JP6306872B2 - Stem cell undifferentiated state maintenance agent and growth promoter - Google Patents

Description

  The present invention relates to, for example, a stem cell proliferation promoter and an undifferentiated state maintaining agent, a stem cell proliferation promoting method, and an undifferentiated state maintaining method.

  When a tissue of a vertebrate (particularly a mammal) is damaged due to injury or disease or aging, etc., cell / organ damage occurs, the regeneration system works to try to recover the cell / organ damage. Stem cells provided in the tissue play a major role in this effect. Stem cells have the pluripotency to differentiate into all cells and organs, and this property is thought to lead to recovery by compensating for damaged parts of cells and tissues. Expectations are gathered for regenerative medicine, which is the next generation of medicine using such stem cells.

  The most advanced tissue in stem cell research in mammals is the bone marrow. The bone marrow contains living hematopoietic stem cells, which have been shown to be the source of all blood cell regeneration. Furthermore, it has been reported that the bone marrow includes stem cells that can be differentiated into other organs (eg, bone, cartilage, muscle, fat, etc.) in addition to hematopoietic stem cells (see Non-Patent Document 1).

  Furthermore, in recent years, in addition to bone marrow, it has been clarified that stem cells exist in all organs / tissues such as liver, pancreas, fat, etc., and it has been found that they are responsible for regeneration and homeostasis of each organ / tissue. (See Non-Patent Documents 2 to 5). In addition, stem cells present in each tissue are excellent in plasticity and may be used for regeneration of organs and tissues that have been impossible to self-replicate until now.

  In recent years, in order to apply the ability (pluripotency) of these stem cells to the regeneration of organs and tissues, they are cultured after separating stem cells from living tissues in the field of cell transplantation and tissue engineering (regenerative medicine and regenerative beauty). Development of techniques for propagation is being promoted (Non-Patent Documents 6 to 7).

  In particular, when culturing stem cells in vitro, it is extremely important to proliferate while maintaining the pluripotency that is the ability of stem cells, that is, maintaining an undifferentiated state. If the undifferentiated state of stem cells cannot be maintained during this culture and differentiation induction has progressed, the ability (pluripotency) of the finally prepared stem cells has been lost, and the desired effect ( Can not reproduce organs and tissues.

  From the above, when stem cells are used for cell transplantation treatment or tissue engineering (regenerative medicine or regenerative beauty) and regeneration of organs or tissues is desired, stem cells must be able to be cultured while maintaining an undifferentiated state.

  To date, there have been several reports on techniques for proliferating stem cells while maintaining an undifferentiated state, but they are still under development. For example, embryonic stem cells (ES cells) and hematopoietic stem cells can be maintained undifferentiated by co-culturing with supporting cells (stromal cells or feeder cells) (see Patent Document 1 and Non-Patent Documents 8 to 10). ). However, recently, there have been reports of cases of infection between heterologous animals caused by feeder cell-derived endogenous viruses (see Non-Patent Document 11), and stem cell culture using feeder cells is a stem cell for medical purposes. It is not suitable for culturing.

  As another method, there is a method of maintaining an undifferentiated state of a stem cell by complexly combining cytokines. For example, mouse ES cells are maintained undifferentiated by adding LIF (Leukemia Inhibitory Factor) to the medium (see Patent Document 2 and Non-Patent Document 12). In addition, in the presence of early-acting cytokines thrombopoietin (TPO), interleukin 6 (IL-6), FLT-3 ligand, and stem cell factor (SCF), it is possible to maintain undifferentiated embryonic stem cells, It has been reported for somatic stem cells (see Patent Document 3 and Non-Patent Document 13).

  However, cytokines are expensive and have problems such as collection raw materials and storage stability, and easy use is difficult. In addition, the effects of LIF are limited to very specific cell lineages, especially in primate ES cells and somatic stem cells, and it has been clarified that LIF alone cannot maintain an undifferentiated state. (See Non-Patent Document 9).

  All of the currently reported methods for maintaining the undifferentiated state of stem cells require complicated operations and have a low effect of maintaining the undifferentiated state. Therefore, in order to utilize stem cells for regenerative medicine, a technique for growing stem cells to a number sufficient for transplantation while maintaining an undifferentiated state has been demanded. That is, there has been a demand for a technique that can proliferate stem cells while maintaining an undifferentiated state in a safe, simple and efficient manner.

