JP6536961B2 - Method for producing fish gametes for cultured fish production using surrogate parent fish, which is applicable to parent species of another genus fish species - Google Patents

Description

  The present invention relates to a method for producing fish gametes (sperm and eggs) for cultured fish production using surrogate parent fish, which is applicable to surrogate parent fish of other genus fish species, and in particular, for producing such cultured fish In a method of producing fish gametes of the present invention, a donor fish species which can not be a surrogate parent of the donor fish species with respect to a donor fish species supplying isolated germ cells for producing a target fish gamete By making it a hybrid with a fish species that can be a surrogate parent of the fish, it becomes possible to apply as a surrogate parent fish to other species that can not be a surrogate parent of the donor fish species originally, and the fish used as a surrogate parent fish Fish which enables practical use as a method of producing fish gametes for producing cultured fish, by enabling selection of surrogate parent fish having practically advantageous characteristics adapted to breeding, etc., by expanding the scope of application of species Provide a gamete production method Bet on.

  In recent years, the catch of natural fishery resources has been gradually decreasing, and the ratio of aquaculture production to the total catch has been greatly increased. On the other hand, in the case of marine fish aquaculture, there are still many cases where natural seedlings are often trained to the size of products. For this reason, with the growing importance of resource management, the introduction of complete aquaculture is strongly demanded.

  With complete aquaculture, seedlings are artificially produced from the fertilized eggs of the target fish species, the obtained artificial seedlings are distributed as products, and some of the obtained artificial seedlings are trained to the parent fish, It refers to an aquaculture style that is completed independently of natural resources, producing gametes (sperm and eggs) and using the obtained gametes for aquaculture. In order to realize complete aquaculture, it is first necessary to obtain sufficient gametes from the parent fish of the target fish in quality and quantity for seedling production. In order to obtain sufficient gametes for seedling production, a breeding facility sufficient for maintaining parent fish and breeding with appropriate feed and induction of oviposition are indispensable, and a lot of space and labor are required. Therefore, it can be said that there are few fish species whose use for seedling production has been established so that at least many fish farmers can easily introduce them.

  As a technique capable of solving this problem, attention has been focused on a fish gamete production technique necessary for seedling production using surrogate parent fish, that is, surrogate parent fish technique. This technique is exemplified by the target fish species for which gametes are to be obtained as donors, the fish species for which gametes are intended to be produced as recipients, and primordial germ cells, spermatogonia or oogocytes of donors. Undifferentiated germ cells are transplanted to the recipient and the recipient is used as a surrogate parent fish. This surrogate parent fish technique is, in other words, a technique for producing a gamete of a donor by producing or differentiating donor germ cells in the recipient's gonads, and creating a next generation individual population of the donor. In fish, male gametes are motile and are called sperm, while female gametes are not motile and are called eggs. In the surrogate parent fishery technique, when it is intended to obtain spermatozoa, the recipient's germ cells are transplanted into a male recipient, while when it is sought to obtain eggs, the recipient's recipient's germ cells are sought. Port.

In the surrogate parent fish technique, donor separated germ cells, which are germ cells derived from fish that are different or different from the host (recipient) fish, have been previously prepared by the present inventors into the abdominal cavity of the host fish before and after hatching. It is possible to induce differentiation of germ cells to germline by transplanting them into host fish individuals by transplanting the host fish, that is, isolated germ cells derived from vertebrates such as fish, before and after hatching of host vertebrates. It has been found that it is possible to induce differentiation of said germ cells to germline by transplantation into fish individuals, and a method for inducing germline differentiation of separated germ cells by heterologous or heterologous host fish Patent No. 4,300,287. In the non-patent literature Fisheries for Global Welfare and Environment, 5th World Fisheries Congress 2008 (2008) p209-219, the donor Yamame (masu
The next generation of the trout, which uses the trout as a substitute parent fish, to obtain trout eggs and spermatozoa by transplanting the spermatogonial cells of salmon, Oncorhynchus masaou) into the recipient male and female trout (rainbouw traut, Oncorhynchus mykiss) It has been reported how to create

  In the method disclosed above, the host (recipient) fish produces gametes (sperm and / or eggs) derived from the donor, and also produces its own gametes (sperm and / or eggs) derived from the host (recipient) Therefore, in order to specifically form and separate the gamete (sperm and / or egg) derived from the donor, an operation of selecting the both is required, which is a problem in practical use. For example, as a donor fish species, when differentiation is induced to germline by using spermatozoa or oogocytes of yamame trout as recipients, picking yamatome spermatozoa from a large number of rainbow trout spermatozoa It is difficult to pick and choose sage eggs from a large number of rainbow trout eggs, and there remains a problem as an industrial application technology that requires mass production of only donor fish species.

  Therefore, in order to solve this problem, the present inventors create a triploid fish species of a host fish species, infertize the fish species, and substitute the triploid fish species for parent fish technology. By using the host (recipient), a method for suppressing the formation of germ cells of the host (recipient) itself was constructed and disclosed (Japanese Patent No. 4581083). Non-patent document Science Vol. 317 (2007) p1517 is used to produce triploid rainbow trout to obtain an infertility substitute parent fish from which rainbow trout-derived sperm and eggs are not produced, and this infertility substitute parent fish is a germline yamame germline There is a report of a method of efficiently obtaining Yamame spermatozoa and eggs by transplanting and producing the next generation individual of Yamame.

  However, in the alternative parent fish technology so far, fish species available as substitute parent fish are limited to fish species close to donors, and fish species to which the alternative parent fish technology can be applied are limited. For example, in Non-Patent Document Fisheries Science Vol. 317 (2011) p. 60-77, when yellowtail spermatogonia were transplanted to nibes, although they were incorporated into the nibe gonads, they did not lead to the production of gametes. It is described. Also, in Non-Patent Document Biology of Reproduction Vol. 82 (2010) p. 896-904, Nive germ cells are taken up and proliferated in the mackerel gonads when semioprogenitor cells of Nibe are transplanted to the mackerel. It is also confirmed that it did not lead to the production of gametes.

  In formation of a donor-derived gamete (sperm and / or egg) by surrogate parent fish technology, for example, from a practical viewpoint, a large fish gamete (sperm and / or egg) can be There is a need to form as a surrogate parent, and in many such cases the choice of surrogate parent beyond the genus to which the fish species belongs is required. However, in many cases, for donor fish species, surrogate parent fish beyond the genus become surrogate parent fish because isolated germ cells of the donor fish species do not engraft in the germline of the surrogate parent fish. There is a problem that you can not Therefore, in order to respond to the practical demands of the use of surrogate parent fish technology, the development of surrogate parent fish technology that enables the use of surrogate parent fish beyond the range of genera etc. for donor fish species is an issue .

Patent No. 4300287 gazette Patent No. 4581083

Fisheries for Global Welfare and Environment, 5th World Fisheries Congress 2008 (2008) p209-219 Science Vol. 317 (2007) p1517 Fishories Science Vol. 317 (2011) p. 60-77 Biology of Reproduction Vol. 82 (2010) p. 896-904

  The subject of the present invention is the technology of a method of producing fish gametes (sperm and eggs) for producing cultured fish using surrogate parent fish, which enables application to surrogate parent fish such as other genus fish species, and it is originally a donor fish It is possible to use a fish species that can not be a surrogate parent of a species as a surrogate parent of a donor fish species, and expand the range of fish species that can be a surrogate parent, and for practical use of this technology, such as breeding It is an object of the present invention to provide a method for producing fish gametes (sperm and eggs) for cultured fish production using surrogate parent fish by selecting and applying a suitable alternate parent.

