acidic amino acid residues, an antibody with reduced affinity for the antigen can be produced as compared to the wild-type. On the other hand, _the K _D value of R5 variants of the anti-TSHR antibody was K _D values comparable to the wild type. That is, for the anti-TSHR antibody, it is suggested that the affinity does not change even if the five amino acid residues of FR3 are mutated to basic amino acid residues.

Example 3 Relationship between Electrical Properties of Amino Acid Sequences of CDRs and Affinity for Antigen From Example 2, the anti-insulin antibody was able to improve and reduce the affinity by mutating FR3. On the other hand, the anti-TSHR antibody was able to reduce the affinity even by introducing a mutation into FR3, but could not improve the affinity. Therefore, the influence of the mutation introduction into FR3 on the surface charge of the antigen binding site of the antibody was examined.

(1) Examination of the change of the surface charge of the antibody by mutation introduction The surface charge distribution of various Fab fragments prepared in Example 1 was analyzed using Discovery Studiou (Dassault Systèmes Biovia Ltd.). The surface charge distribution map of insulin as a Fab fragment of anti-insulin antibody and an antigen is shown in FIG. 2A. The surface charge distribution map of the Fab fragment of anti-TSHR antibody and TSHR as an antigen is shown in FIG. 2B. In the figure, the arrow indicates the antigen binding site, and PI indicates the value of isoelectric point. Here, the antigen binding site is the same as the CDR. Also, in the figure, the surface charge distribution is indicated by color, and the blue part indicates positive charge, the red part indicates negative charge, and the white part indicates electrically neutral.

  From FIG. 2A, it was found that the surface charge of the antigen binding site was neutral in the wild type anti-insulin antibody. In a variant (positive charge mutation) in which a basic amino acid residue was introduced into FR3, a wide range of surface charges including the antigen binding site was positive. Here, insulin, which is an antigen, is a negatively charged protein, but from FIG. 1A, the affinity to the antigen of a mutant type into which a positive charge mutation has been introduced is improved. On the other hand, in the mutant type (negative charge mutation) in which acidic amino acid was introduced into FR3, a wide range of surface charges including the antigen binding site was negative. As shown in FIG. 1A, the affinity for the antigen of the mutant type into which the negative charge mutation was introduced was reduced. From these facts, it is understood that in the wild-type anti-insulin antibody, the contribution to the surface charge by the charged amino acid residue introduced into FR3 is widespread.

  From FIG. 2B, it was found that the surface charge of the antigen binding site was negative in the wild-type anti-TSHR antibody. In the variant (positive charge mutation) in which a basic amino acid was introduced into FR3, the surface charge in the range excluding the antigen binding site was positive, but the surface charge of the antigen binding site did not change much. Here, TSHR, which is an antigen, is a negatively charged protein, but from FIG. 1B, there was no change in the affinity to the antigen of a mutant that has a positive charge mutation introduced. On the other hand, in the mutant type (negative charge mutation) in which acidic amino acid was introduced into FR3, a wide range of surface charges including the antigen binding site was negative. From FIG. 1B, the affinity for the antigen of the mutant type into which the negative charge mutation was introduced was reduced. From these facts, it is understood that in the wild-type anti-TSHR antibody, the contribution to the surface charge by the acidic amino acid residue introduced into FR3 is widespread. On the other hand, it is understood that the surface charge is locally different even if a basic amino acid residue is introduced into FR3 of the wild type anti-TSHR antibody.

(2) The relationship between the electrical property of the amino acid sequence of CDR and the control of affinity We as to how the affinity for the antigen is changed by the introduction of charged amino acid residues into FR3 of the antibody It was believed that the electrical properties of the CDRs of the antibody are relevant. Here, the present inventors defined the electrical properties of CDRs by the following formula (I).

X = [number of basic amino acid residues in amino acid sequence of CDR]-[number of acidic amino acid residues in amino acid sequence of CDR] ... (I)
Wherein the electrical properties of the CDRs are neutral when X is -1, 0 or 1.
When X is 2 or more, the electrical property of CDR is positive charge,
When X is -2 or less, the electrical property of CDR is negative charge)

  Table 5 shows the amino acid sequences of the light chain CDRs of a wild-type anti-TSHR antibody (SEQ ID NO: 16 and 17). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

  The CDRs of the anti-insulin antibody have one basic amino acid residue (arginine) and no acidic amino acid residues, so the electrical properties of the CDRs are defined as neutral (X = 1). As shown in Table 5, since the CDRs of the anti-TSHR antibody have five acidic amino acid residues (aspartic acid) and no basic amino acid residues, the electrical characteristics of the CDRs are negative (X = -5). As can be seen from FIGS. 2A and B, the electrical properties of the CDRs of the anti-insulin antibody and anti-TSHR antibody determined according to formula (I) are consistent with the surface charge of the antigen binding site analyzed in Discovery Studio. Thus, it was found that the antibodies have a bias in the electrical properties of the CDRs and the surface charge of the antigen binding site.

