KR101286154B1 - Composition for Promoting Chondrogenesis from Stem Cells and Anti-Tumor Composition Comprising Anti-sense Oligonucleotides - Google Patents

Abstract

The present invention relates to a composition for promoting chondrocyte differentiation from stem cells comprising an antisense oligonucleotide. The present invention also relates to a pharmaceutical composition for treating cartilage damage, including a composition for promoting cartilage differentiation. The present invention also relates to a method of inducing differentiation from stem cells to chondrocytes. The present invention also relates to an anticancer pharmaceutical composition comprising an antisense oligonucleotide having a sequence complementary to SEQ ID NO: 3 as an active ingredient as a substance that inhibits the expression of the protein of LEF-1. According to the present invention, the antisense oligonucleotide for miR-449a is used to promote differentiation of stem cells (preferably mesenchymal mesenchymal cells) into chondrocytes. The target of miR-449a discovered in the present invention is LEF-1, a transcription-related factor that plays a significant role in a wide range of biological signal transduction pathways, and plays an important role in chondrocyte differentiation and cartilage formation. It can be a therapeutic target. Stem cells transformed with antisense oligonucleotides to miR-449a according to the present invention promote differentiation into chondrocytes and form cartilage. MiR-449a discovered in the present invention directly inhibits the expression of LEF-1 by targeting LEF-1. This can be utilized as an anticancer pharmaceutical composition that can inhibit LEF-1 overexpressed in various cancers.

Description

Composition for Promoting Chondrogenesis from Stem Cells and Anti-Tumor Composition Comprising Anti-sense Oligonucleotides

The present invention relates to a composition for promoting chondrocyte differentiation from stem cells. The present invention also relates to a method of inducing differentiation from stem cells to chondrocytes. The invention also relates to anticancer pharmaceutical compositions.

Mesenchymal stem cells are fibroblast-like cells first known by Frienstein and are plastic-adhesive ¹ . According to initial findings that the mesenchymal stem cells are known to differentiate into various connective tissues such as fat, tendons, cartilage and bone can be ^2-6. Cell coagulation is induced by upregulation of N-cadherin, neural cell adhesion moleucule (NCAM) and fibronectin, and through this complex step, cells, cells, cells and extracellular matrix Cartilage formation occurs as a result of the interaction with. While the differentiating cells are entrusted to the chondrocyte phase, the cells are composed of type II, type VII and type collagen, Cartilage oligomeric matrix protein-1 (COMP-1), whose main components of the extracellular matrix are more cartilaginous from Type I Collagen and Switch to agrecan. Eventually, chondrocytes reach the hypertrophy stage that begins the expression of Type X Collagen which specifically expresses the chondrogenic hypertrophy stage. Finally, as part of the natural growth and development of bone, hypertrophic chondrocytes die and are replaced by bone. Expression patterns of the factors involved in various types of cartilage formation appears differently at each stage of bone ^{formation. 7} (FIG. 1).

The complex process of cartilage formation is regulated by various signaling pathways including TGFβ, FGF, Wnt and Indian hedgehog (Ihh) signals. Among these types of regulators that are potentially involved in cartilage formation, Wnt signaling is of particular interest to many researchers. The reason for this is because the Wnt signal involved in a wide range of biological processes, including embryonic development, tissue morphogenesis, complete body (patterning) and tumor formation ^8.

The 19 Wnt genes known to humans can be classified into Wnt1, Wnt3a, Wnt7a and Wnt8, which are known as canonical pathways, and Wnt4, Wnt5a, and Wnt11, which are known as non-canonical pathways. In the conventional pathway, β-catenin is a key mediator of the Wnt signaling pathway and acts as a transcriptional co-activator of Lymphoid Enhancer Binding Factor 1 (LEF-1) and T-cell factor (TCF) proteins. Typically, Wnt binds to the Frz family of cell membrane receptors and phosphorylates β-catenin of glycogen synthase kinase-3 (GSK-3) to inhibit ubiquitination and degradation of β-catenin. Β-catenin then accumulates in the cytoplasm, migrates into the nucleus, associates with the transcription factor TCF / LEF family, and ultimately induces expression of downstream target genes ⁹ (FIG. 2).

The inventors have used quantitative real-time PCR with high throughput screening to demonstrate that LEF-1, a direct target protein of β-catenin, exhibits a specific expression pattern during cartilage formation and binds to this specific gene. microRNA was studied.

MiRNAs with 17-23 nucleotides length influence a variety of processes including cell proliferation ^{10 , 11} , apoptosis ^{12 , 13} , immune response ¹⁴ , protein expression ^{15 -17} and tissue development ^{18 -24} . By forming a complex of RISC (RNA-induced silencing complex) 25 protein complexes that can function, miRNA recognizes the complementary nucleotide sequence of the 3'UTR of the target protein, mRNA and protein decomposition ²⁶ decrypts (translation) inhibitory activity Two mechanisms of ²⁷ inhibit gene expression. Recently, a few miRNAs have been experimentally identified as key regulators of cartilage formation. One study found that the target of miRNA-19a was CCN2 / CTGF, an important protein for bone formation in cartilage ²⁸ . In pellet culture of differentiated pluripotent C3H10T1 / 2 stem cells, miRNA-199a was known as an early stage inhibitor. Treatment with mir-199a observed a significant decrease in key cartilage markers COMP protein, SOX9 and Type II Collagen, whereas inhibition of mir-199a resulted in increased expression of these genes ²⁹ . The general Wnt signaling pathway, along with LEF-1, plays a significant role in a wide range of biological signaling pathways and is involved in the proliferation, growth and development of cancer cells and is therefore not only limited to the field of cartilage or developmental biology, Information about the potential microRNAs that regulate expression provides the worker with a deeper insight into the overall understanding of human physiology.

A number of patent documents and articles are referenced and cited throughout this specification. The disclosures of the cited patent documents and papers are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have tried to develop a method that can promote differentiation from stem cells to chondrocytes. As a result, the present inventors have completed the present invention by identifying that miR-449a antisense oligonucleotide promotes differentiation from stem cells to chondrocytes by inducing the expression of Lymphoid Enhancer Binding Factor 1 (LEF-1).

It is therefore an object of the present invention to provide a composition for promoting chondrocyte differentiation from stem cells.

Another object of the present invention to provide a pharmaceutical composition for treating cartilage damage.

Another object of the present invention to provide a method for differentiating chondrocytes from stem cells.

Still another object of the present invention is to provide an anticancer pharmaceutical composition comprising an antisense oligonucleotide complementary to the mRNA sequence of LEF-1.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to an aspect of the present invention, the present invention provides a composition for promoting chondrocyte differentiation from stem cells comprising an antisense oligonucleotide having a sequence complementary to microRNA-449a of SEQ ID NO: 1.

