JP5794559B2 - Drugs for regulating differentiation of mesenchymal cells and use thereof - Google Patents

Description

This application claims the priority based on Japanese Patent Application No. 2008-296166 filed on November 19, 2008, and the entire contents of this application are incorporated herein by reference. .
The present invention relates to a drug for regulating (suppressing / promoting) differentiation of mesenchymal cells and use thereof.

  In recent years, various proteins that regulate osteoblast differentiation have been identified, but they have such specificity that they act on various tissues such as bone morphogenetic protein (BMP). It is a very low protein or transcriptional regulator that acts directly on DNA. For example, BMP has a strong osteoinductive effect, but also ossifies soft tissues such as muscles, making it difficult to use as a medicine. Also. In addition to cbfa1, Msx and Dlx, which are homeobox genes, are known as transcriptional regulatory factors that regulate osteoblast differentiation. Among them, Dlx5 is known to be specifically expressed in bone tissue during the development of vertebrate individuals, and the expression level of Dlx5 gene increases with the maturation of osteoblasts. It has been reported that the phenotypic traits of the gene are controlled at the gene level. Furthermore, it is reported that the Dlx5 gene is specifically induced in osteoblasts by stimulation of BMP, and that differentiation is remarkably enhanced in osteoblasts overexpressing this Dlx5.

  It has also been reported that miRNA (microRNA, microRNA) may be involved in osteoblast differentiation (Patent Document 1). miRNA is a non-coding RNA of about 20 to 25 bases that is endogenous to cells. miRNA is first transcribed from a miRNA gene on genomic DNA as a primary transcript (pri-miRNA) having a length of about several hundred to several thousand bases, and then processed to a hairpin structure of about 60 to 70 bases. It becomes pre-miRNA which has. Then, it moves from the nucleus into the cytoplasm and further undergoes processing to become a mature miRNA of a dimer (guide strand and passenger strand) of about 20 to 24 bases. Mature miRNAs are known to function as a guide strand (antisense strand) in a complex with a protein called RISC and act on the mRNA of the target gene, thereby inhibiting the translation of the target gene. Yes.

JP 2008-184450 A

  The target gene of the miRNA described in Patent Document 1 is unknown, and therefore the effect of introducing miRNA or inhibiting the function of miRNA is unknown. In order to regulate differentiation of osteoblasts and the like, it is preferable to target transcription factors that act specifically in the process of osteoblast differentiation, such as the Dlx5 gene.

  Therefore, an object of the present invention is to provide a regulator that specifically acts on the differentiation process of osteoblasts and the like and regulates differentiation, and uses thereof.

  The present inventors have obtained the knowledge that miRNA inhibits the expression of Dlx5 gene at the translation level, and have completed the present invention. That is, according to the disclosure of the present specification, the following means are provided.

(1) A mesenchymal cell differentiation regulator comprising an active ingredient selected from miRNA binding to the 3 ′ untranslated region of the Dlx5 gene, a precursor thereof, a DNA construct encoding them, and an inhibitor of the miRNA.
(2) The agent for regulating differentiation of mesenchymal cells according to (1), wherein the miRNA is one or more selected from RNA-141, miRNA-200a, and miRNA-208.
(3) The mesenchymal system according to (1) or (2), wherein any one selected from the miRNA, a precursor thereof, and a DNA construct encoding them is an active ingredient and suppresses differentiation of mesenchymal cells. Cell differentiation regulator.
(4) The differentiation regulator for mesenchymal cells according to (1), wherein the inhibitor is an active ingredient and promotes differentiation of mesenchymal cells.
(5) The inhibitor has a first RNA strand containing an antisense sequence for at least part of the guide strand of the miRNA, and is represented by at least one of the following formulas in the first RNA strand. The agent for regulating differentiation of mesenchymal cells according to (4), comprising a single-stranded RNA comprising a nucleoside derivative.
[In the formula (1), Z represents CH or N. ]
(6) The differentiation regulator for mesenchymal cells according to (5), wherein the first RNA strand has a higher complementarity to the guide strand than a passenger strand of the endogenous miRNA to the guide strand.
(7) The agent for regulating differentiation of mesenchymal cells according to claim 5 or 6, wherein the first RNA strand comprises the nucleoside derivative on the 3 'end side thereof.
(8) The inhibitor according to any one of (5) to (7), comprising a double-stranded RNA comprising the first RNA strand and a second RNA strand that is a guide strand of the microRNA. Differentiation regulator of mesenchymal cells.
(9) The differentiation regulator for mesenchymal cells according to (8), wherein the second RNA strand comprises the nucleoside derivative on the 3 ′ end side thereof.
(10) The agent for regulating differentiation of mesenchymal cells according to any one of claims 1 to 9, wherein the mesenchymal cells are at least one of preosteoblasts and osteoblasts.
(11) A medicament for treating or preventing a disease caused by abnormal differentiation of mesenchymal cells, comprising a differentiation regulator for mesenchymal cells according to any one of (1) to (10), Medicine.
(12) The medicament according to claim 11, wherein the disease is a disease caused by suppression of differentiation or insufficient differentiation of the mesenchymal cells.
(13) The medicament according to claim 12, wherein the mesenchymal cell is an osteoblast, and the disease is at least one selected from the group consisting of osteoporosis, osteogenesis dysfunction, and growth inhibition during development.
(14) A method for evaluating a differentiation regulator of mesenchymal cells,
An evaluation method using as an index the increase or decrease in the action of miRNA binding to the 3 ′ untranslated region of the Dlx5 gene.
(15) supplying a test compound to a mesenchymal stem cell or progenitor cell having a Dlx5 gene or a non-human animal;
Based on the expression level of the miRNA that binds to the 3 ′ untranslated region of the Dlx5 gene in the mesenchymal stem cell or progenitor cell or the non-human animal compared to when the test compound is not supplied, osteoblasts of the test compound Evaluating the differentiation regulating action of
The method according to (15), comprising:

It is a figure which shows the precursor of miRNA141. It is a figure which shows the precursor of miRNA200a and 208. FIG. It is a figure which shows the state of osteoblast differentiation in BMP-2 stimulation as an ALP activity and a dyeing | staining result. It is a graph which shows the fluctuation | variation of microRNA expression in BMP-2 induced osteoblast differentiation. It is a graph which shows the influence on BMP-2 induction osteoblast differentiation by each precursor introduction | transduction of artificial microRNA-141, -200a as ALP activity. It is a figure which shows the influence on BMP-2 induction osteoblast differentiation by each precursor introduction | transduction of artificial microRNA-141 and -200a. It is a figure which shows the influence on BMP-2 induction osteoblast differentiation by each precursor introduction | transduction of artificial microRNA-141, -200a as an expression level (Western blotting) of Dlx5 protein. It is a figure which shows the identification result of the target gene of microRNA-141 and -200a. It is a graph which shows the influence on mRNA expression of Dlx5 of a target gene by the antisense strand with respect to microRNA-141 and -200a. It is a figure which shows the structure of double stranded RNA which inhibits the effect | action of microRNA-200a. It is a figure which shows the influence (increase in ALP activity) on osteoblast differentiation in the introduction | transduction of antisense strand and double strand RNA of chemically modified microRNA-141, -200a, and -208. It is a figure which shows the influence (formation state of a hydroxyapatite crystal | crystallization) on osteoblast differentiation in introduction | transduction of chemically modified microRNA-141 and 200a antisense strand and double strand RNA.