(3) Results The analysis of Example 2 and Example 3 suggests that the antibody having a neutral electrical property of CDR has a large contribution from the introduction of the charged amino acid residue to FR3. In addition, it is suggested that, in an antibody in which the electrical properties of the CDRs are neutral, the electrostatic interaction generated by the introduction enables the orientation control of the antigen binding site. On the other hand, in the antibody in which the electrical properties of the CDRs are negatively charged, it is suggested that the effect of electrostatic interaction is local even when basic amino acid residues are introduced into FR3. However, it is suggested that, in an antibody in which the electrical properties of the CDRs are negatively charged, it is possible to reduce the affinity for the antigen by electrostatic repulsion when an acidic amino acid residue is introduced into FR3.

Example 4 Examination of the Thermostability of an Antibody Having a Charged Amino Acid Residue Introduced into FR3 How does the thermostability of each variant of the anti-insulin antibody prepared in Example 1 change as compared to the wild type? It was investigated.

(1) Replacement of Buffer by Gel Filtration Buffer used in differential scanning calorimetry (DSC) measurement of the solvent of the Fab fragment-containing solution obtained in Example 2 by gel filtration (phosphate buffered saline: PBS) Replaced by The conditions for gel filtration are as follows.
[Conditions of gel filtration]
Buffer: PBS
Column used: Superdex 200 Increase 10/300 (GE Healthcare)
Column volume (CV): 24 mL
Sample volume: 500 μL
Flow rate: 1.0 mL / min
Dissolution volume: 1.5 CV
Fraction volume: 500 μL

(2) Measurement of denaturation temperature (Tm)
The fraction containing the Fab fragment was diluted with PBS to prepare a Fab fragment-containing sample (final concentration 5 μM). The Tm of each Fab fragment was measured using MicroCal VP-Capillary DSC (Malvern Instruments Ltd). The measurement conditions are as follows.
[DSC measurement conditions]
Sample volume: 400 μL
Measurement range: 30 ° C to 90 ° C
Temperature rising rate: 60 ° C / hour

(3) Results
The Tm values and analysis peaks obtained by DSC measurement are shown in Table 6 and FIG. 3, respectively.

  The D5 mutant had the most reduced thermostability compared to the wild type, but its reduction remained at around 13%. Thermostability was found to change little from wild type in most mutants. Thus, it is suggested that the introduction of charged amino acid residues into FR3 has little effect on the thermal stability of the antibody.

Example 5 Control of affinity of anti-lysozyme antibody for antigen
A mutation was introduced into FR3 of the anti-lysozyme antibody based on the electrical properties of the CDRs, and the affinity of the resulting mutant for lysozyme was confirmed.

(1) Electrical Properties of Anti-Lysozyme Antibody CDRs GenScript Japan Co., Ltd. was commissioned to synthesize the anti-lysozyme antibody gene to obtain a plasmid DNA containing a wild-type anti-lysozyme antibody gene. Based on the nucleotide sequence of the gene, the amino acid sequence of the anti-lysozyme antibody was determined. Table 7 shows the amino acid sequences of the light chain and heavy chain CDRs of a wild-type anti-lysozyme antibody (SEQ ID NOS: 18-23). The amino acid sequences of these CDRs are sequences defined by the Chothia method.

  As shown in Table 7, the CDRs of the light and heavy chains of the anti-lysozyme antibody have two basic amino acid residues and three acidic amino acid residues. Thus, the electrical properties of the anti-lysozyme antibody CDRs are defined as neutral (X = -1).

(2) Preparation of variants of anti-lysozyme antibody Consigning synthesis of genes of R5 variant and D5 variant of anti-lysozyme antibody to Genscript Japan Co., Ltd. to generate plasmid DNA containing a variant of anti-lysozyme antibody. I got it. Here, the R5 mutant of the anti-lysozyme antibody is the 63rd, 65th and 67th serine residues, the 70th aspartic acid residue, and the 72th amino acid of the light chain FR3 defined by the Chothia method in the wild-type antibody. The threonine residue of is substituted with an arginine residue. In addition, D5 variant of anti-lysozyme antibody is the 63rd, 65th and 67th serine residues, 70th aspartic acid residue, and 72nd of light chain FR3 defined by Chothia method in wild type antibody. It is an antibody in which a threonine residue is substituted by an aspartic acid residue.

  The obtained plasmid is used to express each antibody in Expi 293TM cells in the same manner as in Example 1, and the obtained culture supernatant is purified to obtain a wild-type anti-lysozyme antibody, R5 mutant and Solutions of each of the D5 mutants were obtained.

