JP6402347B2 - Nucleic acid detection or quantification method and detection or quantification reagent kit - Google Patents

Description

  The present invention relates to a nucleic acid detection or quantification method and a detection or quantification reagent kit.

Conventionally, as a method for detecting a nucleic acid contained in a biological sample such as blood, a method using a nucleic acid amplification reaction such as PCR (polymerase chain reaction) is known. When this method is used, a method of isolating or purifying nucleic acid from a biological sample is generally used as a pretreatment for the nucleic acid amplification reaction.
On the other hand, a method in which a biological sample is directly used for a nucleic acid amplification reaction without pretreatment such as isolation and purification of nucleic acid has been developed. As such a method, for example, a method using a reaction mixture containing a zwitterionic buffer and / or a non-reducing carbohydrate (Patent Document 1), characterized in that the pH of the PCR reaction solution is in a specific range. (Patent Document 2), a method characterized by performing a heating treatment or a treatment with a glycolytic enzyme (Patent Document 3), and determining the concentration of positive monovalent ions and divalent ions in a reaction mixture A method (Patent Document 4) characterized by setting the range is known.
However, in research and clinical practice, it is necessary to detect a target nucleic acid contained in a biological sample more quickly and with high accuracy, and new detection reagents and detection methods are required.

Special table 2008-531039 gazette Japanese Patent Laid-Open No. 9-238687 Japanese Patent Laid-Open No. 10-80280 JP-A-6-277062

  The present invention has been made in view of such a situation, and the problem to be solved is to detect a target nucleic acid contained in the test sample quickly and accurately without purifying the nucleic acid from the test sample. An object of the present invention is to provide a novel nucleic acid detection or quantification reagent kit and detection or quantification method that can be quantified.

As a result of intensive studies to solve the above problems, the present inventor has found that ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA) or 1,2 -Bis (o-aminophenoxy) ethane-N, N, N ', N'-tetraacetic acid (BAPTA), oligonucleotide for amplifying the target nucleic acid and test sample are mixed, and the mixture is subjected to nucleic acid amplification reaction As a result, it has been found that the target nucleic acid contained in the test sample can be detected or quantified quickly and accurately without purifying the nucleic acid from the test sample, and the present invention has been completed.
That is, the present invention is as follows.
(1) A reagent kit for detecting or quantifying a target nucleic acid, which is ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis ( o-aminophenoxy) ethane-N, N, N ′, N′-tetraacetic acid (BAPTA) and at least one compound selected from the group consisting of these and salts thereof, and an oligo for amplifying the target nucleic acid The reagent kit comprising a nucleotide.
(2) Ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N' , N′-tetraacetic acid (BAPTA) and a first reagent containing at least one compound selected from the group consisting of these derivatives or a salt thereof, and a second reagent containing an oligonucleotide for amplifying the target nucleic acid, The reagent kit according to (1) above, comprising:
(3) The reagent kit according to (1) or (2) above, wherein the target nucleic acid is contained in at least one biological sample selected from the group consisting of urine, saliva, amniotic fluid, breast milk, serum and plasma.
(4) The reagent kit according to any one of (1) to (3), wherein the target nucleic acid is a microorganism-derived DNA or RNA.
(5) The reagent kit according to (4) above, wherein the microorganism is a virus or a bacterium.
(6) The reagent kit according to (5) above, wherein the virus is a herpes virus.
(7) The reagent kit according to any one of (1) to (6), which is used for diagnosis of viral infection or bacterial infection.
(8) A method for detecting or quantifying a target nucleic acid comprising ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis (o -Aminophenoxy) ethane-N, N, N ', N'-tetraacetic acid (BAPTA) and at least one compound selected from the group consisting of these derivatives, or a salt thereof, a test sample, and the target nucleic acid is amplified. And a method for detecting or quantifying the amplified target nucleic acid by mixing the target oligonucleotide with a target oligonucleotide, performing an amplification reaction of the target nucleic acid in the mixture.
(9) A method for detecting or quantifying a target nucleic acid, comprising the following steps.
(a) Ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N' , N′-tetraacetic acid (BAPTA) and a first reagent containing at least one compound selected from the group consisting of these derivatives or a salt thereof, a test sample, and a first reagent containing an oligonucleotide for amplifying the target nucleic acid Mixing the two reagents, and
(b) A step of performing an amplification reaction of the target nucleic acid in the mixture obtained in the step (a) and detecting or quantifying the amplified target nucleic acid (10) A virus infection or a bacterial infection including the following steps is detected Method.
(a) Ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N' , N′-tetraacetic acid (BAPTA) and a first reagent containing at least one compound selected from the group consisting of these derivatives or a salt thereof, a test sample, and a target nucleic acid derived from a virus or bacteria Mixing with a second reagent comprising an oligonucleotide; and
(b) A step of performing an amplification reaction of the target nucleic acid in the mixture obtained in step (a) and detecting or quantifying the amplified target nucleic acid

  According to the present invention, a target nucleic acid contained in a test sample can be detected or quantified quickly and accurately without purifying the nucleic acid from the test sample.

  Hereinafter, the present invention will be described in detail. The following embodiment is an example for explaining the present invention, and is not intended to limit the present invention to this embodiment alone. The present invention can be implemented in various forms without departing from the gist thereof. This specification includes the contents described in the specification and drawings of a Japanese patent application (Japanese Patent Application No. 2012-077174) filed on March 29, 2012, which is the basis of the priority claim of the present application.

1. Overview The present invention relates to ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N ', N'-tetraacetic acid (BAPTA), a derivative thereof or a salt thereof, and an oligonucleotide for amplifying a target nucleic acid and a test sample are mixed, a nucleic acid amplification reaction is performed using the mixture, and the test is performed. The present invention relates to a method for detecting or quantifying a target nucleic acid contained in a sample, and a reagent kit that can be used in the method.
In general, a biological sample has a substance or property that inhibits a nucleic acid amplification reaction. Therefore, when a target nucleic acid contained in a biological sample is amplified and detected or quantified by a nucleic acid amplification reaction, the nucleic acid contained in the biological sample is purified. The method is adopted.
On the other hand, when a target nucleic acid contained in a biological sample is amplified and detected or quantified by a nucleic acid amplification reaction without purifying the nucleic acid from the biological sample, a factor that inhibits the nucleic acid amplification reaction in the biological sample is determined by some method. It is necessary to suppress it.
However, there are many factors (contaminants, physical properties, etc.) that inhibit the nucleic acid amplification reaction in biological samples, and these factors are involved in complex ways to inhibit the nucleic acid amplification reaction. Therefore, it is not always possible to eliminate inhibition of the nucleic acid amplification reaction, and it is not easy to predict how to deal with which factor and how the nucleic acid amplification reaction proceeds normally. Moreover, simplicity is calculated | required about operation which suppresses the inhibitor of the nucleic acid amplification reaction in a biological sample.
Therefore, when the inventor conducted intensive research on this point, the inventor mixed a biological sample with EGTA, BAPTA, a derivative thereof or a salt thereof, and used the mixture for a nucleic acid amplification reaction. It has been found that the target nucleic acid contained in the test sample can be detected or quantified quickly and with high accuracy without purifying the nucleic acid from the test sample, and the present invention has been completed.

That is, the present invention provides a reagent kit for detecting or quantifying a target nucleic acid, comprising at least one compound selected from the group consisting of EGTA, BAPTA, and derivatives thereof, or a salt thereof, and an oligonucleotide for amplifying the target nucleic acid. I will provide a.
Furthermore, the present invention provides a first reagent containing at least one compound selected from the group consisting of EGTA, BAPTA and derivatives thereof, or a salt thereof, and a second reagent containing an oligonucleotide for amplifying a target nucleic acid, A reagent kit for detecting or quantifying a target nucleic acid is provided.
The present invention also relates to a method for detecting or quantifying a target nucleic acid for amplifying at least one compound selected from the group consisting of EGTA, BAPTA and derivatives thereof, a salt thereof, a test sample, and the target nucleic acid. And a method for detecting or quantifying the amplified target nucleic acid by carrying out an amplification reaction of the target nucleic acid in the mixture.
The present invention also provides a method for detecting or quantifying a target nucleic acid, comprising: (a) a first reagent containing at least one compound selected from the group consisting of EGTA, BAPTA, and derivatives thereof, or a salt thereof; The sample was mixed with a second reagent containing an oligonucleotide for amplifying the target nucleic acid, and (b) the target nucleic acid in the mixture obtained by the step (a) was amplified and amplified. The method is provided comprising the step of detecting or quantifying the target nucleic acid.
With the reagent kit and the detection or quantification method of the present invention, the target nucleic acid contained in the test sample can be detected or quantified quickly and accurately without purifying the nucleic acid from the test sample.

2. Target nucleic acid In the present invention, “target nucleic acid” refers to a nucleic acid to be amplified, detected or quantified, and “target nucleic acid sequence” refers to a base sequence of the target nucleic acid. The target nucleic acid can be appropriately selected according to the purpose of detection or quantification, but is preferably DNA or RNA derived from a microorganism. DNA includes total DNA, cDNA, genomic DNA and synthetic DNA. RNA includes mRNA, rRNA, genomic RNA, and synthetic RNA.
In the present invention, the microorganism from which the target nucleic acid is derived is not limited as long as it has a nucleic acid genome, but a microorganism having pathogenicity is preferred. In the present invention, examples of the microorganism include viruses, bacteria, fungi, yeasts, and slime molds, and viruses and bacteria are preferable.
In the present invention, viruses include DNA viruses having DNA as a genome and RNA viruses having RNA as a genome, with DNA viruses being preferred. The DNA virus includes a double-stranded DNA virus and a single-stranded DNA virus, and preferably a double-stranded virus. Examples of the double-stranded DNA virus include herpes virus, adenovirus, pox virus, etc. Herpes virus is preferred.

  Herpesviruses are viruses whose host is an animal, and are found in large numbers from mammals, birds, amphibians, reptiles, fish and the like. As the herpesvirus from which the target nucleic acid targeted by the present invention is derived, a herpesvirus having a human host (human herpesvirus) is preferred. Examples of human herpesvirus include, but are not limited to, human cytomegalovirus (HCMV), herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus. (VSV), Epstein-Barr virus (EBV), human herpes virus 6 (HHV-6), human herpes virus 7 (HHV-7), Kaposi's sarcoma-associated herpes virus (KSHV, HHV-8) Among them, human cytomegalovirus (HCMV) and herpes simplex virus type 1 (HSV-1) are preferable.

  Human herpesviruses are responsible for various diseases. HCMV is involved in HCMV infection, interstitial pneumonia, CMV retinopathy, CMV mononucleosis, congenital giant cell inclusion disease, HSV-1 is a cold sore, genital herpes, Kaposi varicella-like rash, Involved in herpes encephalitis, corneal herpes, bell paralysis. HSV-2 is involved in genital herpes, neonatal herpes, myelitis, aseptic meningitis, and acute retinal necrosis, and VSV is involved in chickenpox, herpes zoster, and Ramsey-Hunt syndrome. EBV is involved in infectious mononucleosis, chronic active EBV infection, nasopharyngeal cancer, Burkitt lymphoma, EBV-related gastric cancer, and HHV-6 is involved in sudden rash, encephalitis / encephalopathy . Furthermore, HHV-7 is involved in idiopathic rash, and HHV-8 is involved in Kaposi's sarcoma (AIDS-related, classical, African), Castleman's disease, and malignant B lymphoma.