  The disclosure herein relates to miRNAs that bind to the 3 'untranslated region of the Dlx5 gene and uses thereof. The disclosure herein is based on the discovery of miRNAs that bind to the 3 'untranslated region of the Dlx5 gene and suppress its translation. That is, according to the disclosure of the present specification, the miRNA, a precursor thereof, and a DNA construct encoding them can be used as those for suppressing differentiation of mesenchymal cells. Moreover, the said miRNA inhibitor can be utilized as what accelerates | stimulates the differentiation of a mesenchymal cell. More specifically, according to the disclosure of the present specification, a miRNA-like duplex in which a miRNA passenger strand or a derivative thereof is further modified with an RNA single strand in which the RNA single strand is further combined with a guide strand. However, both can be used as promoters of differentiation of mesenchymal cells. Furthermore, according to the disclosure of the present specification, a medicament using such a regulator of differentiation of mesenchymal cells and a method for evaluating a differentiation regulator of mesenchymal cells are also provided. Hereinafter, embodiments of the present disclosure will be described in detail.

  In the following description, in miRNA, pri-miRNA, and pre-miRNA, an antisense strand (or an RNA region containing the antisense sense strand) against mRNA that finally paired with mRNA of a target gene is guided. A sense strand (or an RNA region containing the sense strand) with respect to the antisense strand is referred to as a passenger strand.

(Mesenchymal cell differentiation regulator)
The differentiation regulator disclosed in the present specification regulates a compound separated into mesenchymal cells of mesenchymal stem cells or progenitor cells. Therefore, the administration target of the differentiation regulator is a cell having the ability to differentiate into mesenchymal cells. There is no restriction | limiting in particular as a kind of cell which has the differentiation ability to a mesenchymal cell, According to the objective, it can select suitably, For example, a mesenchymal stem cell and a mesenchymal progenitor cell are mentioned. The method for obtaining mesenchymal stem cells and progenitor cells is not particularly limited, and can be appropriately selected according to the purpose. For example, it can be obtained by isolation from the bone marrow of an individual, or has already been obtained. It can also be obtained from various institutions as cloned mesenchymal stem cells. Such already cloned mesenchymal stem cells are not particularly limited and may be appropriately selected depending on the intended purpose. Examples of mouse cells include mouse ST2 cells and mouse NRG cells. (Each can be obtained from RIKEN BioResource Center (BRC)). In addition, even if it is cells other than a mesenchymal stem cell, what is necessary is just a cell which has the differentiation ability to a mesenchymal cell. In the present specification, the mesenchymal stem cells include progenitor osteoblasts.

  Moreover, there is no restriction | limiting in particular as a kind of mesenchymal cell, According to the objective, it can select suitably, For example, an osteoblast, an adipocyte, a muscle cell, a chondrocyte etc. are mentioned. Among these, osteoblasts are particularly preferable.

  The agent for regulating differentiation of mesenchymal cells disclosed in the present specification comprises a miRNA that binds to the 3 ′ untranslated region of the Dlx5 gene, a precursor thereof, a DNA construct that retains DNA encoding the same, and the miRNA It can have an active ingredient selected from inhibitors.

(MiRNA)
The miRNA that binds to the 3 ′ untranslated region of the Dlx5 gene is a single-stranded RNA that has the action of binding to the untranslated region and suppressing translation of the Dlx5 gene (corresponding to the guide strand of the double-stranded miRNA). Means. Such RNAs are miR-141, miR-200a, and miR-208, and their mature sequences are as shown below (SEQ ID NOs: 1 to 6), respectively, and are conserved in mice, humans, and the like. 1 and 2 show schematic diagrams of miR-141, miR-200a, and miRNA-208, respectively.
(Human)
miR-141: UAACACUGUCUGGUAAAGAUGG (SEQ ID NO: 1)
miR-200a: UAACACUGUCUGGUAACGAUGU (SEQ ID NO: 2)
miR-208: AUAAGACGAGCAAAAAGCUUGU (SEQ ID NO: 3)
(mouse)
miR-141: UAACACUGUCUGGUAAAGAUGG (SEQ ID NO: 4)
miR-200a: UAACACUGUCUGGUAACGAUGU (SEQ ID NO: 5)
miR-208: AUAAGACGAGCAAAAAGCUUGU (SEQ ID NO: 6)

  Such miRNAs can be produced by isolation from natural products, chemical synthesis, or genetic engineering in vivo or in vitro based on the nucleotide sequence of the miRNA. it can. Such miRNAs may also be analogs synthesized to mimic endogenous mature miRNAs. Such analogs are available from Ambion, for example. Such miRNA may be single-stranded or double-stranded with a complementary strand.

(MiRNA precursor)
Examples of the miRNA precursor include pri-miRNA and pre-miRNA. Specific examples thereof include pri-miRNA and pre-miRNA shown in the following table for mouse and human, respectively. Such miRNA precursors can also be produced by isolation from natural products, chemical synthesis, or in vivo or in vitro genetic engineering using conventionally known techniques. Furthermore, miR125b precursor analogs synthesized to mimic endogenous miR125b precursors can also be used as miRNA precursors. The miR125b precursor may be single-stranded or double-stranded.

(DNA constructs such as miRNA)
A DNA construct that holds miRNA and miRNA precursor-encoding DNA in a transcribable manner is a DNA construct that encodes such an RNA strand in a transcribable manner in vivo or in vitro. For example, a construct capable of transcribing miRNA or the like in vitro includes a vector in which DNA encoding miRNA or the like is linked under the control of a viral promoter. In addition, examples of constructs that can transcribe miRNA and the like in vivo include vectors in which DNA encoding miRNA and the like is linked under the control of a promoter effective in mammalian cells. Such vectors for in vivo or in vitro transcription are commercially available, and such vectors can be easily constructed based on the base sequence such as miRNA according to the protocol.

(Inhibitor of miRNA)
The miRNA inhibitor is not particularly limited as long as it is a compound that reduces the function of miRNA. Examples thereof include miR141, miR200a, and a first RNA strand (so-called antisense sense miRNA) that is a complementary strand of at least a part of the guide strand of these precursors. The complementary strand in the first RNA strand does not necessarily need to be the entire complementary strand of miRNA and its precursor, and may be a partial complementary strand as long as it has the function of reducing its function. In addition, it is not necessary to be a complete complementary strand, it is not necessary to be a complete complementary strand to at least one of miRNA and the like, and an incomplete complementary strand may be used as long as it has an action of reducing the function of miRNA or the like. Good.