(3) Measurement of Affinity of Mutant for Antigen As a antigen of anti-lysozyme antibody, a solution (200 ng / mL) of hen egg white lysozyme (Sigma Aldrich) dissolved in 10 mM sodium acetate solution (pH 5.0) is used It was. The antigen was immobilized (41 RU or 33 RU) on a sensor chip Series S Sensor Chip CM5 (GE Healthcare) for Biacore (registered trademark). The solutions of each antibody were diluted with HBS EP + buffer (GE Healthcare) to prepare solutions of various concentrations. These solutions were delivered to Biacore® T200 (GE Healthcare). The antibody concentration in each solution and the measurement conditions are as follows. Measured data were analyzed using Biacore (R) Evaluation software to obtain data on the affinity of each antibody.

[Antibody concentration]
Wild type: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
D5 variants: 30 nM, 15 nM, 7.5 nM, 3.75 nM and 1.875 nM
R5 variants: 2 nM, 1 nM, 0.5 nM, 0.25 nM and 0.125 nM

[Measurement condition]
Association: 30 μL / min, 60 sec, 120 sec
Dissociation: 30 μL / min, 60 sec, 1200 sec
Regeneration: Gly-HCl (pH 2.0) / 60 μL / min, 40 sec

(4) Results The dissociation constant (K _D ) was calculated from the association rate constant (k _on ) and dissociation rate constant (k _off ) obtained for the wild-type and variants of anti-lysozyme antibody. The kinetic parameters of each antibody are shown in Table 8 and FIG. In the figure, "negative charge" indicates the K _D values of the D5 variant, "positively charged" refers to a K _D values of R5 variants.

From Table 8 and FIG. 4, the K _D values of R5 variants of the anti-lysozyme antibody, was lower than the K _D values of the wild-type. Further, _the K _D value of D5 mutants was higher than the K _D values of the wild-type. Therefore, it was found that, for the anti-lysozyme antibody, by mutating the five neutral amino acid residues of FR3 to basic amino acid residues, it is possible to produce an antibody with improved affinity to the antigen as compared to the wild type. In addition, it was found that by mutating the five neutral amino acid residues of FR3 to acidic amino acid residues, it is possible to produce an antibody having a reduced affinity for the antigen as compared to the wild type. These results were similar to the variant of anti-insulin antibody of Example 2. Thus, it is suggested that, in an antibody in which the electrical properties of the CDRs are neutral, the electrostatic interaction produced by the introduction of charged amino acid residues in FR3 enables the orientation control of the antigen binding site.

Example 6 Control of Affinity of Anti-HBsAg Antibody for Antigen
A mutation was introduced into FR3 of the anti-HBsAg antibody based on the electrical properties of the CDRs, and the affinity of the resulting mutant for lysozyme was confirmed.

(1) Electrical Properties of CDRs of Anti-HBsAg Antibody Mouse anti-HBsAg antibody according to the method described in Kohler and Milstein, Nature, vol. 256, p. 495-497, 1975, using recombinant HBsAg as an antigen The hybridoma which produces is produced. In the same manner as in Example 1, a plasmid DNA containing a gene of a wild-type anti-HBsAg antibody was obtained from the RNA of this hybridoma. Based on the nucleotide sequence of the gene, the amino acid sequence of the anti-HBsAg antibody was determined. It was found that the light chain and heavy chain CDRs defined by the Chothia method in the wild type anti-HBsAg antibody have two basic amino acid residues and ten acidic amino acid residues. Therefore, the electrical properties of the CDRs of the anti-HBsAg antibody are defined as negative charge (X = -8).

(2) Preparation of anti-HBsAg antibody mutant
In order to introduce a mutation into the light chain FR3 defined by the Chothia method, using the gene of the wild type anti-HBsAg antibody obtained in the above (1) and the primer represented by the following nucleotide sequence, in the same manner as in Example 1. PCR was performed.

[Primer for anti-HBsAg antibody]
D5 variant FOR: 5 'GGGACCGATTATGATCTCACAATCAGTCGAATGGAG 3' (SEQ ID NO: 24)
D5 variant REV: 5 'ATCC CCAT CGGCAT CGAACGAACAAGGGACTCCAGAAGC 3' (SEQ ID NO: 25)

  Using the obtained PCR product, in the same manner as in Example 1, a plasmid containing a gene encoding a mutant or wild-type light chain and a plasmid containing a gene encoding a wild-type heavy chain were obtained. . Using these plasmids, each antibody is expressed in Expi 293TM cells in the same manner as in Example 1, and the resulting culture supernatant is purified to obtain wild-type and D5 mutant anti-HBsAg antibodies, respectively. Solution was obtained. Here, the D5 variant of the anti-HBsAg antibody comprises the 63rd, 65th, 67th and 70th serine residues and the 72nd phenylalanine residue of the light chain FR3 defined by the Chothia method in the wild-type antibody. , And an aspartic acid residue.

