JP6305782B2 - Stem cell undifferentiated state maintenance agent and growth promoter - Google Patents

Description

  The present invention relates to, for example, a stem cell proliferation promoter and an undifferentiated state maintaining agent, a stem cell proliferation promoting method, and an undifferentiated state maintaining method.

  When tissue of vertebrates (especially mammals) is damaged due to injury or disease, or with aging, etc., the regeneration system works and tries to recover the damage of cells / organs. Stem cells provided in the tissue play a major role in this effect. Stem cells have the pluripotency to differentiate into all cells and organs, and this property is thought to lead to recovery by compensating for damaged parts of cells and tissues. Expectations are gathered for regenerative medicine, which is the next generation of medicine using such stem cells.

The most advanced tissue in stem cell research in mammals is the bone marrow. The bone marrow contains living hematopoietic stem cells, which have been shown to be the source of all blood cell regeneration. Furthermore, it has been reported that the bone marrow includes stem cells that can be differentiated into other organs (eg, bone, cartilage, muscle, fat, etc.) in addition to hematopoietic stem cells (see Non-Patent Document 1).
Furthermore, in recent years, it has been clarified that stem cells exist in all organs / tissues other than bone marrow, such as skin, liver, pancreas, fat, etc., and is responsible for regeneration and homeostasis of each organ / tissue. It has been understood (see Non-Patent Documents 2 to 5). In addition, stem cells present in each tissue are excellent in plasticity and may be used for regeneration of organs and tissues that have been impossible to self-replicate until now.

On the other hand, some of these stem cells are known to decrease with aging, and research on techniques to prevent the decrease of stem cells is actively conducted to maintain the homeostasis of each tissue ( Non-patent document 6). In recent years, stem cells have been isolated from living tissues in the field of cell transplantation and tissue engineering (regenerative medicine and regenerative beauty) in order to apply the ability (pluripotency) of stem cells to regeneration of organs and tissues. Development of techniques for propagation is in progress (Non-Patent Documents 7 and 8).
In particular, when culturing stem cells in vitro, it is extremely important to proliferate while maintaining the pluripotency that is the ability of stem cells, that is, maintaining an undifferentiated state. If the undifferentiated state of the stem cells cannot be maintained during this culture and differentiation induction has progressed, the ability (pluripotency) of the finally prepared stem cells has been lost, and the desired effect ( Can not reproduce organs and tissues.
From the above, when stem cells are used for cell transplantation treatment or tissue engineering (regenerative medicine or regenerative beauty) and regeneration of organs or tissues is desired, the stem cells must be able to be cultured while maintaining an undifferentiated state.

To date, there have been several reports on techniques for proliferating stem cells while maintaining an undifferentiated state, but they are still under development. For example, embryonic stem cells (ES cells) and hematopoietic stem cells can be maintained undifferentiated by co-culture with supporting cells (stromal cells or feeder cells) (see Patent Literature 1 and Non-Patent Literatures 9 to 11). ). However, recently, there have been reports of cases of infection between different animals caused by feeder cells-derived endogenous viruses (see Non-Patent Document 12), and stem cell culture using feeder cells is a stem cell for medical purposes. It is not suitable for culturing.
As another method, there is a method of maintaining an undifferentiated state of a stem cell by complexly combining cytokines. For example, mouse ES cells are maintained undifferentiated by adding LIF (Leukemia Inhibitory Factor) to the medium (see Patent Document 2 and Non-Patent Document 13). In addition, maintaining embryonic stem cells in the presence of early-acting cytokines thrombopoietin (TPO), interleukin 6 (IL-6), FLT-3 ligand, and stem cell factor (SCF) It has been reported for somatic stem cells (see Patent Literature 3 and Non-Patent Literature 14).
However, cytokines are expensive and have problems such as collection raw materials and storage stability, and easy use is difficult. In addition, the effect of LIF is limited to a very specific cell lineage. In particular, in primate ES cells and somatic stem cells, it has been clarified that the addition of LIF alone cannot maintain an undifferentiated state. (See Non-Patent Document 10).