  In the first RNA strand, it is preferable that complementarity is enhanced as compared with the passenger strand for the guide strand in the endogenous miRNA or the like. That is, in the case of endogenous miRNA, when there is a mismatch between the guide strand and the passenger strand, the number of such mismatches is preferably reduced in the first RNA strand. Although how much a mismatch should be reduced is not specifically limited, as long as the 1st RNA chain | strand functions as an inhibitor, it is not necessary to eliminate all the mismatches, The one part may be eliminated. The position of the mismatch (position in the guide strand of the endogenous miRNA) that is eliminated in the complementary strand as the inhibitor is not particularly limited, but it is preferable as the inhibitor by eliminating the mismatch at the 3 ′ end side.

  The miRNA inhibitor may comprise a first RNA strand and a second RNA strand that is a guide strand such as miRNA. According to the disclosure of the present specification, it is known that even in such a double-stranded state, it is effective as an inhibitor (see Examples described later).

  It is preferable that at least the complementary strand of the inhibitor disclosed in the present specification is provided with a nucleoside derivative represented by the formula (1). By providing such a derivative in the first RNA strand, nuclease resistance can be improved and the function as an inhibitor can be further enhanced.

[In the formula (1), Z represents CH or N. ]

  In the oligooligonucleotide derivative of the present invention, in formula (1), Z may be N or CH. The 6-membered ring in formula (1) is generally hydrophobic and preferably has no hydrophilic or polar substituent. The substituent that the 6-membered ring may have is preferably a nonpolar substituent, and can have a chain alkyl group having 1 to 4 carbon atoms. That is, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, and a tert-butyl group are exemplified.

  The following cyclic structures 2b to 2g can be used instead of the structure containing the six-membered ring of the formula (1) (within the dotted frame in the formula (1) shown in the following “Chemical Formula 3”). These rings may also have the same substituents as described above. Z has the same meaning as in formula (1). Of the compounds 2b to 2g, monocyclic 2b can be preferably used. Moreover, 2d can also be used preferably.

  One or two or more such nucleoside derivatives can be provided in the first RNA strand. The plurality of nucleoside derivatives may include a plurality of the same ones in Z, or a nucleoside derivative in which Z is N and a nucleoside derivative in which Z is CH may be combined. Such nucleoside derivatives are disclosed, for example, in an international publication pamphlet (WO / 2007/094135).

  Further, such a nucleoside derivative can be introduced into an oligonucleotide by a general oligonucleotide synthesis method using CPG or the like by using the following phosphoramidide derivative or CPG derivative. That is, it is introduced into the oligonucleotide chain via a phosphate ester bond. Those skilled in the art can synthesize such phosphoramidide derivatives and CPG derivatives according to Scheme 1 shown below. In addition, although the following method demonstrates pyridinecarboxylic acid, it is the same also about a benzyl derivative. That is, a benzyl derivative such as dimethyl phthalate or dimethyl pyridinedicarboxylate is reduced, followed by DMTr, which is further amidated with an amidite reagent to obtain an amidite. On the other hand, a DMTr body can be succinylated and further combined with a CPG resin to obtain a CPG derivative. Prior to the coupling of the base to the benzyl derivative or the like, it is preferable that a suitable protecting group is added to the hydroxyl group provided in the benzyl derivative or the like, and deprotection is performed at an appropriate stage after the coupling of the base and before DMTr formation. .

  The nucleoside derivative is preferably provided in a portion of the first RNA strand other than the complementary sequence to the guide strand such as miRNA in the first RNA strand. This is because the first RNA strand does not inhibit the formation of a complementary strand (that is, inhibition of the function as the miRNA) with the target strand such as miRNA. Therefore, the nucleoside derivative is preferably provided on the 3 ′ end side and / or the 5 ′ end end side of the first RNA strand. More preferably, it is added to the 3 ′ end side of the first RNA strand within an appropriate number of ranges from the 3 ′ end. The number of nucleoside derivatives is not limited as long as the nuclease resistance is improved as compared with the case where no nucleoside derivative is added, but it is preferably about 1 to 4.

  Such a nucleoside derivative may be provided in the second RNA strand. By providing the second RNA strand, it is considered that the stability of the first RNA strand is also increased. The nucleoside derivative is preferably provided in the second RNA strand in the same manner as the various embodiments in the first RNA strand already described.

  The first RNA strand and the second RNA strand can be produced by chemical synthesis or genetic engineering, and are commercially available from Ambion and the like. The first RNA strand and the second RNA strand may be appropriately modified in their bases, sugars, etc. from the viewpoint of ensuring stability in the cell or the like. For example, PNA (peptide nucleic acid) or LNA (Locked Nucleic Acid), for example, can form a double strand more strongly with miRNA or the like, and more effectively inhibit (reduce) the function of miRNA or the like. It is preferable to have a modification such as As a complementary strand having a modification such as LNA (Locked Nucleic Acid), for example, miRCURY Knockdown Probes (Exiqon) can be used (for example, Biomedine & Pharmacotherapy, Volume 60, Issue 63, No. 63, No. 63, No. 63, No. 63, No. 63, No. 63, No. 63, reference). In addition, the complementary strand can be present more stably by preventing degradation in the cell. For example, the complementary strand preferably has a modification such as 2'O-methyl. (See, for example, Nucleic Acids Research, 2003, Vol. 31, No. 11 2705-2716).

  The inhibitor may be a DNA construct that holds the first RNA strand against miRNA or the like, and further DNA that encodes the first RNA strand and the second RNA strand in a transcribable manner. Such a DNA construct can be easily obtained by using a vector for in vivo or in vitro transcription.

  The active ingredient of the differentiation regulator disclosed in the present specification is selected according to the purpose. That is, when the differentiation regulator is used for the purpose of suppressing the differentiation of mesenchymal cells, the above DNA constructs such as miRNA, miRNA precursor and miRNA can be used. In addition, when the differentiation regulator is used for the purpose of promoting the differentiation of mesenchymal cells, the above inhibitor can be used. As the active ingredient, one active ingredient contributing to the same purpose may be used alone, or two or more active ingredients may be used in combination. Moreover, there is no restriction | limiting in particular as content of the said active ingredient in the differentiation promoting agent of the said mesenchymal cell, According to the objective, it can set suitably.

  The differentiation regulator disclosed in the present specification may contain only the above-described active ingredient, but may contain other ingredients as necessary. There is no restriction | limiting in particular as another component, According to the objective, it can select suitably. Examples thereof include water and various buffer solutions for diluting the active ingredient to a desired concentration. In addition, as the other components, for introducing the active component into cells (target cells; for example, mesenchymal stem cells such as osteoblasts) that are desired to suppress or promote differentiation into mesenchymal cells. Examples include reagents. The introduction reagent is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include Lipofectamine 2000 (Invitrogen).