The present inventors have tried to develop a method that can promote differentiation from stem cells to chondrocytes. As a result, the inventors have found that miR-449a antisense oligonucleotide promotes differentiation from stem cells to chondrocytes by inducing expression of Lymphoid Enhancer Binding Factor 1 (LEF-1).

The composition of the present invention comprises an antisense oligonucleotide having a sequence complementary to microRNA-449a (miR-449a) of SEQ ID NO: 1. As used herein, the term “antisense oligonucleotide” encompasses nucleic acid-based molecules that have a complementary sequence to the target of a microRNA (miRNA), in particular a miRNA, to form a duplex with the miRNA. Thus, the term "antisense oligonucleotide" can be described herein as a "complementary nucleic acid-based inhibitor."

Sequence Listing 1 shows the mature sequence of miR-449a. The 2nd to 8th nucleotide sequence in SEQ ID NO: 1 is the seed sequence of miR-449a. In general, the seed sequence of miRNA is a very important sequence and is conserved for various species (Krenz, M. et al., J. Am. Coll . Cardiol . 44: 2390-2397 (2004) ; H. Kiriazis, et al, Annu Rev Physiol 62:.... 321 (2000)).

According to a preferred embodiment of the present invention, the antisense oligonucleotides used in the present invention have a sequence complementary to the second to eighth nucleotide sequences of the first sequence.

According to a more preferred embodiment of the present invention, the antisense oligonucleotide used in the present invention comprises a sequence complementary to the 1st to 22nd nucleotide sequence in the nucleotide sequence of the first sequence (ie, the mature sequence of miR-449a) Have Most preferably, the antisense oligonucleotide has a nucleotide sequence of SEQ ID NO: 2.

The term “complementary” as used herein referring to antisense oligonucleotides means that the antisense oligonucleotides are sufficiently complementary to selectively hybridize to miR-449a targets under certain hybridization or annealing conditions, preferably physiological conditions. It has the meaning encompassing both substantially complementary and completely complementary, and preferably means completely complementary.

Antisense oligonucleotides in the present invention include various molecules. Antisense oligonucleotides are DNA or RNA molecules, more preferably RNA molecules. Optionally, the antisense oligonucleotides used in the present invention include ribonucleotides (RNA), deoxyribonucleotides (DNA), 2'-0-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, peptide nucleic acid (PNA) or LNA. (locked nucleic acid). 2'-O- modified oligonucleotides are preferably 2'-O- alkyl oligonucleotide, more preferably 2'-OC _{1 -3} and oligo-alkyl nucleotides, most preferably 2'-OC _{1 -3-methyl} Oligonucleotides.

As mentioned above, antisense oligonucleotides in the present invention have a broad meaning including nucleic acid-based inhibitors having a sequence complementary to miR-449a. Included in the antisense oligonucleotides of the present invention include, for example, antisense oligonucleotides, antagonists and inhibitory RNA molecules in a narrow sense.

The term “antagomere” is a single-stranded chemically-modified ribonucleotide having a sequence that is at least partially preferably completely complementary to miR-449a. Antagonists include one or more modified nucleotides (eg, 2′-O-methyl-sugar modifications). According to certain embodiments, the antagonist comprises only modified nucleotides. Antagonists include one or more phosphorothioate linkages and have a partially or completely phosphorothioate backbone. To improve in vivo transport and stability, antagonists may bind cholesterol or other sites at their 3′-end. Suitable for inhibiting miR-449a, the length of the antagonists is 7-50 nucleotides, preferably 10-40 nucleotides, more preferably 15-30 nucleotides, most preferably 20-25 nucleotides.

Inhibition of miR-449a function can be achieved by administering a typical antisense oligonucleotide. Antisense oligonucleotides are ribonucleotides or deoxyribonucleotides. Preferably, the antisense oligonucleotides comprise at least one chemical modification. Antisense oligonucleotides may comprise one or more locked nucleic acids (LNAs). LNAs are modified ribonucleotides that have a locked form, including additional bridges between the 2 'to 4' carbons of the ribose sugar moiety, so that the oligonucleotides with LNA have improved thermal stability. Alternatively, antisense oligonucleotides may comprise peptide nucleic acids (PNAs), which include peptide-based backbones instead of sugar-phosphate backbones. Other chemical modifications that antisense oligonucleotides may include include 2'-0-alkyl (eg, 2'-0-methyl, 2'-0-methoxyethyl), 2'-fluoro and 4'-thio modifications. Sugar modifications such as; Backbone modifications such as phosphorothioate, morpholino or phosphonocarboxylate linkages (eg, US Pat. Nos. 6,693,187 and 7,067,641). In another embodiment, a suitable antisense oligonucleotide is a 2'-0-methoxyethyl "gapmer" which comprises a 2'-0-methoxyethyl-modified ribonucleotide at the 5'-end and a 3'-end and is centrally located. At least 10 deoxyribonucleotides. This "gapmer" can trigger the RNase I dependent disruption mechanism of the RNA target. The antisense oligonucleotides are 7-50 nucleotides in length, preferably 10-40 nucleotides, more preferably 15-30 nucleotides, and most preferably 20-25 nucleotides.

Another approach to inhibit the function of miR-449a is to administer an inhibitory RNA molecule, said inhibitory RNA molecule comprising a sequence complementary to the mature sequence of miR-449a. Such inhibitory RNA molecules include small interfering RNA (siRNA), short hairpin RNA (shRNA) and ribozymes.

The antisense oligonucleotide of the present invention has a sequence complementary to miR-449a and inhibits miR-449a to induce the expression of its target gene, LEF-1.

Antisense oligonucleotides of the present invention promote chondrocyte differentiation from stem cells. The stem cells include all stem cells known in the art, such as pluripotent stem cells and multipotent stem cells. Preferably, the stem cells are pluripotent stem cells. More preferably, the pluripotent stem cells are mesenchymal stem cells, muscle stem cells, hematopoietic stem cells, neural stem cells, liver stem cells, pancreatic stem cells, endothelial stem cells and epidermal stem cells, even more preferably Are mesenchymal stem cells, most preferably bone marrow-derived mesenchymal stem cells.

According to another aspect of the present invention, the present invention provides a stem cell comprising the step of inducing differentiation into chondrocytes from stem cells transformed with antisense oligonucleotides having a sequence complementary to microRNA-449a of SEQ ID NO: 1 From a chondrocyte differentiation method.

Since the method of the present invention utilizes the chondrocyte differentiation composition, the contents in common between the two are omitted in order to avoid excessive complexity of the present specification according to the repetitive description.