  Examples of the single-stranded DNA virus include parvovirus (such as adeno-associated virus). RNA viruses include double-stranded RNA viruses and single-stranded RNA viruses. Single-stranded RNA viruses include retroviruses (RNA tumor viruses, human immunodeficiency viruses, etc.), rhabdoviruses (rabies virus, vesicular stomatitis virus, etc.), paramyxoviruses (Sendai virus, mumps virus, measles virus, etc.) , Orthomyxovirus (such as influenza virus), arena virus (such as lymphocytic choriomeningitis virus, lassa virus), coronavirus (such as SARS (Severe Acute Respiratory Syndrome) virus), norovirus and the like.

  As a virus-derived target nucleic acid, any region of virus-derived DNA or RNA can be selected. For example, a conserved region of DNA or RNA with few gene mutations can be selected as a target nucleic acid. In human cytomegalovirus, for example, DNA containing a base sequence such as glycoprotein B gene (SEQ ID NO: 1), glycoprotein H gene (SEQ ID NO: 2), matrix phosphorylated protein pp65 gene (SEQ ID NO: 3) is used as a target nucleic acid. Can be selected. Such gene information can be obtained from a known gene information database (for example, ENA of the European Bioinformatics Institute (EBI)).

  In the present invention, the bacterium includes both gram positive bacteria and gram negative bacteria. Gram-positive bacteria include Staphylococcus aureus and other Staphylococcus bacteria, Streptococcus bacteria, Listeria monocytogenes and other Listeria monocytogenes, and Bacillus cereus and other Bacillus cereus species Examples include bacteria, Mycobacterium bacteria such as Mycobacterium tuberculosis, Mycoplasma bacteria, Clostridium botulinum, Clostridium bacteria such as Clostridium perfringens, and the like. Gram-negative bacteria include Escherichia bacteria such as Escherichia coli, Citrobacter koseri such as Citrobacter koseri, Chlamydia trachomatis, Chlamydia pneumoniae ), Chlamydia bacteria such as Klebsiella oxytoca, Enterobacteriaceae represented by Klebsiella oxytoca, Vibrio cholerae and other Haemophilus influenzae Examples include bacteria, Salmonella bacteria, Proteus bacteria, Pseudomonas bacteria, Neisseria gonorrhoeae and the like.

  In the present invention, an arbitrary region can be selected as a target nucleic acid in DNA derived from bacteria. For example, a region containing a gene that causes a disease (pathogenic gene) can be selected as a target nucleic acid. it can. Examples of such virulence genes include Listeria ricin O (hlyA) gene of Listeria bacterium, enterotoxin gene and invasion (invA) gene of Salmonella bacterium, verotoxin gene of pathogenic E. coli O-157, Examples include the Staphylococcus aureus enterotoxin gene, Bacillus cereus cereulide (vomiting toxin) gene, enterotoxin gene, and botulinum toxin genes.

For those skilled in the art, a target nucleic acid derived from a microorganism can be selected from any region of microorganism-derived DNA or RNA based on known gene information and a gene database (for example, NCBI GenBank), and a primer capable of amplifying the region. Can be amplified by a nucleic acid amplification reaction. The nucleic acid sequence to be amplified may be either the full length or a part of the target nucleic acid sequence.
In the case of human cytomegalovirus, DNA containing the base sequence of glycoprotein H gene of human cytomegalovirus is selected as a target nucleic acid, and an oligonucleotide primer that can amplify all or part of the target nucleic acid is used. The target nucleic acid can be amplified and detected or quantified by a nucleic acid amplification reaction (Eiko Fukushima, et al., Journal of Virological Methods 151 (2008) 55-60). A person skilled in the art can detect or quantify other nucleic acid-derived target nucleic acids using the same technique.

  For example, the base sequence of the target nucleic acid to be detected or quantified may be a sense-side base sequence or an antisense-side base sequence as long as it is a double-stranded nucleic acid. For example, a complementary nucleic acid sequence can be detected or quantified by detecting or quantifying the antisense nucleic acid sequence.

  In the present invention, the “test sample” refers to a sample to be examined for the presence or amount of the target nucleic acid, and examples of the target nucleic acid include those contained in the test sample. The test sample may be a biological sample, a food sample, a pharmaceutical product, a sample of natural water (hereinafter referred to as “biological sample etc.”) itself, or a diluted or concentrated sample. That is, as the test sample, one containing a biological sample or the like can be used. Further, the test sample may include other components, microorganisms, solvents and the like in addition to a sample such as a biological sample. In addition, when a test sample contains a biological sample, "target nucleic acid contained in a test sample" and "target nucleic acid contained in a biological sample" represent the same meaning.

In the present invention, the biological sample refers to a sample derived from a living body, for example, a body fluid sample, mucosa (oral mucosa, gastric mucosa, airway mucosa) and cells thereof, feces, skin, other cells (including cultured cells), A part of each tissue may be mentioned, and a body fluid sample is preferable. A body fluid sample refers to a sample containing a body fluid derived from a living body, such as urine, saliva, amniotic fluid, breast milk, blood (whole blood, serum, plasma), spinal fluid, synovial fluid, ascites, pleural effusion, ear leakage, nasal discharge, pus, Examples include bile, sputum, sweat, and other pulverized liquids of cells or tissues. The body fluid sample is preferably selected from the group consisting of urine, saliva, amniotic fluid, breast milk, serum and plasma, and more preferably selected from the group consisting of urine, saliva, amniotic fluid and breast milk. The body fluid sample may contain cells. In the present invention, the living body includes individual animals, animal tissues, animal cells (including cultured cells), and the like. Examples of animals include humans, mice, rats, horses, dogs, sheep, rabbits, cows, pigs, rhesus monkeys, common marmosets, chickens, etc., preferably humans, mice, rats, more preferably humans. It is.
In the case of a human-derived biological sample, the age of the target human (including age and age) is not limited, and is appropriately selected within the range from the fetal period to 120 years depending on the purpose of detection. For example, when diagnosing or detecting congenital cytomegalovirus infection, preferably within 21 days of life from the fetal period, and when diagnosing or detecting acquired cytomegalovirus infection, from 1 month after birth 12 years old is preferable, and when detecting or diagnosing cytomegalovirus infection in an immunodeficient human, it is preferable to detect it continuously regardless of age.

  In the present invention, the biological sample is preferably a biological sample from which the target nucleic acid has not been purified. However, the biological sample of the present invention is treated by treatment other than purification of the target nucleic acid, for example, heating, cooling, centrifugation, enzyme treatment (treatment with an enzyme such as a glycolytic enzyme, lipolytic enzyme, or proteolytic enzyme). A biological sample may be used. In addition, when cells or bacteria are contained in the biological sample, it can be treated with a surfactant in order to destroy the cells or bacteria. Thereby, for example, it is possible to destroy the cell membrane of cells contained in blood, the bacterial membrane of bacteria, and the like.

3. Reagent Kit for Detection or Quantification of Target Nucleic Acid The reagent kit for detection or quantification of a target nucleic acid of the present invention is at least one compound selected from the group consisting of EGTA, BAPTA and derivatives thereof (hereinafter referred to as “the compound of the present invention”). And an oligonucleotide for amplifying the target nucleic acid.
In the present invention, the compound of the present invention and the oligonucleotide for amplifying the target nucleic acid may be contained in one reagent, or may be contained in different reagents. That is, the reagent kit for detecting or quantifying a target nucleic acid of the present invention amplifies the target nucleic acid with a first reagent containing at least one compound selected from the group consisting of EGTA, BAPTA and derivatives thereof, or a salt thereof. And a second reagent containing an oligonucleotide for the purpose.
In the present specification, a reagent containing at least one compound selected from the group consisting of EGTA, BAPTA, and derivatives thereof, or a salt thereof may be referred to as a “first reagent”, and for amplifying a target nucleic acid. The reagent containing the oligonucleotides is sometimes referred to as “second reagent”. Furthermore, in this specification, a reagent comprising at least one compound selected from the group consisting of EGTA, BAPTA and derivatives thereof, or a salt thereof, and an oligonucleotide for amplifying a target nucleic acid is referred to as a “measuring reagent”. There is.

(1) Compound The compound used in the present invention is ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis (o-amino) Phenoxy) ethane-N, N, N ′, N′-tetraacetic acid (BAPTA) and their derivatives. These compounds are common in that their chemical structures have an ether bond and four carboxyl groups.
EGTA is a compound represented by the following chemical formula, and reacts with divalent and trivalent metal ions to form a complex.


A derivative of EGTA is a compound having a structure including an ether bond and four carboxyl groups, and a part of the chemical structure of EGTA (for example, a substituent) is substituted with another structure. The number of ether bonds is preferably 1 to 3. Examples of such derivatives include 8-amino-2-[(2-amino-5-methylphenoxy) methyl] -6-methoxyquinoline-N, N, N ′, N′-tetraacetic acid.

BAPTA is a compound represented by the following chemical formula, and reacts with a divalent metal ion to form a complex.

  A derivative of BAPTA is a compound having a structure containing an ether bond and four carboxyl groups, and a part of the chemical structure of BAPTA (for example, a substituent) is substituted with another structure. The number of ether bonds is preferably 1 to 3. Examples of such derivatives include O, O′-bis (2-aminophenyl) ethylene glycol-N, N, N ′, N′-tetraacetic acid tetraacetoxy ester, 1- [6-amino-2- ( 5-carboxy-2-oxazolyl) -5-benzofuranyloxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ′, N′-tetraacetic acid, 1- [6-amino- 2- (5-carboxy-2-oxazolyl) -5-benzofuranyloxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ′, N′-tetraacetic acid pentaacetoxymethyl ester, 1- [2-Amino-5- (2,7-dichloro-6-hydroxy-3-oxo-9-xanthenyl) phenoxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ', N'-tetraacetic acid, 1- [2-amino-5- (2,7-dichloro-6-hydroxy-3-oxo-9-xanthenyl) phenoxy] -2- (2-amino-5-methylphenoxy) ) Ethane-N, N, N ', N'-tetraacetic acid pentaacetoxymethyl ester, 1- [2-amino-5- (2,7-difluoro) -6-hydroxy-3-oxo-9-xanthenyl) phenoxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ', N'-tetraacetic acid pentaacetoxymethyl ester, 1- [ 2-Amino-5- (6-carboxy-2-indolyl) phenoxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ′, N′-tetraacetic acid, 1- [2- Amino-5- (6-carboxy-2-indolyl) phenoxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ′, N′-tetraacetic acid pentaacetoxymethyl ester, 1- [ 2-Amino-5- (3-dimethylamino-6-dimethylammonio-9-xanthenyl) phenoxy] -2- (2-amino-5-methylphenoxy) ethane-N, N, N ', N'-four Examples include acetic acid.