  All of the currently reported methods for maintaining the undifferentiated state of stem cells require complicated operations and have a low effect of maintaining the undifferentiated state. Therefore, in order to use stem cells for regenerative medicine, a technique for proliferating stem cells while maintaining an undifferentiated state has been demanded. That is, there has been a demand for a technique that can proliferate stem cells while maintaining an undifferentiated state in a safe, simple and efficient manner.

  It is known that Sarnashi has an anti-aging action, an antioxidant action, a whitening action, a moisturizing action, an anti-inflammatory action and a slimming action (see Patent Document 4). However, nothing has been known about the effect of promoting the proliferation of stem cells and the effect of maintaining the undifferentiated state.

JP 2004-24089 A JP-T-2002-525042 Japanese Patent No. 3573354 JP 2008-222625 A

Pittenger M.M. F. Et al., Science, 1999, Vol. 284, pp. 143-147 Goodell M.M. A. Et al., Nat. Med. , 1997, Vol. 3, pp. 1337-1345 Zulewski H. Et al., Diabetes, 2001, Vol. 50, pp. 521-533 Suzuki A. Et al., Hepatology, 2000, Vol. 32, pp. 1230-1239 Zuk P.M. A. Et al., Tissue Engineering, 2001, Vol. 7, pp. 211-228 Koji Hasegawa, Aesthetic Dermatology, 2013, Vol. 23, pp. 1-11 Hiroshi Mabuchi et al., Journal of Japanese Society for Regenerative Medicine, 2007, Vol. 6, pp. 263-268 All Kitagawa et al., Journal of Japanese Society for Regenerative Medicine, 2008, Vol. 7, pp. 14-18 Thomson J.M. A. Et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7848 Thomson J.M. A. Et al., Science, 1998, Vol. 282, pp. 1145-1147 Reubinoff B.E. E. Et al., Nature Biotech. , 2000, Vol. 18, pp. 399-404 van der Laan L.L. J. et al. Et al., Nature, 2000, Vol. 407, pp. 90-94 Smith A. G. Et al., Dev. Biol. , 1987, Vol. 121, pp. 1-9 Madlambayan G.M. J. et al. J. et al. Hematother. Stem Cell Res. , 2001, Vol. 10, pp. 481-492

As described above, there is a need for a technique that can proliferate stem cells while maintaining an undifferentiated state.
Therefore, in view of the above-described circumstances, an object of the present invention is to provide a method for efficiently proliferating stem cells while maintaining an undifferentiated state.

As a result of intensive studies to solve the above-mentioned problems, it has been found that the extract of Sarnashi has an excellent undifferentiated state maintaining effect and proliferation promoting effect on stem cells, and the present invention has been completed.
That is, the present invention includes the following.
(1) An agent for promoting proliferation of stem cells, comprising an extract of Sarnashi.
(2) An agent for maintaining an undifferentiated state of a stem cell, characterized by containing an extract of Sarnashi.
(3) A method for producing a stem cell, comprising a step of culturing the stem cell in a medium containing an extract of Sarnashi.
(4) A method for promoting the proliferation of stem cells, comprising a step of culturing the stem cells in a medium containing an extract of Sarnashi.
(5) A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a medium containing an extract of Sarnashi.

  According to the present invention, stem cells can be efficiently proliferated while maintaining an undifferentiated state. Therefore, the present invention can greatly contribute to the fields of regenerative medicine and regenerative beauty.

Hereinafter, the present invention will be described in detail.
The stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention contains an extract of Sarnashi as an active ingredient. According to the stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention, the stem cell proliferation can be promoted while maintaining the undifferentiated state of the stem cells, and the drug can be used for tissue regeneration such as regenerative medicine and regenerative beauty. It is a useful drug in the field. Furthermore, the stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention can be used as a research reagent for maintaining or promoting proliferation of an undifferentiated state of stem cells.
The present invention also relates to a method for accelerating stem cell proliferation while maintaining the undifferentiated state of stem cells by culturing stem cells in a medium containing an extract of Sarnashi. In other words, the method according to the present invention is referred to as a method for producing a stem cell, a method for promoting proliferation of a stem cell, or a method for maintaining an undifferentiated state of a stem cell, including a step of culturing the stem cell in a medium containing an extract of Sarnashi. it can.