According to a preferred embodiment of the present invention, the step of inducing differentiation is performed by increasing the expression of Lymphoid Enhancer Binding Factor 1 (LEF-1) by the antisense oligonucleotide. The antisense oligonucleotide of the present invention can promote differentiation from stem cells to chondrocytes by inhibiting miR-449a and inducing expression of its target gene, LEF-1. LEF-1 is a transcription-related factor that plays a significant role in a wide range of biological signal transduction pathways, and is commonly known to those of skill in the art that it is not limited to the fields of cartilage or developmental biology, but has an overall impact on human physiology. have. In addition, the major signaling pathway upstream of LEF-1 is known as the Wnt-β-catenin signaling pathway. Conventional Wnt binds to the Frz family of cell membrane receptors and phosphorylates β-catenin of glycogen synthase kinase-3 (GSK-3) to inhibit ubiquitination and degradation of β-catenin. Β-catenin then accumulates in the cytoplasm, migrates into the nucleus, binds to the transcription factor TCF / LEF family, and ultimately induces expression of downstream target genes. As a result, the increase of LEF-1 increases the type II cells, SOX9, Type X Collagen and MMP13, which are markers of chondrocyte differentiation and chondrogenesis, thus differentiating stem cells into chondrocytes and forming cartilage.

In the method of the present invention, the stem cells transformed with the antisense oligonucleotide for the microRNA-449a may be prepared by various transformation methods known in the art. For example, micro-injection (Capecchi, MR, Cell , 22: 479 (1980)), calcium phosphate precipitation (Graham, FL et al., Virology , 52: 456 (1973)), electroporation (Neumann, E et al., EMBO J. , 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene , 10:87 (1980)), DEAE-dextran treatment (Gopal, Mol. . Cell Biol, 5:. 1188-1190 (1985)), and gene night Bard treatment (Yang et al, Proc Natl Acad Sci, 87:..... 9568-9572 (1990) antisense oligonucleotides or the like) Can be injected into stem cells.

The method of inducing differentiation of stem cells transformed with antisense oligonucleotides to chondrocytes with respect to the microRNA-449a may be performed through various chondrocyte differentiation methods known in the art. For example, differentiation induction can be carried out by culturing stem cells in conventional chondrocyte differentiation media known in the art (eg, including DMEM-High Glucose, insulin transferrin selenium A, ascorbic acid, and TGF-β3). have.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for treating cartilage damage comprising the composition for promoting cartilage differentiation.

Since the pharmaceutical composition of the present invention uses the chondrocyte differentiation composition as an active ingredient, the common content between the two is omitted in order to avoid excessive complexity of the present specification according to the repeated description.

The pharmaceutical composition of the present invention may be administered alone or in combination. For example, it can be administered topically to the site of cartilage damage along with mesenchymal stem cells to exert the effect of treating cartilage damage.

Cartilage injury diseases that can be treated using the pharmaceutical compositions of the present invention preferably include osteoarthritis, degenerative arthritis, rheumatoid arthritis and joint damage by trauma.

Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations include, but are not limited to, Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered parenterally, and in the case of parenteral administration, it may be administered by intraarticular injection, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection and the like.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-100 mg / kg.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it with a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person skilled in the art to which the present invention belongs Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

The pharmaceutical composition of the present invention can treat a variety of diseases related to cartilage damage by promoting the differentiation of stem cells at the site within the joint to be administered or stem cells administered in combination into chondrocytes.

According to another aspect of the present invention, the present invention is an anticancer pharmaceutical composition comprising an antisense oligonucleotide having a sequence complementary to SEQ ID NO: 3 as an active ingredient as a substance which inhibits the expression of the protein of LEF-1.

Since the description of the antisense oligonucleotide and the pharmaceutical composition included in the composition of the present invention is the same as that of the chondrocyte differentiation composition, the contents in common between the two are described in order to avoid excessive complexity of the present specification according to the repeated description. Omit.

The composition of the present invention comprises an antisense oligonucleotide having a mRNA sequence of LEF-1, preferably a sequence complementary to the 3'UTR sequence of LEF-1, of SEQ ID NO: 3. As used herein, the term “antisense oligonucleotide” encompasses nucleic acid-based molecules that have a complementary sequence to the sequence of the mRNA of the targeted LEF-1, in particular LEF-1, to form a duplex with the mRNA. do.

According to a preferred embodiment of the present invention, the composition of the present invention is an anticancer pharmaceutical composition, characterized in that it has a nucleotide sequence of SEQ ID NO: 1 sequence.

Sequence Listing 1 is the miR-449a sequence, and the 2nd to 8th nucleotide sequences are the seed sequences of miR-449a. In general, the seed sequence of miRNA is a very important sequence and is conserved for various species (Krenz, M. et al., J. Am . Coll . Cardiol . 44: 2390-2397 (2004). ; H. Kiriazis, et al, Annu Rev Physiol 62:.... 321 (2000)).

According to a preferred embodiment of the present invention, the expression of Lymphoid Enhancer Binding Factor 1 (LEF-1) is inhibited by the oligonucleotide which is the composition of the present invention. As described above in the embodiments of the present invention, miR-449a directly binds to LEF-1 and inhibits its expression. LEF-1 is a sub-material of Wnt signal transduction. When β-catenin accumulates in the cytoplasm and moves into the nucleus by Wnt signaling, it binds to the transcription factor TCF / LEF family and ultimately induces expression of lower target genes. Results in growth, differentiation and expression of various genes. It is commonly known to those skilled in the art that overexpression of LEF-1 in various cancer cells is used as a mechanism for growth of cancer cells. In particular, many researchers are interested in the overexpression of LEF-1 in colorectal cancer (Karine H. et al., Nature . Vol29. May 2011). Efforts have been made to inhibit colorectal cancer by inhibiting LEF-1 (Tony W. et al., Mol and Cel Biol. Vol. 26. 2006. p5284-5299), and in the present invention, substances that inhibit LEF-1. By identifying miR-449a, we suggest that it can be applied to the treatment of cancer by inhibiting LEF-1 overexpressed in various cancers.

Cancers that can be prevented or treated with the compositions of the present invention include gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer , Head and neck cancer, skin cancer, thyroid cancer, parathyroid cancer and ureter cancer, most preferably colon cancer.

According to a preferred embodiment of the present invention, the composition of the present invention is an anticancer pharmaceutical composition characterized in that it is effective in preventing or treating colon cancer disease.

The features and advantages of the present invention are summarized as follows:

(a) According to the present invention, the antisense oligonucleotide for miR-449a is used to promote the differentiation of stem cells (preferably mesenchymal mesenchymal cells) into chondrocytes.