  Since the differentiation regulator disclosed in the present specification can suppress or promote the translation of the Dlx5 gene, it can suppress or promote differentiation into mesenchymal cells such as mesenchymal stem cells or mesenchymal progenitor cells. . Therefore, it can be used as a medicament for preventing or treating diseases associated with differentiation into mesenchymal cells. Moreover, it can be preferably used also for evaluation and screening of research reagents and drugs related to differentiation into mesenchymal cells.

(Medicine for treating or preventing diseases caused by abnormal differentiation of mesenchymal cells)
The medicament disclosed in the present specification is a medicament for treating or preventing a disease caused by abnormal differentiation of mesenchymal cells, and can contain the above-described differentiation regulator as an active ingredient. The differentiation regulator is selected from the various differentiation regulators already disclosed in the present specification according to the type of disease targeted by the pharmaceutical. When the medicament disclosed in the present specification is a disease caused by excessive differentiation of mesenchymal cells, miRNA, miRNA precursor, and a DNA construct for transcription of these can be used as active ingredients. On the other hand, when the medicament disclosed in the present specification is a disease caused by suppression of differentiation of mesenchymal cells, an inhibitor is used as an active ingredient.

  The content of the differentiation regulator in the medicament disclosed in the present specification is not particularly limited and can be appropriately selected depending on the purpose. Moreover, the medicament disclosed in the present specification may be composed of only active ingredients, but may contain other ingredients as necessary. There is no restriction | limiting in particular as another component, According to the objective, it can select suitably. Typically, a pharmaceutically acceptable carrier and the like can be mentioned. The carrier is not particularly limited and may be appropriately selected depending on, for example, the pharmaceutical dosage form. Moreover, there is no restriction | limiting in particular also as content of the said other component in the said pharmaceutical, According to the objective, it can select suitably.

  The medicament disclosed in the present specification can take various conventionally known preparation forms. It can be appropriately selected according to the desired administration method as will be described later. For example, oral solid preparations (tablets, coated tablets, granules, powders, capsules, etc.), oral liquid preparations (internal solutions, syrups, elixirs) Etc.), injections (solutions, suspensions, solid preparations for dissolution, etc.), ointments, patches, gels, creams, external powders, sprays, inhaled powders and the like. Additives that are appropriately required in these various preparations are well known to those skilled in the art, and those skilled in the art can produce various preparations according to the purpose.

  The medicament disclosed in the present specification preferably takes a dosage form suitable for transfection of a medicament into a cell to a subject to be administered or a tissue containing cells collected from the subject to be administered. For example, it can take the form of an injection preparation (subcutaneous injection, intravenous injection, intramuscular injection, bone marrow injection, dental pulp injection, intraperitoneal injection, etc.) according to the application site. Injections include, for example, active ingredients, pH regulators, buffers, stabilizers, isotonic agents, local anesthetics, etc., and are used for subcutaneous, intramuscular, intravenous, etc. by conventional methods. An injection can be produced. Examples of the pH adjuster and buffer include sodium citrate, sodium acetate, and sodium phosphate. Examples of the stabilizer include sodium pyrosulfite, EDTA, thioglycolic acid, thiolactic acid, and the like. Examples of the isotonic agent include sodium chloride and glucose. Examples of the local anesthetic include procaine hydrochloride and lidocaine hydrochloride.

  The administration method of the medicine disclosed in the present specification is not particularly limited, but is appropriately selected according to the dosage form of the medicine. As described above, the medicament disclosed in the present specification can be administered, for example, by transfecting an active ingredient into cells or tissues in a patient. The cells and tissues are preferably locations where mesenchymal stem cells and progenitor cells are present. For example, in a disease caused by abnormal differentiation into osteoblasts, it is preferable to administer a site where stem cells or progenitor cells to osteoblasts are present, typically bone marrow.

  In addition, it can be administered by transfecting mesenchymal stem cells or mesenchymal progenitor cells collected from a patient or the like or a tissue containing them and transplanting the cells into the patient. The transfection method is not particularly limited, and for example, conventionally known methods such as lipofection and electrolysis can be appropriately selected and used. There are no particular limitations on the method of transplanting cells transfected in vitro to the patient, and for example, conventionally known cell transplantation methods can be used as appropriate.

  In addition, there is no restriction | limiting in particular as dosage of the medicine disclosed by this specification, According to the age of a patient who is an administration object, a body weight, the grade of a desired effect, etc., it can select suitably. The number of administrations is not particularly limited, and can be appropriately selected according to the age, weight, desired degree of effect, etc. of the patient to be administered. Furthermore, there is no restriction | limiting in particular as the administration time, According to the objective, it can select suitably, For example, prophylactically with respect to the disease resulting from the differentiation abnormality (excess and suppression) of the said mesenchymal cell. It may be administered or may be administered therapeutically. The mammal to be administered with the medicament disclosed in the present specification is not particularly limited and can be appropriately selected according to the purpose. For example, human, mouse, rat, cow, pig, monkey, dog, cat Etc.

  The disease targeted by prevention or treatment by the medicament disclosed in the present specification is a disease caused by abnormal differentiation (excess or suppression) of mesenchymal cells. For example, the mesenchymal cell is preferably an osteoblast. This is because the differentiation regulator disclosed in the present specification is related to the expression of the Dlx5 gene that specifically acts in the differentiation process of osteoblasts. Examples of the diseases caused by excessive differentiation of mesenchymal cells include osteoblast type osteosarcoma caused by excessive differentiation of osteoblasts. In addition, diseases caused by suppression of differentiation (insufficient differentiation) of mesenchymal cells include osteoporosis (postmenopausal osteoporosis, senile osteoporosis, osteoporosis due to steroid treatment, diabetic osteoporosis due to suppression or lack of differentiation of osteoblasts) ), Bone dysplasia, and growth inhibition in the developmental stage.

(Evaluation method)
The method for evaluating a differentiation regulator of mesenchymal cells disclosed in the present specification can be based on an increase or decrease in the action of miRNA that binds to the 3 ′ untranslated region of the Dlx5 gene. According to the evaluation method disclosed in this specification, a differentiation regulator capable of suppressing or promoting the differentiation of mesenchymal cells can be obtained. That is, the evaluation method disclosed in the present specification can be used as a screening method for the differentiation regulator and pharmaceutical active ingredient disclosed in the present specification.

  The evaluation method disclosed herein is typically tested on cells or non-human animals that have mesenchymal stem cells or progenitor cells that have the Dlx5 gene and have endogenous miRNA that targets the gene. Based on the comparison between the step of supplying the compound and the expression level of miRNA that binds to the 3 ′ untranslated region of the Dlx5 gene in the mesenchymal stem cell or the non-human animal, when the test compound is not supplied And a step of evaluating the differentiation regulating action of mesenchymal stem cells. Furthermore, the screening method disclosed in the present specification can include a step of selecting a test compound that promotes or suppresses the differentiation of mesenchymal stem cells after the evaluation step.

  As described above, a conventionally known transfection method used when administering the differentiation regulator or medicament disclosed in the present specification to cells or patients can be used for the above-described supplying step. The test compound is not particularly limited. For example, miRNA that is a candidate for a differentiation regulator disclosed in the present specification, or an inhibitor thereof.

