JP6228426B2 - Stem cell undifferentiated state maintenance agent and growth promoter - Google Patents

Description

  The present invention relates to, for example, a stem cell proliferation promoter and an undifferentiated state maintaining agent, a stem cell proliferation promoting method, and an undifferentiated state maintaining method.

  When a tissue of a vertebrate (particularly a mammal) is damaged due to injury or disease or aging, etc., cell / organ damage occurs, the regeneration system works to try to recover the cell / organ damage. Stem cells provided in the tissue play a major role in this effect. Stem cells have the pluripotency to differentiate into all cells and organs, and this property is thought to lead to recovery by compensating for damaged parts of cells and tissues. Expectations are gathered for regenerative medicine, which is the next generation of medicine using such stem cells.

  The most advanced tissue in stem cell research in mammals is the bone marrow. The bone marrow contains living hematopoietic stem cells, which have been shown to be the source of all blood cell regeneration. Furthermore, it has been reported that the bone marrow includes stem cells that can be differentiated into other organs (eg, bone, cartilage, muscle, fat, etc.) in addition to hematopoietic stem cells (see Non-Patent Document 1).

  Furthermore, in recent years, in addition to bone marrow, it has been clarified that stem cells exist in all organs / tissues such as liver, pancreas, fat, etc., and it has been found that they are responsible for regeneration and homeostasis of each organ / tissue. (See Non-Patent Documents 2 to 5). In addition, stem cells present in each tissue are excellent in plasticity and may be used for regeneration of organs and tissues that have been impossible to self-replicate until now.

  In recent years, in order to apply the ability (pluripotency) of these stem cells to the regeneration of organs and tissues, they are cultured after separating stem cells from living tissues in the field of cell transplantation and tissue engineering (regenerative medicine and regenerative beauty). Development of techniques for propagation is being promoted (Non-Patent Documents 6 to 7).

  In particular, when culturing stem cells in vitro, it is extremely important to proliferate while maintaining the pluripotency that is the ability of stem cells, that is, maintaining an undifferentiated state. If the undifferentiated state of stem cells cannot be maintained during this culture and differentiation induction has progressed, the ability (pluripotency) of the finally prepared stem cells has been lost, and the desired effect ( Can not reproduce organs and tissues.

  From the above, when stem cells are used for cell transplantation treatment or tissue engineering (regenerative medicine or regenerative beauty) and regeneration of organs or tissues is desired, stem cells must be able to be cultured while maintaining an undifferentiated state.

  To date, there have been several reports on techniques for proliferating stem cells while maintaining an undifferentiated state, but they are still under development. For example, embryonic stem cells (ES cells) and hematopoietic stem cells can be maintained undifferentiated by co-culturing with supporting cells (stromal cells or feeder cells) (see Patent Document 1 and Non-Patent Documents 8 to 10). ). However, recently, there have been reports of cases of infection between heterologous animals caused by feeder cell-derived endogenous viruses (see Non-Patent Document 11), and stem cell culture using feeder cells is a stem cell for medical purposes. It is not suitable for culturing.

  As another method, there is a method of maintaining an undifferentiated state of a stem cell by complexly combining cytokines. For example, mouse ES cells are maintained undifferentiated by adding LIF (Leukemia Inhibitory Factor) to the medium (see Patent Document 2 and Non-Patent Document 12). In addition, in the presence of early-acting cytokines thrombopoietin (TPO), interleukin 6 (IL-6), FLT-3 ligand, and stem cell factor (SCF), it is possible to maintain undifferentiated embryonic stem cells, It has been reported for somatic stem cells (see Patent Document 3 and Non-Patent Document 13).

  However, cytokines are expensive and have problems such as collection raw materials and storage stability, and easy use is difficult. In addition, the effects of LIF are limited to very specific cell lineages, especially in primate ES cells and somatic stem cells, and it has been clarified that LIF alone cannot maintain an undifferentiated state. (See Non-Patent Document 9).

  All of the currently reported methods for maintaining the undifferentiated state of stem cells require complicated operations and have a low effect of maintaining the undifferentiated state. Therefore, in order to utilize stem cells for regenerative medicine, a technique for growing stem cells to a number sufficient for transplantation while maintaining an undifferentiated state has been demanded. That is, there has been a demand for a technique that can proliferate stem cells while maintaining an undifferentiated state in a safe, simple and efficient manner.