(b) The target of miR-449a discovered in the present invention is a transcription-related factor that plays a significant role in a wide range of biological signal transduction pathways as LEF-1, and plays an important role in chondrocyte differentiation and cartilage formation. It can be a practical therapeutic target for the disease.

(c) Stem cells transformed with antisense oligonucleotides against miR-449a according to the present invention promote differentiation into chondrocytes and form cartilage.

(d) miR-449a discovered in the present invention directly inhibits the expression of LEF-1 by targeting LEF-1. This can be utilized as an anticancer pharmaceutical composition that can inhibit LEF-1 overexpressed in various cancers.

Figure 1 is a schematic diagram showing the expression patterns of cartilage marker genes important in the process of cartilage formation.
Figure 2 is a schematic diagram showing the interaction between the Wnt signaling pathway and Wnt and LEF / TCF transcription factors in general.
Figure 3 shows the optimization of cartilage formation through microculture, showing the increase of type II collagen, SOX9, type X collagen, markers of cartilage formation.
Figure 4 is a data showing the degree of cartilage formation, showing the increase in type II Collagen in mesenchymal stem cells cultured in the culture medium causing cartilage compared to stem cells cultured in the culture medium that does not differentiate cartilage.
Figure 5 is a real-time PCR results showing the expression pattern of cartilage marker genes that can confirm the cartilage formation. (A) is data for agrecan, (B) SOX9 and (C) type X collagen, with aggrecan and SOX9 increased in mesenchymal stem cells and type X collagen, a marker of chondrocyte hypertrophy. Shows little change.
The right panel shows three genes with the largest difference in expression patterns in the cartilage-induced and non-cartilage-induced groups (D) LEF-1, (E) c-Jun and (F) FOCO4. Show the difference. Day 0 CT is the normal control group on day 0 of cultivation, Day 10 CT is the normal control group incubated for 10 days in a medium that does not form cartilage. Indicates.
6 is a schematic diagram classified into six cluster groups based on similar changes in expression patterns. (A) CT0 is a normal control group on day 0 of culture, CT10 is a normal control group incubated for 10 days in a medium that does not form cartilage, and CH10 represents a cartilage forming group that was cultured in a medium that forms cartilage for 10 days. Scatter plots of genes increased or decreased in mesenchymal stem cells (MSCs) induced by chondrogenesis. (B) LEF-1 is present in the cluster 6 group.
FIG. 7 shows (A) donor 1, (B) donor 2 and (C) donor 3 as data showing the expression profile of LEF-1 in chondrogenic induced mesenchymal stem cells obtained from three donors. Compared with previous results, LEF-1 increases expression at an early stage of differentiation and then decreases rapidly.
8 is an experimental result showing the role of LEF-1 in cartilage formation of human bone marrow-derived chondrocytes. The mesenchymal stem cells had decreased cartilage differentiation marker genes Type II Collagen (Col2A1) and SOX9 up to 7 days after siLEF-1 transformation and showed a decrease in MMP13 and Type X Collagen related to cartilage maturation.
9 is data showing the effect of overexpression of several microRNAs on the expression of intracellular LEF-1 in (A) SW1353 and (B) JJ cell lines ( ^** p-value <0.01).
10 is data showing that overexpression of miR-449a regulates expression of LEF-1 in cells. Overexpression of miR-449a decreases the expression of intracellular LEF-1, whereas inhibition of miR-449a increases the expression of intracellular LEF-1. Data from (A) SW1353 and (B) JJ cell lines and (C) Western blot results show similar patterns observed ( ^** p-value <0.01).
FIG. 11 is data showing that miR-449a specifically binds to the seed sequence of the 3′UTR of LEF-1. The pGL3 control vector and miR-449a were transformed together to show reduced expression of sequence specific LEF-1 by miR-449a. (A) Schematic diagram showing the sequence of miR-449a binding to LEF-1 mRNA, (B) Schematic diagram showing the structure cloned into the 3'UTR of 1.2 kb LEF-1 at the back of luciferase of the pGL3 vector, (C) miR The data show an 80% decrease in luciferase function in the presence of -449a, and (D) miR-449a concentration dependent decrease in function of luciferase.
12 is data showing the sequence specific function of miR-449a for LEF-1. The correct seed sequence of miR-449a was confirmed in the 3'UTR of LEF-1 by various modifications of the LEF-1 3'UTR sequence of pGL3 cloned from the 3'UTR of LEF-1 (A). Mutations in the seed sequence in both (B) JJ and (C) HeLa cell lines show that the inhibition of luciferase's function on miR-449a is remarkably restored ( ^** p-value <0.01).
Fig. 13 is a schematic diagram showing the effect of miR-449a, which is a direct target of LEF-1, on cartilage formation.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and methods

1. Invitation Intermediate lobe  Stem Cells( MSC ) Culture

Bone marrow was extracted from the posterior iliac crest from 10 adult donors aged 20-69 with the approval of the Institutional Review Board (IRB). The mesenchymal stem cells were specifically selected according to the innate properties attached to the surface of the model culture vessel. Cells are medium containing low glucose (DMEM) -DMEM (DMEM-LG, Invitrogen, Grand Island, NY, USA), 10% (v / v) fetal bovine serum (FBS) and 1 × antibiotic-antifungal (Invitrogen) After 7 days of incubation, the floating cells were removed and the attached cells continued to be cultured. With an average of about 10 days of culture, when the cells reached 70% confluence, they were separated using 0.25% trypsin-EDTA (Invitrogen) and then centrifuged at 1,300 rpm for 3 minutes. Placement of initial cultured cells was 1, cells were fresh 10 cm ² to 6-7 generations Incubated in the flask.

2. Alginate Alginate bead and  Cartilage Formation Using Microculture

Mesenchymal stem cells cultured between 3-5 generations were harvested in the same manner as before. In alginate bead culture, mesenchymal stem cells were encapsulated with 1.2% (w / v) alginate beads (Sigma-Aldrich, St. Louis, MO, USA). More specifically, the cells present in the culture were encapsulated by passing through a 19-gauge needle in a drop manner to a concentration of 2 × 10 ⁶ cells / ml in a 6 well plate in which 102 mM CaCl ₂ solution was present. The cells were polymerized for about 5 minutes, the alginate beads were washed with brine and incubated in 10% bovine serum-DMEM-HG.