  Here, the extract of Sarnashi used in the present invention is part and / or all of plant bodies such as flowers, branches, trunks, leaves, roots, fruits, seeds, etc. More extracted. The extraction method is not particularly limited, and for example, it may be a heat extraction or a room temperature extraction. Furthermore, the plant may be extracted as it is, or may be extracted after drying.

Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, Propyl ether, etc.). Preferably, water, lower alcohol and liquid polyhydric alcohol are preferable, and water and ethanol are particularly preferable. These solvents may be used alone or in combination of two or more. For example, an ethanol aqueous solution of 30 to 70 v / v% can also be used. Moreover, the acid which adjusted the pH by adding an acid or an alkali to the said extraction solvent can also be used.
Using the above-mentioned solvent, Sarnashi is subjected to solvent extraction. The ratio of Sarnashi to the solvent is, for example, 1 to 50% (w / w), preferably 5 to 25% (w / w). For example, by adding water to a dried product of Sarnashi and performing hot water extraction at 95 to 100 ° C., a Sarnash extract can be obtained. Alternatively, a lower alcohol (for example, ethanol) or a liquid polyhydric alcohol (for example, propylene glycol, 1,3-butylene glycol, etc.) is added to the dried product of Sarnashi, and extraction is performed at room temperature (for example, 5-35 ° C.). Thus, an extract of Sarnashi can be obtained.

After the solvent extraction, the obtained extract can be used as an extract of Sarnashi. Alternatively, if necessary, the obtained extract is subjected to treatment such as concentration, drying, dilution, filtration, spray drying, freeze drying, decolorization with activated carbon, deodorization treatment, etc. It can be an extract of Sarnashi.
The extract of Sarnashi thus obtained is used as an active ingredient of the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention. Stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention includes cell culture additives, research reagents, medical reagents, cell transplants, pharmaceuticals, quasi drugs, cosmetics, foods, etc. Formulation and application to pharmaceutical preparations are possible.

  The compounding amount of the extract of Sarnashi in the proliferation promoter or undifferentiated state maintaining agent according to the present invention is not particularly limited, but is, for example, 0.00001 to 10 wt in terms of a dry product relative to the total amount of the preparation. %, And most preferably 0.0001 to 1% by weight. If it is less than 0.00001% by weight, the effect may not be sufficiently exhibited. In addition, for internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Usually, the daily dose per adult is preferably 5 mg or more as a dry product, 10 mg to 2 g is more preferable. Furthermore, 20 mg to 0.5 g is most preferable.

  By applying the stem cell proliferation promoter or undifferentiated state maintenance agent according to the present invention described above to stem cells of animals including humans, the proliferation of stem cells is promoted and the undifferentiated state of stem cells is maintained. be able to. The stem cell to which the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is applied is not particularly limited as long as it meets the purpose of the present invention. For example, embryonic stem cells (ES cells); bone marrow, blood And somatic stem cells present in skin, fat, brain, liver, pancreas, kidney, muscle and other tissues; stem cells artificially prepared by gene transfer and the like. In addition, the stem cell may be any of a primary cultured cell, a subcultured cell, or a frozen cell. Preferably, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is more effective for stem cells derived from bone marrow, blood, skin, or adipose tissue. Furthermore, as long as they have equivalent characteristics regarding the direction of differentiation of stem cells and the process of differentiation, the present invention can be applied to stem cells derived from all mammals. For example, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is a stem cell of a mammal such as human, monkey, mouse, rat, guinea pig, rabbit, cat, dog, horse, cow, sheep, goat, pig, etc. Can be effective. Alternatively, the stem cell proliferation promoter or undifferentiated state maintenance agent according to the present invention can be applied to non-human ES cells or mammalian somatic stem cells.