  In order to solve the above problems, the present invention provides a separated germ cell donor for a fish species used as a surrogate parent fish in a method for producing fish gametes (sperm and eggs) for producing cultured fish using a surrogate parent fish. A proxy that combines the ability of being able to be a surrogate parent (a fish species capable of engrafting undifferentiated germ cells) to a fish species and the ability to be a breeding parent fish that is an easy breeding fish species etc. In the diligent study on the selection of parents, with respect to donor fish species such as other genus fish species, a fish species which can not be a surrogate parent of the donor fish species can be a fish species which can be a surrogate parent of a donor fish species. It has been found that by hybridizing, it is possible to impart the ability to become a surrogate parent fish even to other genus fish species that can not become a surrogate parent of the donor fish species. By the formation of the hybrid, the range of selection of surrogate parent fish can be extended to fish species of other genera which can not originally become surrogate parent fish of the donor fish species. It has been found that use can be made, and the present invention has been made. The method of the present invention makes it possible, for example, to select small fish species of other genera which are easy to breed as a surrogate parent of a donor fish species of large fish such as tuna, and to produce cultured fish using the surrogate parent fish The present invention has come to provide a practical application method as a method for producing fish gametes (sperm and eggs).

That is, the present invention uses a recipient fish, and uses a surrogate parent fish including transplantation of isolated germ cells of fish of different lineage or heterogeneity to the recipient fish into recipient fish and induction of differentiation into germ line. In the method of producing gametes of
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
(E) using the hybrid fish species produced in (D) as a recipient and transplanting the separated germ cells of the donor fish species to induce differentiation into the germ line,
And methods for producing fish gametes using surrogate parent fishes.

  In the method of producing gametes of fish using the surrogate parent fish of the present invention, it is possible to use fish species such as other genus fish species which can not originally be a surrogate parent of a donor fish species as a surrogate parent of a donor fish species By expanding the application range of fish species, the selection range of easy substitute parent fish such as rearing can be expanded as substitute parent fish, and it is practically suitable as a method of producing fish gametes for cultured fish production It becomes possible to provide a method for producing fish gametes.

  In the method for producing fish gametes using the surrogate parent fish of the present invention, examples of fish gametes include sperm or eggs of donor fish species. In the method for producing fish gametes using the surrogate parent fish of the present invention, the first fish species that can be surrogate parent fish for the donor fish species is the gonads of isolated germ cells of the transplanted donor species. As fish of the second fish species that can not be substitute parent fish for the donor fish species, the gonads of isolated germ cells of the transplanted donor fish species can be mentioned. The fish of the fish species which do not have the survival ability of

  In the method of producing gametes of fish using the surrogate parent fish of the present invention, as fish of the first fish species that can be surrogate parent fish for the donor fish species, fish of the same species as the donor fish species As fish of the second fish species that can be mentioned and can not be surrogate parent fish for the donor fish species, fish of fish species different from the donor fish species can be mentioned. In the method for producing fish gametes using the surrogate parent fish of the present invention, examples of genera of donor fish species include the genus Irana, the genus Bry or the genus Tuna.

  In the method for producing fish gametes using the surrogate parent fish of the present invention, a hybrid fish species having the ability to become a surrogate parent fish for a donor fish species is the first to be a surrogate parent fish for a donor fish species. It is preferred to have the genome of the fish species at half or less per cell, and more preferably to have the genome of the first fish species capable of becoming a surrogate parent to the donor fish species at 1/3 or less per cell. By setting the genome of the first fish species that can be surrogate parent fish to the donor fish species to the above range per cell, the surrogate parent fish for the donor fish species while preserving the breeding characteristics of the fish of the second fish species The ability to become a surrogate parent fish of the first fish species that can be can be introduced to confer on the donor fish species the ability to become a surrogate parent fish.

  In the method for producing fish gametes using the surrogate parent fish of the present invention, a hybrid fish species capable of becoming a surrogate parent fish for a donor fish species is produced as a heteroploid gamete from the hybrid fish species Can be produced as a hybrid fish species of infertility. As heteroploidy of hybrid fish species having the ability to become a surrogate parent fish for the donor fish species, infertile hybrid fish species in which sperm and eggs from the hybrid fish species are not produced are hybrid species of triploid hybrid fish species Can be mentioned.

The present invention relates to a method for producing a hybrid fish as a recipient,
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
And methods of producing hybrid fishes.

  In addition, the present invention substitutes recipient fish into recipient fish and transplants the separated germ cells of fish species different from or different from the recipient fish into recipient fish to induce differentiation into germ line. In a method of inducing differentiation of germ cells into germline differentiation of fish using parent fish, transplanting and differentiation induction of isolated germ cells of donor fish species using the above-produced hybrid fish species as recipient fish The present invention includes the invention of a method for inducing differentiation of germ cells to germ line differentiation of fish using a surrogate parent fish as characterized.