JP 2004-24089 A Special table 2002-525042 gazette Japanese Patent No. 3573354

Pittenger M.F. et al., Science, 1999, Vol. 284, pp. 143-147 Goodell M.A. et al., Nat. Med., 1997, Vol. 3, pp. 1337-1345 Zulewski H. et al., Diabetes, 2001, Vol. 50, pp. 521-533 Suzuki A. et al., Hepatology, 2000, Vol. 32, pp. 1230-1239 Zuk P.A. et al., Tissue Engineering, 2001, Vol. 7, pp. 211-228 Hiroshi Mabuchi et al., Journal of Japanese Society for Regenerative Medicine, 2007, Vol. 6, pp. 263-268 All Kitagawa et al., Journal of Japanese Society for Regenerative Medicine, 2008, Vol. 7, pp. 14-18 Thomson J.A. et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7848 Thomson J.A. et al., Science, 1998, Vol. 282, pp. 1145-1147 Reubinoff B.E., et al., Nature Biotech., 2000, Vol. 18, pp. 399-404 van der Laan L.J., et al., Nature, 2000, Vol. 407, pp. 90-94 Smith A.G., et al., Dev. Biol., 1987, Vol. 121, pp. 1-9 Madlambayan G.J. et al., J. Hematother. Stem Cell Res., 2001, Vol. 10, pp. 481-492

As described above, there is a need for a technique that can proliferate stem cells while maintaining an undifferentiated state.
Therefore, in view of the above-described circumstances, an object of the present invention is to provide a method for efficiently proliferating stem cells while maintaining an undifferentiated state.

  As a result of intensive studies to solve the above-mentioned problems, it has been found that an extract of Shobu has an excellent undifferentiated state maintaining effect and proliferation promoting effect on stem cells, and the present invention has been completed.

That is, the present invention includes the following.
(1) An agent for promoting proliferation of stem cells, comprising a shobu extract as an active ingredient.
(2) An agent for maintaining an undifferentiated state of stem cells, which contains a shobu extract as an active ingredient.
(3) A method for producing a stem cell, comprising a step of culturing the stem cell in a medium containing a shobu extract.
(4) A method for promoting the proliferation of stem cells, comprising a step of culturing stem cells in a medium containing a shobu extract.
(5) A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a medium containing a shobu extract.

  According to the present invention, stem cells can be efficiently proliferated while maintaining an undifferentiated state. Therefore, the present invention can greatly contribute to the fields of regenerative medicine and regenerative beauty.

Hereinafter, the present invention will be described in detail.
The stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention contains a shobu extract as an active ingredient. According to the stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention, the stem cell proliferation can be promoted while maintaining the undifferentiated state of the stem cells, and the drug can be used for tissue regeneration such as regenerative medicine and regenerative beauty. It is a useful drug in the field. Furthermore, the stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention can be used as a research reagent for maintaining or promoting proliferation of an undifferentiated state of stem cells.

  The present invention also relates to a method for promoting stem cell proliferation while maintaining the undifferentiated state of stem cells by culturing stem cells in a medium containing an extract of shobu. In other words, the method according to the present invention is referred to as a method for producing stem cells, a method for promoting proliferation of stem cells, or a method for maintaining undifferentiated states of stem cells, including a step of culturing stem cells in a medium containing a shobu extract. it can.

  Here, Shobu (scientific name: Acorus calamus L.) is a perennial plant belonging to the taro family. Examples of the part used for extraction include the above-ground part (leaves, branches, bark, stem, stem, fruit, seed, flower, etc.), a part of the plant body such as the rhizome, or the whole plant body. The above ground part is preferable. The extraction method of the extract from a shobu is not specifically limited, For example, what was extracted by heating may be used, and what was extracted at normal temperature or refrigeration may be used.

  Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, Propyl ether and the like). Preferably, water, lower alcohol and liquid polyhydric alcohol are preferable, and water and ethanol are particularly preferable. These solvents may be used singly or in combination of two or more. For example, an aqueous ethanol solution of 30 to 70 v / v% can be used. Further, it is also possible to use a solvent whose pH is adjusted by adding acid or alkali to the extraction solvent.

  The shovel is subjected to solvent extraction using the solvents described above. The ratio of the shob to the solvent is, for example, 1 to 50% (w / w), preferably 5 to 25% (w / w). For example, the extract of a shobu can be obtained by adding water to the dry matter of the above-ground part of a shobu, and performing hot water extraction at 95-100 degreeC. Alternatively, lower alcohol (e.g., ethanol) or liquid polyhydric alcohol (e.g., propylene glycol, 1,3-butylene glycol, etc.) is added to the dried product of the above-ground portion of shobu, and at room temperature (e.g., 5-35 ° C). By performing extraction, a shobu extract can be obtained.

