JP6782962B2 - TRPM8 activator, cooling sensitizer, cosmetics and oral composition - Google Patents

Description

The present invention relates to TRPM8 activators, cooling sensitizers, cosmetics and oral compositions.

To date, temperature-sensitive receptors, collectively referred to as the transient receptor potential (TRP) family, have been cloned from the peripheral nervous system. The TRP channel is extremely important for the reception of visual, taste, olfactory, auditory, tactile, warm, and various other physical and chemical stimuli in humans, rodents, birds, Drosophila, nematodes, zebrafish, etc. I have come to understand. In mammals, TRPV, TRPM, TRPA subfamilies and the like are known, and their activation temperature thresholds are widely distributed in a physiological temperature range that can be distinguished by humans.

TRPM8 is a cold stimulus receptor that is activated at about 8 to 28 ° C. (Non-Patent Document 1). Electrophysiological analysis in cells expressing TRPM8 revealed that TRPM8 is a Ca ²⁺ highly permeable non-selective cation channel. That is, when the ligand binds to the receptor TRPM8, the inflow of Ca ²⁺ passing through the channel is increased to cause depolarization of the membrane, and a feeling of coldness is given.

TRPM8 is also activated by menthol, which gives a feeling of coldness. Cooling substances are often blended in various products such as cosmetics, hair care products, toiletry products, bath salts, and pharmaceuticals for the purpose of giving a refreshing feeling during and after use, and as such a cooling substance. , Menthol is widely used. It is thought that the cooling sensation caused by menthol is caused by the direct action of menthol on the sensory nerve endings present in the skin and mucosal tissues. In addition to menthol, linalool, geraniol, hydroxycitronellal and the like are also known to activate TRPM8 (Non-Patent Document 2).

Himefuuro is a member of the family Geraniaceae, the genus Geraniaceae, and the Herb robert Geraniaceae L. Is. It is a plant with a height of about 10 to 50 cm that grows in limestone areas. It is found in several places such as Mt. Ibuki and Mt. Tsurugi in Japan, and is widely distributed in temperate regions worldwide. So far, Himefuuro has an anti-inflammatory effect (Patent Document 1), an NF-κB activation inhibitory effect (Patent Document 2), an active oxygen scavenging effect (Patent Document 3), a trypsin inhibitory effect (Patent Document 4), and the like. It is known that there is. However, until now, nothing is known about the cooling sensation effect of Himefuuro through the promotion of TRPM8 activity, and the cosmetics and oral compositions applying the cooling sensation of Himefuuro.

Neem is from the family Meliaceae, the genus Melia, Neem Melia azadirachta L. et al. (= Azadirachta indica Just.). It is an evergreen tree of the family Meliaceae that grows and grows naturally in tropical regions such as India, South Asia, Africa, and Central and South America, and grows up to 15 to 20 m. So far, neem has cyclooxygenase activity inhibitory action (Patent Document 5), anti-obesity action (Patent Document 6), acne prevention / improvement action (Patent Document 7), skin photoaging prevention action (Patent Document 8), and the like. It is known that there is. However, until now, nothing is known about the cooling sensation effect of neem through the promotion of TRPM8 activity, and the cosmetics and oral compositions to which the cooling sensation of neem is applied.

JP-A-2005-2057 JP-A-2005-194246 JP 2006-117612 JP 2006-182732 JP 2006-76910 JP-A-2007-91645 JP 2014-43397 JP 2015-86183

Makoto Tominaga, Physical Properties Research, 82, p82-89 (2004) Behrendt. H. J. et al, Br. J. Pharmacol. , 141, p737-745 (2004)

When a large amount of menthol is used, irritation to the skin and mucous membranes and a peculiar unpleasant pungent odor become problems, so that the amount of menthol used may be limited. In addition, the refreshing sensation exhibited by the compounds of linalool, geraniol, and hydroxycitronellal was not always sufficient.

An object of the present invention is to provide an excellent TRPM8 activator, cooling sensation agent, cosmetics and oral composition.