That is, the present invention is as follows.
[1] A fish using a surrogate parent fish, which comprises using recipient fish and transplanting isolated germ cells of a fish of different lineage or heterogeneity with the recipient fish to the recipient fish to induce differentiation into germ line. In the production of gametes of
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
(E) using the hybrid fish species produced in (D) as a recipient and transplanting the separated germ cells of the donor fish species to induce differentiation into the germ line,
Method of producing gametes of fish using surrogate parent fishes including.
[2] The method for producing fish gametes using the surrogate parent fish according to the above-mentioned [1], wherein the gamete of the fish is a donor fish species sperm or egg.
[3] A fish of the first fish species that can be a surrogate parent fish for the donor fish species is a fish of a fish species having the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species, the donor fish It is characterized in that the fish of the second fish species which can not be a substitute parent fish for the species is a fish of a fish species which does not have the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species The gamete production method of the fish using the substitute parent fish as described in said [1] or [2].
[4] The fish according to any one of the above [1] to [3], characterized in that the fish of the first fish species that can be surrogate parent fish to the donor fish species is of the same genus as the donor fish species. Method for producing fish gametes using surrogate parent fish.
[5] A fish of a second fish species which can not be a surrogate parent to a donor fish species, which is different from the donor fish species, according to any one of the above [1] to [4] Method for producing fish gametes using surrogate parent fish as described.
[6] The method for producing gametes of fish using a surrogate parent fish according to any one of the above-mentioned [1] to [5], wherein the donor fish species is the genus Iguana, the genus Bri or tuna.
[7] A hybrid fish species capable of becoming a surrogate parent to a donor fish species is characterized by having at most half or less the genome of the first fish species capable of being a surrogate parent to the donor fish species. The method for producing gametes of fish, which uses the surrogate parent fish according to any one of the above [1] to [6].
[8] A hybrid fish species having the ability to be a surrogate parent to a donor fish species having the genome of the first fish species capable of being a surrogate parent to the donor fish at 1/3 or less per cell A method for producing gametes of fish using the surrogate parent fish according to any one of the above [1] to [7], characterized in that
[9] A hybrid fish species capable of becoming a parent parent to a donor fish species is characterized as being heteroploid and an infertile hybrid fish species in which gametes derived from the hybrid fish species are not produced. The production method of the gamete of the fish using the substitute parent fish in any one of said [1]-[8].
[10] A hybrid fish species capable of becoming a surrogate parent to a donor fish species is allopolyploid, and infertile hybrid fish species in which sperm and eggs are not produced from the hybrid fish species are triploid. A method for producing gametes of fish using the surrogate parent fish according to any one of the above [1] to [9], which is characterized in that
[11] In a method of producing hybrid fish as a recipient,
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
How to produce hybrid fish including
[12] A fish of the first fish species that can be a surrogate parent fish for the donor fish species is a fish of a fish species having the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species, the donor fish It is characterized in that the fish of the second fish species which can not be a substitute parent fish for the species is a fish of a fish species which does not have the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species The method of producing a hybrid fish according to the above [11].
[13] The hybrid fish according to the above [11] or [12], wherein the fish of the first fish species that can be surrogate parent fish for the donor fish species is of the same genus as the donor fish species. How to make.
[14] A fish of a second fish species which can not be a surrogate parent to a donor fish species is characterized by being different from the donor fish species, according to any one of the above [11] to [13] Method of producing hybrid fish described.
[15] The method for producing a hybrid fish according to any one of the above-mentioned [11] to [14], wherein the donor fish species is a genus of the genus Iwana, a genus of yellowtail or a tuna.
[16] A hybrid fish species capable of being a surrogate parent to a donor species is characterized by having at most half or less the genome of the first fish species capable of being a surrogate parent to the donor species. The method for producing a hybrid fish according to any one of the above [11] to [15]. [17] A hybrid fish species capable of being a surrogate parent to a donor fish species having less than or equal to 1/3 of the genome of the first fish species capable of being a surrogate parent to the donor fish species per cell The production method of the hybrid fish as described in any one of said [11]-[16] characterized by the above-mentioned.
[18] A hybrid fish species capable of becoming a parent parent to a donor fish species is characterized as being heteroploid and an infertile hybrid fish species in which gametes derived from the hybrid fish species are not produced. The production method of the hybrid fish using the substitute parent fish in any one of said [11]-[17].
[19] A hybrid fish species capable of becoming a surrogate parent to a donor fish species is allopolyploid, and infertile hybrid fish species in which sperm and eggs from the hybrid fish species are not produced are triploid. The method for producing a hybrid fish according to any one of the above [11] to [18], which is characterized in that
[20] Using a recipient fish, using a surrogate parent fish, which transplants the separated germ cells of donor fish species of different or different species from the recipient fish into the recipient fish and induces differentiation into germ line, In the method for inducing differentiation of germ cells of the isolated fish into germ line, using the hybrid fish species produced by any of the above [11] to [19] as recipient fish, isolated germ cells of donor fish species A method for inducing differentiation of germ cells into germline of isolated fish using a surrogate parent fish, which comprises transplanting and differentiation induction.
[21] A hybrid fish produced by the method according to any one of the above [11] to [19].
[22] An egg or sperm of a donor fish species produced by the method of producing gametes of fish using the surrogate parent fish according to any one of the above [1] to [10].
[23] Seedlings for aquaculture of donor fish species produced from eggs or sperm of the donor fish species described in the above [22].
[24] An adult donor fish species obtained by cultivating the culture seedling of the donor fish species described in [23] above.
[25] A fish using a surrogate parent fish, which comprises using recipient fish and transplanting isolated germ cells of a fish of different lineage or heterogeneity with the recipient fish to the recipient fish to induce differentiation into germ line. In the method of producing transplanted fish of
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
(E) transplanting the separated germ cells of the donor fish species with the hybrid fish species produced in (D) as a recipient;
Method of producing transplanted fish using surrogate parent fishes including
[26] A fish of the first fish species that can be a surrogate parent fish for the donor fish species is a fish of a fish species having the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species, the donor fish It is characterized in that the fish of the second fish species which can not be a substitute parent fish for the species is a fish of a fish species which does not have the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species The manufacturing method of the transplanted fish using the substitute parent fish as described in said [25].
[27] The surrogate parent fish according to the above [25] or [26], which is characterized in that the fish of the first fish species that can be surrogate parent fish for the donor fish species is of the same genus as the donor fish species. Production method of transplanted fish used.
[28] Any of the above-mentioned [25] to [27], wherein the fish of the second fish species which can not be substitute parent fish for the donor fish species is different from the donor fish species Method for producing transplanted fish using the surrogate parent fish described above.
[29] The method for producing a transplanted fish using a surrogate parent fish according to any one of the above-mentioned [25] to [28], wherein the donor fish species is the genus Iwana, yellowtail or tuna.
[30] A hybrid fish species capable of being a surrogate parent to a donor species is characterized by having less than half the genome of the first fish species capable of being a surrogate parent to the donor species per cell. The method for producing transplanted fish using the surrogate parent fish according to any one of the above [25] to [29].
[31] A hybrid fish species having the ability to be a surrogate parent to a donor fish species having the genome of the first fish species capable of being a surrogate parent to the donor fish at 1/3 or less per cell The manufacturing method of the transplanted fish using the substitute parent fish in any one of said [25]-[30] characterized by the above-mentioned.
[32] A hybrid fish species capable of becoming a surrogate parent to a donor fish species is characterized as being heteroploid and infertile hybrid fish species in which gametes derived from the hybrid fish species are not produced. The manufacturing method of the transplanted fish using the substitute parent fish in any one of said [25]-[31].
[33] A hybrid fish species capable of becoming a surrogate parent to a donor fish species is allopolyploid, and infertile hybrid fish species in which sperm and eggs from the hybrid fish species are not produced are triploid. The manufacturing method of the transplanted fish using the substitute parent fish in any one of said [25]-[32] characterized by a certain thing.
[34] A transplanted fish obtained by the method according to any one of the above [25] to [33].
[35] A gamete obtained from a transplanted fish obtained by the method according to any one of the above [25] to [33].
[36] Seedlings for aquaculture produced from the gametes described in the above [35].
[37] An adult donor fish species obtained by cultivating the culture seedling described in the above [36].

  In conventional proxy parent fish technology, fish species that can be used as proxy parent fish are limited to fish species that are closely related to donors, and fish species to which proxy parent fish technology can be applied have been limited. It was difficult to use substitute parent fish such as other genus fish species that require the use of substitute parent fish such as other genus fish species easy to breed. The present invention makes it possible to use for alternative parent fish such as other genus fish species, and it is possible to use easy fish species such as breeding of other genera as recipients in substitute parent fish technology, so a wide range of recipes It is possible to select a suitable fish species as an entity, and to provide technology for practical use as a method of producing fish gametes (sperm and eggs) for cultured fish production using surrogate parent fish did.

The present invention uses a recipient fish, and uses a surrogate parent fish including transplanting isolated germ cells of a fish different or different from the recipient fish into the recipient fish to induce differentiation into germ line. In the method of producing fish gametes,
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
(E) As a recipient, the hybrid fish species produced in (D) are transplanted with separated germ cells of the donor fish species to induce differentiation into germ line, and fish breeding using a surrogate parent fish Includes methods of producing offspring.