  On the other hand, the method according to the present invention is a method for producing a stem cell, a method for promoting proliferation of a stem cell, or a method for maintaining an undifferentiated state of a stem cell, which comprises a step of culturing the stem cell in a medium containing an extract of Sarnashi.

In the method according to the present invention, the medium for culturing stem cells and the additive used at the same time are not limited, and examples thereof include the following. Specifically, as a medium for culturing stem cells, a basic medium containing components necessary for cell survival (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, etc.), such as Dulbecco's Modified Eagle, is used. Medium (D-MEM), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle Eagle (BME), Dulbecco's Modified Eagle Medium (N-MentientMix). (Glasgow MEM), Hank's balanced salt solution, and the like. In addition, basic fibroblast growth factor (bFGF) and / or leukocyte migration inhibitory factor (LIF) may be added to the medium as growth factors. Further, if necessary, the medium may be epidermal growth factor (EGF), tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27. -It may contain supplements, N2-supplements, ITS-supplements, antibiotics and the like.
In addition to the above, it is preferable that serum is contained in the medium at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in its effects, it is preferably used after lot check.

  Commercially available media include Mesenchymal stem cell basal medium manufactured by Invitrogen, Mesenchymal stem cell basal medium manufactured by Sanko Junyaku Co., Ltd., MF medium manufactured by TOYOBO, Hanks' solution manufactured by Sigma (Hank's balanced salt solution) ) Etc. can be used.

  The added concentration of the extract of Sarnashi to the medium used for the stem cell culture may be appropriately determined according to the blending amount of the extract of Sarnashi in the above-described stem cell growth promoter or undifferentiated state maintaining agent according to the present invention. The concentration can be, for example, 0.1 to 1000 μg / mL, preferably 1 to 100 μg / mL. Further, during the stem cell culture period, the extract of Sarnashi may be periodically added to the medium.

Examples of the culture conditions for stem cells include 35 to 38 ° C. (preferably 36 to 37 ° C.).
Stem cell undifferentiated state maintenance is, for example, the stem cell undifferentiated state maintenance agent according to the present invention or the stem cell cultured in the absence of the extract of Sarnashi, Determine whether the expression level of the stem cell undifferentiated marker gene is significantly maintained at the mRNA level or the protein level at the same level as the expression level at the start of culture in the stem cells cultured in the presence of the extract of Sarnashi Can be evaluated. Examples of the stem cell undifferentiation marker gene include Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transitional networks in Jemantic in Pamp. .

  In the evaluation method of stem cell undifferentiated marker gene expression, mRNA or protein is extracted from the cultured stem cells. Subsequently, the expression level of the stem cell undifferentiation marker gene in the obtained mRNA or protein is compared with the expression level of the gene in the stem cell cultured in the absence of the stem cell undifferentiation state maintenance agent or the extract of Sarnashi according to the present invention. . At the mRNA level, for example, RT-PCR using a primer or probe specific to a stem cell undifferentiation marker gene, a method of confirming by quantitative PCR or Northern blotting can be mentioned. At the protein level, for example, immunological methods such as ELISA, flow cytometry, and Western blotting using an antibody specific for a protein encoded by a stem cell undifferentiated marker gene can be mentioned.

  Compared to the stem cells cultured in the absence of the stem cell undifferentiated state maintenance agent or the extract of the sardine according to the present invention, in the stem cells cultured in the presence of the stem cell undifferentiated state maintenance agent or the sarnashi extract of the present invention. Significantly (for example, 1.5 to 5 times, preferably 2 to 3 times) the expression level of the stem cell undifferentiated marker gene is equivalent to the expression level at the start of culture (eg, compared with the expression level at the start of culture). At an expression level of 60% or more, preferably 70% or more, particularly preferably 75% or more), it can be determined that the undifferentiated state of the stem cells could be maintained.