The compounds used in the present invention may form salts and hydrates. The salt is not particularly limited as long as it has the effect of the present invention, and may form a salt with an acid or a salt with a base.
Examples of the salt with an acid include inorganic acids such as hydrochloride, hydrobromide, sulfate, and phosphate. Examples of the salt with a base include alkali metal salts such as sodium salt and potassium salt, and chloride salts.
In the present invention, examples of the salt of the compound include 8-amino-2-[(2-amino-5-methylphenoxy) methyl] -6-methoxyquinoline-N, N, N ′, N′-tetraacetic acid tetra Potassium salt, 1,2-bis (o-aminophenoxy) ethane-N, N, N ', N'-tetraacetic acid tetrasodium salt, 1,2-bis (o-aminophenoxy) ethane-N, N, N ', N'-tetraacetic acid tetrapotassium salt, 1- [6-amino-2- (5-carboxy-2-oxazolyl) -5-benzofuranyloxy] -2- (2-amino-5-methylphenoxy) ethane -N, N, N ', N'-tetraacetic acid pentapotassium salt, 1- [2-amino-5- (6-carboxy-2-indolyl) phenoxy] -2- (2-amino-5-methylphenoxy) Ethane-N, N, N ', N'-tetraacetic acid pentapotassium salt, 1- [2-amino-5- (3-dimethylamino-6-dimethylammonio-9-xanthenyl) phenoxy] -2- (2 -Amino-5-methylphenoxy) ethane-N, N, N ′, N′-tetraacetic acid chloride and the like.
Examples of the hydrate of the compound of the present invention include 1,2-bis (o-aminophenoxy) ethane-N, N, N ′, N′-tetraacetic acid tetrapotassium hydrate. In the present specification, for the sake of convenience, a salt of a compound and a hydrate thereof may be represented only by the compound name.
As the compound used in the present invention, a so-called free form which does not form a salt can be selected.
The above compounds and salts thereof are commercially available, and can be purchased from, for example, Dojindo Laboratories Co., Ltd.

  The compound of the present invention has a function to suppress the nucleic acid amplification reaction inhibitor present in the test sample by mixing with the test sample containing the target nucleic acid. That is, in the present invention, the test sample can be used for the nucleic acid amplification reaction without purifying the nucleic acid from the test sample by the function of the compound of the present invention.

In the present invention, the concentration of the compound of the present invention is a mixture of a test sample containing a biological sample and a detection or quantification reagent containing the compound of the present invention and an oligonucleotide (hereinafter also referred to as “reaction mixture”). The target nucleic acid contained in the test sample can be detected or quantified more rapidly and accurately when the concentration is within a certain range with respect to the concentration of the biological sample in the total amount.
That is, in one embodiment of the present invention, at least one compound selected from the group consisting of EGTA, BAPTA, and derivatives thereof, or a salt thereof is detected or detected including a test sample including a biological sample, the compound of the present invention, and an oligonucleotide. When the quantification reagent is mixed, it is contained in the reaction mixture so that the concentration relative to the concentration of the biological sample in the total amount of the mixture becomes a certain concentration (mM) or more. The concentration of the compound of the present invention in the reaction mixture is, for example, 0.01 mM or more, 0.03 mM or more, 0.05 mM or more, 0.09 mM or more, 0.1 mM or more, 0.15 mM or more, 0.2 mM or more, 0.3 mM or more, 0.45 mM. Or more, 0.5 mM or more, 0.6 mM or more, 0.8 mM or more, 1 mM or more, 1.5 mM or more, or 2.4 mM or more, preferably 0.1 mM or more, 0.15 mM or more, 0.2 mM or more, or 0.3 mM or more More preferably, the concentration is 0.2 mM or more, or 0.3 mM or more, but is not limited thereto. Further, the upper limit of the concentration of the compound of the present invention in the total amount of the reaction mixture is not limited, and examples include a concentration of 10 mM or less.
The volume of a detection or quantification reagent containing a test sample, a compound of the present invention, etc. and an oligonucleotide can be arbitrarily determined, and those skilled in the art can detect or contain a test sample, a compound of the present invention, etc. and an oligonucleotide. The amount or concentration of the compound of the present invention contained in the detection or quantification reagent is determined according to each volume of the reagent for quantification and the total amount of these mixtures, and the concentration of the compound of the present invention in the total amount of the mixture Can be produced so that the concentration is as exemplified above.
For example, when a biological sample is used as it is as a test sample without dilution, the test sample is 2 μl, the reagent containing the compound of the present invention is 2 μl, the oligonucleotide containing reagent is 16 μl, and the total amount of these mixtures is 20 μl. In this case, the reagent containing the compound of the present invention contains the compound of the present invention in the reagent containing the compound of the present invention at a concentration of 2 mM or more, whereby the reagent of the present invention in the total amount of the mixture The compound of the present invention can be contained so that the concentration of the compound or the like is 0.2 mM or more.
In another example, when a biological sample is used as it is as a test sample without dilution, the test sample is 4 μl, and the detection or quantification reagent containing the compound of the present invention and the oligonucleotide is 16 μl. When the total amount is 20 μl, the reagent containing the compound of the present invention contains the compound of the present invention in the detection or quantification reagent at a concentration of 0.75 mM or more, whereby the compound of the present invention in the total amount of the mixture The compound of the present invention and the like can be contained so that the concentration thereof becomes 0.6 mM or more.
In yet another example, when a test sample obtained by diluting a biological sample 5 times is used, the test sample is 10 μl (biological sample 2 μl + diluted solution 8 μl), the reagent containing the compound of the present invention is 4 μl, the oligonucleotide When the reagent containing 6 μl and the total amount of these mixtures is 20 μl, the reagent containing the compound of the present invention contains the compound of the present invention at a concentration of 1.5 mM or more, so that the present invention in the total amount of the mixture The compound of the present invention can be contained so that the concentration of the compound or the like becomes 0.3 mM or more.

  In another embodiment of the present invention, at least one compound selected from the group consisting of EGTA, BAPTA, and derivatives thereof or a salt thereof is a test sample containing a biological sample, a compound of the present invention, etc. When mixed with the reagent for quantification, the concentration in the total amount of the mixture is included in the reagent for detection or quantification so that the concentration is not less than the concentration calculated by the following formula A, and more preferably, the following formula B It is contained in the reagent for detection or quantification so as to be equal to or higher than the concentration calculated by In addition, the upper limit of the concentration of at least one compound selected from the group consisting of EGTA, BAPTA and derivatives thereof in the total amount of the mixture or a salt thereof is not limited, but examples include a concentration of 10 mM or less. .

Formula A
{[Biological sample in test sample (volume)] / [Total amount (volume) of mixture of test sample and detection or quantification reagent]} × 2 (mM)

Formula B
{[Biological sample in test sample (volume)] / [Total amount (volume) of mixture of test sample and detection or quantification reagent]} × 3 (mM)

When a biological sample is used as it is as a test sample without dilution, the test sample is 2 μl, the reagent containing the compound of the present invention is 2 μl, the oligonucleotide containing reagent is 16 μl, and the total amount of these mixtures is 20 μl In this case, the calculation using Equation A is as follows.
[Concentration of the compound of the present invention in the total amount of the mixture of the test sample, the reagent containing the compound of the present invention and the reagent containing the oligonucleotide] is (2/20) × 2 (mM) = 0.2 (mM) More specifically, in this example, the compound of the present invention has a concentration in the total amount of a mixture of a test sample containing a biological sample, a reagent containing the compound of the present invention, and a reagent containing an oligonucleotide. It is contained in the reagent containing the compound of the present invention so as to be 0.2 mM or more.

In another example, when a biological sample is used as it is as a test sample without dilution, the test sample is 4 μl, and the detection or quantification reagent containing the compound of the present invention and the oligonucleotide is 16 μl. When the total amount is 20 μl, the calculation using Equation B is as follows.
[Concentration of the compound of the present invention in the total amount of the mixture of the test sample, the compound of the present invention and the detection or quantification reagent containing the oligonucleotide] is (4/20) × 3 (mM) = 0.6 (mM In other words, in this example, the compound of the present invention contains the test sample containing the biological sample and the detection or quantification reagent containing the compound of the present invention and the oligonucleotide in the total amount of the mixture. It is contained in the reagent for detection or quantification so that the concentration is 0.6 mM or more.
In yet another example, when a test sample obtained by diluting a biological sample 5 times is used, the test sample is 10 μl (biological sample 2 μl + diluted solution 8 μl), the reagent containing the compound of the present invention is 4 μl, the oligonucleotide When the reagent is 6 μl and the total amount of these mixtures is 20 μl, the calculation using Equation B is as follows.
[Concentration of the compound of the present invention in the total amount of the mixture of the test sample, the reagent containing the compound of the present invention and the reagent containing the oligonucleotide] is (2/20) × 3 (mM) = 0.3 (mM) That is, in this example, the compound of the present invention has a concentration in the total amount of the mixture of a test sample containing a biological sample, a reagent containing the compound of the present invention, and a reagent containing an oligonucleotide. It is contained in the reagent containing the compound of the present invention so as to be 0.3 mM or more.

Thus, those skilled in the art can determine the concentration of the compound of the present invention in the total amount of the mixture by using the above formula A or B. Moreover, if the said density | concentration is determined, the amount and density | concentration of the compound of this invention etc. which are used for the reagent containing the compound of this invention etc. can be determined like the above.
Thereby, this invention functions more effectively and can detect or quantify the target nucleic acid contained in a test sample more rapidly and accurately.

  In the detection or quantification reagent of the present invention, the compound or the like of the present invention or a hydrate thereof can be used as it is, or it can be dissolved in a solvent and used in the form of a solution. Examples of such a solvent include water and a buffer solution. There are no limitations on the type of buffer, general acetate buffer, phosphate buffer, Tris-HCl buffer, phosphate-citrate buffer, MES, ADA, PIPES, ACES, BES, MOPS, TES HEPES, Tricine, Bicine, TAPS, CHES, CAPS, and the like can be used. The pH of the buffer can be appropriately set by those skilled in the art, and is, for example, pH 6.0 to 10.0, preferably pH 7.0 to 9.0, and more preferably pH 8.0 to 8.5.