By microculture, cells were resuspended in 10% bovine serum-DMEM-HG at a concentration of 8,000 cells / μl and 10 μl of floating cells were dropped in the center of a 24 well plate. A drop of 1 × phosphate buffered saline (Thermo Scientific, Logan, Utah, USA) was added to prevent overdrying of the cells. Cells were stimulated to adhere to the plates by incubating for 2 hours at 37 ° C. with 5% CO ₂ . As a control, 1 ml of DMEM-High Glucose (DMEM-HG, Invitrogen) was added, 1 x antibiotic-antifungal, 1x insulin transferrin selenium A (Invitrogen) and 50 μg / ml ascorbic acid, and 10 ng to the chondrogenic culture. / ml TGF-β3 (R & D systems, Minneapolis, MN, USA) was added. Cultures were changed every 2-3 days. After washing three times with phosphate buffered saline, 40 mM EDTA was treated for 10 minutes to dissolve the encapsulation beads.

3. mRNA  Gene Expression Analysis at the Level

RNAiso plus (Takara, Japan) was used to separate RNA from mesenchymal cells. 1 ml of RNAiso plus solution was added to the obtained cells, and the cells were thawed sufficiently with repeated pipetting. Cells were incubated at room temperature for 10 minutes, followed by the addition of 200 μl of chloroform and vortexed until they had a cloudy color. After incubation for 5 minutes at room temperature it was centrifuged at 13,000 rpm for 15 minutes at 4 ℃. The top layer was transferred to a new tube and 500 μl of 100% isopropanol was added. After vortexing, the solution was incubated at room temperature for 10 minutes and then centrifuged at 13,000 rpm for 10 minutes at 4 ° C. The supernatant was removed while keeping the RNA pellet well maintained and centrifuged at 70 rpm for 5 minutes at 4 ° C. with 70% ethanol. Finally, the RNA pellet was dissolved in 30 μl of diethylpyrocarbonate aqueous solution (DEPC water). Spectrophotometer was used to quantify the total amount and concentration of each RNA sample. Reverse transcription of DNA was performed using Omniscript reverse transcription kit (Qiagen, Venlo, Netherlands). PCR conditions and primer lists for amplification of specific genes were obtained from gene banks and manufacturers (Tables 1 and 2). GAPDH was used for the relative expression correction of all genes. NCode ^™ for microRNA precursor reverse transcription miRNA First-Strand cDNA Synthesis and qRT-PCRKit and MIRC-50 (Invitrogen, USA) were used and the method was according to the manufacturer's instructions. A list of primers for amplifying specific pre-miRNAs was obtained from the Invitrogen primer database ( http://escience.invitrogen.com/ncode/ ) (Table 3). U6 snRNA was used for standardizing relative expression levels of all pre-miRNAs.

PCR conditions gene Condition cycle Cbfa1 / runx2 94 ° C 30 s-59 ° C 30 s-72 ° C-30 s 34 SOX-6 94 ° C 30 s-58 ° C 30 s-72 ° C-30 s 30 SOX-9 94 ° C 30 s-58 ° C 30 s-72 ° C-30 s 30 Type II Collagen 94 ° C 30 s-58 ° C 30 s-72 ° C-30 s 30 Type X Collagen 94 ° C 30 sec-60 ° C 30 sec-72 ° C-30 sec 29 GAPDH 94 ° C 30 s-57 ° C 30 s-72 ° C-30 s 31

Primer Sequence for RT PCR gene spiral primer  Base sequence size ( bp ) Cbfa1 / runx2 sense 5'-CCACCTCTGACTTCTGCCTC-3 ' 172 Antisense 5'-GACTGGCGGGGTGTAAGTAA-3 ' SOX-6 sense 5'-ACTGTGGCTGAAGCACGAGTC-3 ' 562 Antisense 5'TCCGCCATCTGTCTTCATACC-3 ' SOX-9 sense 5'-GAACGCACATCAAGACGGAG-3 ' 631 Antisense 5'-TCTCGTTGATTTCGCTGCTC-3 ' Type II Collagen sense 5'-TTCAGCTATGGAGATGACAATC-3 ' 472 Antisense 5'-AGAGTCCTAGAGTGACTGAG-3 ' Type X Collagen sense 5'-GCCCAAGAGGTGCCCCTGGA-3 ' 570 Antisense 5'-CCTGAGAAAGAGGAGTGGAC-3 ' GAPDH sense 5'-GAAGGTGAAGGTCGGAGTC-3 ' 220 Antisense 5'-GAAGATGGTGATGGGATTTC-3 '

Primer Sequence for miRNA PCR Analysis microRNA spiral primer  Base sequence size( bp ) Hsa-miR-449a sense* 5'-TGGCAGTGTATTGTTAGCTGGT-3 ’ About 70 bp Hsa-miR-106a sense* 5'-GAAAAGTGCTTACAGTGCAGGTAG-3 ' Hsa-miR-548c-5p sense* 5'-AAAAGTAATTGCGGTTTTTGCC-3 ' Hsa-miR-629 sense* 5'-TGGGTTTACGTTGGGAGAACT-3 ' Hsa-miR-299-5p sense* 5'-TGGTTTACCGTCCCACATACAT -3 ' Hsa-miR-411 sense* 5'-CGTAGTAGACCGTATAGCGTACG-3 ' Hsa-miR-218 sense* 5'-CGTTGTGCTTGATCTAACCATGT-3 ' Hsa-miR-450b-5p sense* 5'-GCTTTTGCAATATGTTCCTGAATA -3 ' Hsa-miR-421 sense* 5'-AACAGACATTAATTGGGCGC-3 ' Hsa-miR-149 sense* 5'-GCTCCGTGTCTTCACTCCC -3 ' Hsa-miR-138 sense* 5'-GTGTTGTGAATCAGGCCG -3 ' Hsa-miR-767-3p sense* 5'-TGCTCATACCCCATGGTTTCT -3 ' Hsa-miR-550 sense* 5'-CCTGAGGGAGTAAGAGCCC -3 ' U6 snRNA sense 5'-CTCGCTTCGGCAGCACA-3 ' 94 bp

Asterisk (*) indicates sense strand used in microRNA PCR reaction

RT-PCR and quantitative real-time PCR were used as an experimental method for gene expression analysis at the mRNA level, and Takara Ex Taq ^™ (Takara, Shiga, Japan) was used as polymerase. ABI7500 (ABI, Carlsbad, USA) was used as a quantitative real-time PCR experiment and analysis machine, and the primers and universal primers (Bioneer, Korea) used are shown in Tables 4 and 5 below:

Primer sequences for quantitative real-time PCR analysis Gene Strand Primer Sequence β-actin sense 5 'GTCCTCTCCCAAGTCCACACAG 3' Antisense 5 'GGGCACGAAGGCTCATCATTC 3' LEF-1 sense 5 'GCCACGGACGAGATGATCC 3' Antisense 5 'TGTCTGGCCACCTCGTGTC 3' Aggrecan sense 5 'CCACTGTTACCGCCACTT 3' Antisense 5 'GTAGTCTTGGGCATTGTTGT 3' Sense OX9 sense 5 'CGACTACGCTGACCATCAGA 3' Antisense 5 'AGACTGGTTGTTCCCAGTGC 3' Type X collagen sense 5 'CCAGGACAGCCAGGCATCAA 3' Antisense 5 'ATGCCTTCTGGCCCTCGTTC 3' cJUN P155634 (Bioneer) FOXO4 P269629 (Bioneer)

Qualitative Real-Time PCR Conditions process Temperature time Initial denaturation stage 95 ° C 30 seconds Denaturation stage 95 ° C 5 seconds Annealing / Extension 60 ° C 34 seconds Harry steps

PCR progress was performed in a total of 40 cycle conditions, and cyberrin fluorescence was detected during annealing / extension.