  The surrogate parent fish technique in the present invention uses a target fish species to obtain gametes (sperm and eggs) as a donor, a fish species to produce gametes as a recipient, primordial germ cells of the donor, and spermatozoa. Transplanted undifferentiated germ cells exemplified by protoplasts or oogocytes into a recipient to create a transplanted fish into which the undifferentiated germ cells have been transplanted, and in the gonads of the transplanted fish (recipient) And obtaining a gamete derived from the donor in the body of the transplanted fish (recipient) by engrafting, proliferating and differentiating the undifferentiated germ cells of the donor, and obtaining the seedling to be the offspring of the donor.

  In the method of producing fish gametes using the surrogate parent fish of the present invention, spermatozoa or eggs are produced as gametes. When sperm is to be obtained, donor germ cells are transplanted into a male recipient, and when eggs are to be obtained, donor germ cells are transplanted into a female recipient. As gonads, testis can be used to obtain sperm, and ovaries can be used to obtain eggs. Germ cells of a donor transplanted into a male recipient can produce donor sperm by proliferating and differentiating in the recipient's testis. Germ cells of donors transplanted into female recipients can produce donor eggs by proliferating and differentiating within the recipient's ovaries. The sperm or egg thus obtained can be obtained as a fertilized egg by cross-linking each other, or by cross-linking the separately obtained egg and sperm. By generating the obtained fertilized eggs, it is possible to obtain the seed and seedlings of the target fish species.

  As a donor, fish intended for aquaculture can be appropriately selected. For the purpose of aquaculture, various fish species for aquaculture purpose such as food fish species, fish species for collecting materials, and ornamental fish species can be selected as donors. Examples of edible fish species for aquaculture purpose include salmonids such as the genus Iwana, horse mackerel such as yellowtail and the family mackerel such as tuna, among which the donor fish species include the genus IWan and yellowtail Or a tuna edible fish can be mentioned.

  In the method of producing fish gametes using the surrogate parent fish of the present invention, the undifferentiated germ cells of the donor used in the surrogate parent fish technique include primordial germ cells obtained from the gonads before sexual differentiation and seminal cells obtained from the testis Progenitor cells, ooprogenitor cells obtained from ovaries, etc. are included. These undifferentiated germ cells can be used in combination with cells of different differentiation stages, or cells of the same differentiation stage alone.

  In order to obtain an undifferentiated germ cell from a donor, it can be collected from a donor tissue according to the differentiation stage of the target undifferentiated germ cell by a conventional method. For example, by removing the gonad before sexual differentiation from a donor or a tissue after sexual differentiation, such as testis or ovary, and dispersing it from the tissue into individual cells by physical exfoliation or treatment with a proteolytic enzyme, etc. Undifferentiated germ cells can be obtained. The dispersed individual cells can be isolated, for example, using a marker antibody or using a cell sorter.

  Undifferentiated germ cells can be obtained from frozen bodies or living individuals. In order to increase the success rate of surrogate parent technology, it is preferable to obtain undifferentiated germ cells from a living individual. As the frozen body, one obtained by freezing any unit of an individual, an organ and a cell may be used. When freezing cells, it is preferable to carry out using a suitable lyoprotectant. Suitable lyoprotectants include 0.1 wt% to 10 wt% glucose or trehalose, or 0.1 mol / l to 20 mol / l dimethylsulfoxide (DMSO), ethylene glycol or propylene glycol These lyoprotectants can be used alone or in combination of two or more.

  The step of collecting primordial germ cells preferably comprises confirming that the obtained cells are primordial germ cells, using markers of primordial germ cells. Markers applicable to the identification of primordial germ cells include the Vasa gene, the CD205 gene, and the like. The confirmation can be performed by confirming the expression, modification, localization or a combination of two or more of the gene or gene product.

  In order to confirm the expression of a gene, it is convenient to confirm mRNA transcribed from a specific gene by PCR (polymerase chain reaction). For gene expression and localization, it is convenient to confirm RNA transcribed from a specific gene using in situ hybridization. The expression, modification and expression of a gene product can be conveniently confirmed by using an antibody specific for the gene product which is obtained from a specific gene and translated.

  When donor cells are introduced into a recipient, it is preferable to introduce them into embryo or larval stage individuals before the recipient's immune system works sufficiently. The introduction can be performed using a manipulator such as a micromanipulator, an electric knife, a laser knife or the like. The introduction may be to any tissue or site of the recipient, and the tissue or site to be introduced includes, for example, the epidermis or the abdominal cavity. There is no restriction | limiting in particular as a cell number at the time of introduce | transducing into the embryo or larval stage individual, For example, 1 to 100,000 cells can be introduce | transduced.

  Confirmation of engraftment in the recipient gonads of donor germ cells can be performed using an index that can distinguish between donor cells and recipient cells. Examples of usable indexes include genes, antibodies, fluorescent dyes and the like, and these indexes can be used alone or in combination of two or more. Examples of the gene serving as an indicator include genes expressed in undifferentiated germ cells, and examples include the vasa gene, dead-end gene and the like. As a fluorescent dye used as a parameter | index, PKH26, CFSE etc. can be mentioned.

  When using a gene, PCR is performed by designing a primer using a site where the sequence differs between the donor and the recipient among the sequences of the index gene, or using a site where the sequence differs between the donor and the recipient It is convenient to confirm using in situ hybridization. Engraftment can be confirmed under a fluorescent microscope by labeling donor germ cells with a fluorescent dye prior to introduction. The confirmation of engraftment can be performed immediately after the introduction, and preferably, it should be performed 7 days or more after the introduction to confirm that the engraftment to the recipient and the cells are functioning. it can. It is expected that donor sperm or eggs will be obtained from an individual who has observed engraftment in the recipient's gonad 7 days after the introduction.

  In the present invention, a hybrid means an individual having a combination of genomes derived from different varieties, strains or species in cells, and the hybrid is prepared by hybridization, cell fusion or gene transfer, or a combination of two or more of these. Contains the individual who has been In fish, different reproductive populations, which are biologically isolated by their habitat, etc., are recognized as different breeds, strains, or biological species, but hybridization between reproductive populations occurs in close areas of different reproductive population distributions, and hybrids May occur. However, in a natural environment, it is not well known when hybridization occurs and hybrids can be obtained, and hybrids are exclusively artificially produced. Even when artificially producing and maintaining varieties and lines, hybrids can be artificially produced similarly.

  In the case of producing individuals as hybrids by hybridization, individuals of different breeds, strains or biological species can be multiplied to obtain hybrids.

  In particular, when hybrids are produced by crossbreeding xenogeneic hybrids, fertilized eggs are produced by bringing the eggs of one species obtained by artificial breeding or natural collection into contact with the sperm of the other species, By hatching the obtained fertilized eggs, interspecies hybrids can be produced. At this time, when the egg to be fertilized is artificially doubled and brought into contact with the sperm of the other species, the obtained interspecies hybrid becomes heteroploid. Allopolyploid individuals are less likely to make their own eggs or sperm and are particularly preferred for use as recipients. Examples of polyploids include diploids, triploids, tetraploids and the like, and any of these polyploids can be used.

  As a method to artificially multiply the eggs to be fertilized, polar body release is suppressed by using a cell division inhibitor, electrical stimulation, light stimulation or thermal stimulation, pressure stimulation, or a combination of two or more of them during fertilization. Methods can be used. For example, colchicine can be used as a cell division inhibitor. In addition, a tetraploid can be produced as a polyploid, and this can be multiplied with a diploid individual to produce a triploid.