(2) Oligonucleotide The oligonucleotide used in the present invention is not limited as long as it contributes to amplification of the target nucleic acid, and examples thereof include oligonucleotide primers. The oligonucleotide can be easily designed and synthesized by those skilled in the art depending on the base sequence of the target nucleic acid to be detected or quantified and the nucleic acid amplification method used. For example, base sequence information of a microorganism from which the target nucleic acid is derived is obtained from known gene information and gene databases (for example, NCBI GenBank, etc.), and a region specific to the microorganism (for example, a conserved region in the case of a virus, a toxin) In the case of a bacterium having the above, a base sequence of a toxin protein-encoding region) is selected, and a nucleic acid having the base sequence is selected as a target nucleic acid. Next, based on known gene information and gene databases (for example, NCBI GenBank, etc.), Primer express (manufactured by Applied Biosystems, Inc.) so that all or part of the target nucleic acid can be amplified by any nucleic acid amplification method. It is possible to design by using production software such as The primer has, for example, a length of at least 10 bases, preferably at least 15 bases, more preferably at least 20 bases. In addition, oligonucleotides specifically designed and commercialized for amplifying or detecting or quantifying a specific target nucleic acid can also be used.
For example, in the case of human cytomegalovirus, DNA containing the human cytomegalovirus glycoprotein H gene can be selected as a target nucleic acid, and primers can be designed so that all or part of the target nucleic acid can be amplified. (Eiko Fukushima, et al., Journal of Virological Methods 151 (2008) 55-60).
Moreover, the primer used for nucleic acid amplification reaction can be used with the combination (primer set) of a some primer. The number of primers included in the primer set is not limited, and can be set as appropriate according to the type of nucleic acid amplification method described below.

(3) Nucleic Acid Amplification Method In the present invention, the target nucleic acid can be amplified by any nucleic acid amplification method. Examples of the nucleic acid amplification method that can be used in the present invention include a method using a reaction involving temperature change (temperature cycle) and a method using an isothermal nucleic acid amplification reaction (hereinafter also referred to as “isothermal nucleic acid amplification method”). It is done. In the present invention, the target nucleic acid is preferably amplified by an isothermal nucleic acid amplification method.
As a method using a reaction with temperature change, PCR method (White, TJ et al., Trends Genet., 5, 185 (1989)), RT-PCR method, LCR method (Ligase Chain Reaction: Barany, F., Proc. Natl. Acad. Sci. USA, Vol. 88, p.189-193, 1991). As isothermal nucleic acid amplification methods, SmartAmp (Smart Amplification Process) method (Patent No. 3897805), LAMP (Loop-Mediated Isothermal Amplification) method (Patent No. 3313358), SDA method (Strand Displacement Amplification: Edward L) Chan et al, Arch. Pathol. Lab. Med., 124: 1649-1652, 2000), ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids) method, TMA (Transcription Mediated Amplification) method, NASBA (Nucleic Acid Examples include, but are not limited to, sequence-based amplification (RCA) method, rolling circle amplification (RCA) method, Transcription Reverse Transcription Concerted Reaction (TRC) method, and HDA (Helicase-dependent isothermal DNA amplification) method.
In the present invention, amplification of the target nucleic acid is performed by PCR, RT-PCR, LCR, SmartAmp, LAMP, RT-LAMP, SDA, ICAN, TMA, NASBA, RCA, TRC. And a method selected from the group consisting of HDA methods, and from the viewpoint of simplicity and rapidity of the amplification reaction operation, it is more preferable to use the SmartAmp method or LAMP method. In the present invention, the “SmartAmp method” includes a SmartAmp2 (Smart Amplification Process 2) method.

  The PCR method, RT-PCR method, LCR method, SmartAmp method, LAMP method, SDA method, ICAN method, TMA method, NASBA method, RCA method, TRC method and HDA method are techniques well known to those skilled in the art. If it exists, it can implement easily based on well-known information.

The PCR method is a nucleic acid amplification reaction using PCR (polymerase chain reaction), and can amplify a large portion of a DNA portion sandwiched between two primers in a test tube. The PCR method is a method of amplifying a nucleic acid by a reaction cycle of heat denaturation of DNA, primer annealing, and extension reaction with DNA polymerase, and involves a temperature change (temperature cycle). There are various improved methods for PCR, such as RT-PCR.
The RT-PCR method is a method of synthesizing cDNA from RNA extracted from a biological sample by reverse transcription and amplifying a nucleic acid by PCR using the cDNA as a template. DNA fragments amplified by PCR are visualized and quantified by labeling with fluorescent substances such as ethidium bromide and SYBER (registered trademark) GREENI and II that specifically bind to DNA after agarose gel electrophoresis, for example. be able to.

  The SmartAmp method is a nucleic acid amplification method using an isothermal nucleic acid amplification reaction, and is a method using 2 to 6 primer sets and a strand displacement type DNA polymerase. This method is a method of using a combination of a primer capable of forming a stem-loop only when a target nucleic acid is amplified and a primer having a folding sequence at the 5 ′ end in a nucleic acid amplification method using a strand displacement reaction. It is. According to this method, since it becomes possible to synthesize target nucleic acids continuously under isothermal conditions, a special apparatus such as a thermal cycler is not required, and time required for temperature change is not required. An amplification product can be obtained in a short time, and nucleic acid amplification can be performed more rapidly and with higher accuracy than the PCR method.

  In the nucleic acid amplification reaction, even when the template nucleic acid is a double-stranded nucleic acid, it can be used as it is in the reaction. However, if necessary, the primer nucleic acid can be denatured into a single strand to obtain a primer for the template nucleic acid. Annealing can also be performed efficiently. Such a modification method includes a method of raising the temperature to about 95 to 98 ° C. As another method, it is possible to denature by raising the pH, but in this case, it is necessary to lower the pH in order to hybridize the primer to the target nucleic acid.

  Any strand-displacing DNA polymerase that can be used in the SmartAmp method may have any strand displacement activity (strand displacement ability), and any of room temperature, intermediate temperature, and heat resistance may be used. can do. Further, this polymerase may be either a natural body or a mutant with artificial mutation. Examples of such a polymerase include DNA polymerase. Furthermore, it is preferable that the DNA polymerase has substantially no 5 '→ 3' exonuclease activity. Examples of such DNA polymerase include Aac DNA polymerase having strand displacement activity derived from moderately thermophilic acidophile Alicyclobacillus acidocaldarius (Aac), Bst DNA polymerase derived from Bacillus stearothermophilus, Bacillus cardio Examples include Bac DNA polymerase derived from Tenac (Bacillus caldotenax), Csa DNA polymerase, Klenow fragment of DNA polymerase I derived from E. coli, but from the group consisting of Aac DNA polymerase, Bst DNA polymerase and Csa DNA polymerase At least one DNA polymerase selected is preferred, and Aac DNA polymerase is more preferred.

  The nucleic acid amplification reaction using the above primer set can be performed isothermally. Therefore, this nucleic acid amplification reaction includes a step of incubating a mixture of the test sample, the first reagent and the second reagent in the present invention isothermally. Here, “isothermal” refers to maintaining an approximately constant temperature condition such that the enzyme and the primer can substantially function. Furthermore, the “substantially constant temperature condition” means that not only the set temperature is accurately maintained but also a temperature change that does not impair the substantial functions of the enzyme and the primer is allowed. To do.

  The nucleic acid amplification reaction under a certain temperature condition can be carried out by keeping the temperature at which the activity of the enzyme used can be maintained. In this nucleic acid amplification reaction, in order for the primer to anneal to the target nucleic acid, for example, the reaction temperature is preferably set to a temperature near the melting temperature (Tm) of the primer or lower, and further, It is preferable to set the stringency level in consideration of the melting temperature (Tm) of the primer. Accordingly, this temperature is preferably about 20 ° C to about 75 ° C, more preferably about 35 ° C to about 65 ° C, and even more preferably about 60 ° C to about 65 ° C.

Details such as the nucleic acid amplification mechanism of the SmartAmp method are described in International Publication WO 2005/063977 (Patent No. 3897805) and International Publication WO 2004/040019 (Patent No. 3867926), etc. A person skilled in the art can design a primer based on these documents and the description in the present specification, and perform the SmartAmp method.
Reagents for amplifying nucleic acids by the SmartAmp method can be obtained from Danaform Co., Ltd.

The LAMP method anneals its 3 'end to the template nucleotide and uses it as a starting point for complementary strand synthesis. By combining primers that anneal to the loop formed at this time, isothermal complementary strand synthesis reaction is performed. This is a possible nucleic acid amplification method.
In the LAMP method, using an inner primer pair or an outer primer pair, further adding a loop primer pair, two, four or six specific primers, a strand displacement polymerase and a substrate nucleotide, Amplify the target nucleic acid under isothermal conditions.

  In the LAMP method, sequences complementary to each other are generated on the same strand of the amplified product, and these are annealed to form a hairpin-like loop, and an elongation reaction by the polymerase starting from the loop occurs. At the same time, a strand displacement type extension reaction occurs from the primer annealed in the loop, and the extension product is dissociated into single strands. Since the dissociated single strand also has a complementary sequence at the end, this reaction occurs repeatedly. Thus, in the LAMP method, since the extension reaction and the amplification reaction proceed simultaneously at multiple positions on the same strand of the amplification product, DNA amplification can be achieved exponentially and under isothermal conditions, and a small amount of nucleic acid can be efficiently used. Can be amplified.

Details of the primer and reaction mechanism of the LAMP method are described in International Publication WO 00/28082 (Patent No. 3313358) and the like, and those skilled in the art will be able to describe these documents and this specification. Primers can be designed based on the above and the LAMP method can be performed.
Reagents for amplifying nucleic acids by the LAMP method can be obtained from Eiken Chemical Co., Ltd.

  In the present invention, it is preferable to perform real-time detection or quantification using a real-time PCR apparatus in combination with the nucleic acid amplification method. Real-time PCR devices include real-time PCR devices such as Mx3000p QPCR System (Agilent Technology Co., Ltd.) and ABIPRISM7500 (Applied Biosystems Co., Ltd.), which detect and monitor amplification products in real time to detect or quantify target nucleic acids. Is possible. The amplified DNA can be detected with a fluorescent substance such as SYBER GREEN I described above. In the real-time PCR method, a fluorescent probe can be used in combination with a primer.

  In a real-time PCR device, a threshold is set for a certain fluorescence intensity (fluorescence) to be detected, and the target nucleic acid with a known concentration is amplified when the detected fluorescence intensity reaches the threshold when the test sample is amplified. The target nucleic acid contained in the test sample can be quantified (or measured) more accurately by comparing with the time when the detected fluorescence intensity reaches the threshold value. The threshold value is not limited as long as it is a value set so that the samples can be compared with each other. For example, the threshold value can be set within the range of the fluorescence intensity in the logarithmic amplification phase of the nucleic acid amplification curve. Such a threshold can be easily set by those skilled in the art. Regarding the determination of the presence or absence (positive or negative) of the target nucleic acid contained in the test sample, the threshold value is set to a value that allows the fluorescence intensity associated with the amplification reaction to be sufficiently discriminated compared to the fluorescence intensity before amplification. A test sample whose fluorescence intensity reaches a threshold value within a time period can be determined as positive, and a test sample whose fluorescence intensity does not reach a threshold value within a certain time can be determined as negative.

(4) Other Reagents The reagent for detecting or quantifying the target nucleic acid of the present invention may contain a reagent for amplifying and / or detecting or quantifying the nucleic acid in addition to the oligonucleotide for amplifying the target nucleic acid. . Examples of such a reagent include, but are not limited to, a nucleic acid amplification reaction mixture, a coloring reagent, and a DNA polymerase.