5. cDNA Wow microRNA Microarray  analysis

RNA of cultured mesenchymal stem cells was isolated using RNAiso Plus (Takara, Japan) according to the manufacturer's instructions, and the spectrophotometer was used to quantify the amount and concentration of the total RNA samples. Affymetrix GeneChipHuman Gene 1.0 ST Array (Affymetrix, Santa Clara, USA) was used to analyze cDNA expression, and Pearson correlation analysis was used to analyze genes specifically expressed in cartilage-induced mesenchymal stem cells. Differentially Expressed Genes (DEGs) used the conventional formula for the difference between the interest group and the control group: DEGs = [Day 10 cartilage group (Day 0 control + Day 10 control)]

Strict cut-off thresholds were used to select only those genes that showed at least two or more expression differences.

6. Immunity Blotting  analysis

Digestion buffer (Promega, Madison, USA), protease 10 μg / ml and phosphatase inhibitors were used for the preparation of whole cell lysates. The prepared cell lysates were centrifuged at 13,000 rpm for 15 minutes at 4 ° C. to obtain clear cell lysates, and the quantification was performed using a modified Bradford method. Cell lysates were aliquoted in total at 30 μg and loaded into 10% SDS-PHAGE. The protein was transferred to PVDF (Amersham, Pharmacia, Piscataway, USA) membrane and transfer buffer [1.4% glycine, 20% methanol and Tris-HCL 25 mM (pH 8.3)] was added and reacted at 50V for 90 minutes. The PVDF membrane was taken out and soaked in 1x TBST (Tris-HCl 50 mM, NaCl 150mM, Tween-20 0.1%) in a blocking solution with 1% added milk, and then incubated for 1 hour at room temperature. LEF-1 primary antibody (Cell Signaling, Danvers, USA) was incubated overnight at 4 ° C using a 1: 10,000 ratio, washed with 1X TBST and then anti-Toki mustard peroxidase (HRP) secondary antibody Proteins were detected using (Amersham Pharmacia, USA) in a 1: 5,000 ratio. Antibody of β-actin (Santa Cruz, USA) was used as internal standard quantitative material.

7. microRNA Overexpression and inhibition of LEF -1 of siRNA

 In order to analyze the detected microRNA function and its effect on the target gene (LEF-1), microRNA-mimic (Genolus, Korea) was purchased to overexpress the microRNA. The purchased microRNA is double stranded and processed into mature microRNA by internal mechanisms. miR-1 was used as a positive control to inhibit the target gene TWf-1 and scrambled microRNA as a negative control (Table 6). MicroRNA constructs were added to 7 μl and 4 μl of Lipofectamine 2000 (Invitrogen, USA) to transform SW1353, JJ cell lines and mesenchymal stem cells.

MicroRNA mimics used for overexpression microRNA piece Dimer  order hsa-miR-1 S 5 ’UGGAAUGUAAAGAAGUAUGUAU 3’ AS 5 ’AUACAUACUUCUUUACAUUCCA 3’ hsa-miR-SC S 5 ’UUACCAGACGUGUCUUCACUCCC 3’ AS 5 ’GGGAGUGAAGACACGUCUGGUAA 3’ hsa-miR-138 S 5 ’AGCUGGUGUUGUGAAUCAGGCCG 3’ AS 5 ’CGGCCUGAUUCACAACACCAGCU 3’ hsa-miR-411 S 5 ’UAGUAGACCGUAUAGCGUACG 3’ AS 5 ’CGUACGCUAUACGGUCUACUA 3’ hsa-miR-449a S 5 ’UGGCAGUGUAUUGUUAGCUGGU 3’ AS 5 ’ACCAGCUAACAAUACACUGCCA 3’ hsa-miR-548c-5p S 5 ’AAAAGUAAUUGCGGUUUUUGCC 3’ AS 5 ’GGCAAAAACCGCAAUUACUUUU 3’ hsa-miR-767-3p
S 5 ’UCUGCUCAUACCCCAUGGUUUCU 3’ AS 5 ’AGAAACCAUGGGGUAUGAGCAGA 3’

Meanwhile, in order to suppress the function of miRNA449a, 2′-OME RNA (ST pharm, Korea) having a sequence complementary to antagonists was used (Table 3). At the 5 'end of the antagonist, a modified form of antagonist with FAM fluorescent material was used for visualization after transformation and the sequence is shown in Table 7 below:

miR-449a and antagonist sequences name spiral Base sequence hsa-miR-449a sense 5’UGGCAGUGUAUUGUUAGCUGGU 3 Antisense 5'ACCAGCUAACAAUACACUGCCA 3 anti-hsa-miR-449a - 5 'ACCAGCUAACAAUACACUGCCA 3'

The siRNA dimer used in the experiment was a FITC fluorescent substance attached to the 5 'end for visualization after transformation and the sequence is shown in Table 8.

siRNA dimer sequences siRNA Strand Duplex sequence siControl S 5 'CCUACGCCACCAAUUUGGU 3' AS 5 'ACGAAAUUGGUGGCGUAGG 3' siLEF-1 S 5 'GUUAUUCCGGGUACAUAAU 3' AS 5 'AUUAUGUACCCGGAAUAAC 3'

8. Construction of Luciferase Reporter Vector

In order to identify the microRNA that binds to 3′UTR of LEF-1 and the nucleotide sequence recognized by the microRNA, various forms of LEF-1 3′UTR were cloned into a pGL3 control vector (Promega, USA). More specifically, the region of about 100 bp where 1.2 kb of LEF-1 3'UTR and microRNA-449a are predicted to be cloned was cloned behind luciferase using Xba-I, and the primers used are shown in Table 9 below. The recognition sites for Xba-I restriction enzymes are underlined:

miR-449a and antagonist sequences name spiral Base sequence LEF-1 3'UTR
Cloning Primer sense 5'ATGC TCTAGA GTGGAAAACGAAGCTCATTCC 3 Antisense 5'ATGC TCTAGA TTAAAAAAATGCTCAGCACATTAACT 3

9. Statistical Analysis

Appropriate statistical analysis method was used for all data analysis. Values indicating statistical significance in all figures and tables are indicated by “*” and “**”, “*” is p-value <0.05, “**” Means p-value <0.01.

result

1. Cartilage formation of mesenchymal cells was very effective in the micro culture system.

Previous studies have reported patterns of expression of key marker genes such as type II Collagen and SOX9 during the overall process of cartilage formation. The inventors confirmed that the expression rate of type II Collagen and SOX9 was significantly increased in mesenchymal stem cells cultured in microculture compared to other culture methods. While microculture, type X Collagen gene expression was observed in mesenchymal stem cells, but no significant change in type X Collagen gene expression was observed compared to other counterpart gene expression (FIG. 3).