  In the above-described evaluation step, it is evaluated whether the test compound enhances or reduces the action of endogenous miRNA. The evaluation method is not particularly specified and can be appropriately selected according to the purpose. For example, the expression level of endogenous miRNA and the expression level of Dlx5 gene (preferably the expression level as a protein) in the presence and absence of the test compound can be measured. In addition, when mesenchymal stem cells or progenitor cells for osteoblasts are used as cells, differentiation indicators for various osteoblasts such as alkaline phosphatase activity can also be used.

  In the evaluation step, for example, when the expression level of miRNA and the like is increased in the presence of the test compound (during supply) compared to the absence of the test compound (during supply), the test compound is endogenous miRNA. It can be evaluated as increasing the action of. That is, the test compound can be evaluated as a test compound that suppresses differentiation into mesenchymal cells. On the other hand, when the expression level of miRNA or the like decreases in the presence of the test compound, the test compound can be evaluated to decrease the action of the endogenous miRNA. That is, it can be evaluated that the test compound promotes differentiation into mesenchymal cells.

  In addition, you may perform the process which induces | guides | derives the mesenchymal stem cell or the progenitor cell to the mesenchymal cell suitably in either of the above supply process or evaluation process, or between these processes. As the differentiation induction process, for example, BMP-2 or the like can be used for the induction process to osteoblasts. By evaluating the test compound under such differentiation induction treatment, it is possible to more clearly detect the differentiation inhibiting ability and differentiation promoting ability of the test compound.

  Moreover, the screening method disclosed in this specification can include a selection step in addition to the supply step and the evaluation step. The selection step is a step of selecting a test compound that can be evaluated to suppress or promote differentiation into mesenchymal cells as an agent for regulating differentiation into mesenchymal cells. The selected test compound is useful as a differentiation regulator and a pharmaceutical active ingredient disclosed herein or as a candidate thereof.

  Examples of the present invention will be described below, but the present invention is not limited to these examples.

(Experimental example 1)
(Osteblast differentiation by BMP-2 stimulation)
Mouse skull-derived progenitor osteoblast cell line MC3T3-E1 cells (distributed from RIKEN) were seeded on 24-well plates at 1 × 10 ⁵ cells / ml at 500 μl / well, and MEM-α (10 % FBS, 100 U / ml penicillin, 100 μg / ml streptomycin contained: manufactured by Invitrogen) for 24 hours. After 24 hours, BMP-2 (manufactured by BioVison) was added to the medium to a final concentration of 200 ng / ml and cultured for 24-72 hours. After each set culture time, cells were collected, a cell lysate was added, and ultrasonic turbidity (10 seconds, 3 times) was performed. Thereafter, centrifugation (14,500 rpm, 4 ° C., 15 minutes) was performed, and the supernatant was transferred to a new 1.5 ml tube and stored on ice until measurement of enzyme activity. Osteoblast differentiation was evaluated using as an index the activity of alkaline phosphatase (hereinafter abbreviated as ALP) whose activity increases during the differentiation stage. About the activity of ALP, it performed by the double evaluation of the enzyme activity by a lab assay (trademark) ALP kit (made by Wako Pure Chemical Industries, Ltd.) and the ALP dyeing | staining by TRACP & ALP double-stain kit (made by Takara Bio Inc.). The results are shown in FIG.

  As shown in FIG. 3, when the mouse skull-derived progenitor osteoblast cell line MC3T3-E1 cells were induced to differentiate with BMP-2, the activity of ALP, whose activity increased in the middle stage of differentiation, increased significantly after 48 hours. From this, it was found that differentiation was induced by BMP-2 in this cell.

(Experimental example 2)
(Changes in microRNA expression during BMP-2 induced osteoblast differentiation)
In order to confirm the change of microRNA expression in BMP-2 induction, total RNA was extracted from BMP-2 induction treated (final concentration: 200 ng / ml) MC3T3-E1 cells and untreated cells using Trizol (manufactured by Invitrogen). Extracted. Some of them were subjected to microRNA array analysis manufactured by Mitsubishi Rayon Co., Ltd. As a result, microRNA (registered trademark) miR-)-141, -200a in which the expression level was changed was further subjected to Taqman microRNA assay kit (Applied Biosystems), and reproducibility was confirmed by Real Time-PCR method. The results are shown in FIG.

  As shown in FIG. 4, when the total RNA extracted from MC3T3-E1 cells from BMP-2 differentiation-inducing cells and untreated cells was subjected to microRNA array analysis manufactured by Mitsubishi Rayon Co., Ltd., microRNA (miR-). -141, -200a, 208 expression was altered. When reproducibility was confirmed by the Real Time-PCR method using Taqman (registered trademark) microRNA assay kit (Applied Biosystems), the expression was significantly reduced. From these results, it was confirmed that the expression of these miRs was reduced by BMP-2 differentiation-inducing stimulation.

(Experimental example 3)
(Influence on BMP-2-induced osteoblast differentiation by introduction of precursors of artificial miRNA-141, -200a, -208)
Pre-miR (registered trademark) Precursor-141, -200a, 208 (produced by Ambion) designed to mimic endogenous miRNA molecules were used with Lipofectameme (registered trademark) RNAiMAX (produced by Invitrogen), respectively. The cells were introduced into MC3T3-E1 cells by a lipofection method so that the final concentrations were 20 nM and 40 nM. In order to verify the function of the introduced miRs, Pre-miR (registered trademark) Negative Control that does not have an effect that can be regarded as equivalent to the known miRNA function was used for the negative control. Various introduced cells were cultured in OPTI-MEM serum-free medium (manufactured by Invitrogen) for 18 hours, and then cultured in MEM-α (containing 10% FBS, 100 U / ml penicillin, 100 μg / ml streptomycin) for 72 hours. Thereafter, cells adjusted to 1 × 10 ⁵ cells / ml were seeded on a 24-well plate at 500 μl / well, and 3 hours after seeding, BMP-2 was added to a final concentration of 200 ng / ml to induce differentiation, Cultured for 72 hours. 72 hours after differentiation induction, differentiation ability was evaluated by the ALP activity and staining shown in Experimental Example 1 above. The results are shown in FIGS.

  As shown in FIG. 5, Pre-miR (registered trademark) Precursor-141, -200a, -208 (Ambion) designed to mimic endogenous miRNA molecules were introduced into MC3T3-E1 cells. As a result of differentiation induction with BMP-2, it was confirmed that ALP activity, which is an osteoblast differentiation index, was significantly reduced in cells introduced with these miRs compared to BMP-2 treatment and the negative control group. It was done. Further, as shown in FIG. 6, it was confirmed that the ALP staining result was also lightly stained by miR introduction. From these results, it was confirmed that the decrease in the expression of these miRs is involved in osteoblast differentiation.