  When producing a hybrid by cell fusion, a method of fusing eggs or dissociated embryonic cells of different species can be used. For cell fusion, a method of direct cell fusion using cell membrane fusion agent, electrical stimulation, light stimulation or heat stimulation, or a combination thereof can be used. For example, polyethylene glycol can be used as the cell membrane fusion agent. Hybrid cells obtained by cell fusion may retain all chromosomes, or may retain only some chromosomes. When used in the present invention, when undifferentiated germ cells of a donor are transplanted, genomes necessary for the germ cells after transplantation to function as an egg or sperm may be prepared.

  When producing an individual as a hybrid by gene transfer, it can be produced by introducing the chromosome or gene of the other species into the egg of one species. The amount of chromosomes to be introduced is as long as the germ cells after transplantation are required to function as eggs or sperm when transplanting donor undifferentiated germ cells to the recipient hybrid. May be For example, as a chromosome to be introduced, one or more, or a fragment of one or more of these may be used. Also, different combinations of chromosomes can be introduced to find suitable chromosomes that function after transplantation.

  The gene to be introduced may be any gene that is necessary for the germ cell after transplantation to function as an egg or sperm when the primordial germ cell of the donor is transplanted to the recipient hybrid. Alternatively, one or more genes may be introduced. As such a gene, the gsdf gene can be exemplified.

  In the present invention, as a hybrid used for a recipient, it is preferable to use a cultivar, strain or species having properties suitable as a recipient. Properties suitable as recipients include the high survival rate under artificial breeding environment, the smallness of the breeding facilities required, the cost of facilities for temperature control needed, the cost of food, eggs or Ease of collecting sperm, etc. are exemplified. In the present invention, the recipient used is preferably such that the produced hybrid inherits a property suitable as a recipient. In order for the produced hybrid to inherit the property suitable as a recipient, it is obtained by including more genomes of varieties, strains or species having properties suitable as a recipient in the genome of the hybrid. Can. In order to include more genomes of breeds, strains or species with properties suitable as recipients, it is possible to artificially multiply eggs obtained from breeds, strains or species with properties suitable as a recipient. By doing this, you can have more genomes.

  Preferably, the hybrid has less than half of the genome of the (first) fish species that can be a surrogate parent to the donor, in that the hybrid is less offensive to the surrogate parent. More preferably, it is preferable to have the genome of (first) fish species that can be surrogate parent fish to the donor at 1/3 or less per cell. The amount of genome in the hybrid can be an amount calculated by DNA flow cytometry using somatic cells or blood cells as cells and using cells collected by a standard method. For example, in the case of a hybrid cell having a genome of a (first) fish species that can be a surrogate parent fish and a genome of a fish species other than a (first) fish species that can be a surrogate parent fish, hybrid cells The amount of genomes of (first) fish species that can be surrogate parent fish in A is halved. The chromosome or DNA of a part of the genome of the (first) fish species in which the chromosome of the (first) fish species that can become a surrogate parent fish is missing or the DNA is deficient or can become a surrogate parent fish at this time is In the case of a hybrid cell produced by introducing into the genome of a fish species other than a (first) fish species that can become a surrogate parent fish, the amount is less than half of the amount of the donor genome. In the case of a hybrid cell, the genome of a (first) fish species that can be a surrogate parent fish and a doubled genome of a fish species other than a (first) fish species that can be a surrogate parent fish are hybrids. The amount of the genome of the (first) fish species that can be surrogate parent fish in the cells of is 1/3. At this time, if the chromosome derived from the donor is missing or the DNA derived from the donor is deficient or can become a surrogate parent fish, the chromosome or DNA of a part of the genome of the (first) fish species can become a surrogate parent fish (No. 1) In the case of a hybrid cell prepared by introducing it into the genome of fish species other than fish species, it can be confirmed that it is 1/3 or less of the amount of the genome of the (first) fish species that can be a surrogate parent fish.

  In the present invention, the first fish selected to obtain the hybrid is a fish species that can be a surrogate parent fish for the donor. A fish species capable of acting as a parent parent to a donor is to engraft the donor's germ cell and obtain a donor's gamete when a donor's germ cell is transplanted with a fish belonging to the fish species as a recipient. Refers to fish species that can The fish species that can be surrogate parent fish for the first donor is preferably a donor or a fish species closely related to the donor. A donor or a fish species close to a donor is likely to establish a donor germ cell when a donor germ cell is transplanted, and a donor gamete is easily obtained. Among the hybrids, one or more genes possessed by the donor or a fish species closely related to the donor assist the germ cells of the donor transplanted to the recipient to obtain donor-derived eggs or sperm. It is believed that you can. One or more genes that help the donor's germ cell function transplanted to the recipient are considered to be on one or more chromosomes of the donor or the genome of a fish species closely related to the donor. ing.

  The fish species closely related to the donor is preferably selected from the same genus of the donor, and more preferably selected from the same species as the donor. Specifically, when the donor is the genus Iwana, the first fish species includes fish species of the same or different species as the donor, for example, American trout of the genus Iwana, Oshorocoma, Miyabaywana, Brooktrout, Iwana etc. It can be mentioned. When the donor is the genus Brycea, the first fish species include fish species of the same or different species as the donor, and examples thereof include yellowtail yellowtail, white kingfish, campaci and the like. When the donor is a tuna, the first fish species includes fish species that are the same as or different from the donor, and includes yellowfin tuna, bluefin tuna, southern bluefin tuna, Atlantic bluefin tuna, koshinaga, and the like.

  In the present invention, a (second) fish species which can not be a substitute parent fish for a donor means that when the donor germ cells are transplanted with a fish belonging to the fish species as a recipient, the donor germ cells are viable. It is a fish species that is difficult to put on and get donor gametes. The second fish species that can not be surrogate parent fish for the donor may include fish species different from the donor. As a recipient in surrogate parent fish technology, generally, related fish species are selected as fish species with suitable properties, but, for example, in the case of donors such as large fish, Due to easiness, etc., it may not be possible to select a breed, strain or species having properties suitable as a recipient from a donor or a species of fish cogener with the donor. That is, low survival rate under artificial breeding environment, size of breeding facility needed, cost of facility for temperature control needed, cost of feed, difficulty of collecting eggs or sperm, For reasons such as this, it may not be possible to select a breed, strain or species having properties suitable as a recipient. In such a case, the need arises to select fish species different from donors as recipients. However, donor and non-genus fish species generally have difficulty in establishing donor germ cells when donor germ cells are transplanted, and donor gametes are difficult to obtain.

  In the present invention, when such a second fish species is selected and used as a recipient, a second fish species and a first fish species are produced by hybridizing the second fish species. It is possible to give the ability to be a substitute parent fish to a donor to a fish species and make it possible to use as a recipient, and efficiently obtain a donor gamete by utilizing the breeding characteristics of the second fish species and the like. it can. The method for producing donor gametes using the surrogate parent fish of the present invention is particularly effective as a method for artificially producing hybrids in marine fish in which the formation of hybrids is not found in nature. In particular, in the field of cultured fish, it has economic utility value in securing the necessary supply of fish seedlings.