Examples of the mixture for nucleic acid amplification reaction include, but are not limited to, a substrate such as dNTPs, a buffer solution such as Tris-HCl buffer, tricine buffer, sodium phosphate buffer, potassium phosphate buffer, magnesium chloride (MgCl ₂ ), A catalyst such as potassium chloride (KCl), ammonium sulfate (NH ₄ ) ₂ SO ₄ and magnesium sulfate (MgSO ₄ ), and a surfactant (such as Tween 20). In addition, a fluorescent probe can be included.

In addition, a melting temperature adjusting agent can be added to the amplification reaction mixture in order to increase the amplification efficiency of the nucleic acid. The melting temperature adjusting agent used in the present invention and its concentration in the reaction solution are appropriately selected by those skilled in the art in consideration of other reaction conditions that affect the hybridization conditions, such as salt concentration, reaction temperature, etc. The
The melting temperature adjusting agent is not particularly limited, but is preferably dimethyl sulfoxide (DMSO), betaine, formamide or glycerol, or any combination thereof, and more preferably dimethyl sulfoxide (DMSO) or betaine.

  The coloring reagent is a reagent that emits fluorescence by binding to a nucleic acid, and can be used instead of a fluorescent probe. Examples of the coloring reagent used in the present invention include, but are not limited to, a reagent that emits fluorescence by binding to double-stranded DNA, for example, SYBR (registered trademark) GreenI. Real-time PCR (quantitative PCR, qPCR) using SYBR (registered trademark) Green I does not require the preparation of a special fluorescent-labeled probe for each target nucleic acid, and is inexpensive in terms of cost. it can.

  As described above, the DNA polymerase includes Aac DNA polymerase, Bca DNA polymerase (BcaBEST DNA polymerase, Bca (exo-) DNA polymerase, etc.), Bst DNA polymerase, Csa DNA polymerase, Klenow fragment, Vent DNA polymerase, Vent (Exo -) DNA polymerase, DeepVent DNA polymerase, DeepVent (Exo-) DNA polymerase, Φ29 phage DNA polymerase, MS-2 phage DNA polymerase, Z-Taq DNA polymerase, Pfu DNA polymerase, Pfu turbo DNA polymerase, KOD DNA polymerase, 9 ° Examples include Nm DNA polymerase, Therminater DNA polymerase, and the like, but at least one DNA polymerase selected from the group consisting of Aac DNA polymerase, Bst DNA polymerase, and Csa DNA polymerase is preferable. The type of DNA polymerase can be appropriately selected by those skilled in the art according to the nucleic acid amplification method used. For example, Aac DNA polymerase can be selected when SmartAmp method is used, and Bst DNA polymerase or Csa DNA polymerase can be selected when LAMP method is used, but is not limited thereto.

Furthermore, an enzyme stabilizer may be added to the target nucleic acid detection or quantification reagent of the present invention. Thereby, since the enzyme in the reaction solution is stabilized, the amplification efficiency of the nucleic acid can be increased. The enzyme stabilizer used in the present invention may be any known in the art, such as glycerol, bovine serum albumin, and saccharides, and is not particularly limited.
Furthermore, in the reagent for detecting or quantifying the target nucleic acid of the present invention, a reagent for enhancing the heat resistance of an enzyme such as DNA polymerase or reverse transcriptase can be added to the reaction solution as an enzyme stabilizer. . As a result, the enzyme in the reaction solution is stabilized, so that the nucleic acid synthesis efficiency and amplification efficiency can be increased. Such a reagent may be any known in the art and is not particularly limited, but is preferably a saccharide, more preferably a mono- or oligosaccharide, more preferably trehalose, sorbitol or mannitol, or these The mixture of 2 or more types of these is mentioned.

The reagent kit for detecting or quantifying the target nucleic acid of the present invention may be any kit as long as it contains at least a reagent containing the compound of the present invention and an oligonucleotide, and may contain other components. Examples of other components include a reaction container (such as a test tube) and an instruction manual. Also, some of the components of the detection or quantification reagent can be included in the kit as separate reagents.
In the present invention, “detection” of a target nucleic acid means confirmation of amplification of the target nucleic acid. For example, when a nucleic acid amplification reaction is performed, if the amount of amplification of the target nucleic acid contained in the test sample is higher than that of a control not containing the target nucleic acid, it can be said that the target nucleic acid contained in the test sample has been detected. In a more preferred embodiment, it can be said that the target nucleic acid has been detected when the amplification amount of the target nucleic acid contained in the test sample reaches a certain value within a certain time. In the present invention, “quantification” of the target nucleic acid means measuring the amount (for example, copy number) of the target nucleic acid contained in the test sample.

In the present invention, a target nucleic acid derived from a virus or bacteria can be amplified and detected or quantified. Therefore, for example, by detecting or quantifying a target nucleic acid derived from a virus or bacteria contained in a biological sample collected from an animal, it is possible to detect or diagnose viral infection or bacterial infection. That is, the reagent kit for detecting or quantifying the target nucleic acid of the present invention can be used for detecting or diagnosing viral infection or bacterial infection, and thus can be used as a diagnostic kit for viral infection or bacterial infection.
For example, by using the detection or quantification kit of the present invention, detection or quantification of a herpes virus-derived target nucleic acid contained in urine collected from a human patient, the presence or absence of herpes virus infection in the patient Diagnosis can be made. More specifically, it is possible to diagnose congenital cytomegalovirus infection by detecting or quantifying the target nucleic acid derived from human cytomegalovirus contained in urine collected from a newborn within 3 weeks of birth. In addition, by detecting or quantifying human cytomegalovirus-derived target nucleic acid contained in urine collected from infants, it is possible to diagnose the presence or absence of infection including acquired cytomegalovirus infection. .
As a target nucleic acid derived from human cytomegalovirus, DNA containing the base sequence of the glycoprotein H gene of human cytomegalovirus can be selected.

4). Method for detecting or quantifying target nucleic acid The present invention relates to ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis (o -Aminophenoxy) ethane-N, N, N ', N'-tetraacetic acid (BAPTA) and at least one compound selected from the group consisting of these derivatives, or a salt thereof, a test sample, and the target nucleic acid is amplified. And a method for detecting or quantifying the amplified target nucleic acid by mixing with an oligonucleotide for the purpose, performing an amplification reaction of the target nucleic acid in the mixture.
The present invention also relates to (a) ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane- A first reagent containing at least one compound selected from the group consisting of N, N, N ′, N′-tetraacetic acid (BAPTA) and derivatives thereof, or a salt thereof, a test sample, and a target nucleic acid A step of mixing with a second reagent containing the oligonucleotide of (b), and (b) a step of performing an amplification reaction of the target nucleic acid in the mixture obtained in step (a) and detecting or quantifying the amplified target nucleic acid. A method for detecting or quantifying a target nucleic acid is provided.

The step (a) may be a step of mixing the first reagent and the test sample, and mixing all or a part of the mixture with the second reagent, or the first reagent and the second sample. The step may be a step of mixing all or a part of the mixture with the test sample. Moreover, the process of mixing a test sample and a 2nd reagent and mixing all or one part of the mixture and a 1st reagent may be sufficient.
In the above step, the mixture of the first reagent and the second reagent (that is, the reagent containing the compound of the present invention and the oligonucleotide for amplifying the target nucleic acid) should be used as a single measuring reagent. Can do.
That is, in the step (a), a test sample is mixed with a reagent containing at least one compound selected from the group consisting of EGTA, BAPTA, and derivatives thereof, or a salt thereof, and an oligonucleotide for amplifying a target nucleic acid. It may be a process.
The description of the first reagent, the test sample, and the second reagent is as described above. In the present invention, mixing can be performed by a commonly used method. Examples of such a method include, but are not limited to, pipetting, tapping, and stirring with a stirrer (Vortex mixer or the like).
In the step (a), “all” of the mixture means the total amount of the mixture. For example, when the second reagent is added to the mixture of the first reagent and the test sample, the entire mixture of the first reagent and the test sample and the second reagent are mixed. The case where the mixture of a 1st reagent and a test sample is added to a reagent is mentioned. The “part” of the mixture means a solution of a part of the mixture. For example, for mixing a part of the mixture of the first reagent and the test sample and the second reagent, a part is taken from the mixture of the first reagent and the test sample, and this is used as the second reagent. When adding, the case where a 2nd reagent is added to a part of the said mixture is mentioned. The same applies to the mixing of other reagents.

Step (b) is a step of amplifying a target nucleic acid in a mixture (reaction mixture) of a first reagent, a test sample, and a second reagent by a nucleic acid amplification reaction, and detecting or quantifying the amplified target nucleic acid. .
The description of the nucleic acid amplification method that can be used in the present invention is as described above. In the nucleic acid amplification reaction, the entire reaction mixture can be used, or a part of the solution can be used.
The target nucleic acid amplified by the nucleic acid amplification reaction can be detected or quantified by any method. Examples of such a method include a real-time PCR apparatus, general gel electrophoresis, a method using a labeled probe, Northern blotting, Southern blotting, dot blot, and a method using immunochromatography. The method using is preferable. Detection or quantification using a real-time PCR apparatus can be performed using a real-time PCR apparatus such as Mx3000p QPCR System (Agilent Technology Co., Ltd.) or ABIPRISM7500 (Applied Biosystems Co., Ltd.). In the detection by gel electrophoresis, for example, it can be detected by a fluorescent substance such as ethidium bromide or SYBR (registered trademark) GreenI. Examples of the method using a labeled probe include a method of detecting by using a labeled probe having a label such as biotin and hybridizing it to an amplification product.

Moreover, in the method for detecting or quantifying the target nucleic acid of the present invention, viral infection or bacterial infection can be detected by selecting a target nucleic acid derived from a virus or bacteria as the target nucleic acid.
That is, the present invention relates to ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N , N ′, N′-tetraacetic acid (BAPTA) and derivatives thereof, at least one compound or a salt thereof, a test sample, and an oligonucleotide for amplifying a target nucleic acid derived from a virus or a bacterium And a method of detecting a viral infection or a bacterial infection, comprising the steps of performing amplification reaction of the target nucleic acid in the mixture, and detecting or quantifying the amplified target nucleic acid.
Moreover, in another aspect, this invention provides the method of detecting viral infection or bacterial infection including the following processes.
(a) Ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N' , N′-tetraacetic acid (BAPTA) and a first reagent containing at least one compound selected from the group consisting of these derivatives or a salt thereof, a test sample, and a target nucleic acid derived from a virus or bacteria Mixing with a second reagent comprising an oligonucleotide; and
(b) A step of performing an amplification reaction of the target nucleic acid in the mixture obtained in the step (a) and detecting or quantifying the amplified target nucleic acid.
The explanation regarding the steps (a) and (b) is the same as the method for detecting or quantifying the target nucleic acid.