  In addition, the proliferation promotion of the stem cell according to the present invention is, for example, compared to the stem cell cultured in the absence of the stem cell proliferation promoting agent or the extract of the Sarnashi according to the present invention, or the extract of the stem cell or the Sarnashi extract according to the present invention. It can be evaluated by determining whether the number of the stem cells cultured in the presence is significantly increased.

  Compared with the stem cells cultured in the absence of the stem cell proliferation promoter or the extract of the sultanas according to the present invention, the number of stem cells cultured in the presence of the stem cell proliferation promoter or the sarnash extract according to the present invention is significant. (For example, 1.1 to 10 times, preferably 1.2 to 1.5 times), it can be determined that the proliferation of stem cells could be promoted.

  On the other hand, according to the above-described stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention or the method according to the present invention, the extract of Sarnashi alone or separately from the medium or mixed with the medium. Also, it can be provided as a reagent kit for maintaining the undifferentiated state of stem cells or promoting proliferation. The kit can include an instruction manual or the like as necessary. Alternatively, the extract of Sarnashi can be mixed with a medium and provided as a medium for maintaining the undifferentiated state of stem cells or promoting growth.

EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.
[Example 1] Production example of extract of Sarnashi A production example of a solvent extract using Sarnashi is shown below.
1. Production Example 1 Hot water extract of Sarnashi fruit 400 mL of purified water was added to 20 g of dried product of Sarnashi fruit, extracted at 95-100 ° C. for 2 hours, filtered, and the filtrate was concentrated, lyophilized, and dried. 11.8 g of hot water extract was obtained.
2. Production Example 2 50% Ethanol Extract of Sarnashi Fruit Add 400 mL of 50 (w / v)% ethanol to 20 g of dried fruit of Sarnashi fruit, extract at room temperature for 7 days, filter, and concentrate the filtrate to dryness. Then, 7.0 g of a 50% ethanol extract of Sarnashi was obtained.
3. Production Example 3 Ethanol extract of Sarnashi fruit 1000 mL of ethanol was added to 40 g of dried product of Sarnashi fruit, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness. 6 g was obtained.
4). Production Example 4 50% 1,3-Butylene Glycol Extract of Sarnashi Fruit Add 50 mL of 50 (w / v)% 1,3-butylene glycol to 20 g of Sarnashi fruit, extract at room temperature for 7 days, filter, 380 g of 50% 1,3-butylene glycol extract was obtained.

[Example 2] Evaluation of undifferentiated state maintaining effect and proliferation promoting effect on stem cells of extract of Sarnashi Undifferentiated on stem cells using extracts of Sarnasi of Production Examples 1 to 4 produced in Example 1 below Experimental examples and results of the state maintaining effect and the growth promoting effect are shown.
1. Experimental Example 1 Evaluation of effect of maintaining undifferentiated state on stem cells In Dulbecco's Modified Eagle Medium culture solution (Gibco), fetal bovine serum (FBS, 15%, Sigma), nucleoside solution (100-fold dilution, Dainippon) Manufactured by Pharmaceutical Co., Ltd.), non-essential amino acid solution (100-fold dilution, manufactured by Dainippon Pharmaceutical), β2-mercaptoethanol solution (100-fold diluted, manufactured by Dainippon Pharmaceutical), L-glutamine solution (100-fold diluted, Dainippon Pharmaceutical) Mouse embryonic stem cells (mouse ES cells: manufactured by Cosmo Bio) using a medium prepared by adding penicillin (100 units / mL, manufactured by Sigma) and streptomycin (100 μg / mL, manufactured by Sigma). , gelatin (Sigma Co., Ltd.) in the seeded 5x10 ⁵ cells in 6cm dish coated, each extraction (Production Example 1-4) a final concentration was added to the medium to be 0.01%, was continued for 3 days of culture.
After 3 days of culture, the cells were collected, washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). 2-STEP real-time PCR kit (Applied Biosystems) was used to reverse-transcribe the extracted RNA into cDNA, and then ABI7300 (Applied Biosystems) was used for real-time PCR (95 ° C: 15 seconds, 60 ° C) using the following primer set: : 30 seconds, 40 cycles), and Nanog (undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Revue. Nanog and transcribable networks in embr. The gene expression of was confirmed. Other operations were carried out in accordance with established methods.
Primer set for Nanog (undifferentiation marker):
ATGCCTGCAGGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)