  For example, if the donor is a genus of char, if it is beyond the scope of the genus, the second fish species may include salmon trout (Yamame), rainbow trout, trout, etc. When the donor is a genus of yellowtail, as a second fish species, a group of horse mackerel such as horse mackerel, a group of horse mackerel such as group horse mackerel, a group of horse mackerel such as group horse mackerel, a horse mackerel such as group horse mackerel, etc. And the like, fish species of the same species as or different from the same family as the horse mackerel family or fish family, fish species of the family different from the donor family, and the like. When the donor is a tuna genus, as the second fish species, such as a mackerel of the mackerel family Suma, a horse mackerel such as a horse mackerel such as a horse mackerel such as a horse mackerel such as a horse mackerel such as a horse mackerel These include fish species of the same species as donors and fish species of the same species as donors.

  Furthermore, to give a specific example, in the case of salmonids charans, the survival rate is low due to poor feeding of feed under artificial rearing, and methods for collecting eggs or spermatozoa have been well established. Because it is not, it is not suitable as a substitute parent fish. The breeding method has not been established for Osorocoma which belongs to the same species as the rockfish. Though the rearing method has been found, the common trout of the rockfish is an alien species and it is difficult to obtain it quickly. However, like salmonids, there is a fish species that is easy to rearing like rainbow trout and yamame, it is easy to collect eggs and sperm, there is a fish species whose proxy parent technology is well studied, and it is suitable as a proxy parent fish It is known to have. Therefore, in order to produce char or eggs or sperm using surrogate parent fish technology, a hybrid having the genome or gene of either kawamas or ochoroku which is closely related to char or ichana and the genome or gene of rainbow trout or trout Preferably, the hybrids are made and used as recipients.

  Also, for example, in the case of horse mackerel yellowtail, large-scale equipment is required for rearing and temperature control for collecting eggs or spermatozoa often occurs at a great cost, so it is suitable as a surrogate parent fish Not. Kanpachi and Hiramasa, which are members of the same species as yellowtail, are not suitable as surrogate parent fish for the same reason. However, compared to yellowtails such as horse mackerel, blue horse mackerel, blue horse mackerel, etc., there are fish species whose breeding facilities are significantly smaller compared to yellowtails such as horse mackerel, blue horse mackerel, and horse mackerel, and gametes are easy to collect. . Therefore, in order to obtain yellowtail gametes using surrogate parent fish, a small yellowish or white horsefish or a small genome such as horse mackerel, blue horse mackerel, or white horse mackerel, or any other genome or gene related to yellowtail It is preferable to use a hybrid as a recipient by preparing a hybrid having any genome or gene of a fish of the fish species. The hybrid obtained in this way can also be used as a surrogate parent of other fish species of yellowtail, for example, campaci and lentil.

  For example, in the case of the mackerel bluefin tuna, extensive equipment is required for rearing, and at least three years or more for collecting eggs or sperm, it is not suitable as a substitute parent fish. In addition, the southern bluefin tuna, the bigeye tuna, the bigeye tuna, the bivalve tuna, which is a fish species closely related to bluefin tuna, also require extensive equipment for rearing, and methods for collecting eggs or spermatozoa have not been established. . However, in the same mackerel family as the bluefin tuna, there are fish species with small breeding facilities, which are exemplified by chub mackerel, sesame mackerel, sesame, hirasouda, and marousouda, which are easy to collect eggs and sperm, and have properties suitable as surrogate parent fish . Therefore, in order to obtain bluefin tuna eggs or sperm using surrogate parent fish technology, the southern bluefin tuna or southern bluefin tuna and related southern bluefin tuna, bigeye, vinaga, koshinaga, and any genome or gene of yellowfin tuna, It is preferable to use a hybrid as a recipient by preparing a hybrid having a combination of the genome or gene of either or Suma. The hybrids obtained in this way can be used as recipients of other fish species of the tuna genus, such as southern bluefin tuna, bigeye bees, bivalves, pokeweed and yellowfin tuna.

  In order to produce eggs or sperm using the surrogate parent fish technology of the present invention, hybrids are produced, and by using the produced hybrids as recipients, primordial germ cells of donors are transplanted to produce transplanted fish. be able to. The primordial germ cells of the transplanted donor enter the gonads of the recipient and produce eggs or sperm from the donor. Therefore, in the present invention, production of a transplanted fish transplanted with primordial germ cells of a donor includes obtaining an egg or sperm from the donor by the transplanted fish.

  In order to obtain eggs or sperm derived from donors from transplanted fish, maturation can be induced and collected by conventional methods (Japanese Patent No. 4300287) according to the fish species. In particular, by preparing the hybrid as heteroploid (Japanese Patent No. 4581083), the recipient of the hybrid which is allopolyploid can be used, and in such a case, egg or sperm derived from the recipient is produced. As a result, donor-derived eggs or sperm in transplanted fish can be easily obtained.

  In the present invention, fish seedling used for aquaculture is the eggs or spermatozoa from the transplanted fish obtained by cultivating the produced hybrid and transplanting primordial germ cells of the donor with the hybrid as a recipient, It can be obtained by obtaining a fertilized egg by crossing with a sperm or egg obtained from an individual, and cultivating the fertilized egg. The fish seedling used for aquaculture can also be produced by cultivating the produced hybrid and using the hybrid as a recipient to graft the primordial germ cells of the donor with the egg or sperm obtained by crossing the donor's egg or spermatozoa. You can get it. Alternatively, it can also be obtained by growing the produced hybrid and multiplying the hybrid with an egg or sperm obtained by implanting a primordial germ cell of a donor as a recipient. The said seedling can be further grown by aquaculture to obtain adult fish.

  The method of producing fish gametes (sperm and eggs) for cultured fish production using the surrogate parent fish of the present invention makes it possible to secure seedlings for aquaculture of donor fish species, for which production of seedlings has hitherto been difficult. As a result, it becomes easy to cultivate the target donor fish species. The obtained adult fish can be widely used as a cultured fish. Thus, the transplanted fish according to the present invention and a hybrid for substitute parent fish technique, spermatozoa or eggs obtained from the transplanted fish, seedlings obtained from the transplanted fish, and adult fish obtained by growing the seedlings obtained from the transplanted fish, It can be applied to the artificial aquaculture of various fish, and can contribute to the construction of a practical application technique of the artificial aquaculture of the fish.

  Hereinafter, the present invention will be described in detail by examples. However, the present invention is not limited thereto. In the following examples, "%" means "% by weight" unless otherwise stated.

Example 1
<(1) Transplanting Iwana spermatogonia to allotriploid host and generation of next generation>
A 13-month-old immature male char (about 43 g in weight and about 15 cm in length) was used as a donor. The testis is removed from the char as a donor, and the cryoprotective solution (sodium chloride 132 mM, potassium chloride 2.56 mM, potassium dihydrogenphosphate 8.13 mM, disodium hydrogen phosphate 1.34 mM, calcium chloride 0.9 mM, magnesium chloride) It was immersed in 0.5 mM, sodium pyruvate 1.28 mM, Hepes 19.5 mM, dimethylsulfoxide 1.3 M, chicken egg egg yolk 10%, trehalose 0.1 M) and frozen in liquid nitrogen. Freezing was slow freezing to -80 ° C at a rate of -1 ° C / min. One week after cryopreservation, thawing was performed. The thawed testicular testis was dispersed by reaction in PBS containing trypsin (0.9 U / ml), fetal bovine serum (5%), DNase (100 U / ml) to obtain a cell suspension. The obtained cell suspension was transplanted into the abdominal cavity of the host in 5,000 cells using an injector.