As a result of diligent studies to solve the above problems, the present inventors have found that the extracts of Himefuuro and Neem have an excellent TRPM8 activating effect, thereby imparting a good cooling sensation. The invention was completed.

That is, the present invention includes the following inventions.
(1) A TRPM8 activator characterized by containing an extract of herb robert and / or neem.
(2) A cooling sensation agent containing the agent according to (1).
(3) Cosmetics containing the agent according to (1).
(4) An oral composition containing the agent according to (1).

The extracts of Himefuuro and Neem of the present invention were excellent in the effect of promoting TRPM8 activity. The TRPM8 activator, which is characterized by containing this extract, can impart a good cooling sensation. Further, since the TRPM8 activator of the present invention contains a plant extract having a mild action as an active ingredient, it has no side effects and is highly safe. Therefore, it can be safely used for pharmaceuticals, quasi-drugs, cosmetics, and foods and drinks.

The Himefuuro used in the present invention is a plant of the genus Geraniaceae of the family Geraniaceae, Himefuuro (Geranium robertianum L.) (raw drug name: Byoukaquin (cat leg mark)). Part or whole grass of Himefuuro flowers, spikes, stems, leaves, branches, branches and leaves, roots, seeds, etc. can be used.

The neem used in the present invention is a plant belonging to the genus Melia of the family Melia azadillachta L. (= Azadillachta indica Just) (also known as neem, neem) (also known as neem, neem). Part or whole plants such as neem flowers, spikes, pericarp, pods, leaves, branches and leaves, bark, rhizomes, root bark, roots and seeds can be used.

The method for extracting Himefuuro and Neem of the present invention is not particularly limited, and may be, for example, heat-extracted or extracted at room temperature or low temperature. Examples of the solvent to be extracted include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol, propylene). Glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl, etc.) Ether, etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used alone or in admixture of two or more. Further, as the extract of Himefuuro and the extract of neem, commercially available products may be used.

The above extract may be used as it is in the extracted solution, or may be used after being concentrated, diluted, filtered, decolorized with activated carbon or the like, deodorized, or the like, if necessary. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze-drying and used as a dried product, or may be used after column purification and the like to concentrate or isolate the active ingredient. Is also good. The herb robert and neem used in the present invention are naturally derived plants, and the components extracted from the herb robert and neem are a mixture in which a large number of compounds having various structures are present at the same time. Therefore, it is difficult to clarify all the structures or properties of the contained components, and it is preferable to treat them as an extract.

The TRPM8 activator in the present invention means a preparation that increases the influx of Ca ²⁺ through the receptor TRPM8 to cause depolarization of the membrane. TRPM8 may be a receptor present on the surface layer of mammalian cells, preferably skin cells constituting the epidermis or dermis, and most preferably keratinocytes. The cells are preferably of human origin, but may be of any mammalian origin such as mice, rats, guinea pigs, rabbits, pigs and the like.

The cooling sensation agent in the present invention means a preparation that feels cold even though the temperature sensation threshold temperature rises due to the activation of TRPM8 and is not accompanied by an actual temperature decrease.

The cosmetics in the present invention include, for example, lotions, milky lotions, gels, beauty liquids, general creams, sunscreen creams, packs, masks, wash pigments, cosmetic soaps, foundations, whitewashes, bathing agents, body lotions, body shampoos, etc. Examples include hair shampoo, hair conditioner, scalp lotion, scalp cream, hair tonic, and hair restorer.

Examples of the oral composition in the present invention include dentifrices, mouthwashes, gingival massage creams and the like. Examples of foods and drinks include candies, gums, tablets, capsules, and beverages.

In order to use a TRPM8 activator, a cooling sensation agent, a cosmetic and an oral composition, which is characterized by containing an extract of herb robert and neem used in the present invention, it is usually used externally or internally, systemically or locally. Administered by use. The dose varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc., but is usually administered once to several times a day in the range of 1 mg to 1 g, preferably 20 mg to 200 mg per adult. Will be done. Since the dose varies depending on various conditions, an amount smaller than the above-mentioned administration range may be sufficient, or it may be necessary to administer beyond the above-mentioned range.