  After the solvent extraction, the obtained solvent phase itself can be used as a shochu extract. Alternatively, the obtained solvent phase is subjected to treatment such as concentration, dilution, filtration, and drying, and decolorization and deodorization treatment with activated carbon, etc., if necessary, and the resulting product is used as a shobu extract. Can do. In particular, it is preferable that the extracted solution is subjected to a treatment such as concentration to dryness, spray drying, freeze drying, and the like, and the obtained dried product is used as an extract of shochu.

  The extract of camphor thus obtained is used as an active ingredient of the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention. The stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention includes cell culture additives, research reagents, medical reagents, cell transplants, pharmaceuticals, quasi drugs, cosmetics, foods, and the like. Can be blended and applied.

  The compounding amount of the extract of shobu in the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is not particularly limited. For example, the total amount of the drug is 0.00001 to 10% by weight in terms of dry matter. Preferably, it is most preferably 0.0001 to 1% by weight. If the amount is less than 0.00001% by weight, the effect may not be sufficiently exerted.

  By applying the stem cell proliferation promoter or undifferentiated state maintenance agent according to the present invention described above to stem cells of animals including humans, the proliferation of stem cells is promoted and the undifferentiated state of stem cells is maintained. be able to. Stem cells to which the stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention is applied are not particularly limited as long as they meet the object of the present invention. For example, embryonic stem cells (ES cells); bone marrow, blood And somatic stem cells present in skin, fat, brain, liver, pancreas, kidney, muscle and other tissues; stem cells artificially prepared by gene transfer and the like. In addition, the stem cell may be any of a primary cultured cell, a subcultured cell, or a frozen cell. Preferably, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is more effective for stem cells derived from bone marrow, blood, skin, or adipose tissue. Furthermore, as long as they have equivalent characteristics regarding the direction of differentiation of stem cells and the process of differentiation, the present invention can be applied to stem cells derived from all mammals. For example, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is a stem cell of a mammal such as human, monkey, mouse, rat, guinea pig, rabbit, cat, dog, horse, cow, sheep, goat, pig, etc. Can be effective.

  Alternatively, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention can be applied to non-human ES cells or mammalian somatic stem cells.

  On the other hand, the method according to the present invention is a method for producing a stem cell, a method for promoting proliferation of a stem cell, or a method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a medium containing a shobu extract.

  In the method according to the present invention, the medium for culturing stem cells and the additive used at the same time are not limited, and examples thereof include the following.

  Specifically, as a medium for culturing stem cells, a basic medium containing components necessary for cell survival (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, etc.), such as Dulbecco's Modified Eagle Medium ( D-MEM), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle (BME), Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (D-MEM / F-12), Glasgow Minimum Essential Medium (Glasgow MEM) And Hank's balanced salt solution. In addition, basic fibroblast growth factor (bFGF) and / or leukocyte migration inhibitory factor (LIF) may be added to the medium as growth factors. Further, if necessary, the medium may be epidermal growth factor (EGF), tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27 -It may contain supplements, N2-supplements, ITS-supplements, antibiotics, etc.

  In addition to the above, it is preferable that serum is contained in the medium at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in its effects, it is preferably used after lot check.

  Commercially available media include Mesenchymal stem cell basal medium from Invitrogen, Mesenchymal stem cell basal medium from Sanko Junyaku, MF medium from TOYOBO, Hank's balanced salt solution from Sigma, etc. Can be used.

  The concentration of the Shobu extract added to the medium used for stem cell culture can be appropriately determined according to the blending amount of the Shobu extract in the above-described stem cell growth promoter or undifferentiated state maintaining agent according to the present invention. The concentration can be, for example, 1 to 1000 μg / mL, preferably 10 to 100 μg / mL. In addition, an extract of Shobu may be periodically added to the medium during the stem cell culture period.

Examples of stem cell culture conditions include 35 to 38 ° C. (preferably 36 to 37 ° C.).
Stem cell undifferentiated state maintenance is, for example, stem cell undifferentiated state maintenance agent according to the present invention or stem cell cultured in the absence of Shobu extract, Determine whether the expression level of the stem cell undifferentiated marker gene is significantly maintained at the mRNA level or the protein level at the same level as the expression level at the start of culture in the stem cells cultured in the presence of shobu extract Can be evaluated. Examples of stem cell undifferentiation marker genes include Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embryonic stem cell pluripotency. Pan G, Thomson JA.). .