In the present invention, if amplification of the target nucleic acid contained in the test sample occurs, it can be determined that virus infection or bacterial infection has been detected. In a more preferred embodiment, when the amount of target nucleic acid-derived nucleic acid contained in the test sample reaches a certain value within a certain time, it can be determined that virus infection or bacterial infection has been detected.
When a real-time PCR device is used as a detection method, a threshold is set for a certain fluorescence intensity (Fluorescence) to be detected, and the time when the detected fluorescence intensity when the test sample is amplified reaches the threshold within a specified time Can be quantified (or measured) the target nucleic acid contained in the test sample by comparing with the time when the detected fluorescence intensity when the target nucleic acid of known concentration is amplified reaches the threshold value, and thus more accurately the virus infection or Bacterial infection can be detected. The threshold value is not limited as long as it is a value set so that the samples can be compared with each other. For example, the threshold value can be set within the range of the fluorescence intensity in the logarithmic amplification phase of the nucleic acid amplification curve. In addition, for the detection or diagnosis of the presence or absence (positive or negative) of virus infection or bacterial infection, a value that allows the fluorescence intensity associated with the amplification reaction to be sufficiently distinguished from the fluorescence intensity before amplification is set as a threshold, and within a certain time The test sample whose fluorescence intensity has reached the threshold value can be detected or diagnosed as positive, and the test sample whose fluorescence intensity does not reach the threshold value within a certain time can be determined or diagnosed as negative. That is, the method of the present invention provides a diagnostic method in addition to a method for detecting viral infection or bacterial infection. Although the fixed time from the start of nucleic acid amplification reaction to detection is not limited, it is, for example, about 30 to 90 minutes, preferably about 30 minutes to 60 minutes, more preferably about 40 minutes to 60 minutes.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to these Examples.

Preparation of reagents First reagent The first reagent is ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA (GEDTA)) and 1,2-bis (o-amino) Phenoxy) ethane-N, N, N ′, N′-tetraacetic acid (BAPTA) (Dojindo Laboratories) was dissolved in a 10 mM Tris-HCl (pH 8.0) solution.

2. Second Reagent The second reagent was prepared so that real-time PCR can be performed using various nucleic acid amplification methods. In this example, a reagent for carrying out the SmartAmp method (SmartAmp method reagent) and a reagent for carrying out the LAMP method (LAMP method reagent) were prepared as the second reagent. The composition and production method of each reagent are shown below. The concentration in the composition of each reagent indicates the final concentration relative to the total amount of the mixture of the test sample, the first reagent, and the second reagent (reaction mixture).
(1) SmartAmp reagent
(i) Reagent composition
2 x Reaction Mix (D) dNTPs 1.4 mM each
DMSO 5%
Tris-HCl (pH 8.0) 20 mM
KCl 10 mM
(NH ₄ ) ₂ SO ₄ 10 mM
MgSO ₄ 8 mM
Tween20 0.1%
SYBR (registered trademark) Green I 0.0012%
Aac DNA polymerase 4.8 U
Primer mixture 6 μM

In the above composition, 2 x Reaction Mix (D) and Aac DNA polymerase were purchased from Danaform Co., Ltd., and SYBR (registered trademark) Green I was purchased from Takara Bio Inc. The primer mixture was purchased from Sigma-Aldrich, and the water used for the reagent (PCR Grade) was purchased from Roche Diagnostics.

(ii) Primer mixture The primer mixture was prepared by mixing the following primers (100 μM) of TP, FP, BP, OP1 and OP2 at a ratio of 8: 8: 4: 1: 1.
TP 5'- CGCGTCTCTCCAAGAACTCTACCTCATG (SEQ ID NO: 4)
FP 5'- TTTATATATATATAAACGTTTCTACGATGAAGAT (SEQ ID NO: 5)
BP 5'- CATGGAGTGGACGA (SEQ ID NO: 6)
OP1 5'-GCCGACTTTGCCCTA (SEQ ID NO: 7)
OP2 5'- CAACTGCGTAAAGTGTG (SEQ ID NO: 8)

(2) LAMP reagent
(i) Reagent composition
2 x Reaction Mix dNTPs 1.4 mM each
Betaine 0.8 M
Tris-HCl (pH 8.8) 20 mM
KCl 10 mM
(NH ₄ ) ₂ SO ₄ 10 mM
MgSO ₄ 8 mM
Tween20 0.1%
SYBR (registered trademark) Green I 0.0012%
Bst DNA polymerase 4%
Primer mixture 5 μM

In the above composition, 2 × Reaction Mix (RM) and Bst DNA polymerase were those of Loopamp DNA amplification reagent kit (Eiken Chemical Co., Ltd.). The sources of SYBR (registered trademark) Green I, primer mixture and water (PCR Grade) are the same as described above.

(ii) Primer mixture The primer mixture is prepared by mixing the following FIP, BIP, LPF, LPB, F3 and B3 primers (100 μM) in a ratio of 8: 8: 4: 4: 1: 1. Produced. The nucleotide sequence of each primer was according to Table 1 of Eiko Fukushima, et al., Journal of Virological Methods 151 (2008) 55-60.
FIP (F1c-F2) 5'- gatttcgcgtctctccgtcgt-gaactctacctcatgggcag (SEQ ID NO: 9)
BIP (B1-B2c) 5'- catcgtagaaacgggcctctg-tgcggatgagctagcaactg (SEQ ID NO: 10)
LPF (LPFc) 5'- tgtaccaacatggagtggac (SEQ ID NO: 11)
LPB (LPB) 5'- cattggccgagctatcacactt (SEQ ID NO: 12)
F3 (F3) 5'-ggcctcttttctttcagcct (SEQ ID NO: 13)
B3 (B3c) 5'-gggtgtgtacaggtcgct (SEQ ID NO: 14)

1. Detection of target nucleic acid in virus-positive urine using EGTA-containing reagent and SmartAmp method reagent Preparation of virus-positive urine In this example, a sample (virus-positive urine) obtained by adding a human cytomegalovirus (HCMV) solution to urine determined to be CMV-negative as a result of real-time PCR was used as a test sample. The ratio of the HCMV solution contained in the test sample is 0.25%.
The negative urine (urine that does not contain HCMV) was collected from a healthy human with a urine collection pack or a paper cup.
The HCMV solution was prepared as follows.
First, the HCMV towne strain was obtained from ATCC (American Type Culture Collection) and inoculated into a human fetal lung-derived normal fibroblast cell line (HFL-III). The inoculated cell line was cultured in a medium in which FBS was added to D-MEM / Ham's F-12 with L-Glutamine and Phenol Red (Wako) and grown by a general method. The culture solution after the proliferation of the cells was centrifuged, and the supernatant collected after centrifugation was used as an HCMV solution (5 × 10 ⁶ pfu / mL).

2. Detection of target nucleic acid in virus-positive urine (1) Method
The first reagent containing EGTA at each concentration shown in Tables 2 to 4 is added to a 0.2 mL PCR tube (Agilent Technologies) in the amount shown in Table 1 below (2, 3 or 4 μl). An additional 2 μl was added and spun down. Next, heat treatment (at 98 ° C. for 30 seconds) was performed, followed by ice cooling. As shown in Table 1, the second reagent was added thereto, followed by spin-down, and then nucleic acid amplification reaction and target nucleic acid detection by SmartAmp method were performed using Mx3000p QPCR System (Agilent Technologies Inc.). Table 1 below shows the composition of a mixture (reaction mixture) of the test sample, the first reagent, and the second reagent. Of the following composition, the water volume is appropriately selected as 2, 3 or 4 μl depending on the amount of test sample added so that the volume of the mixture of the test sample, first reagent and second reagent is 20 μl. did.

Table 1

Nucleic acid amplification reaction and target nucleic acid detection by the SmartAmp method were performed under the following conditions.
Reaction time: Reaction at 60 ° C. for 60 minutes.
Measurement wavelength: detected at excitation 492 nm, fluorescence 516 nm.
Judgment criteria for detection: The amount of change in fluorescence intensity relative to the fluorescence intensity before amplification (hereinafter referred to as “Fluorescence (dR)”) is compared with the time (minutes) to reach 4000, and positive when it reaches 4000 within 60 minutes It was determined.

(2) Detection result
(i) Detection results when the ratio of the test sample to the total reaction mixture is 10% The detection results are shown in Table 2 below.
Table 2

As shown in Table 2 above, when the first reagent containing no EGTA (0 mM) was used, Fluorescence (dR) did not reach 4000 within 60 minutes in any of Samples 1 to 3 ( That is, the detection result was negative). On the other hand, when the first reagent having an EGTA concentration of 1 mM (concentration with respect to the total amount of the reaction mixture is 0.1 mM) or more is used, in Sample 1, the Fluorescence (dR) reaches 4000 within 60 minutes, Positive. In addition, when the first reagent with an EGTA concentration of 2 mM (concentration with respect to the total amount of the reaction mixture is 0.2 mM) or more, Fluorescence (dR) reaches 4000 within 60 minutes in any of samples 1 to 3. , Showed positive.

(ii) Detection results when the ratio of the test sample to the total reaction mixture is 15% The detection results are shown in Table 3 below.
Table 3

  As shown in Table 3 above, when the first reagent not containing EGTA (0 mM) was used, Fluorescence (dR) did not reach 4000 within 60 minutes in any of Samples 4 to 6 ( That is, the detection result was negative). On the other hand, when the first reagent having an EGTA concentration of 1.5 mM (concentration with respect to the total amount of the reaction mixture is 0.15 mM) or more, Fluorescence (dR) reaches 4000 in Sample 5 within 60 minutes, and positive. Indicated. In addition, when the first reagent with an EGTA concentration of 4.5 mM (concentration with respect to the total amount of the reaction mixture is 0.45 mM) or more, Fluorescence (dR) reaches 4000 within 60 minutes in any of Samples 4 to 6. , Showed positive.

(iii) Detection results when the ratio of the test sample to the total reaction mixture is 20% The detection results are shown in Table 4 below.
Table 4

In the table, “-” indicates that measurement is not performed.

  As shown in Table 4 above, when the first reagent not containing EGTA (0 mM) was used, Fluorescence (dR) did not reach 4000 within 60 minutes in any of Samples 7 and 8 ( That is, the detection result was negative). On the other hand, when the first reagent having an EGTA concentration of 4 mM (concentration with respect to the total amount of the reaction mixture is 0.4 mM) or more, Fluorescence (dR) reaches 4000 within 60 minutes in the specimen 8 and is positive. showed that. In addition, when the first reagent having an EGTA concentration of 6 mM (concentration with respect to the total amount of the reaction mixture is 0.6 mM) or more, Fluorescence (dR) reaches 4000 within 60 minutes in both specimens 7 and 8. , Showed positive.

  As described above, from the results of this example, by using the first reagent containing EGTA and the second reagent containing the oligonucleotide for amplifying the target nucleic acid by the SmartAmp method, the nucleic acid was not purified from the test sample. It was shown that the target nucleic acid derived from HCMV contained in urine can be detected. In addition, by using the first reagent containing EGTA so that the concentration of EGTA relative to the total amount of the reaction mixture is equal to or higher than the concentration calculated by the above formula A or B, detection is possible when a reagent not containing EGTA is used. It was shown that target nucleic acids derived from HCMV in urine that could not be detected can be detected.