JP 2004-24089 A Special table 2002-525042 gazette Japanese Patent No. 3573354

Pittenger M.F. et al., Science, 1999, Vol. 284, pp. 143-147 Goodell M.A. et al., Nat. Med., 1997, Vol. 3, pp. 1337-1345 Zulewski H. et al., Diabetes, 2001, Vol. 50, pp. 521-533 Suzuki A. et al., Hepatology, 2000, Vol. 32, pp. 1230-1239 Zuk P.A. et al., Tissue Engineering, 2001, Vol. 7, pp. 211-228 Hiroshi Mabuchi et al., Journal of Japanese Society for Regenerative Medicine, 2007, Vol. 6, pp. 263-268 All Kitagawa et al., Journal of Japanese Society for Regenerative Medicine, 2008, Vol. 7, pp. 14-18 Thomson J.A. et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7848 Thomson J.A. et al., Science, 1998, Vol. 282, pp. 1145-1147 Reubinoff B.E., et al., Nature Biotech., 2000, Vol. 18, pp. 399-404 van der Laan L.J., et al., Nature, 2000, Vol. 407, pp. 90-94 Smith A.G., et al., Dev. Biol., 1987, Vol. 121, pp. 1-9 Madlambayan G.J. et al., J. Hematother. Stem Cell Res., 2001, Vol. 10, pp. 481-492

As described above, there is a need for a technique that can proliferate stem cells while maintaining an undifferentiated state.
Therefore, in view of the above-described circumstances, an object of the present invention is to provide a method for efficiently proliferating stem cells while maintaining an undifferentiated state.

  As a result of intensive studies in order to solve the above-mentioned problems, the present inventors have found that an extract of chili has excellent undifferentiated state maintenance effects and proliferation promoting effects on stem cells, and has completed the present invention.

That is, the present invention includes the following.
(1) A stem cell proliferation promoter containing an extract of red pepper as an active ingredient.
(2) An agent for maintaining an undifferentiated state of stem cells, which contains an extract of red pepper as an active ingredient.
(3) A method for producing a stem cell, comprising a step of culturing the stem cell in a medium containing a capsicum extract.
(4) A method for promoting the proliferation of stem cells, comprising a step of culturing stem cells in a medium containing a red pepper extract.
(5) A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a medium containing a capsicum extract.

  According to the present invention, stem cells can be efficiently proliferated while maintaining an undifferentiated state. Therefore, the present invention can greatly contribute to the fields of regenerative medicine and regenerative beauty.

Hereinafter, the present invention will be described in detail.
The stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention contains an extract of red pepper as an active ingredient. According to the stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention, the stem cell proliferation can be promoted while maintaining the undifferentiated state of the stem cells, and the drug can be used for tissue regeneration such as regenerative medicine and regenerative beauty. It is a useful drug in the field. Furthermore, the stem cell proliferation promoter or the undifferentiated state maintenance agent according to the present invention can be used as a research reagent for maintaining or promoting proliferation of an undifferentiated state of stem cells.

  The present invention also relates to a method of promoting stem cell proliferation while maintaining the undifferentiated state of stem cells by culturing stem cells in a medium containing a red pepper extract. In other words, the method according to the present invention refers to a method for producing a stem cell, a method for promoting proliferation of a stem cell, or a method for maintaining an undifferentiated state of a stem cell, which includes a step of culturing the stem cell in a medium containing a red pepper extract. it can.

  Here, the red pepper (winter cocoon) used in the present invention means a mature seed of the cucurbitaceae red pepper (or also referred to as red pepper) (Benincasa cerifera Savi or Benincasa hispida (Thunb.) Cogn.). The extraction method of the extract from chili pepper is not specifically limited, For example, the heating extraction method may be sufficient, and the normal temperature and refrigeration extraction method may be sufficient.

  Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, Propyl ether and the like). Preferably, water, lower alcohol and liquid polyhydric alcohol are preferable, and water and ethanol are particularly preferable. These solvents may be used singly or in combination of two or more. For example, an aqueous ethanol solution of 30 to 70 v / v% can be used. Further, it is also possible to use a solvent whose pH is adjusted by adding acid or alkali to the extraction solvent.

  The pepper is subjected to solvent extraction using the solvent described above. The ratio of the pepper to the solvent is, for example, 1 to 50% (w / w), preferably 5 to 25% (w / w). For example, an extract of chili can be obtained by adding water to a dry matter of chili and performing hot water extraction at 95 to 100 ° C. Alternatively, a lower alcohol (eg, ethanol) or a liquid polyhydric alcohol (eg, propylene glycol, 1,3-butylene glycol, etc.) is added to the dried pepper, and extraction is performed at room temperature (eg, 5 to 35 ° C.). Thus, an extract of red pepper can be obtained.