  In the method for evaluating stem cell undifferentiated marker gene expression, mRNA or protein is extracted from the cultured stem cells. Next, the expression level of the stem cell undifferentiation marker gene in the obtained mRNA or protein is compared with the expression level of the gene in the stem cell cultured in the absence of the stem cell undifferentiated state maintaining agent or shobu extract according to the present invention. . At the mRNA level, for example, a method of confirming by RT-PCR using a primer or probe specific to a stem cell undifferentiated marker gene, quantitative PCR or Northern blotting can be mentioned. Further, at the protein level, for example, immunological methods such as ELISA, flow cytometry, and Western blotting using an antibody specific to a protein encoded by a stem cell undifferentiation marker gene can be mentioned.

  Stem cells cultured in the presence of an undifferentiated state maintaining agent for stem cells or a shob extract according to the present invention, compared to stem cells cultured in the absence of a stem cell undifferentiated state maintaining agent or a shob extract according to the present invention. Significantly (e.g., 1.5 to 5 times, preferably 3 to 5 times) the expression level of the stem cell undifferentiated marker gene is equivalent to the expression level at the start of culture (e.g., 60 compared to the expression level at the start of culture). %, Preferably 70% or more, and particularly preferably 75% or more), it can be determined that the undifferentiated state of the stem cells could be maintained.

  Further, the proliferation promotion of the stem cell is performed, for example, compared with the stem cell grown in the absence of the stem cell proliferation promoter or the shob extract according to the present invention, or the stem cell proliferation promoter or the shob extract according to the present invention. It can be evaluated by determining whether the number of the stem cells cultured in the presence is significantly increased.

  Compared with the stem cells cultured in the absence of the stem cell proliferation promoter or shobu extract according to the present invention, the number of stem cells cultured in the presence of the stem cell proliferation promoter or shobu extract according to the present invention is significant. (For example, 1.1 to 10 times, preferably 1.4 to 5 times), it can be determined that the proliferation of stem cells could be promoted.

  On the other hand, in accordance with the above-described stem cell growth promoter or undifferentiated state maintaining agent according to the present invention or the method according to the present invention, the Shobu extract is used alone or separately from the medium or mixed with the medium. Also, it can be provided as a reagent kit for maintaining the undifferentiated state of stem cells or promoting proliferation. The kit can include an instruction manual or the like as necessary. Alternatively, the Shobu extract can be mixed with a medium and provided as a medium for maintaining the undifferentiated state of stem cells or promoting proliferation.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.

[Example 1] Production Example of Shobu Extract A production example of a solvent extract using shobu is shown below.
In addition, the show used in a present Example is a commercially available show.

1. Production Example 1 Hot Water Extract of Shobu 800 mL of purified water was added to 100 g of dried product of the above-ground portion of Shobu, and extraction was performed at 95-100 ° C. for 2 hours. Subsequently, the obtained extract was subjected to filtration, and the obtained filtrate was further subjected to concentration and lyophilization, thereby obtaining 4.3 g of hot water extract of shobu.

2. Production Example 2 50% ethanol extract of Shobu To 100 g of dried product of the above-ground portion of Shobu was added 400 mL of a 50 (v / v)% aqueous ethanol solution, and extraction was performed at room temperature for 7 days. Next, the obtained extract was subjected to filtration, and the obtained filtrate was further concentrated to dryness to obtain 2.1 g of 50% ethanol extract of shobu.

3. Production Example 3 Ethanol Extract of Shobu 1 L of ethanol was added to 100 g of dried product of the above-ground portion of shobu, and extraction was performed at room temperature for 7 days. Next, the obtained extract was subjected to filtration, and the obtained filtrate was further concentrated to dryness to obtain 3.7 g of an ethanol extract of shobu.

[Example 2] Evaluation of undifferentiated state maintaining effect and proliferation promoting effect of stem extract on stem cells Using stem extract of production examples 1 to 3 produced in Example 1 below, undifferentiated on stem cells Experimental examples and results of the state maintaining effect and the growth promoting effect are shown.

1. Experimental Example 1 Evaluation of effect of maintaining undifferentiated state on stem cells
Dulbecco's Modified Eagle Medium culture solution (Gibco), fetal bovine serum (FBS, 15%, Sigma), nucleoside solution (100-fold dilution, Dainippon Pharmaceutical), non-essential amino acid solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), β2-mercaptoethanol solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), L-glutamine solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), penicillin (100 unit / mL, Sigma) And a medium prepared by adding streptomycin (100 μg / mL, manufactured by Sigma), mouse embryonic stem cells (mouse ES cells: manufactured by Cosmo Bio) were coated in 5 × 10 on a 6 cm dish coated with gelatin (manufactured by Sigma). ^Five seeds were seeded, each extract (Production Examples 1 to 3) was added to the medium so that the final concentration was 0.001%, and the culture was continued for 3 days.