When administered by external use, it can be used for any of cosmetics, non-medicinal products and pharmaceuticals, and its dosage form includes, for example, skin external preparations (insect repellent spray, etc.), cleaning agents, lotions, milky lotions, shampoos. , Rinses, body lotions, etc. that are applied to the scalp and body. The above extract may be used as it is, and oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, and surfactants, which are components used for external preparations as long as the effects of the present invention are not impaired. It can also contain agents, metal soaps, pH regulators, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, chelating agents and the like.

When administered by internal use, it can be used for any of foods, quasi-drugs and pharmaceuticals. Various formulations can be selected, and examples thereof include toothpaste, liquid toothpaste, mouthwash, ointment, cream, oral gel, mouth spray, mouth rinse, and troche. Furthermore, the forms of ordinary pharmaceuticals such as powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids and emulsions, and the forms of foods such as candy, gum, tablets, capsules and beverages. Can also be adopted.

When the TRPM8 activator, cooling sensation agent, cosmetics and oral composition of the present invention are contained in a pharmaceutical product, they are mixed with pharmacologically and pharmaceutically acceptable additives and applied to the affected area. It can be formulated into various formulations in a suitable formulation form. Pharmacologically and pharmacologically acceptable additives include excipients, thickeners, tonicity agents, pH regulators, stabilizers, preservatives, and preservatives, depending on the dosage form and application. , Dispersants, emulsifiers, gelling agents, pigments, fragrances and the like can be used. A form suitable for the pharmaceutical product of the present invention is an external preparation, and examples thereof include ointments, creams, gels, liquids, and patches. The ointment refers to a homogeneous semi-solid external preparation, and includes an oily ointment, an emulsion ointment, and a water-soluble ointment. A gel agent refers to an external preparation in which a water-holding compound, which is a water-insoluble component, is suspended in an aqueous solution. The liquid agent refers to a liquid external preparation, and includes a lotion agent, a suspension agent, an emulsion, a liniment agent, and the like.

When the TRPM8 activator, cooling sensation agent, cosmetics and oral composition of the present invention are contained in a non-medicinal product or cosmetics, the dosage form is an aqueous solution type, a solubilizing type, an emulsifying type, a powder type, etc. Any of powder dispersion system, oil solution system, gel system, ointment system, aerosol system, water-oil two-layer system, water-oil-powder three-layer system and the like may be used. In addition, the quasi-drugs and cosmetics include TRPM8 activators, cooling sensitizers, cosmetics and oral compositions, as well as various components, additives, bases and the like usually used in external skin compositions. It can be selected according to the type, appropriately contained, and produced according to a method known in the art. The form may be any of liquid, emulsion, cream, gel, paste, spray and the like. Examples of the contained components include fats and oils (olive oil, palm oil, evening primrose oil, jojoba oil, castor oil, hardened castor oil, etc.), waxes (lanolin, beeswax, carnauba wax, etc.), hydrocarbons (liquid paraffin, squalane, etc.). Squalane, Vaseline, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol, etc.), esters (myristin) Isopropyl acid, isopropyl palmitate, cetyl octanate, glycerin trioctate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), organic acids (citrate, lactic acid, α-hydroxyacetic acid, pyrrolidonecarboxylic acid, etc.), sugars (Martitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and hydrolyzates of proteins, amino acids and their salts, vitamins, plant / animal extracts, various surfactants, moisturizers, Examples thereof include ultraviolet absorbers, antioxidants, stabilizers, preservatives, bactericides, and fragrances.

Next, in order to explain the present invention in detail, specific examples will be given. These examples specifically explain the effect and do not limit the scope of the invention. The content in the examples is% by weight.

[Example 1]
An extract of Himefuuro was produced as follows.
(Production Example 1) Preparation of hot water extract of Himefuuro (aboveground part) 50 mL of purified water is added to 5 g of the above-ground part of dried Himefuuro, extracted at 95-100 ° C. for 1 hour, filtered, and the filtrate is concentrated. , Freeze-dried to obtain 1.22 g of a hot water extract of Himefuuro (aboveground part).