  After solvent extraction, the resulting solvent phase itself can be used as an extract of red pepper. Alternatively, the obtained solvent phase is subjected to treatment such as concentration, dilution, filtration and drying, and decolorization and deodorization treatment with activated carbon, etc. as necessary, and the resulting product is used as an extract of chili. Can do. In particular, it is preferable to subject the extracted solution to a treatment such as concentration to dryness, spray drying, freeze drying, and the like, and use the obtained dried product as an extract of red pepper.

  The extract of red pepper thus obtained is used as an active ingredient of the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention. The stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention includes cell culture additives, research reagents, medical reagents, cell transplants, pharmaceuticals, quasi drugs, cosmetics, foods, and the like. Can be blended and applied.

  The compounding amount of the extract of red pepper in the stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention is not particularly limited, but is, for example, 0.00001 to 10% by weight in terms of dry matter relative to the total amount of the drug. Preferably, it is most preferably 0.0001 to 1% by weight. If the amount is less than 0.00001% by weight, the effect may not be sufficiently exerted.

  By applying the stem cell proliferation promoter or undifferentiated state maintenance agent according to the present invention described above to stem cells of animals including humans, the proliferation of stem cells is promoted and the undifferentiated state of stem cells is maintained. be able to. Stem cells to which the stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention is applied are not particularly limited as long as they meet the object of the present invention. For example, embryonic stem cells (ES cells); bone marrow, blood And somatic stem cells present in skin, fat, brain, liver, pancreas, kidney, muscle and other tissues; stem cells artificially prepared by gene transfer and the like. In addition, the stem cell may be any of a primary cultured cell, a subcultured cell, or a frozen cell. Preferably, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is more effective for stem cells derived from bone marrow, blood, skin, or adipose tissue. Furthermore, as long as they have equivalent characteristics regarding the direction of differentiation of stem cells and the process of differentiation, the present invention can be applied to stem cells derived from all mammals. For example, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention is a stem cell of a mammal such as human, monkey, mouse, rat, guinea pig, rabbit, cat, dog, horse, cow, sheep, goat, pig, etc. Can be effective.

  Alternatively, the stem cell proliferation promoter or the undifferentiated state maintaining agent according to the present invention can be applied to non-human ES cells or mammalian somatic stem cells.

  On the other hand, the method according to the present invention is a method for producing a stem cell, a method for promoting proliferation of a stem cell, or a method for maintaining an undifferentiated state of a stem cell, which comprises a step of culturing the stem cell in a medium containing a red pepper extract.

  In the method according to the present invention, the medium for culturing stem cells and the additive used at the same time are not limited, and examples thereof include the following.

  Specifically, as a medium for culturing stem cells, a basic medium containing components necessary for cell survival (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, etc.), such as Dulbecco's Modified Eagle Medium ( D-MEM), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle (BME), Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (D-MEM / F-12), Glasgow Minimum Essential Medium (Glasgow MEM) And Hank's balanced salt solution. In addition, basic fibroblast growth factor (bFGF) and / or leukocyte migration inhibitory factor (LIF) may be added to the medium as growth factors. Further, if necessary, the medium may be epidermal growth factor (EGF), tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27 -It may contain supplements, N2-supplements, ITS-supplements, antibiotics, etc.

  In addition to the above, it is preferable that serum is contained in the medium at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in its effects, it is preferably used after lot check.

  Commercially available media include Mesenchymal stem cell basal medium from Invitrogen, Mesenchymal stem cell basal medium from Sanko Junyaku, MF medium from TOYOBO, Hank's balanced salt solution from Sigma, etc. Can be used.

The concentration of the extract of chili pepper with respect to the medium used for stem cell culture may be appropriately determined according to the blending amount of the chili extract in the above-described stem cell growth promoter or undifferentiated state maintaining agent according to the present invention. The concentration can be, for example, 1 to 1000 μg / mL, preferably 10 to 100 μg / mL. Moreover, you may add an extract of a red pepper regularly to a culture medium during the culture | cultivation period of a stem cell.
Examples of stem cell culture conditions include 35 to 38 ° C. (preferably 36 to 37 ° C.).

  Stem cell undifferentiated state maintenance is, for example, the stem cell undifferentiated state maintenance agent according to the present invention or the stem cell cultured in the absence of a red pepper extract, Determine whether the expression level of the stem cell undifferentiated marker gene is significantly maintained at the mRNA level or the protein level at the same level as the expression level at the start of culture in the stem cells cultured in the presence of the extract of red pepper Can be evaluated. Examples of stem cell undifferentiation marker genes include Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embryonic stem cell pluripotency. Pan G, Thomson JA.). .