(Experimental example 4)
(Identification of miRNA-141 and -200a target genes)
miR-141, -200a target genes were transferred to the Sanger Institute database miRBase Targets Version 5 (http://microrna.sanger.ac.uk/targets/v5/) and TargetScan4.2 (http: //www.tar. As a result of searching by /), it has been reported so far to control osteoblast differentiation (References 1-5). Distal-less homeobox 5 (Dlx5), which is one of transcription factors, is commonly targeted. Was guessed. Thus, the protein expression of Dlx, which was the estimated target gene, was examined by Western blotting.

Pre-miR (registered trademark) Precursor-141, -200a was introduced into MC3T3-E1 cells in the same manner as in Experiment 3 above (final concentration: 40 nM) and adjusted to 1 × 10 ⁵ cells / ml on a 6-well plate. Cells were seeded at 1 ml / well, BMP-2 (final concentration: 200 ng / ml) was added 3 hours after seeding, and cultured for 72 hours. After 72 hours of induction of differentiation, a cell lysate (RIPA buffer) was added to prepare a cell lysate, which was subjected to Western blotting after SDS-PAGE. For detection, ECL-Plus (registered trademark) (manufactured by GE Healthcare) using chemiluminescence was used. The results are shown in FIG.

  As shown in FIG. 7, Pre-miR (registered trademark) Precursor-141, -200a (Ambion) was introduced into MC3T3-E1 cells, and a cell lysate was prepared from the cells induced to differentiate with BMP-2. However, when subjected to Western blotting, the cell group into which these miRs were introduced significantly suppressed the protein expression of Dlx5, which is a transcription factor involved in osteoblast differentiation, as compared to the BMP-2 treatment and the negative control group. This suppression was comparable to the BMP-2 untreated level. From this result, it was confirmed that microRNA-141 and -200a have Dlx5 as a target gene.

(Experimental example 5)
(Effect of microRNA-141 and -200a on Dlx5 mRNA expression of target gene)
Since miR-141 and -200a significantly suppressed the protein expression of Dlx5 involved in osteoblast differentiation from Experimental Example 4 above, the protein expression suppression mechanism of these miRs was examined by the Real Time-PCR method. Pre-miR (registered trademark) Precursor-141, -200a was introduced into MC3T3-E1 cells in the same manner as in Experimental Example 3, and the cells adjusted to 1 × 10 ⁵ cells / ml were added to the 6-well plate at 1 ml / well. After seeding, 3 hours after sowing, BMP-2 (final concentration: 200 ng / ml) was added and cultured for 72 hours. Thereafter, total RNA was extracted from each cell using Trizol (manufactured by Invitrogen), cDNA was prepared using PrimeScript (registered trademark) RT reagent Kit (manufactured by Takara Bio Inc.), and then SYBER (registered trademark) Premix Ex Taq ( The expression level of mRNA was measured by registered trademark II (manufactured by Takara Bio Inc.). GAPDH (glyceraldehyde-3 -phosphate dehydrogenase) was used as an internal standard. As the primer pair used for Real Time-PCR, mouse housekeeping gene primer (manufactured by mouse Gapdh primer) (manufactured by Takara Bio Inc.) is used for GAPDH, and Dlx5 is shown below. The results are shown in FIG.

Dlx5-sense; 5'-GCTCTAGAGCTAGATGGGCACTACTTCTCTT-3 '
Dlx5-antisense; 5′-GCTCTAGAGCGTTCAAACATCCCCGTATGA-3 ′

  As shown in FIG. 8, when the mRNA level of Dlx5 was confirmed by the Real Time-PCR method, the mRNA expression of Dlx5 was not different from that of the BMP-2 treatment and negative control group even in the cells into which miR was introduced. From these results, it was confirmed that these miRs suppressed Dlx5 protein expression by controlling translation from mRNA rather than degrading Dlx5 mRNA.

(Experimental example 6)
(Influence on osteoblast differentiation by introduction of microRNA-141 and -200a antisense strand)
Anti-miR (registered trademark) Inhibitor-141, -200a (manufactured by Ambion) designed to specifically bind to and inhibit endogenous microRNAs was introduced into cells by the same method as in Experimental Example 3 above. (Final concentrations: 20 nM, 40 nM, 80 nM). After 24, 48 and 72 hours of induction of differentiation by BMP, the differentiation ability was evaluated by the ALP activity shown in Experimental Example 1 above. The results are shown in FIG.

  As shown in FIG. 9, Anti-miR (registered trademark) Inhibitor-141, -200a (miR inhibitor) designed to specifically bind to and inhibit the microRNA endogenous to MC3T3-E1 cells. When introduced and induced to differentiate with BMP-2, the ALP activity, which is an osteoblast differentiation index, is significantly increased in cells introduced with these miR inhibitors compared to the BMP-2 treated and negative control group. It was confirmed. It was also confirmed that this ALP activity was dependent on the culture time and added concentration. From these results, it was confirmed that introduction of the antisense strand of these miR inhibitors is effective as an osteoblast differentiation promoter.

(Experimental example 7)
(Influence on osteoblast differentiation by introduction of chemically modified microRNA200a antisense strand)
As shown in FIG. 10, a modified miRNA (inhibitor) was prepared by matching the base sequence of the passenger strand of miRNA-200a having 5 mismatches in the double strand at two or three locations. In addition, at the 3 terminal of this modified miRNA, the nucleoside derivative (indicated by “B” in FIG. 10) in which Z is CH in formula (1) and the nucleoside derivative in which Z is N in formula (1) ( In FIG. 10, "P") was introduced at the 3 'end of each RNA strand. In addition, fixation to the used phosphoramidide and CPG is as shown in the following schemes 1 and 2, and the synthesis method of each compound in each scheme is shown below. These phosphoamidide bodies were treated in the same manner as phosphoamide bodies of other nucleotide derivatives to synthesize modified RNA. An RNA oligonucleotide having a 3 ′ terminal dangling end was synthesized by an automatic nucleic acid synthesizer according to the solid phase phosphoramidite method. That is, for solid phase synthesis of RNA, 2 mL of EtOH: NH ₃ = 3: 1 aqueous solution was added to the oligonucleotide bound to CPG resin, and the mixture was shaken at room temperature for 12 hours to cleave from the resin and deprotect. The condensation time was 15 minutes. The filtrate after the reaction was transferred to an Eppendorf tube and dried under reduced pressure. 1 mL of 1M TBAF in THF solution was added to the residue and shaken for 12 hours. This reaction solution was diluted with 0.1 M TEAA buffer to 30 mL. This reaction solution was passed through an equilibrated C-18 column (Sep-Pak) and adsorbed on the column. Here, the column was washed with sterilized water to remove salt, and eluted with 3 mL of 50% CH ₃ CN in H ₂ O, and dried under reduced pressure. To the residue, 100 μL of loading solution (1 × TBE in 90% formamide) was added, and the target oligonucleotide was isolated by 20% PAGE (600 V, 20 mA). The target oligonucleotide was cut out, 20 mL of 0.1 M TEAA buffer 1 mM EDTA aqueous solution was added, and the mixture was shaken for 12 hours. The filtrate was passed through an equilibrated C-18 reverse phase or ram (Sep-Pak) and adsorbed onto the column. Here, the column was washed with sterilized water to remove salts, and eluted with 3 mL of 50% CH ₃ CN in H ₂ O, and dried under reduced pressure.