(Production Example 2) 30% ethanol extract of Himefuuro (aboveground part) 50 mL of 30 (v / v)% ethanol was added to 5 g of the above-ground part of dried Himefuuro, extracted at room temperature for 5 days, filtered, and the filtrate was used. The mixture was concentrated to dryness to obtain 1.08 g of a 30% ethanol extract of Himefuuro (aboveground part).

(Production Example 3) 50% 1,3-butylene glycol extract of Himefuuro (aboveground part) After adding 50 mL of purified water and 50 mL of 1,3-butylene glycol to 5 g of the above-ground part of dried Himefuuro and extracting at room temperature for 7 days. , Filtration to obtain 89 g of 50% 1,3-butylene glycol extract of Himefuuro (aboveground part).

[Example 2]
An extract of neem was produced as follows.
(Production Example 4) Preparation of hot water extract of neem (leaves) 50 mL of purified water is added to 5 g of dried neem leaves, extracted at 95 to 100 ° C. for 1 hour, filtered, and the filtrate is concentrated and frozen. Drying gave 1.28 g of hot water extract of neem (leaves).

(Production Example 5) 30% ethanol extract of neem (leaves) 50 mL of 30 (v / v)% ethanol was added to 5 g of dried neem leaves, extracted at room temperature for 5 days, filtered, and the filtrate was concentrated and dried. Hardened to give 1.13 g of 30% ethanol extract of neem (leaves).

(Production Example 6) 50% 1,3-butylene glycol extract of neem (leaves) 50 mL of purified water and 50 mL of 1,3-butylene glycol were added to 5 g of dried neem leaves, extracted at room temperature for 7 days, and then filtered. Then, 85 g of 50% 1,3-butylene glycol extract of neem (leaf) was obtained.
[Example 3]
An experiment to evaluate the effect of the extracts of Himefuuro and Neem was carried out as follows.

(Test Example 1) Effect of Himefuuro and Neem extract on TRPM8 channel activity in human melanocytes In the test, human epidermal melanocytes expressing endogenous TRPM8 (Human Epidermal Melanocytes, normal neotal foreskin, Cell Applications) were used. .. The cells were seeded in 4 × 10 ⁴ cells on a 96-well plate for fluorescence measurement, and cultured in Medium 254 under the conditions of 37 ° C. and 5% CO ₂ for 24 hours. Then, 50, 100, 500 and 1000 μg / mL of Himefuuro extract (Production Example 3) and Neem extract (Production Example 6) were added, respectively, and 10 μM of l-menthol (Wako Pure Chemical Industries, Ltd.) was added as a comparative product. The TRPM8 channel activity was measured by quantifying the intracellular Ca ²⁺ concentration using Calcium Kit-Fluoro 4 (Dojin Chemical Laboratory). The excitation wavelength λ _ex and the fluorescence wavelength λ _em of the fluorescence plate reader are λ _ex = 490 and λ _em = 518.

The results of these tests are shown in Table 1. As a result, it was confirmed that the extracts of Himefuuro and Neem had the effect of activating the TRPM8 channel and increasing the feeling of coldness. The same effect was observed in the extract of Himefuuro (Production Examples 1 and 2) and the extract of neem (Production Examples 4 and 5).

(Test Example 2) Effect of Himefuuro and Neem extract on TRPM8 production in human melanocytes 1 × 10 ⁵ human epidermal melanocytes were inoculated on a 6-well plate and in Medium 254 under 37 ° C. and 5% CO ₂ conditions for 1 week. It was cultured. To the confluent cells, 500 and 1000 μg / mL of Himefuuro extract (Production Example 3) and Neem extract (Production Example 6), respectively, and 10 μM of l-menthol (Wako Junyaku) as comparison products were added. After culturing for 24 hours, total RNA was extracted. Extraction of total RNA from cells was performed using RNAiso plus (TAKARA), and the total amount of RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. SYBR Select Master Mix (Life Technologies) was used for the real-time RT-PCR method. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C: 15 seconds, 60 ° C: 30 seconds, 40 cycles) was performed. For other operations, the expression level of TRPM8 mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The TRPM8 expression level was calculated as the ratio of the expression level of TRPM8 mRNA in the sample addition group to the expression level of TRPM8 mRNA in the control. As the primers for TRPM8 and β-actin, those shown below were used.