The effect of maintaining the undifferentiated state is that the expression level of Nanog mRNA in mouse ES cells at the start of culture was calculated as a ratio relative to the expression level of Gapdh mRNA as an internal standard (Nanog gene expression level / Gapdh gene expression). The amount of the relative expression level of Nanog in ES cells after 3 days of culture was calculated and evaluated.
The test results are shown in Table 1 below.

  As shown in Table 1, a remarkable effect of maintaining the undifferentiated state of the stem cells was observed in all the extracts of Sarnashi (Production Examples 1 to 4). From the above, the extremely excellent stem cell undifferentiated state maintenance effect of the extract of Sarnashi was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on somatic stem cells. As a result, a remarkable effect of maintaining the undifferentiated state of stem cells was observed.

2. Experimental Example 2 Evaluation of Growth-Promoting Effect on Stem Cells Human somatic stem cells (DS Pharma Biomedical) cultured using human stem cell culture medium (manufactured by TOYOBO) are seeded at 3 × 10 ^{5 in} a 6 cm dish, and the extract of saruna The product (Production Examples 1 to 3) was added to a final concentration of 0.01%, and the culture was continued for 3 days.
After culturing for 3 days, the cells were washed three times with PBS (−) and then collected by a rubber policeman, and the number of each cell was counted.
When the total number of cells when no extract is added is used as a control and the control is 100 (%), the increase / decrease (%) in the number of cells when the extract of Sarnashi (Production Examples 1 to 4) is added is calculated. The growth promoting effect was evaluated.
The test results are shown in Table 2 below.

  As shown in Table 2, a remarkable stem cell proliferation-promoting effect was observed in all the extracts of Sarnashi (Production Examples 1 to 4). When the control value described above was 100%, the number of human somatic stem cells at the start of culture was 25%. From the above, the extremely excellent stem cell proliferation promoting effect of the extract of Sarnashi was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on embryonic stem cells (ES cells), and a remarkable effect of promoting stem cell proliferation was observed.

  As described above, by applying the extract of Sarnashi to stem cells, it becomes possible to promote the proliferation of stem cells while maintaining an undifferentiated state more easily and efficiently than conventional techniques. It was.

As an application example of the present invention, application to regenerative medicine and regenerative beauty is expected. For example, by utilizing the present invention, it becomes possible to easily and efficiently prepare undifferentiated stem cells used for regenerative medicine and regenerative beauty. Furthermore, the stem cell extract according to the present invention is directly injected or applied by oral administration, application, pasting, etc., to the stem cells present after transplantation of the stem cells or in the tissue, It is possible to proliferate while maintaining an undifferentiated state.
That is, the present invention can be used as a preparation method of stem cells and / or an undifferentiated state maintaining agent or growth promoting agent for regenerative medicine and regenerative beauty.

Claims (5)

A stem cell proliferation promoter characterized by containing a hot water extract of Sarnasi, an aqueous ethanol extract, an ethanol extract or a butylene glycol extract. An agent for maintaining an undifferentiated state of a stem cell, comprising a hot water extract of Sarnasi, an aqueous ethanol extract, an ethanol extract or a butylene glycol extract. A method for producing a stem cell, comprising a step of culturing a stem cell in a medium containing a hot water extract, a ethanol aqueous solution extract, an ethanol extract or a butylene glycol extract of Sarnashi . A method for promoting the proliferation of stem cells, comprising a step of culturing stem cells in a medium containing a hot water extract, a ethanol aqueous solution extract, an ethanol extract or a butylene glycol extract of Sarnashi . A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a medium containing a hot water extract, a ethanol aqueous solution extract, an ethanol extract, or a butylene glycol extract of Sarnashi .