1. Detection of target nucleic acid in virus-positive urine using BAPTA-containing reagent and SmartAmp method reagent Method In this example, the same method as in Example 2 was used, except that the first reagent containing BAPTA at each concentration shown in Table 6 was used instead of EGTA.
Table 5 below shows the composition of the mixture (reaction mixture) of the test sample, the first reagent, and the second reagent in this example. Of the following composition, 4 μl of water was added such that the volume of the mixture of the test sample, the first reagent and the second reagent was 20 μl.
Table 5

2. Detection results The detection results are shown in Table 6 below.
Table 6

  As shown in Table 6 above, when the first reagent not containing BAPTA (0 mM) was used, Fluorescence (dR) did not reach 4000 within 60 minutes in any of Samples 9 to 11 ( That is, the detection result was negative). On the other hand, when the first reagent with a BAPTA concentration of 2 mM (concentration with respect to the total amount of the reaction mixture is 0.2 mM) or more is used, the Fluorescence (dR) reaches 4000 within 60 minutes in any of the specimens 9 to 11. Reached and showed positive.

  From the results of this example, by using the first reagent containing BAPTA and the second reagent containing the oligonucleotide for amplifying the target nucleic acid by the SmartAmp method, urine was purified without purifying the nucleic acid from the test sample. It was shown that the target nucleic acid derived from HCMV contained in can be detected. It was also shown that the HCMV-derived target nucleic acid contained in urine can be detected within 60 minutes by using the first reagent containing BAPTA so that the concentration of BAPTA relative to the total amount of the reaction mixture is 0.2 mM or more. . Furthermore, by using the first reagent containing BAPTA so that the concentration of BAPTA with respect to the total amount of the reaction mixture is equal to or higher than the concentration calculated by the above formula A or B, detection is performed when a reagent not containing BAPTA is used. It was shown that target nucleic acids derived from HCMV in urine that could not be detected can be detected.

1. Detection of target nucleic acid in virus-positive urine using EGTA-containing reagent and LAMP reagent Method In this example, the same method as in Example 2 was used, except that the LAMP method reagent was used as the second reagent instead of the SmartAmp method reagent.
Table 7 below shows the composition of the mixture (reaction mixture) of the test sample, the first reagent, and the second reagent in this example. Of the following composition, 3 μl of water was added such that the volume of the mixture of the test sample, the first reagent and the second reagent was 20 μl.
Table 7

Nucleic acid amplification reaction and target nucleic acid detection by the LAMP method were performed under the following conditions.
Reaction time: Reaction at 60 ° C. for 45 minutes.
Measurement wavelength: detected at excitation 492 nm, fluorescence 516 nm.
Detection criteria: The time (minutes) at which Fluorescence (dR) reaches 1000 was compared, and the case where it reached 1000 within 45 minutes, which is a general determination time in the LAMP method, was detected.

(2) Detection results The detection results are shown in Table 8 below.
Table 8

  As shown in Table 8 above, when the target nucleic acid was amplified by the LAMP method, when the first reagent not containing EGTA (0 mM) was used, the Fluorescence (dR) in the sample 13 was within 45 minutes. Did not reach 1000. On the other hand, when the first reagent having an EGTA concentration of 1.5 mM (concentration with respect to the total amount of the reaction mixture is 0.15 mM) or more is used, the fluorescence (dR) reaches 1000 within 45 minutes in both the samples 12 and 13. Reached.

  From the results of this example, by using the first reagent containing EGTA and the second reagent containing the oligonucleotide for amplifying the target nucleic acid by the LAMP method, the urine was purified without purifying the nucleic acid from the test sample. It was shown that the target nucleic acid derived from HCMV contained in can be detected. It was also shown that the HCMV-derived target nucleic acid contained in urine can be rapidly detected within 45 minutes by using the first reagent containing EGTA so that the concentration of EGTA relative to the total amount of the reaction mixture is 0.45 mM or higher. It was done. Furthermore, by using the first reagent containing EGTA so that the concentration of EGTA relative to the total amount of the reaction mixture is equal to or higher than the concentration calculated by the above formula A or B, detection is possible when a reagent not containing EGTA is used. It was shown that target nucleic acids derived from HCMV in urine that could not be detected can be detected.

1. Detection of target nucleic acid in virus-positive saliva using EGTA-containing reagent and SmartAmp method reagent Preparation of virus-positive saliva In this example, a sample (virus-positive saliva) obtained by adding a human cytomegalovirus (HCMV) solution to saliva determined to be CMV-negative as a result of real-time PCR was used as a test sample. The ratio of the HCMV solution contained in the test sample is 0.25%.
The negative saliva (saliva not containing HCMV) was collected from a healthy human in a 1.5 ml tube.
The HCMV solution was prepared in the same manner as described in Example 2.

2. Detection of target nucleic acid in virus-positive saliva (1) Method In this example, the same procedure as in Example 2 was used, except that virus-positive saliva was used instead of virus-positive urine as a test sample.
Table 9 below shows the composition of the mixture (reaction mixture) of the test sample, the first reagent, and the second reagent in this example. Of the following composition, 4 μl of water was added such that the volume of the mixture of the test sample, the first reagent and the second reagent was 20 μl.
Table 9

Nucleic acid amplification reaction and target nucleic acid detection by the SmartAmp method were performed under the following conditions.
Reaction time: Reaction at 60 ° C. for 60 minutes.
Measurement wavelength: detected at excitation 492 nm, fluorescence 516 nm.
Detection criteria: The time (minutes) for Fluorescence (dR) to reach 1000 was compared, and the case where it reached 1000 within 60 minutes was determined as positive.

(2) Detection results The detection results are shown in Table 10 below.
Table 10

  As shown in Table 10 above, when virus-positive saliva was used as the test sample, when the first reagent containing no EGTA (0 mM) was used, fluorescence ( dR) did not reach 1000 (ie the detection result was negative). On the other hand, when the first reagent having an EGTA concentration of 10 mM (concentration relative to the total amount of the reaction mixture is 1 mM) or more is used, the fluorescence (dR) reaches 1000 within 60 minutes in either of the specimens 14 and 15. Reached and showed positive.

  From the results of this Example, saliva was obtained without purifying the nucleic acid from the test sample by using the first reagent containing EGTA and the second reagent containing the oligonucleotide for amplifying the target nucleic acid by the SmartAmp method. It was shown that the target nucleic acid derived from HCMV contained in can be detected. Moreover, it was shown that the target nucleic acid derived from HCMV contained in saliva can be detected by using the first reagent containing EGTA so that the concentration of EGTA with respect to the total amount of the reaction mixture is 1 mM or more.

1. Detection of target nucleic acid in positive urine using EGTA-containing reagent and SmartAmp method reagent Preparation of positive urine In this example, unlike the virus-positive urine used in Examples 2 to 4, urine collected from a human actually infected with HCMV (positive urine) was used as a test sample. The age of the human is 0-6 years.
In order to demonstrate that the target nucleic acid contained in positive urine can be detected in this example, a preliminary test for confirming that the test sample is positive urine (contains HCMV genome in the urine) is as follows: I went as follows.
First, urine collected from five humans was purified by genome using QIAamp DNA Mini kit (QIAGEN), then measuring device: Mx3000p QPCR System (Agilent Technologies), measuring reagent: Brilliant III Ultra-Fast QPCR Master Real-time PCR was performed using a mix probe (Agilent Technologies) to quantify the CMV genome. Primers and probes used for real-time PCR were prepared as described in Eiko Fukushima, et al., Journal of Virological Methods 151 (2008) 55-60.
As a result of quantification by real-time PCR, 5 urine samples determined to be CMV positive (CMV genome: 5000copies / mL urine or more) were used as positive urine in this Example without purification (sample numbers S1 to S5).
In addition to these 5 samples of positive urine, 11 people from unpurified urine (hereinafter referred to as “CMV genome strongly positive urine”) that have been found to contain 10 ⁶ copies / mL urine or more of CMV genome. Positive urine (hereinafter referred to as “strongly positive urine”) added to each unpurified negative urine sample collected from humans at a rate of 10% was prepared (sample numbers S6 to S15).

2. Detection of target nucleic acid in positive urine (1) Method In this example, the same procedure as in Example 2 was used except that positive urine or strong positive urine collected from a human infected with HCMV was used instead of virus-positive urine. Using. As the first reagent, one containing EGTA at a concentration of 0 or 10 mM was used.
Table 11 below shows the composition of the mixture (reaction mixture) of the test sample, the first reagent, and the second reagent in this example. In the following table, “positive urine” represents positive urine or strongly positive urine.
Table 11

(2) Detection result
(i) Detection result of strong positive urine The detection result of strong positive urine is shown in Table 12 below.
Table 12

As shown in Table 12 above, when strongly positive urine is used as a test sample, the first reagent (EGTA- (0 mM)) containing no EGTA is used in any of sample numbers S6 to S15. A remarkable difference was confirmed when the first reagent having an EGTA concentration of 10 mM (concentration with respect to the total amount of the reaction mixture was 1 mM) was used.
In particular, for specimen numbers S10, S12, and S15, when the first reagent of EGTA- was used, Fluorescence (dR) did not reach 4000 within 60 minutes. On the other hand, when the first reagent with an EGTA concentration of 10 mM (concentration with respect to the total amount of the reaction mixture is 1 mM), Fluorescence (dR) reached 4000 within 60 minutes in all specimens, and positive. Indicated.

(ii) Detection result of positive urine The detection result of positive urine is shown in Table 13 below.
Table 13

As shown in Table 13 above, when positive urine was used as the test sample, the concentration of EGTA was the same as that when using the first reagent (EGTA- (0 mM)) not containing EGTA in specimen numbers S2 to S5. A significant difference was observed when the first reagent of 10 mM (concentration with respect to the total amount of the reaction mixture was 1 mM) was used.
In particular, for specimen numbers S2 and S5, when the first reagent of EGTA- was used, Fluorescence (dR) did not reach 4000 within 60 minutes (that is, the detection result was negative). On the other hand, when the first reagent with an EGTA concentration of 10 mM (concentration with respect to the total amount of the reaction mixture is 1 mM), Fluorescence (dR) reached 4000 within 60 minutes in all specimens, and positive. Indicated.

  As described above, even when positive urine collected from a human infected with CMV is used from the results of this example, the first reagent containing EGTA and the oligonucleotide containing the oligonucleotide for amplifying the target nucleic acid by the SmartAmp method are used. It was shown that by using the two reagents, the target nucleic acid derived from HCMV contained in urine can be detected without purifying the nucleic acid from the test sample. Moreover, it was shown that the target nucleic acid derived from HCMV in urine that could not be detected when using a reagent not containing EGTA can be detected by the present invention.