Primer set for TRPM8 TATACAAAGCCTTCAGCACCA (SEQ ID NO: 1)
AATTCATCATCATTGGCTAAGTCC (SEQ ID NO: 2)

Primer set for β-actin CACTTTCCAGCCTTCCTTCC (SEQ ID NO: 3)
GTGTTGGGCGTACAGGTCTTG (SEQ ID NO: 4)

The results of these tests are shown in Table 2. As a result, it was confirmed that the extracts of Himefuuro and Neem had the effect of increasing the expression level of TRPM8 mRNA and increasing the feeling of coldness. The same effect was observed in the extract of Himefuuro (Production Examples 1 and 2) and the extract of neem (Production Examples 4 and 5).

[Example 4] Product formulation example The formulation example of the product containing the extracts of Himefuuro and Neem produced in Production Examples 1 to 6 is shown below.

(Prescription example 1) Lotion prescription content (% by weight)
1. 1. Hot water extract of Himefuuro (Production Example 1) 0.1
2.1,3-butylene glycol 8.0
3. 3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Fragrance 0.1
11. Remaining amount of purified water [Manufacturing method] After components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, both are mixed and filtered to obtain a product.

(Prescription example 2) Pack prescription content (% by weight)
1. 1. 30% ethanol extract of Himefuuro (Production Example 2) 0.1
2. Polyvinyl alcohol 12.0
3. 3. Ethanol 5.0
4.1,3-butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
7. Citric acid 0.1
8. Sodium citrate 0.3
9. Appropriate amount of fragrance 10. Remaining amount of purified water [Manufacturing method] Dissolve components 1 to 10 uniformly to obtain a product.

(Prescription example 3) Hair tonic prescription content (% by weight)
1. 1. 50% 1,3-butylene glycol extract of Himefuuro (Production Example 3) 2.0
2.95% ethanol 60.0
3. 3. Glycerin 2.0
4. Remaining amount of purified water [Manufacturing method] Dissolve component 1 in component 2, add components 3 and 4, and mix well with stirring to obtain a product.

(Prescription example 4) Hair lotion Prescription content (% by weight)
1. 1. Neem hot water extract (Production Example 4) 0.2
2. Stearic acid 5.0
3. 3. Cetyl alcohol 5.0
4. Liquid paraffin 2.0
5. Glycerin monostearate 1.3
6. Sorbitan Monooleate 1.5
7. Polyoxyethylene sorbitan monooleate (10E.О.) 0.8
8. Glycerin 6.0
9. Preservatives Appropriate amount 10. Remaining amount of purified water [Manufacturing method] Components 2 to 7 are heated and dissolved, mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 8 to 10 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the product is cooled while stirring.

(Prescription example 5) Shampoo prescription content (% by weight)
1. 1. 30% ethanol extract of neem (Production Example 5) 0.1
2. Alkylation Triethanolamine 18.0
3. 3. Lauric acid diethanolamide 3.0
4. Methyl cellulose 0.5
5. Appropriate amount of fragrance 6. Remaining amount of purified water [Manufacturing method] After uniformly dissolving component 4 in component 6, add components 1 and 2, heat-dissolve at 70 to 75 ° C., add component 3, add component 5 during cooling, and add component 5. Cool to 30 ° C to make a product.