  In the method for evaluating stem cell undifferentiated marker gene expression, mRNA or protein is extracted from the cultured stem cells. Subsequently, the expression level of the stem cell undifferentiation marker gene in the obtained mRNA or protein is compared with the expression level of the gene in the stem cell cultured in the absence of the stem cell undifferentiation state maintenance agent or the extract of red pepper according to the present invention. . At the mRNA level, for example, a method of confirming by RT-PCR using a primer or probe specific to a stem cell undifferentiated marker gene, quantitative PCR or Northern blotting can be mentioned. Further, at the protein level, for example, immunological methods such as ELISA, flow cytometry, and Western blotting using an antibody specific to a protein encoded by a stem cell undifferentiation marker gene can be mentioned.

  Compared to the stem cells cultured in the absence of the stem cell undifferentiated state maintenance agent or chili extract according to the present invention, the stem cell cultured in the presence of the stem cell undifferentiated state maintenance agent or chili extract according to the present invention Significantly (e.g., 1.5 to 5 times, preferably 3 to 5 times) the expression level of the stem cell undifferentiated marker gene is equivalent to the expression level at the start of culture (e.g., 60 compared to the expression level at the start of culture). %, Preferably 70% or more, and particularly preferably 75% or more), it can be determined that the undifferentiated state of the stem cells could be maintained.

  Further, the proliferation promotion of the stem cell is performed, for example, compared with the stem cell cultured in the absence of the stem cell proliferation promoter or the red pepper extract according to the present invention, or the stem cell proliferation promoter or the red pepper extract according to the present invention. It can be evaluated by determining whether the number of the stem cells cultured in the presence is significantly increased.

  Compared with the stem cells cultured in the absence of the stem cell proliferation promoter or capsicum extract according to the present invention, the number of stem cells cultured in the presence of the stem cell proliferation promoter or capsicum extract according to the present invention is significant. (For example, 1.1 to 10 times, preferably 1.4 to 5 times), it can be determined that the proliferation of stem cells could be promoted.

  On the other hand, the stem cell proliferation promoter or undifferentiated state maintaining agent according to the present invention or the method according to the present invention described above, the capsicum extract, alone or separately from the medium or mixed with the medium. Also, it can be provided as a reagent kit for maintaining the undifferentiated state of stem cells or promoting proliferation. The kit can include an instruction manual or the like as necessary. Alternatively, the extract of red pepper can be mixed with a medium and provided as a medium for maintaining the undifferentiated state of stem cells or promoting proliferation.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.

[Example 1] Production example of extract of red pepper An example of production of a solvent extract using hot pepper is shown below.
In addition, the red pepper used in the present Example is a commercially available red pepper.

1. Production Example 1 Hot water extract of red pepper 800 mL of purified water was added to 100 g of dried red pepper and extracted at 95-100 ° C. for 2 hours. Subsequently, the obtained extract was subjected to filtration, and the obtained filtrate was further subjected to concentration and lyophilization, thereby obtaining 1.5 g of hot water extract of red pepper.

2. Production Example 2 50% ethanol extract of red pepper 400 mL of a 50 (v / v)% aqueous ethanol solution was added to 100 g of dried red pepper and extracted for 7 days at room temperature. Subsequently, the obtained extract was subjected to filtration, and the obtained filtrate was further concentrated to dryness to obtain 1.3 g of a 50% ethanol extract of red pepper.

3. Production Example 3 Ethanol extract of red pepper 1 L of ethanol was added to 100 g of dried red pepper and extracted for 7 days at room temperature. Next, the obtained extract was subjected to filtration, and the obtained filtrate was further concentrated to dryness to obtain 2.3 g of an extract of hot pepper.

[Example 2] Evaluation of undifferentiated state maintaining effect and proliferation promoting effect on stem cells of extract of red pepper Undifferentiated on stem cells using extract of hot pepper of Production Examples 1 to 3 produced in Example 1 below Experimental examples and results of the state maintaining effect and the growth promoting effect are shown.

1. Experimental Example 1 Evaluation of effect of maintaining undifferentiated state on stem cells
Dulbecco's Modified Eagle Medium culture solution (Gibco), fetal bovine serum (FBS, 15%, Sigma), nucleoside solution (100-fold dilution, Dainippon Pharmaceutical), non-essential amino acid solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), β2-mercaptoethanol solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), L-glutamine solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), penicillin (100 unit / mL, Sigma) And a medium prepared by adding streptomycin (100 μg / mL, manufactured by Sigma), mouse embryonic stem cells (mouse ES cells: manufactured by Cosmo Bio) were coated in 5 × 10 on a 6 cm dish coated with gelatin (manufactured by Sigma). ^Five seeds were seeded, each extract (Production Examples 1 to 3) was added to the medium so that the final concentration was 0.001%, and the culture was continued for 3 days.

  After 3 days of culture, the cells were collected, washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). After reverse transcription of extracted RNA to cDNA using 2-STEP real-time PCR kit (Applied Biosystems), real-time PCR (95 ° C: 15 seconds, 60 ° C) using the following primer set using ABI7300 (Applied Biosystems) Nanocycle (Undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Review.Nanog and transcriptional networks in embryonic stem cell pluripotency.Pan G, Thomson JA.) The gene expression of was confirmed. Other operations were carried out in accordance with established methods.

Primer set for Nanog (undifferentiated marker):
ATGCCTGCAGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)
The effect of maintaining the undifferentiated state is the relative expression level of Nanog gene (Nanog gene expression level / Gapdh gene expression) calculated as the ratio of Nanog mRNA expression level in mouse ES cells at the start of culture to the internal standard Gapdh mRNA expression level. The value of the amount of relative expression of Nanog in ES cells after 3 days of culture was calculated and evaluated.
The test results are shown in Table 1 below.

  As shown in Table 1, a remarkable effect of maintaining the undifferentiated state of stem cells was observed in all the extracts of capsicum (Production Examples 1 to 3). From the above, the extremely excellent stem cell undifferentiated state maintaining effect of the extract of red pepper was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on somatic stem cells. As a result, a remarkable effect of maintaining the undifferentiated state of stem cells was observed.

2. Experimental example 2 Evaluation of growth-promoting effect on stem cells 3x10 ⁵ human somatic stem cells (DS Pharma Biomedical) cultured using human stem cell culture solution (TOYOBO) were seeded in 6cm dishes and extracted Products (Production Examples 1 to 3) were added to a final concentration of 0.001%, and the culture was continued for 3 days.

  After culturing for 3 days, the cells were washed three times with PBS (−), collected by a rubber policeman, and the number of each cell was counted.

Calculate the increase / decrease (%) in the number of cells when adding the extract of pepper (Production Examples 1 to 3) when the total number of cells when no extract is added is the control and the control is 100 (%). The growth promoting effect was evaluated.
The test results are shown in Table 2 below.

  As shown in Table 2, a significant stem cell proliferation-promoting effect was observed in all of the red pepper extracts (Production Examples 1 to 3). When the above control value was 100%, the number of human somatic stem cells at the start of culture was 25%. From the above, the extremely superior stem cell proliferation promoting effect of the extract of red pepper was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on embryonic stem cells (ES cells), and a remarkable effect of promoting stem cell proliferation was observed.

  As described above, by applying the extract of chili pepper to stem cells, it becomes possible to promote the proliferation of stem cells while maintaining an undifferentiated state more easily and efficiently than conventional techniques. It was.

  As an application example of the present invention, application to regenerative medicine and regenerative beauty is expected. For example, by utilizing the present invention, it becomes possible to easily and efficiently prepare undifferentiated stem cells used for regenerative medicine and regenerative beauty. Furthermore, to the stem cells present after transplantation of stem cells or in tissues, the extract of red pepper according to the present invention is directly injected or applied by oral administration, application, pasting, etc. It is possible to proliferate while maintaining an undifferentiated state.

  That is, the present invention can be used as a method for preparing stem cells and / or an undifferentiated state maintaining agent or growth promoting agent for regenerative medicine and regenerative beauty.

Claims (5)

A stem cell proliferation promoter containing hot water extract of hot pepper, aqueous ethanol extract or ethanol extract as an active ingredient. An agent for maintaining an undifferentiated state of a stem cell, comprising a hot water extract of hot pepper, an aqueous ethanol extract or an ethanol extract as an active ingredient. A method for producing a stem cell, comprising a step of culturing a stem cell in a hot water extract of hot pepper, an aqueous ethanol extract or an ethanol extract . A method for promoting the proliferation of stem cells, comprising a step of culturing stem cells in a hot water extract of hot pepper, an aqueous ethanol extract or an ethanol extract . A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a hot water extract of hot pepper, an aqueous ethanol extract or an ethanol extract .