(3) Measurement of the affinity of the variant for the antigen
(3.2) Immobilization of Capture Antibody In the same manner as in Example 2, except that a mouse anti-HBsAg antibody produced from a hybridoma different from the hybridoma obtained in (1) above was used as the capture antibody. The capture antibody was immobilized on each well of a plate (NUNC-immunomodule, Cat No. 469949, manufactured by NUNC). Also, as in Example 2, each well of the plate was blocked with a blocking solution (PBS containing 1% BSA).

(3.3) Primary reaction A HISCL (registered trademark) HBsAg calibrator (HBsAg concentration: 0.025 IU / mL, Sysmex Corporation) was used as an anti-HBsAg antibody antigen. The blocking solution was removed from the plate on which the capture antibody was immobilized, and 50 μL of the antigen solution was added to each well. The plate was shaken at room temperature for 60 minutes to carry out an antigen-antibody reaction.

(3.3) Secondary reaction and detection Wild type and D5 variants of anti-HBsAg antibody were used as detection antibodies. Each antibody was serially diluted in PBS containing 1% BSA to obtain antibody solutions at concentrations of 400 nM, 80 nM, 16 nM, 3.2 nM, 640 pM, 128 pM, 25.6 pM and 5.12 pM. In addition, HRP labeled anti-mouse IgG (Fc specific) antibody was used as a secondary antibody. Using these, an antigen-antibody reaction was carried out in the same manner as in Example 2. Then, the absorbance at 450 nm was measured for each well of the plate in the same manner as in Example 2 using 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) as a substrate solution.

(4) Results The dissociation constant (K _D ) was calculated from the measured values of ELISA using wild-type and D5 variants of anti-HBsAg antibody. The results are shown in Table 9 and FIG. In the figure, "negative charge" indicates the K _D values of D5 variants.

From Table 9 and Figure 5, is _the K _D value of D5 variants of the anti-HBsAg antibody was higher than _the K _D value of the wild-type. Further, _the K _D value of D5 mutants was higher than the K _D values of the wild-type. Thus, it was found that, for the anti-HBsAg antibody, by mutating the five neutral amino acid residues of FR3 to acidic amino acid residues, an antibody with reduced affinity for the antigen can be prepared as compared to the wild-type. These results were similar to the D5 and E5 mutants of the anti-TSHR antibody of Example 2. Thus, it is suggested that, in an antibody in which the electrical properties of CDRs are negatively charged, it is possible to reduce the affinity for the antigen by electrostatic repulsion generated by the introduction of acidic amino acid residues in FR3.

Claims (2)

In the antibody of negative charge, the electrical properties of the CDR based on the amino acid sequence of the complementarity determining region (CDR) are 63, 65, 67, 70 and 72 in the light chain of the antibody as defined by the Chothia method A method of reducing the affinity of an antibody for an antigen relative to an unmodified antibody by substituting the ath amino acid residue with an aspartic acid residue or a glutamic acid residue,
The 63rd, 65th, 67th, 70th and 72nd amino acid residues in the light chain of the unmodified antibody are neutral amino acid residues,
The method wherein the electrical properties of the CDRs are determined by the following formula (I):
X = [number of basic amino acid residues in amino acid sequence of CDR]-[number of acidic amino acid residues in amino acid sequence of CDR] ... (I)
Wherein the electrical properties of the CDRs are neutral when X is -1, 0 or 1.
When X is 2 or more, the electrical property of CDR is positive charge,
When X is -2 or less, the electrical properties of the CDRs are negative charges). In the antibody of negative charge, the electrical properties of the CDR based on the amino acid sequence of the complementarity determining region (CDR) are 63, 65, 67, 70 and 72 in the light chain of the antibody as defined by the Chothia method Substituting the ath amino acid residue with an aspartic acid residue or a glutamic acid residue;
And a step of recovering the antibody obtained in the substitution step, which is a method for producing an antibody whose affinity to an antigen is lower than that of an unmodified antibody,
The 63rd, 65th, 67th, 70th and 72nd amino acid residues in the light chain of the unmodified antibody are neutral amino acid residues,
The method according to claim 1, wherein the electrical properties of the CDRs are determined by the following formula (I):
X = [number of basic amino acid residues in amino acid sequence of CDR]-[number of acidic amino acid residues in amino acid sequence of CDR] ... (I)
Wherein the electrical properties of the CDRs are neutral when X is -1, 0 or 1.
When X is 2 or more, the electrical property of CDR is positive charge,
When X is -2 or less, the electrical properties of the CDRs are negative charges).