(Prescription example 6) Body shampoo Prescription content (% by weight)
1. 1. 50% 1,3-butylene glycol extract of neem (Production Example 6) 0.2
2. Stearic acid 10.0
3. 3. Palmitic acid 8.0
4. Myristic acid 12.0
5. Lauric acid 4.0
6. Oleyl alcohol 1.5
7. Purified lanolin 1.0
8. Coconut oil fatty acid diethanolamide 1.0
9. Glycerin 10.0
10. Potassium hydroxide 6.0
11. Appropriate amount of fragrance 12. Preservatives Appropriate amount 13. Appropriate amount of sequestrant 14. Remaining amount of purified water [Manufacturing method] Components 2 to 5 are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Component 10 is dissolved in an appropriate amount of component 14 and added to the oil phase for saponification. Subsequently, components 6 to 9 are added to the saponified product, and component 1, components 11 to 13 and the remaining component 14 are further added at room temperature to prepare a product.

(Prescription example 7) Bath agent Prescription content (% by weight)
1. 1. 50% 1,3-butylene glycol extract of Himefuuro (Production Example 3) 5.0
2. 50% 1,3-butylene glycol extract of neem (Production Example 6) 5.0
3. 3. Sodium bicarbonate 50.0
4. Yellow No. 202 Appropriate amount 5. Appropriate amount of fragrance 6. Anhydrous sodium sulfate Remaining amount [Manufacturing method] Ingredients 1 to 6 are uniformly mixed to prepare a product.

(Prescription example 8) Toothpaste prescription content (% by weight)
1. 1. Calcium hydrogen phosphate 22.0
2. Sodium lauryl sulfate 1.5
3. 3. Tranexamic acid 0.01
4. β-glycyrrhetinic acid 0.2
5. Isopropylmethylphenol 0.1
6. Cetylpyridinium chloride 0.05
7. Hot water extract of Himefuuro (Production Example 1) 0.001
8. Glycerin 20.0
9. Carrageenan 0.9
10. Saccharin sodium 0.001
11. Fragrance 1.0
12. Sodium benzoate 0.5
13. Remaining amount of purified water [Manufacturing method] After the components 3 to 13 are mixed well, the components 1 and 2 are added and kneaded, and after defoaming, the tube is filled to obtain a product. Use 1g at a time, 3 times a day.

(Prescription example 9) Mouthwash prescription content (% by weight)
1. 1. Ethanol 20.0
2. Neem hot water extract (Production Example 4) 0.01
3. 3. Glycerin 10.0
4. Saccharin sodium 0.1
5. Fragrance 0.1
6. Polyoxyethylene hydrogenated castor oil (60EO) 1.5
7. Ethyl paraoxybenzoate 0.1
8. Remaining amount of purified water [Manufacturing method] Component 2 is dissolved in component 1 (composition A). Then, the components 3 to 7 are dissolved in the component 8 (composition B). The composition A and the composition B are well mixed to obtain a product. Use 10 mL at a time, 3 times a day.

(Prescription example 10) Tablet prescription content (% by weight)
1. 1. Hot water extract of Himefuuro (Production Example 1) 0.005
2. Neem hot water extract (Production Example 4) 0.005
3. 3. Erythritol 60.4
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Fragrance 0.1
7. Maltitol Remaining amount [Manufacturing method] Ingredients 1 to 4 and 7 are mixed, and 10% water is added as a binder to form a fluidized bed. Ingredients 5 and 6 are added to the molded granules, mixed, and locked to obtain a product. Ingest 2 g of 1 tablet and 6 tablets daily so as to dissolve in the oral cavity.

The TRPM8 activator, cooling sensation agent, cosmetics and oral composition characterized by containing the extracts of herb robert and neem according to the present invention have an excellent TRPM8 activating effect, thereby being good. It has the effect of giving a feeling of coldness. Therefore, Himefuuro and Neem can be used in the fields of manufacturing pharmaceuticals, quasi-drugs, cosmetics and foods and drinks for the purpose of giving a refreshing sensation to the skin, hair, oral cavity, etc. by promoting TRPM8 activity.

Claims (2)

A TRPM8 activator characterized by containing an extract of herb robert and / or neem. A cooling sensation agent containing the agent according to claim 1.