Detection of target nucleic acid in herpes simplex virus type 1 (HSV-1) positive urine In this example, detection of a target nucleic acid of herpes simplex virus type 1 (HSV-1) was performed. Further, the detection was performed using a single reagent containing EGTA and the LAMP method reagent without dividing the reagent used for detecting the target nucleic acid into the first reagent and the second reagent.

1. Preparation of Reagent First, a reagent (hereinafter referred to as “measurement reagent”) containing EGTA and a LAMP method reagent was prepared. The composition and production method of the measurement reagent are shown below. The concentration in the composition of the measurement reagent indicates the final concentration with respect to the total amount of the mixture of the test sample and the measurement reagent (reaction mixture).
(1) Composition of measuring reagent
2 x Reaction Mix dNTPs 1.4 mM each
DMSO 5%
Tris-HCl (pH 8.0) 20 mM
KCl 10 mM
(NH ₄ ) ₂ SO ₄ 10 mM
MgSO ₄ 8 mM
Tween20 0.1%
SYBR (registered trademark) Green I 0.0012%
Aac DNA polymerase 6U
Primer mixture 5μM
EGTA 0-5 mM

In the above composition, 2 x Reaction Mix (D) and Aac DNA polymerase were purchased from Danaform Co., Ltd., and SYBR (registered trademark) Green I was purchased from Takara Bio Inc. The primer mixture was purchased from Sigma-Aldrich.

(2) Primer mixture The primer mixture above contains the following HSV1 FIP, HSV1 BIP, HSV1 LPF, HSV1 LPB, HSV1 F3 and HSV1 B3 primers (100 μM) at 8: 8: 4: 4: 1: 1 It was prepared by mixing at a ratio of The base sequence of each primer was according to Table 1 of AK Reddy et al., Clin. Microbiol Infect, 2011; 17: 210-213.
HSV1 FIP (F1-F2) 5'- ccagacgttccgttggtaggtcttttactttgactgttcgcgcacc (SEQ ID NO: 15)
HSV1 BIP (B1-B2) 5'- ccatcatcgccacgtcggactttttcggcgtctgctttttgtg (SEQ ID NO: 16)
HSV1 LPF 5'-aaatcctgtcgccctacacagcgg (SEQ ID NO: 17)
HSV1 LPB 5'- caccccgcgacgggacgccg (SEQ ID NO: 18)
HSV1 F3 5'- cagccacacacctgtgaa (SEQ ID NO: 19)
HSV1 B3 5'- tccgtcgaggcatcgttag (SEQ ID NO: 20)

2. Virus-positive urine of herpes simplex virus type 1 (HSV-1) A sample (virus-positive urine) obtained by adding an HSV-1 solution to urine collected from a healthy human was used as a test sample. The percentage of HSV-1 solution contained in the test sample is 0.25%. Urine was collected in a urine collection pack or paper cup. HSV-1 was obtained from ABI (Advanced Biotechnologies Inc.).

3. Detection of target nucleic acid in virus-positive urine (1) Method
Add a test sample that has been heat-treated (95 ° C for 30 seconds) and a measurement reagent to a 0.2 mL PCR tube (Agilent Technologies), spin down, and then use the Mx3000p QPCR System (Agilent Technologies Inc.) The nucleic acid amplification reaction and target nucleic acid were detected by the LAMP method. Table 14 below shows the composition of the mixture (reaction mixture) of the test sample and the measurement reagent.

Table 14

Nucleic acid amplification reaction and target nucleic acid detection by the LAMP method were performed under the following conditions.
Reaction time: Reaction at 65 ° C. for 45 minutes (Study 1 below).
Reaction at 63 ° C for 45 minutes (Study 2 below).
Measurement wavelength: detected at excitation 492 nm, fluorescence 516 nm.
Detection criteria: The time (minutes) at which Fluorescence (dR) reaches 1000 was compared, and the case where it reached 1000 within 45 minutes, which is a general determination time in the LAMP method, was detected.

(2) Detection result (2-1) Study 1
The concentration of EGTA in the reaction mixture was changed, and the target nucleic acid was detected in the test sample (virus positive urine (specimen 16)). The results are shown in Table 15.
Table 15

  As a result, as shown in Table 15 above, when a measurement reagent not containing EGTA (0 mM) was used, Fluorescence (dR) did not reach 1000 within 45 minutes in the sample 16 (that is, the detection result was Negative). On the other hand, when a measurement reagent containing EGTA at a concentration of 0.2 mM or more with respect to the total amount of the reaction mixture was used, Fluorescence (dR) reached 1000 within 45 minutes and was positive.

(2-2) Study 2
Next, target nucleic acids were detected in a plurality of test samples (specimens 17 to 20). As a measuring reagent, a measuring reagent not containing EGTA (0 mM) and a measuring reagent containing EGTA at a concentration of 1 mM with respect to the total amount of the reaction mixture were used.
The detection results are shown in Table 16 below.
Table 16

  As shown in Table 16 above, when a measurement reagent not containing EGTA (0 mM) was used, Fluorescence (dR) did not reach 1000 within 45 minutes in all samples (that is, the detection result was negative). ) On the other hand, when a measurement reagent containing EGTA was used at a concentration of 1 mM with respect to the total amount of the reaction mixture, Fluorescence (dR) reached 1000 within 45 minutes in all specimens, indicating a positive result.

  From the results of this example, by using a measurement reagent containing EGTA and an oligonucleotide for detecting the target nucleic acid, the target nucleic acid derived from HSV-1 contained in urine can be obtained without purifying the nucleic acid from the test sample. It was shown to be detectable. In addition, it was shown that HSV-1-derived target nucleic acid contained in urine can be rapidly detected within 45 minutes by using a measurement reagent containing EGTA so that the concentration of EGTA relative to the total amount of the reaction mixture is 0.2 mM or more. It was done. Furthermore, by using a measuring reagent containing EGTA so that the concentration of EGTA relative to the total amount of the reaction mixture is equal to or higher than the concentration calculated by the above formula A or B, it is not detected when a reagent not containing EGTA is used. It was shown that target nucleic acid derived from HSV-1 in human urine can be detected.

  In addition, the above results showed that the present invention can detect viral infection or bacterial infection. Furthermore, it was shown that the present invention can be used for diagnosis of viral infection or bacterial infection by judging positive and negative based on the time to reach the threshold value of detected fluorescence intensity (Threshold).

[Comparative example]
1. Detection of target nucleic acid in virus-positive urine using reagents containing other metal ion-binding compounds and SmartAmp method reagents Method In this comparative example, a detection test of target nucleic acid contained in virus-positive urine was performed using another metal ion binding compound instead of the compound used in the present invention.
As other metal ion binding compounds, ethylenediaminetetraacetic acid (EDTA), sodium citrate and sodium oxalate were used.
A detection test was conducted in the same manner as in Example 2 except that these metal ion binding compounds were used in place of the compounds of the present invention.
Table 17 below shows the composition of the mixture (reaction mixture) of the test sample, the first reagent, and the second reagent in this comparative example.
Table 17

(2) Detection results The detection results are shown in Table 18 below.
Table 18

In the table, “-” indicates that measurement is not performed.

  As shown in Table 18 above, when a metal ion binding compound such as EDTA, sodium citrate, or sodium oxalate is used instead of the compound used in the present invention, it is within 60 minutes at any concentration. The detected fluorescence intensity Fluorescence (dR) did not reach 4000 (that is, the detection result was negative).

From the results of this comparative example, instead of the compound used in the present invention, when using a metal ion binding compound such as EDTA, sodium citrate, or sodium oxalate, the target nucleic acid derived from HCMV contained in urine is It was shown that it could not be detected within a certain time.
This result is that the compounds used in the present invention cannot be predicted from metal ion binding compounds such as EDTA, sodium citrate, or sodium oxalate, which are generally known as chelating agents, and these metal ion binding It has shown that it has a remarkable effect compared with a sex compound.

  According to the present invention, there are provided a novel nucleic acid detection reagent kit and detection method capable of rapidly and accurately detecting a target nucleic acid contained in a biological sample without purifying the nucleic acid from the biological sample.

  SEQ ID NOs: 4-20: Synthetic DNA

Claims (4)

A method for detecting or quantifying a target nucleic acid derived from a herpes virus , comprising ethylene glycol-bis (2-aminoethyl ether) -N, N, N ′, N′-tetraacetic acid (EGTA), 1,2-bis ( o-Aminophenoxy) ethane-N, N, N ′, N′-tetraacetic acid (BAPTA) and at least one compound selected from the group consisting of these derivatives or a salt thereof, and the target nucleic acid is not extracted Mixing a test sample and an oligonucleotide for amplifying the target nucleic acid, performing an amplification reaction of the target nucleic acid in the mixture, and detecting or quantifying the amplified target nucleic acid,
The method, wherein the concentration of the compound or a salt thereof in the total amount of the mixture is not less than the concentration calculated by the following formula A and not more than 10 mM .
Formula A
{[Biological sample in test sample (volume)] / [Total amount (volume) of mixture of test sample and detection or quantification reagent]} × 2 (mM) A method for detecting or quantifying a target nucleic acid derived from a herpes virus , comprising:
(a) Ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N' , N'- tetraacetic acid (BAPTA), and a first reagent comprising at least one compound or salt thereof selected from the group consisting of their derivatives, and test sample extraction is not the target nucleic acid, said target nucleic acid Mixing with a second reagent comprising an oligonucleotide for amplifying
(b) performing a target nucleic acid amplification reaction in the mixture obtained in step (a), and detecting or quantifying the amplified target nucleic acid, wherein the concentration of the compound or salt thereof in the total amount of the mixture is The method, wherein the concentration is not less than the concentration calculated by the following formula A and not more than 10 mM .
Formula A
{[Biological sample in test sample (volume)] / [Total amount (volume) of mixture of test sample and detection or quantification reagent]} × 2 (mM) A method for detecting a herpesvirus infection in a test sample, comprising :
(a) Ethylene glycol-bis (2-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 1,2-bis (o-aminophenoxy) ethane-N, N, N' , N′-tetraacetic acid (BAPTA) and a first reagent containing at least one compound selected from the group consisting of these derivatives or a salt thereof, a test sample from which target nucleic acid derived from herpes virus has not been extracted , mixing a second reagent comprising an oligonucleotide for amplifying said target nucleic acid, and
(b) performing a target nucleic acid amplification reaction in the mixture obtained in step (a), and detecting or quantifying the amplified target nucleic acid, wherein the concentration of the compound or salt thereof in the total amount of the mixture is The method, wherein the concentration is not less than the concentration calculated by the following formula A and not more than 10 mM .
Formula A
{[Biological sample in test sample (volume)] / [Total amount (volume) of mixture of test sample and detection or quantification reagent]} × 2 (mM) The method according to any one of claims 1 to 3 , wherein a concentration of the compound or a salt thereof in a total amount of the mixture is not less than a concentration calculated by the following formula B and not more than 10 mM .
Formula B
{[Biological sample in test sample (volume)] / [Total amount (volume) of mixture of test sample and detection or quantification reagent]} × 3 (mM)