(Synthesis of benzene unit)
Compounds 2 to 5 shown in the above scheme I were synthesized. That is, dimethyl isophthalate was reduced to obtain compound 2 in a yield of 75%, followed by DMTr conversion to obtain compound 3 in a yield of 54%. DTMr body 3 was amidated to obtain compound 4 in a yield of 88%. DMTr body 3 was succinylated and bound to CPG resin to obtain compound 5 with an activity of 106 μmol / g. Production examples of compounds 2 to 5 are shown below.

Using dimethyl isophthalate (Compound 1) as a starting material, a reduction reaction was performed with LiBH ₄ to obtain Compound 2. Further, one hydroxyl group was DMTr protected to obtain a trityl compound, which was compound 3, and then phosphorylated to obtain an amidite unit, which was compound 4. Further, Compound 5 which is a CPG carrier was obtained from Compound 3 through succinylation.

(Compound 2: Production example of 1,3-bis-hydroxymethylbenzene)
In THF, dry THF (51.5 ml, 0.2 M solution) was added to dimethyl isophthalate (2.00 g, 10.30 mmol), and lithium borohydride (1.12 g, 51.1 mmol, 5 eq) was added. After stirring for 23 hours, several drops of acetic acid were added in an ice bath to neutralize the reaction solution, and the reaction was stopped. After stirring for a while, the precipitated crystals were dissolved with MeOH. In TLC during the reaction (Hex: EtOAc = 1: 1), the product was one spot, but when the reaction was stopped, it was divided into two spots. After evaporating the solvent under reduced pressure, the residue was isolated by silica gel chromatography (EtOAc only) to obtain Compound 2 (75%).

(Compound 3: Production example of 1- (4,4'-dimethoxytrityloxy) methyl-3-hydroxymethylbenzene)
Compound 2 (0.5 g, 3.62 mmol), which had been vacuum-dried in advance, was dissolved in pyridine (18 mL), and DMAP (22.1 mg, 0.18 mmol, 0.05 eq) and 4,4'-Dimethoxytrityl chloride (1.23 g, 3.62 mmol) , 1 eq) and stirred for 17 hours under Ar atmosphere. The disappearance of the starting material was confirmed by TLC (Hex: EtOAc = 3: 1). Extraction was performed with EtOAc and satNaHCO ₃ aq, and the organic layer was washed with sat NaCl aq, dried over anhydrous Na ₂ SO ₄ . After evaporating the solvent under reduced pressure, the residue was isolated by silica gel chromatography (Hex: EtOAc = 4: 1) to obtain Compound 3 (54%).

(Compound 4: 1- (4,4'-dimethoxytrityloxy) methyl-3-0-[(2-cyanoethyl)-(N, N-diisopropyl)]-
Production example of phosphoamidiomethyl-hydroxymethylbenzene)
Compound 3 (0.35 g, 0.80 mmol), which had been vacuum-dried in advance, was dissolved in dry THF (8 mL), and DIPEA (0.4 mL, 4.00 mmol, 5 eq) and phosphorylation reagent (0.29 mL, 1.60 mmol, 2 eq) Was added and stirred for 1.5 hours under Ar atmosphere. The disappearance of the raw material was confirmed by TLC (EtOAc only). Extraction was performed with EtOAc and satNaHCO ₃ aq, and the organic layer was washed with sat NaCl aq, dried over anhydrous Na ₂ SO ₄ . After evaporating the solvent under reduced pressure, the residue was isolated by silica gel chromatography (Hex: EtOAc = 1: 1) to obtain Compound 4 (88%).

(Production Example of Compound 5 (CPG resin of isophthalic acid derivative))
Compound 3 (0.30 g, 0.68 mmol) is dissolved in pyridine (6.8 mL), and DMAP (3.7 mg, 0.03 mmol, 0.02 eq) and succinic anhydride (204 mg, 2.04 mmol, 3 eq) are added thereto under Ar atmosphere. Stir. After stirring for 24 hours, the progress of the reaction was confirmed by TLC (Hex: EtOAc = 3: 1), extracted with EtOAc and satNaHCO ₃ aq, the organic layer was washed with sat NaCl aq, dried by adding anhydrous Na ₂ SO ₄ I let you. The solvent was distilled off under reduced pressure, followed by vacuum drying. To this concentrate (5) (0.04 g, 0.74 mmol, 109%), dry DMF (10 mL) was added and dissolved, CPG (500 mg, 0.11 mmol) was added, and the mixture was allowed to stand for 30 minutes to allow it to blend with the reaction solution. Thereafter, WSC (110 mg, 0.57 mmol, 4.9 eq) was added, and the mixture was shaken at room temperature for one day. As a post-treatment, after washing with pyridine, 0.1M DMAP in pyridine: acetic anhydride (9: 1) solution (6 mL) was added and shaken for 16 hours. This was washed with MeOH and acetone, dried, and the activity was measured. The activity of Compound 5 was 108.6 μmol / g. For activity, 6 mg of dried CPG resin was placed on a glass filter, a solution of HClO4: EtOH = 3: 2 was poured, and the absorbance of the filtrate at a wavelength of UV 498 nm (wavelength of DMTr group) was determined. Calculated by substituting into the equation.
Activity (μmol / g) = Abs, (498 nm) × Vol. (Solution) (mL) × 14.3 / Weight (support) (mg)

(Synthesis of dimethyl pyridinecarboxylate for the synthesis of 3 'terminal down-gring end)
Compound 7 was obtained by carrying out a reduction reaction with LiBH ₄ using dimethyl 2,6-pyridinecarboxylate (compound 6) as a starting material. Further, one of the hydroxyl groups was DMTr protected to obtain a trityl compound, which was compound 10, and then compound 10 as a CPG carrier was obtained from this compound through succinylation. In addition, the synthesis example of the amidite body 9 is also shown for reference.

(Compound 7: Production example of 2,6-bis-hydroxymethylpyridine)
2.6 Anhydrous THF (51.3 mL, 0.2 M solution) was added to dimethyl pyridinecarboxylate (2.00 g, 10.25 mmol) under an Ar atmosphere, and lithium borohydride (1.16 g, 51.3 mmol,
5 eq) was added. After stirring for 16 hours, several drops of acetic acid were added in an ice bath to neutralize the reaction solution, and the reaction was stopped. After stirring for a while, the precipitated crystals were dissolved in methanol. In TLC during the reaction (chloroform: methanol = 3: 1), the product was one spot, but when the reaction was stopped, it was divided into two spots. After the solvent was removed under reduced pressure, the residue was isolated by silica gel chromatography (chloroform: methanol = 10: 1 to 3: 1) to obtain Compound 7 (91%).