  As recipients, a triploid brook trout embryo 43 days after fertilization, a heterodiploid rainbow trout-fish trout hybrid embryo 38 days after fertilization, and a triploid rainbow trout embryo 30 days after fertilization were used. Transplantation was performed on 58 triploid brook trout embryos, 60 allotriploid rainbow trout-fish trout hybrid embryos, and 61 triploid rainbow trout embryos. The rainbow trout-kawamas hybrid embryo was obtained by artificially inseminating unseminated eggs and brook trout sperm extracted from ovulated female rainbow trout. The eggs of brook trout, rainbow trout-fish trout hybrid, and rainbow trout were subjected to doubling treatment by treating each egg 5 minutes after fertilization for 3 minutes at 38 ° C.

  One year after transplantation, each host of the triploid brook trout, allogeneic triploid rainbow trout-kawamas hybrid, and triploid rainbow trout transplanted with testicular cells of the donor carp, 52 tails (89.7% of the number of transplanted tails), respectively. 53 tails (80.0%) and 55 tails (90.2%) remain, and 5 tails (19.2% of the surviving tails), 4 tails (16.0%), 2 tails (19.2%) The same 6.5% matured and produced gametes. The mature individuals are all males, and as a result of fertilizing the obtained sperms with wild-type rockfish eggs, next generation rockfish individuals derived from donors are obtained. The obtained next generation was confirmed to be char by PCR method for detecting wrinkle pattern, body pattern, number of vertebrae, and restriction fragment length variation. The results are shown in Table 1.

  After 2 years of transplantation, each host of triploid brook trout, heterotriploid rainbow trout-kawamas hybrid, and triploid rainbow trout has 48 tails (82.7% in the number of transplanted tails) and 45 tails (75.0%). ), 48 tails (78.7%) remain, 14 tails (29.2% of the number of tails remaining), 9 tails (20.0%) and 3 tails (6.3%) did. The breakdown of mature males and females (female population: male population) was 5: 9 for the triploid brook trout host and 3: 6 for the heterotriploid rainbow trout-kawamas hybrid host. The mature individuals of triploid rainbow trout were all male. As a result of performing artificial insemination using sperm and eggs obtained from each host, next generation individuals of Iwana derived from donor rock were obtained. The results are shown in Table 1.

  After 3 years of transplantation, each host of triploid brook trout, heterotriploid rainbow trout-kawamas hybrid, and triploid rainbow trout has 45 tails (77.6% of the number of transplanted tails) and 39 tails (65.0 percent). ), 41 tails (67.2%) remain, 19 tails (42.2% of the number of tails remaining), 9 tails (23.1%) and 4 tails (9.8%) did. The breakdown of mature males and females (female population: male population) was 7:12 for the triploid brook trout host and 3: 6 for the heterotriploid rainbow trout-kawamas hybrid host. The mature individuals of triploid rainbow trout were all male. As a result of performing artificial insemination using sperm and eggs obtained from each host, it was found that the transplanted fish can survive for 3 years or more, and it is possible to obtain the next generation individual rockfish derived from the donor rock. The results are shown in Table 1.

  From the above results, when the char was used as the donor, the gamete derived from the donor was most efficiently produced when using the triploid kawamas as the host. Also, if the host is a far-reaching rainbow trout, it produces spermatozoa of the char, but eggs of the char will not be produced, and it is advantageous to use a more closely related host to produce eggs from donors It was shown. On the other hand, donor-derived eggs have come to be produced by using a hybrid of a closely related rainbow trout with a closely related river trout as a host. From this, it was thought that the production efficiency of donor-derived gametes can be remarkably enhanced by using a recipient having a gene that is closely related to at least a part of them.

<(2) Characteristics of gametes of triploid recipients>
Among the triploid brook trout, triploid rainbow trout, and heterotriple rainbow trout-fish trout hybrid obtained above, eggs of each female (2 and 3 years of age) are collected by squeezing method, and the number is Counted. The results are shown in Table 2.

  Among the triploid brook trout, triploid rainbow trout, and heterotriploid rainbow trout-fish trout hybrid obtained above, the sperm at each male (2 and 3 years of age) is collected by squeezing method The number was confirmed using a calculation board. The results are shown in Table 3. As a comparison target, the number of eggs in diploid rainbow trout without diploid treatment, diploid brook trout, diploid rockfish at 2 and 3-year-old females, and the number of spermatozoa in males in the same manner. The results are shown in Table 3 below.

  The function of gametes obtained from each recipient was confirmed. The function of the gametes obtained by fertilization of the eggs and sperms obtained above by the transfer method was confirmed by the eyeing rate and the hatching rate. Eyeing rate was evaluated by counting the number of eggs that had black pigment deposited in the retina at 3 weeks after fertilization. Hatching rate was assessed by counting individuals who had completed hatching 35 days after fertilization. The results are shown in Table 4. In addition, * shows that all of the triploid female individual was infertility.

  As shown in Table 3, it was found that all gametes of the triploid host transplanted with frozen testicular cells can produce functional gametes derived from a donor. Also, donor sardines and brook trout are in the same genus. As triploid brook trout and triploid rainbow trout brook trout hybrid can produce both eggs and spermatozoa, introducing donor and closely related genome into one set of host is high in gamete production efficiency of infertility host Was shown to be

Example 2
<Transplantation of yellowtail spermatogonia to allotriploid host>
A 10-month-old immature male yellowtail (body weight about 1 kg, length about 40 cm) was used as a donor. The testis was removed from the donor bullion, and the cell suspension obtained by dispersing the enzyme treatment was transplanted into the peritoneal cavity of the host at 20,000 cells. As a host, 92 heteroploid triploid bris-horse mackerel hybrid larvae 10 days after hatching were used. The heterotriploid Bry-horse mackerel hybrid larva was obtained by artificial insemination of unfertilized egg of horse mackerel and spermatozoa of yellowtail, and pressurization to 650 kg / cm ² with a French press for 1 minute 5 minutes after fertilization. One month after transplantation, 18 tails (19.5% of the transplanted tails) survived. The obtained heterotriploid Brigi mackerel hybrid is suitable as a recipient of germ cells of the genus B. avian donor.

[Example 3]
<Allele triploid fish production for host for tuna germ cell transplantation>
Suma eggs, which are relatively small fishes of the mackerel family, were artificially mated (spurted) with bluefin tuna sperm to produce a tuna-tuna hybrid. A fertilized egg of the Suma-Bluf tuna hybrid was obtained by placing Suma's eggs on the bluefin tuna sperm. The fertilized eggs of the Suma-Bluefin tuna hybrid hatched, but the larvae died without feeding. Therefore, the fertilized eggs of the Suma-Bluefin tuna hybrid were treated with triploidization. The triploidization treatment was performed by immersing the fertilized egg of the Suma-Bluefin tuna hybrid for 5 minutes after fertilization for 5 minutes in seawater cooled to 4 ° C. The thus obtained hybrid triploid fertilized eggs possess two sets of chromosomes of Suma and one set of chromosomes of bluefin tuna.

  The hatched Suma-Bluefin tuna hybrid larvae are Suma and Bluefin tuna, primers with different amplification sizes for each species (TGC AGA ACG AAC AGG ATG AG and CCC ATT GAG GAG ATT GGA GA) and primers for which amplification is confirmed only with Blue Tuna The PCR method using the set (ACATGGTCCCATTCCATCCATT and TGG CTT AGC TCT ACC CCAA) was shown to retain the respective genetic information. Moreover, it was confirmed by DNA flow cytometry using somatic cells that it is a triploid which holds three sets of chromosomes. This indicates that the Suma-Bluefin tuna hybrid allotrope could be produced. The allogeneic triploids survived until 5 days after hatching, and feeding was also observed. The resulting tuna-bluefin tuna hybrid allotrope is suitable as a recipient of germline tuna donors.

  The disclosure of Japanese Patent Application No. 2014-064639, filed March 26, 2014, is incorporated herein by reference in its entirety. All documents, patent applications, and technical standards described herein are as specific and distinct as when individual documents, patent applications, and technical standards are incorporated by reference. Hereby incorporated by reference.

  The present invention makes it possible to use for alternative parent fish such as other genus fish species, and it is possible to use easy fish species such as breeding of other genera as recipients in substitute parent fish technology, so a wide range of recipes It is possible to select a suitable fish species as an entity, and to provide technology for practical use as a method of producing fish gametes (sperm and eggs) for cultured fish production using surrogate parent fish did.

Claims (20)

Using the recipient fish, transplanting isolated germ cells of a fish of different lineage or different from the recipient fish into the recipient fish and inducing differentiation into germ line, including fish gamete using the surrogate parent fish In the production method of
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
(E) using the hybrid fish species produced in (D) as a recipient and transplanting the separated germ cells of the donor fish species to induce differentiation into the germ line,
Method of producing gametes of fish using surrogate parent fishes including.   The method for producing fish gametes using surrogate parent fish according to claim 1, wherein the gametes of fish are sperms or eggs of a donor fish species.   The fish of the first fish species that can be surrogate parent fish for the donor fish species is a fish of the fish species capable of engrafting the gonads of the separated germ cells of the transplanted donor fish species, and for the donor fish species The fish of the second fish species which can not be a surrogate parent fish is a fish of a fish species which does not have the ability to engraft the gonads of the separated germ cells of the transplanted donor fish species. Or the production method of the gamete of the fish using the substitute parent fish as described in 2.   The fish using the surrogate parent fish according to any one of claims 1 to 3, characterized in that the fish of the first fish species which can be the surrogate parent fish for the donor species is the same genus as the donor fish species. How to produce gametes.   The surrogate parent fish according to any one of claims 1 to 4, characterized in that the fish of the second fish species which can not be surrogate parent fish with respect to the donor fish species is different from the donor fish species. How to produce fish gametes.   The method for producing gametes of fish using surrogate parent fish according to any one of claims 1 to 5, wherein the donor fish species is the genus Iwana, the genus Bryce or the genus Tuna.   A hybrid fish species having the ability to be a surrogate parent to a donor fish species characterized by having less than half the genome of the first fish species capable of being a surrogate parent to the donor fish species per cell. A method for producing gametes of fish using the surrogate parent fish according to any one of items 1 to 6.   The hybrid fish species having the ability to be a surrogate parent to a donor fish species is characterized in that the genome of the first fish species that can be a surrogate parent to the donor fish is less than 1/3 per cell. A method of producing gametes of fish using the surrogate parent fish according to claim 7.   The hybrid fish species having the ability to become a parent parent to a donor fish species is heteroploid, and it is an infertile hybrid fish species in which gametes derived from the hybrid fish species are not produced. The production method of the gamete of the fish using the substitute parent fish in any one of -8.   Hybrid fish species with the ability to be surrogate parent fish to donor fish species are allopolyploids, and infertile hybrid fish species that do not produce sperm and eggs from hybrid fish species are triploid. A method of producing gametes of fish using the surrogate parent fish according to claim 9 characterized by the above. A recipient parent fish that uses recipient fish and transplants isolated germ cells of donor fish species that are different or different from the recipient fish into recipient fish to induce differentiation into germ line, In the method of inducing differentiation of germ cells into germ line of isolated germ cells, a hybrid fish as a recipient is produced by the following (A) to (D), and the produced hybrid fish species is used as a recipient fish, a donor A method of inducing differentiation of germ cells into germline differentiation of fish using a surrogate parent fish, which comprises transplanting and differentiation induction of the germ cells of fish species:
(A) Select a donor fish species that supplies isolated germ cells,
(B) selecting a fish of the first fish species that can be a surrogate parent to the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to gain. The recipient fish is a transplanted fish using a surrogate parent fish including transplantation of isolated germ cells of a fish different or different from the recipient fish into recipient fish and induction of differentiation into germ line. In the production method
(A) selecting a donor fish species that supplies isolated germ cells;
(B) selecting a fish of a first fish species that can be a surrogate parent for the donor fish species;
(C) selecting a fish of a second fish species that can not be a surrogate parent for the donor fish species;
(D) hybridizing the fish of the first fish species selected in (B) with the fish of the second fish species selected in (C) to become a surrogate parent fish for the donor fish species Create hybrid fish species with the ability to
(E) A method of producing a transplanted fish using a surrogate parent fish, which comprises using the hybrid fish species produced in (D) as a recipient and transplanting separated germ cells of the donor fish species. The fish of the first fish species that can be surrogate parent fish for the donor fish species is a fish of the fish species capable of engrafting the gonads of the separated germ cells of the transplanted donor fish species, and for the donor fish species claims second species of fish not be a surrogate parent fish, characterized in that it is a species of fish with no engraftment potential to the gonads of transplanted donor species separation germline on 12 A method of producing transplanted fish using the surrogate parent fish described in. The method for producing transplanted fish using a surrogate parent fish according to claim 12 or 13 , characterized in that the fish of the first fish species capable of becoming a surrogate parent fish for the donor species is the same genus as the donor fish species. . The surrogate parent fish according to any one of claims 12 to 14 , characterized in that the fish of the second fish species which can not be surrogate parent fish with respect to the donor fish species is different from the donor fish species. How to produce transplanted fish. The method for producing a transplanted fish using a surrogate parent fish according to any one of claims 12 to 15 , wherein the donor fish species is a genus of the genus Iwana, a genus of yellowtail or a tuna genus. Claims hybrid species with the ability can be a surrogate parent fish to a donor fish species, the first species of the genome can be a surrogate parent fish to a donor species characterized as having less than half per cell A method for producing transplanted fish using the surrogate parent fish according to any one of items 12 to 16 . The hybrid fish species having the ability to be a surrogate parent to a donor fish species is characterized in that the genome of the first fish species that can be a surrogate parent to the donor fish is less than 1/3 per cell. A method of producing gametes of fish using the surrogate parent fish according to claim 17 . Hybrid species with the ability can be a surrogate parent fish to a donor species is a heterogeneous polyploid, claim 12 gametes from hybrid fish species characterized in that it is a hybrid species of infertility that are not produced The manufacturing method of the transplanted fish using the substitute parent fish in any one of -18 . Hybrid fish species with the ability to be surrogate parent fish to donor fish species are allopolyploids, and infertile hybrid fish species that do not produce sperm and eggs from hybrid fish species are triploid. A method of producing gametes of fish using the surrogate parent fish according to claim 19 characterized by the above.