After 3 days of culture, the cells were collected, washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). After reverse transcription of extracted RNA to cDNA using 2-STEP real-time PCR kit (Applied Biosystems), real-time PCR (95 ° C: 15 seconds, 60 ° C) using the following primer set using ABI7300 (Applied Biosystems) Nanocycle (Undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Review.Nanog and transcriptional networks in embryonic stem cell pluripotency.Pan G, Thomson JA.) The gene expression of was confirmed. Other operations were carried out in accordance with established methods.
Primer set for Nanog (undifferentiated marker):
ATGCCTGCAGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)

The effect of maintaining the undifferentiated state is the relative expression level of Nanog gene (Nanog gene expression level / Gapdh gene expression) calculated as the ratio of Nanog mRNA expression level in mouse ES cells at the start of culture to the internal standard Gapdh mRNA expression level. The value of the amount of relative expression of Nanog in ES cells after 3 days of culture was calculated and evaluated.
The test results are shown in Table 1 below.

  As shown in Table 1, a remarkable effect of maintaining the undifferentiated state of stem cells was observed in all the Shobu extracts (Production Examples 1 to 3). From the above, the extremely excellent stem cell undifferentiated state maintaining effect of the Shobu extract was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on somatic stem cells. As a result, a remarkable effect of maintaining the undifferentiated state of stem cells was observed.

2. Experimental example 2 Evaluation of growth-promoting effect on stem cells 3x10 ⁵ human somatic stem cells (DS Pharma Biomedical) cultured using human stem cell culture solution (TOYOBO) were seeded in 6cm dishes Products (Production Examples 1 to 3) were added to a final concentration of 0.001%, and the culture was continued for 3 days.

  After culturing for 3 days, the cells were washed three times with PBS (−), collected by a rubber policeman, and the number of each cell was counted.

When the total number of cells when no extract is added is taken as a control and the control is 100 (%), the increase or decrease (%) in the number of cells when the Shobu extract (Production Examples 1 to 3) is added is calculated, and the stem cells The growth promoting effect was evaluated.
The test results are shown in Table 2 below.

  As shown in Table 2, a remarkable stem cell proliferation promoting effect was observed in all the Shobu extracts (Production Examples 1 to 3). When the above control value was 100%, the number of human somatic stem cells at the start of culture was 25%. From the above, the extremely excellent stem cell proliferation promoting effect of the Shobu extract was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on embryonic stem cells (ES cells), and a remarkable effect of promoting stem cell proliferation was observed.

  As described above, by applying the extract of Shobu to stem cells, it becomes possible to promote the proliferation of stem cells while maintaining the undifferentiated state more easily and efficiently than conventional techniques. It was.

  As an application example of the present invention, application to regenerative medicine and regenerative beauty is expected. For example, by utilizing the present invention, it becomes possible to easily and efficiently prepare undifferentiated stem cells used for regenerative medicine and regenerative beauty. Furthermore, the stem cell extract according to the present invention is directly injected or applied by oral administration, application, pasting, or the like to stem cells existing after transplantation of stem cells or in tissues, It is possible to proliferate while maintaining an undifferentiated state.

  That is, the present invention can be used as a method for preparing stem cells and / or an undifferentiated state maintaining agent or growth promoting agent for regenerative medicine and regenerative beauty.

Claims (5)

A proliferation promoter for stem cells containing a hot water extract of shobu, an aqueous ethanol extract or an ethanol extract as an active ingredient , wherein the stem cells exclude epidermal stem cells . An agent for maintaining an undifferentiated state of a stem cell , comprising a hot water extract of shobu, an aqueous ethanol extract or an ethanol extract as an active ingredient , wherein the stem cell excludes epidermal stem cells . A method for producing a stem cell, comprising a step of culturing a stem cell in a medium containing a hot water extract of shobu, an aqueous ethanol extract or an ethanol extract , wherein the stem cell excludes epidermal stem cells . A method for promoting the proliferation of stem cells, comprising the step of culturing stem cells in a medium containing a hot water extract of shobu, an aqueous ethanol extract or an ethanol extract , wherein the stem cells exclude epidermal stem cells . A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing a stem cell in a medium containing a hot water extract of shobu, an aqueous ethanol extract or an ethanol extract , wherein the stem cell excludes epidermal stem cells, Said method .