(Compound 8: Production example of 2- (4,4'-dimethoxytrityloxy) methyl-6-hydroxymethylpyridine)
Compound 7 (0.5 g, 3.62 mmol), which had been vacuum-dried in advance, was dissolved in pyridine (18 mL), and DMAP (22.1 mg, 0.18 mmol, 0.05 eq) and 4,4'-Dimethoxytrityl chloride
-22 g, 3.60 mmol, 1 eq) was added, and the mixture was stirred for 16 hours under an Ar atmosphere.
(TLC (Hex: EtOAc = 1: 1) confirmed the disappearance of the starting material EtOAc and satNaHCO _3.
Extracted with aq, the organic layer was washed with sat NaCl aq, dried over anhydrous Na ₂ SO ₄ . After evaporating the solvent under reduced pressure, the residue was isolated by silica gel chromatography (Hex: EtOAc = 4: 1 to 3: 1) to obtain Compound 8 (44%).

(Compound 9: Production Example of 2- (4,4'-dimethoxytrityloxy) methyl-6-0-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidiomethyl-hydroxymethylbenzene)
Compound 8 (0.20 g, 0.45 mmol), which had been vacuum-dried in advance, was dissolved in anhydrous THF (4.5 mL), and DIPEA (0.23 mL, 2.25 mmol, 5 eq) and phosphite reagent (0.16 mL, 0.90 mmol, 2 eq) were dissolved. And stirred for 15 hours under Ar atmosphere. The disappearance of the raw material was confirmed by TLC (EtOAc only). Extraction was performed with EtOAc and satNaHCO ₃ aq, and the organic layer was washed with sat NaCl aq, dried over anhydrous Na ₂ SO ₄ . After evaporating the solvent under reduced pressure, the residue was isolated by silica gel chromatography (EtOAc only) to obtain Compound 9.

(Compound 10: Example of production of CPG resin of dimethyl pyridylcarboxylate derivative)
Compound 8 (0.20 g, 0.45 mmol) is dissolved in pyridine (4.5 mL), and DMAP (1.1 mg, 0.009 mmol, 0.02 eq) and succinic anhydride (136 mg, 1.36 mmol, 3 eq) are added thereto under Ar atmosphere. Stir. After stirring for 17 hours, the progress of the reaction was confirmed by TLC (Hex: EtOAc = 1: 1), extracted with EtOAc and satNaHCO ₃ aq, the organic layer was washed with sat NaCl aq, dried by adding anhydrous Na ₂ SO ₄ I let you. The solvent was distilled off under reduced pressure, followed by vacuum drying. To this concentrate (0.16 g, 0.30 mmol, 66%), dry DMF (7.5 mL) was added and dissolved, CPG (338 mg, 0.075 mmol) was added, and the mixture was allowed to stand for 30 minutes to allow it to blend with the reaction solution. Thereafter, WSC (71 mg, 0.37 mmol, 4.9 eq) was added, and the mixture was shaken at room temperature for one day. As a post-treatment, after washing with pyridine, 0.1M DMAP in pyridine: acetic anhydride (9: 1) solution (6 mL) was added and shaken for 16 hours. This was washed with MeOH and acetone, dried, and the activity was measured. The activity of Compound 10 was 31.4 μmol / g.

  Each modified miRNA (inhibitor) and Anti-miR (registered trademark) Inhibitor-141, -200a used in Experimental Example 6 as well as -208 (Ambion) were introduced into cells by the same method as in Experimental Example 3 above. (Final concentrations: 20 nM, 40 nM, 80 nM). After 24, 48 and 72 hours of induction of differentiation by BMP, differentiation ability was evaluated by the ALP activity and staining shown in Experimental Example 1 above. In addition, hydroxyapatite crystals were formed. These results are shown in FIGS.

  As shown in FIG. 11 and FIG. 12, in the cells into which these miRNAs (inhibitors) were introduced, ALP activity and hydroxyapatite crystal formation, which are osteoblast differentiation indicators, were compared with those of the BMP-2 treatment group and the Negative Control group. Was significantly increased. It was also confirmed that this ALP activity was dependent on the culture time and added concentration. From these results, introduction of the modified miRNA-200a in which the base sequences of these passsenger chains are matched at two or three positions and the nucleoside derivative represented by the formula (1) is introduced is effective as an osteoblast differentiation promoter. It was confirmed.

Claims (11)

  One or more miRNAs selected from miRNA-141, miRNA-200a and miRNA-208 that bind to the 3 ′ untranslated region of the Dlx5 gene, precursors thereof, DNA constructs encoding these, and inhibition of the miRNA An agent for regulating differentiation of osteoblasts, comprising an active ingredient selected from the inhibitor having a first RNA strand containing an antisense sequence for at least part of the guide strand of the miRNA.   The osteoblast differentiation regulator according to claim 1, wherein the miRNA, a precursor thereof, and a DNA construct encoding them are used as active ingredients to suppress differentiation into osteoblasts.   The osteoblast differentiation regulator according to claim 1, wherein the inhibitor is an active ingredient and promotes differentiation into osteoblasts. The osteoblast differentiation regulator according to claim 3, wherein the inhibitor comprises a single-stranded RNA comprising at least one nucleoside derivative represented by the following formula in the first RNA strand.
[In the formula (1), Z represents CH or N. ]   The osteoblast differentiation regulator according to any one of claims 1 to 4, wherein the first RNA strand has higher complementarity to the guide strand than a passenger strand to the guide strand of the endogenous miRNA.   The osteoblast differentiation regulator according to claim 4, wherein the first RNA strand comprises the nucleoside derivative on the 3 'terminal side thereof.   The osteoblast differentiation according to any one of claims 1 to 6, wherein the inhibitor comprises a double-stranded RNA comprising the first RNA strand and a second RNA strand that is a guide strand of the miRNA. Regulator.   The osteoblast differentiation regulator according to claim 7, wherein the second RNA strand comprises the nucleoside derivative on the 3 'terminal side.   A medicament for treating or preventing a disease which is at least one selected from the group consisting of osteoporosis, osteogenesis dysgenesis, and growth inhibition during development, comprising: osteoblast according to any one of claims 1-8. A pharmaceutical comprising a cell differentiation regulator. A method for evaluating an osteoblast differentiation regulator,
Providing a test compound to a progenitor osteoblast or non-human animal having a Dlx5 gene,
An evaluation method using as an index the increase or decrease in the action of one or more miRNAs selected from miRNA-141, miRNA-200a and miRNA-208 that bind to the 3 ′ untranslated region of the Dlx5 gene. Before Symbol wherein the expression level of one or more types of miRNA is selected from precursor osteoblast miRNA-141, miRNA-200a and miRNA-208 in cells or non-human animal that bind to the 3 'untranslated region of Dlx5 gene A step of evaluating the osteoblast differentiation-regulating action of the test compound based on comparison with the time of non-supply of the test compound;
The method of claim 10, comprising: