JP4092139B2 - Nucleic acid extraction method - Google Patents

Description

[0001]
BACKGROUND OF THE INVENTION
The present invention relates to a nucleic acid extraction method for obtaining a nucleic acid as a sample when various operations are performed using a nucleic acid.
[0002]
[Prior art]
As a general method for extracting nucleic acid from biological materials such as viruses, bacteria, fungi, protozoa, plants, animals, etc., a cell wall is decomposed with an enzyme such as lysozyme and extracted into a solution, or a protein with an enzyme such as proteinase. A method is used in which cells are decomposed to break down cells and extracted into a solution. Nucleic acids extracted in the solution are subjected to denaturation and removal of impurities with phenol / chloroform and concentrated and purified by ethanol precipitation.
[0003]
However, nucleic acid extraction by the above-described enzyme treatment requires a skillful technique and has a problem that processing efficiency is poor because it takes time. In particular, when this method is applied to a substance having a hard cell wall such as a mycobacterium bacterium or a fungus, mold spores, nucleic acid extraction efficiency is extremely poor because the cells do not break. For example, in order to extract nucleic acid from bacteria belonging to the genus Mycobacterium, which are difficult to destroy, cells are described in Vary et al. (J. Clin. Microbiol., 28 (5), 933-937, (1990)). In this method, a total of 48 hours of treatment is performed with three kinds of enzymes.
[0004]
Therefore, in order to overcome the problem that the cell wall is hard and it is difficult to destroy cells, a method of vigorously stirring using phenol and fine particles is known. For example, in a paper by Giessen et al. (J. Med. Microbiol., 36 (1992), 255-263), a specimen containing a bacterium of the genus Mycobacterium is used in TE Buffer (10 mM Tris-HCl, 1 mM EDTA) and phenol. In order to break down the cells by vigorous stirring with fine particles of zirconium oxide. The same is also described in US Pat. No. 4,918,178.
[0005]
However, this method improves the efficiency of nucleic acid extraction, but uses a very harmful reagent such as phenol, and there is a problem that phenol contaminates the laboratory environment during the stirring operation. .
[0006]
[Problems to be solved by the invention]
An object of the present invention is to provide a method capable of extracting a nucleic acid from a biological material from which the nucleic acid is to be extracted easily and efficiently without using a highly harmful reagent. In particular, the object of the present invention is simple, efficient, and harmful from biological materials that have been difficult to destroy cells and that conventionally require special operations to extract nucleic acids, particularly bacteria belonging to the genus Mycobacterium. An object of the present invention is to provide a method capable of extracting a nucleic acid without using a highly reactive reagent.
[0007]
[Means for Solving the Problems]
As a result of intensive studies, the present inventor has found that the above-described object can be achieved by vigorously stirring a biological material with fine particles in a solution containing a chelating reagent, and has completed the present invention.
[0008]
That is, the present invention is a nucleic acid extraction method in which a biological material from which nucleic acid is to be extracted is stirred in a solution containing a chelating reagent in the presence of fine particles, and the concentration of the chelating reagent in the solution is 5 mM to 500 mM. A nucleic acid extraction method characterized by
[0009]
The present invention is the above nucleic acid extraction method, wherein the chelating reagent is selected from the group consisting of polyaminocarboxylic acids and salts thereof.
[0010]
The present invention is the above nucleic acid extraction method, wherein the chelating reagent is selected from the group consisting of EDTA or a reagent similar to EDTA.
[0011]
In the present invention, the chelating reagent includes ethylenediaminetetraacetic acid (EDTA), O, O′-bis (2-aminophenylethyleneglycol) ethylenediaminetetraacetic acid (BAPTA), N, N-bis (2-hydroxyethyl) glycine ( Bicine), trans-1,2-diaminocyclohexane-ethylenediaminetetraacetic acid (CyDTA), 1,3-diamino-2-hydroxypropane-ethylenediaminetetraacetic acid (DPTA-OH), diethylenetriaminepentaacetic acid (DTPA), ethylenediaminedipropanoic acid hydrochloride (EDDP), ethylenediamine dimethylenephosphonic acid monohydrate (EDDPO), N- (2-hydroxyethyl) ethylenediaminetriacetic acid (EDTA-OH), ethylenediaminetetramethylenephosphonic acid (EDTPO), O, O′-bis 2-aminoethyl) ethylene glycol tetraacetic acid (EGTA), N, N′-bis (2-hydroxybenzyl) ethylenediaminediacetic acid (HBED), 1,6-hexamethylenediaminetetraacetic acid (HDTA), N- (2- Hydroxyethyl) iminodiacetic acid (HIDA), iminodiacetic acid (IDA), 1,2-diaminopropanetetraacetic acid (Methyl-EDTA), nitrilotriacetic acid (NTA), nitrilotripropanoic acid (NTP), nitrilotrimethylenephosphone The nucleic acid extraction method described above, which is selected from the group consisting of acid trisodium salt (NTPO), ethylenediaminetetra (2-pyridylmethyl) (TPEN) and triethylenetetraaminehexaacetic acid (TTHA).
[0013]
The present invention is the nucleic acid extraction method described above, wherein no phenol is used.
[0014]
The present invention is the nucleic acid extraction method described above, wherein the biological material is a virus, a bacterium, a fungus, a protozoan, a plant, or an animal.
The present invention is the nucleic acid extraction method as described above, wherein the bacterium belongs to the genus Mycobacterium.
The present invention is the above-described nucleic acid extraction method, wherein the bacteria belonging to the genus Mycobacterium are Mycobacterium tuberculosis, atypical mycobacteria, gonorrhea, Johne's disease, and Crohn's disease.
[0015]
The present invention is the nucleic acid extraction method described above, wherein the biological material is contained in a biological sample such as a biological tissue, body fluid, secretion, excrement, or an environmental sample such as soil, water, or air.
The present invention is the nucleic acid extraction method described above, wherein the biological sample is animal feces, sputum or blood.
[0016]
In the present invention, the nucleic acid means both DNA and RNA.
[0017]
DETAILED DESCRIPTION OF THE INVENTION
In the present invention, nucleic acid is extracted into a solution by vigorously stirring the biological material in the solution containing the chelating reagent in the presence of fine particles.
[0018]
Examples of the biological material used in the present invention include, but are not limited to, viruses, bacteria, fungi, protozoa, plants, animals and the like. The present invention is particularly useful for biological materials such as fungi and mycobacterium bacteria that are difficult to destroy cells. Examples of Mycobacterium bacteria include, but are not limited to, Mycobacterium tuberculosis, atypical mycobacteria, Neisseria gonorrhoeae, Monebacterium paratuberculosis, and clonal bacteria.
[0019]
Examples of samples containing these biological materials include biological samples of animals and plants, biological samples such as feces, rabbits and blood derived from livestock and humans, environmental samples such as soil, water and air. However, it is not limited to these.
[0020]
As the chelating reagent used in the present invention, EDTA or polyaminocarboxylic acid similar to EDTA may be used. Specifically, ethylenediaminetetraacetic acid (ethylenediamnie-N, N, N ', N'-tetraacetic acid; EDTA), O, O'-bis (2-aminophenylethylene glycol) ethylenediaminetetraacetic acid (O, O'- Bis (2-aminophenyl) ethyleneglycol-N, N, N ′, N′-tetraacetic acid (BAPTA), N, N-Bis (2-hydroxyethyl) glycine (Bine) ), Trans-1,2-diaminocyclohexane-ethylenediaminetetraacetic acid (trans-1,2-Diaminocyclohexane-N, N, N ′, N′-tetraacetic acid; CyDTA), 1,3-diamino-2-hydroxypropane-ethylenediaminetetraacetic acid Acetic acid (1,3-Diamino-2-hydroxypropane-N, N, N ', N'-tetraacetic acid; DPTA-OH), Diethylenetriamine-N-N, N', N ", N" -pentaacetic acid; DTPA), Ethylenediamine dipropanoic acid hydrochloride (Ethylenediamine-N, N'-diprop ionic acid, dihydrochloride (EDDP), ethylenediamine dimethylenephosphonic acid monohydrate (Ethylenediamine-N, N'-bis (methylenephosphonic acid), hemihydrate; EDDPO), N- (2-hydroxyethyl) ethylenediaminetriacetic acid (N- (2-Hydroxyethyl) ethylenediamine-N, N ', N''-triacetic acid (EDTA-OH), Ethylenediamine-N, N', N'-tetrakis (methylenephosphonic acid); EDTPO O, O′-bis (2-aminoethyl) ethylene glycol tetraacetic acid (O, O′-Bis (2-aminoethyl) ethyleneglycol-N, N, N ′, N′-tetraacetic acid; EGTA), N, N '-Bis (2-hydroxybenzyl) ethylenediamine-acetic acid (N, N'-Bis (2-hydroxybenzyl) ethylenediamine-N, N'-diacetic acid; HBED), 1,6-hexamethylenediaminetetraacetic acid (1,6 -Hexamethylenediamine-N, N, N ', N'-tetraacetic acid (HDTA), N- (2- Droxyethyl) iminodiacetic acid (N- (2-Hydroxyethyl) iminodiacetic acid; HIDA), iminodiacetic acid (IDA), 1,2-diaminopropanetetraacetic acid (1,2-Diaminopropane-N, N, N ' , N'-tetraacetic acid (Methyl-EDTA), Nitrilotriacetic acid (NTA), Nitrilotripropionic acid (NTP), Nitrilotris (methylenephosphonic acid), trisodium salt NTPO), ethylenediaminetetra (2-pyridylmethyl) (N, N, N ′, N′-Tetrakis (2-pyridylmethyl) ethylenediamine; TPEN), triethylenetetramine-N, N, N ′, N ", N", N "-hexaacetic acid; TTHA). These chelating reagents may be used alone or in combination of two or more.
[0021]
One of the factors that maintain the structure of the cell wall is the presence of calcium ions. These chelating reagents are easy to coordinate with calcium ions. These chelating reagents are considered to coordinate with cell wall calcium ions and modify the cell wall structure so that the structure cannot be maintained, thereby easily destroying the cell wall.
[0022]
Chelating agent in the solution in the present invention, 5 mM~ 500 mM, preferably Ru used at a concentration of 10MM～250mM. If the concentration of the chelating reagent is less than 5 mM, the cell destruction efficiency tends to be low. If the concentration is higher than 500 mM, additional treatment may be required in the course of nucleic acid purification or desalting after cell destruction. .
[0023]
The present invention is characterized in that it is not necessary to use other modifying agents such as conventional phenol in order to destroy cells by using the chelating reagent at the above-mentioned concentration, which makes nucleic acid extraction easier and safer. It is possible.
[0024]
In the present invention, in order to increase the efficiency of cell destruction, fine particles are added and vigorously stirred. The fine particles used at this time are usually glass beads or zirconium oxide fine particles that are not biologically involved in the cell suspension. Usually, fine particles having a specific gravity of 2.0 or more, for example, 2.3 to 6.3 and a diameter of 0.01 mm to 0.9 mm are used, but are not limited thereto. If the diameter is 1 mm or more, the cell destruction efficiency tends to deteriorate.
[0025]
【Example】
EXAMPLES The present invention will be described in more detail with reference to the following examples, but the present invention is not limited thereto.
[0026]
[Experimental Example 1]
Feces derived from cattle infected with Johne's disease including Mycobacterium paratuberculosis (hereinafter abbreviated as Johne's), which is a mycobacterial bacterium, was used as the biological material.
First, 1 g of stool derived from a Johne bacteria-infected cow was suspended in 10 mL of distilled water and allowed to stand for 5 minutes, and then 5 mL of the supernatant was collected and centrifuged to obtain a stool pellet containing the bacterium. A series of operations for obtaining stool pellets was repeated four times to obtain four stool pellets.
[0027]
Next, the nucleic acid extraction solution shown below is added to each of the fecal pellets, 800 mg of glass beads having a diameter of 0.1 mm (specific gravity: 2.5) are further added, and the mixture is stirred using BIOSPEC's MINI-BEADBEATER ( 5,000 rpm, 3 min). After stirring with MINI-BEADBEATER, centrifugation was performed to recover 500 μL of the supernatant, and phenol / chloroform treatment and ethanol precipitation, which are general purification and desalting concentration methods, were performed to obtain a nucleic acid pellet.
[0028]
(Nucleic acid extraction solution)
[Experimental example A] TE buffer (10 mM Tris-HCl, 1 mM EDTA) 750 μL, phenol [Experimental example B] TE buffer (10 mM Tris-HCl, 1 mM EDTA) 750 μL
[Experimental example C] Tris buffer (10 mM Tris-HCl) 750 μL, phenol 750 μL
[Experimental Example D] Tris buffer (10 mM Tris-HCl) 750 μL
[0029]
Each nucleic acid pellet obtained in the above experimental examples A to D was dissolved in 50 μL of distilled water, and further a double dilution series of pellet solution was prepared using distilled water. Primers for amplifying a partial region of IS900, which is a gene specific to Johnella bacterium, each of the obtained nucleic acid dilution series [base sequence is GATCGGAACGTCGCGCTGGTCAGG (SEQ ID NO: 1) and ACGACGACGCGGCAGCGATTGCCTCT (SEQ ID NO: 2)], Taq polymerase enzyme, dNTP and buffer solution were added, and PCR reaction was performed under the temperature conditions of 97 ° C-30 seconds, 65 ° C-30 seconds, 72 ° C-30 seconds, 40 cycles.
[0030]
After the PCR reaction, reaction products were detected by agarose gel electrophoresis, ethidium staining, and photography using a transilluminator, and the difference in extraction efficiency between the above experimental examples A to D was examined.
[0031]
The detection results of the reaction products in the above experimental examples A to D are shown in FIGS. With the PCR primers used in this experiment, a reaction product of 362 base pairs (bp) can be obtained if the IS900 gene is present. Lane 1 (left end) is 25 μL of 50 μL of nucleic acid pellet lysate, lane 2 is 12.5 μL, lane 3 is 6.3 μL, lane 4 is 3.1 μL, lane 5 is 1.6 μL, and lane 6 is 0. 8 μL, Lane 7 contains 0.4 μL, and Lane 8 contains 0.2 μL. Lane M is a molecular weight marker obtained by digesting Φx174 DNA with the restriction enzyme HincII. The extraction efficiency is better as the reaction product is detected up to the right lane containing only a smaller amount of sample.
[0032]
In Experimental Example A and Experimental Example C, since harmful phenol was used, reaction products were detected up to Lane 5 (FIG. 1) and Lane 6 (FIG. 3), respectively, and the extraction efficiency was good. In Experimental Example B, since the concentration of EDTA used was as low as 1 mM, EDTA had no effect on nucleic acid extraction, and only a weak band was detected in lane 1 (FIG. 2). In Experimental Example D, neither phenol nor EDTA was used, so only a weak band was detected in Lane 2 and the extraction efficiency was poor (FIG. 4).
[0033]
[Experiment 2]
First, a stool pellet containing three Yone bacteria was obtained by the same operation as in Experimental Example 1. Next, the nucleic acid extraction solution shown below is added to each of the fecal pellets, 800 mg of glass beads having a diameter of 0.1 mm (specific gravity: 2.5) are further added, and the mixture is stirred using BIOSPEC's MINI-BEADBEATER ( 5,000 rpm, 3 min). In Experimental Example 2, no modifier such as phenol was used. After stirring with MINI-BEADBEATER, centrifugation was performed to recover 500 μL of the supernatant, and phenol / chloroform treatment and ethanol precipitation, which are general purification and desalting concentration methods, were performed to obtain a nucleic acid pellet.
[0034]
(Nucleic acid extraction solution)
[Experiment Example E] Solution E (10 mM Tris-HCl, 5 mM EDTA) 750 μL
[Example F] Solution F (10 mM Tris-HCl, 10 mM EDTA) 750 μL
[Example G] Solution G (10 mM Tris-HCl, 100 mM EDTA) 750 μL
[0035]
The obtained nucleic acid pellet was processed in the same manner as in Experimental Example 1 in the steps of serial dilution, PCR reaction, agarose gel electrophoresis, ethidium staining, transillumination photography, and the extraction efficiency in the case of EG The difference was examined.
[0036]
The detection results of reaction products in the cases of E to G are shown in FIGS. In Experimental Example E using 5 mM EDTA as the solution at the time of extraction, up to Lane 5 (FIG. 5), Experimental Example F using 10 mM EDTA up to Lane 6 (FIG. 6), and in Experimental Example G using EDTA 100 mM The reaction product was detected up to lane 8 (FIG. 7), and the result was that the extraction efficiency increased as the concentration of EDTA increased.
[0037]
[Experiment 3]
First, a stool pellet containing two bacterium was obtained in the same manner as in Experimental Example 1. Next, the nucleic acid extraction solution shown below is added to each of the fecal pellets, 800 mg of glass beads having a diameter of 0.1 mm (specific gravity: 2.5) are further added, and the mixture is stirred using BIOSPEC's MINI-BEADBEATER ( 5,000 rpm, 3 min). Also in Experimental Example 3, no modifying agent such as phenol was used. After stirring with MINI-BEADBEATER, centrifugation was performed to recover 500 μL of the supernatant, and phenol / chloroform treatment and ethanol precipitation, which are general purification and desalting concentration methods, were performed to obtain a nucleic acid pellet.
[0038]
(Nucleic acid extraction solution)
[Example H] Solution H (10 mM Tris-HCl, 100 mM CyDTA) 750 μL
[Example I] Solution I (10 mM Tris-HCl, 100 mM EGTA) 750 μL
[0039]
The obtained nucleic acid pellet was processed in the same manner as in Experimental Example 1 in the steps of serial dilution, PCR reaction, agarose gel electrophoresis, ethidium staining, and transillumination photography. The difference was examined.
[0040]
The detection results of reaction products in the case of H and I are shown in FIGS. 8 and 9, respectively. In Example H using CyDTA as the solution at the time of extraction, reaction products were detected up to lane 7 (FIG. 8), and in Example I using EGTA up to lane 5 (FIG. 9). This polyaminocarboxylic acid also showed high extraction efficiency similar to EDTA.
[0041]
【The invention's effect】
According to the present invention, nucleic acid can be efficiently extracted from a biological material from which nucleic acid is to be extracted without using harmful reagents. In particular, nucleic acids can be efficiently extracted without using harmful reagents from biological materials that are difficult to destroy cells, such as Mycobacterium bacteria, and that require special operations to extract nucleic acids. be able to.
[Sequence Listing]
<110> Shimadzu corp.
<120> method for extracting nucleic acids
<130> K1020283
<160> 2
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 1
gatcggaacgtcggctggtcagg
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 2
acgacgacgcgcagcgattgctct
[Brief description of the drawings]
FIG. 1 is a result of detection by PCR of agarose gel electrophoresis of a PCR reaction product when TE buffer and phenol are used as a nucleic acid extraction solution.
FIG. 2 is a detection result by agarose gel electrophoresis of a PCR reaction product when TE buffer is used as a nucleic acid extraction solution.
FIG. 3 is a detection result by agarose gel electrophoresis of a PCR reaction product when Tris buffer and phenol are used as a nucleic acid extraction solution.
FIG. 4 is a detection result by agarose gel electrophoresis of a PCR reaction product when Tris buffer is used as a nucleic acid extraction solution.
FIG. 5 is a detection result by agarose gel electrophoresis of a PCR reaction product when solution E (10 mM Tris-HCl, 5 mM EDTA) is used as a nucleic acid extraction solution.
FIG. 6 is a detection result by agarose gel electrophoresis of a PCR reaction product when Solution F (10 mM Tris-HCl, 10 mM EDTA) is used as a nucleic acid extraction solution.
FIG. 7 shows a detection result by agarose gel electrophoresis of a PCR reaction product when solution G (10 mM Tris-HCl, 100 mM EDTA) is used as a nucleic acid extraction solution.
FIG. 8 is a detection result by agarose gel electrophoresis of a PCR reaction product when Solution H (10 mM Tris-HCl, 100 mM CyDTA) is used as a nucleic acid extraction solution.
FIG. 9 is a detection result by agarose gel electrophoresis of a PCR reaction product when Solution I (10 mM Tris-HCl, 100 mM EGTA) is used as a nucleic acid extraction solution.

Claims (10)

A nucleic acid extraction method in which a biological material from which nucleic acid is to be extracted is stirred in a solution containing a chelating reagent in the presence of fine particles , wherein the concentration of the chelating reagent in the solution is 5 mM to 500 mM Extraction method.   The nucleic acid extraction method according to claim 1, wherein the chelating reagent is selected from the group consisting of a polyaminocarboxylic acid and a salt thereof.   The nucleic acid extraction method according to claim 1, wherein the chelating reagent is selected from the group consisting of EDTA and a reagent similar to EDTA.   The chelating reagents include ethylenediaminetetraacetic acid (EDTA), O, O′-bis (2-aminophenylethyleneglycol) ethylenediaminetetraacetic acid (BAPTA), N, N-bis (2-hydroxyethyl) glycine (Bicine), trans 1,2-diaminocyclohexane-ethylenediaminetetraacetic acid (CyDTA), 1,3-diamino-2-hydroxypropane-ethylenediaminetetraacetic acid (DPTA-OH), diethylenetriaminepentaacetic acid (DTPA), ethylenediaminedipropanoic acid hydrochloride (EDDP), Ethylenediamine dimethylenephosphonic acid monohydrate (EDDPO), N- (2-hydroxyethyl) ethylenediaminetriacetic acid (EDTA-OH), ethylenediaminetetramethylenephosphonic acid (EDTPO), O, O′-bis (2-a Noethyl) ethylene glycol tetraacetic acid (EGTA), N, N′-bis (2-hydroxybenzyl) ethylenediaminediacetic acid (HBED), 1,6-hexamethylenediaminetetraacetic acid (HDTA), N- (2-hydroxyethyl) Iminodiacetic acid (HIDA), iminodiacetic acid (IDA), 1,2-diaminopropanetetraacetic acid (Methyl-EDTA), nitrilotriacetic acid (NTA), nitrilotripropanoic acid (NTP), nitrilotrimethylenephosphonic acid trisodium The nucleic acid extraction method according to any one of claims 1 to 3, which is selected from the group consisting of a salt (NTPO), ethylenediaminetetra (2-pyridylmethyl) (TPEN), and triethylenetetraaminehexaacetic acid (TTHA). The nucleic acid extraction method according to any one of claims 1 to 4 , wherein phenol is not used. The nucleic acid extraction method according to any one of claims 1 to 5 , wherein the biological material is a virus, a bacterium, a fungus, a protozoan, a plant, or an animal. The nucleic acid extraction method according to claim 6 , wherein the bacterium belongs to the genus Mycobacterium. The nucleic acid extraction method according to claim 7 , wherein the bacterium of the genus Mycobacterium is Mycobacterium tuberculosis, atypical mycobacteria, gonorrhea, Johne's disease or Crohn's disease. The nucleic acid according to any one of claims 1 to 8 , wherein the biological material is contained in a biological sample such as a biological tissue, body fluid, secretion, excrement, or an environmental sample such as soil, water, or air. Extraction method. The nucleic acid extraction method according to claim 9 , wherein the biological sample is animal feces, sputum or blood.

Images