By microculture different from other cultures, the inventors were able to distinguish the expression patterns of marker genes such as Type II Collagen and SOX9 reported in existing expression profiles. The present inventors accurately confirmed the expression profile of the reported marker genes in RT-PCR in mesenchymal stem cells cultured in a micro culture system (FIG. 4).

Taken together, a) the preponderance of the microculture method compared to other methods was confirmed by the expression profile of Type II Collagen, and b) cartilage formation by the microculture method showed an expression pattern consistent with the previously reported results. It was confirmed.

All experiments mentioned below used a microculture method. After establishing the most suitable method of inducing chondrogenesis, mesenchymal stem cells from various donors were cultured for 10 days in control culture or chondrogenic culture. Then, RNA extracted from the control group on the first day of culture (day 0), the control group and the cartilage forming population after 10 days of culture, was confirmed the efficacy of cartilage formation through quantitative real-time PCR before using the microarray which is a highly efficient search method. Marker genes agrecan and SOX9 increased during chondrogenesis were confirmed to be significantly increased expression compared to mesenchymal stem cell control on day 0 and day 10, and also confirmed the efficacy of cartilage induced by microculture. Could be (FIGS. 5A-B). It was confirmed that SOX9 was increased in cartilage-induced mesenchymal stem cells in the absence of a change in the expression of cartilage hypertrophy type X Collagen. As a result of microarray analysis, the expression patterns of cartilage-specific genes were confirmed by quantitative real-time PCR. LEF-1 showed an impressive increase in cartilage-induced mesenchymal stem cells. All experiments were repeated three or more times in mesenchymal stem cells from three different donors.

2. Microarray analysis identified clusters of genes with specific increased or decreased expression patterns in cartilage-induced mesenchymal stem cells.

In order to confirm the pattern of genes specifically expressed in chondrogenic induced mesenchymal stem cells, microRNA and cDNA microarray analysis was performed on the samples. Genes with different expression patterns were classified, as shown in the hierarchical cluster analysis, using Pearson's correlation coefficient and stringent criteria to select only those genes that showed at least twice the difference in expression between groups. A total of 418 genes with a significantly increased or decreased expression in the cartilage-induced group were identified, compared to the 0-day culture group and the 10-day culture group. More specifically, it was confirmed that 128 genes had increased expression patterns in the group in which cartilage was induced, and 290 genes had decreased expression. When the change in expression pattern was classified on the basis of similarity, it was classified into 6 cluster groups (FIG. 6). In order to elucidate the genes of fractional expression, gene expression patterns appearing only in the group in which cartilage was induced for 10 days were analyzed, and information of genes was collected using the provided algorithm. The top 20 genes are shown in Table 10 below:

Top 20 genes with increased expression in the cartilage-induced group Probe Set ID Genetic symbol Gene description Change in expression rate 8092169 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 14.9 8095886 CXCL13 chemokine (C-X-C motif) ligand 13 13.8 8107722 MEGF10 multiple EGF-like-domains 10 11.5 8113666 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 10.9 7924461 --- --- 10.7 8102232 LEF1 lymphoid enhancer-binding factor 1 10.4 8129082 COL10A1 collagen, type X, alpha 1 9.1 8095043 RASL11B RAS-like, family 11, member B 8.9 7952785 OPCML opioid binding protein / cell adhesion molecule-like 8 7916654 KANK4 KN motif and ankyrin repeat domains 4 7.3 8055969 ERMN ermin, ERM-like protein 7.3 8155754 MAMDC2 MAM domain containing 2 7.3 8020779 DSG2 desmoglein 2 6.7 8119974 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 6.6 8079931 SLC38A3 solute carrier family 38, member 3 6.2 7916667 --- --- 5.6 7947184 --- --- 5.5 8067233 PMEPA1 prostate transmembrane protein, androgen induced 1 5.3 8063634 MGC4294 hypothetical protein MGC4294 4.8 8054439 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 4.7

3. LEF -One( Lymphoid Enhancer Binding Factor  1) plays a very important role in the process of cartilage formation.

The inventors have identified the presence of individual genes in 418 genes found by early high-efficiency screening that can affect the overall process of cartilage formation. Among the genes analyzed, c-Jun, FOXO4 and LEF-1 were distinguished to play a more important role in various developmental processes in Wnt signaling. The present inventors performed quantitative real-time PCR to confirm that the experimental results on the expression patterns of the analyzed genes are consistent with the microarray data, and as a result, the data of the two experiments were found to be in perfect agreement (FIGS. 5B-F). ).

Based on previous studies reporting on the important role of Wnt signaling in cartilage formation of mesenchymal stem cells, we studied WF mediators, focusing on LEF-1, a mediator of β-catenin signaling. As a result of the microarray data, LEF-1 was found to be 10.4 times higher in the 10-day cartilage forming group than the 10-day control group, which was the sixth highest among 418 genes. The present inventors extracted RNA samples of three donors according to various dates of cartilage formation in order to confirm the expression profile of various LEF-1 in the process of cartilage formation, and confirmed the expression pattern using real-time PCR (Fig. 7).

After confirming the agreement between the microarray data and the quantitative real-time PCR results, the inventors performed an inhibitor experiment to elucidate the specific role of LEF-1 during cartilage formation. Human bone marrow stem cells (BMSC, Bone Marrow Stem Cell) cell lines were transformed with siControl or siLEF-1 100 nM, respectively, and cultured in a medium capable of cartilage formation for 10 days. Total RNA was obtained at days 0, 1, 3, 5, 6, 7 and 10 and RT-PCR was performed for potency analysis of LEF-1 in cartilage formation (FIG. 8).

Inhibition of LEF-1 clearly shows that LEF-1 is involved in two processes of cartilage differentiation and maturation. Not only was the expression of Type II Collagen and SOX9 known to be involved in cartilage differentiation decreased, but MMP13 and Type X Collagen related to cartilage maturation were also reduced. This result is consistent with previous findings that LEF-1 plays an important role in the overall process of cartilage at various stages ^(30-37) .

4. Intermediate lobe  During chondrogenesis of stem cells LEF -1 specific target microRNA Navigation in

In the early stages of cartilage formation, we identified specific expression patterns of LEF-1. After identifying the important role of LEF-1 during the whole cartilage of mesenchymal stem cells, LEF-1 expression was regulated. Efforts have been made to identify target micoRNAs that specifically bind -1. Two of the most widely used microRNA prediction databases, TargetScan (www.targetscan.org) and miRanda (www.microRNA.org), were used to search for microRNAs that bind to the 3'UTR of LEF-1. The inventors have cross-identified microRNAs in a list derived from the database, showing a phenomenon opposite to the expression pattern of LEF-1 of the microarray data.

The expression profile of microRNA was observed during cartilage progression. An important point to consider with the expression profile was to determine if miRNA binds directly to the target LEF-1, and if so, how the microRNA regulates target gene expression. To this end, the present inventors have identified five microRNAs showing an expression pattern opposite to LEF-1 in the process of cartilage differentiation. The microRNAs found were miR-138, -411, -449a, -548 and -767, and their microRNA mimics were transformed into human chondroma cell lines SW1353 and JJ to induce overexpression. It was then observed through quantitative real-time PCR how the microRNA affects the expression of LEF-1 inside (Fig. 9). In order to most directly identify the effect of miR-449a on cartilage formation, functional experiments were performed in BMSC cell lines, but the BMSC cell line was transformed with microRNA mimics or antagonists to stably express the transformed substances for a sufficient time. Transformation to induction was quite difficult. Therefore, the use of human chondroma cell lines SW1353 and JJ was the best alternative.

Using various microRNA search tools, the top five candidate microRNAs targeting LEF-1 were tested among the microRNAs showing expression profiles opposite to LEF-1 in microarray data and RT-PCR data, of which only miR- Only 449a effectively reduced the intracellular expression of LEF-1 in human chondrosarcoma cell lines SW1353 and JJ. In particular, when LEF-1 was overexpressed, miR449-a reduced the expression of LEF-1 by more than 70%.

5. miR -449a is LEF -1 of 3 UTR Directly through LEF -1 Targeting  do.

Initial screening methods revealed that miR-449a is a regulatory candidate for LEF-1, and the present inventors have identified the antagomir of miR-449a in the chondrosarcoma cell lines SW1353 and JJ to elucidate the miR-449a function for LEF-1. ) And mimic were transformed. 24 hours after transformation, LEF-1 showed a statistically significant decrease in the presence of miR-499a, and LEF-1 increased in the presence of anti-miR-a499a (FIG. 10).

To confirm sequencing specific regulation of miR-449a for LEF-1, LEF-1 3′UTR was cloned into pGL3 control vectors (FIGS. 11A and 11B). Transformation of miR-449a into the HeLa cell line reduced luciferase function by about 70% (FIG. 11C). In addition, luciferase function decreased concentration dependent of miR-449a targeting LEF-1 (FIG. 11D). According to the experimental results, the miR-449 and LEF-1 3'UTR seed sequences can be accurately known. Various constructs of LEF-1 3′UTR, including constructs with mutations specific for sites predicted by the miR-449a seed sequence, were generated and analyzed by reporter (FIG. 12A). Experiments in HeLa and JJ cell lines showed that miR-449a mimic transfetion reduced luciferase function by about 50% and 60% in constructs containing LEF-1 3'UTR and constructs flanking the seed sequence of miR-449a. (FIGS. 12B and 12C). In addition, when the miR449a binding predictor site of the 3'UTR of LEF-1 was mutated, the luciferase function of the construct was completely restored, thereby confirming that the miR-449a seed sequence was correctly predicted.

Review

According to previous studies, Wnt signaling and LEF-1 play an important role in the overall process of cartilage formation (FIG. 12) ³⁰ . Wnt4 and Wnt9a showed high expression during joint development, while Wnt7a and Wnt8a were found during cartilage development. Wnt5a and Wnt11 were found to be expressed in the chondrocytes, whereas Wnt5b was only observed in pre-hypertrophic chondrocytes. Wnt members, such as Wnt4, Wnt8 and Wnt11, inhibit cartilage differentiation and promote cartilage hypertrophy, while other Wnt members, such as Wnt3a, Wnt5a, and Wnt5b, have been shown to enhance cartilage formation. ^{31 -36, 38} .

Other studies have reported an increase in Wnt3a by treatment with chondro-stimulatory factor (BMP-2) in high concentration cultures of C3H10T1 / 2 cells ³⁰ . In addition, overexpression of Wnt3a and GSK-3β resulted in a notable increase in LEF-1 and β-catenin in the nucleus, indicating that LEF-1 and β-catenin are actively interacting with BMP-2 during cartilage. ³¹ . Consequently, these findings show that Wnt members such as Wnt3a play an important role in the cartilage process and are made through reported β-catenin / LEF-1 interactions.

Fumiko Yano 's study is consistent with reports that overexpression of LEF-1 induces the expression of the chondrogenic marker gene SOX9 in C3H10T1 / 2, ATDC5 and primary chondrocyte lines ³⁷ . However, the persistent presence of LEF-1 using the always active LEF-1 overexpression vector caused mesenchymal stem cells to rapidly enter the hypertrophy phase ⁴¹ . According to Tamamura 's study, overexpression of transformed LEF-1 by the Type II Collagen promoter resulted in rather incomplete maturation of chondrocytes and overexpression of mutated β-catenin in chicken embryos inhibited cartilage development and hypertrophy. . These results suggest that normal Wnt signaling affects cartilage differentiation and hypertrophy at different stages of development ⁴² .

As a result, previous studies have shown that LEF-1 plays an important role in the proper stages of cartilage formation and plays an important role in the initiation and control of cartilage hypertrophy, as well as in the early stages of cartilage formation of mesenchymal stem cells. Shows. At the same time, the present inventors showed an increase in expression of the LEF-1 gene during chondrogenesis of mesenchymal stem cells through data confirmed using high-efficiency search through microarray and RT-PCR and quantitative real-time PCR.

To identify potential target microRNAs of LEF-1, we used widely used target prediction databases (TargetScan and miRanda) and identified miR-449a as a modulator of LEF-1 expression. Tested in two cartilage sarcoma cell lines (SW1353 and JJ), miR-449a significantly reduced the expression of LEF1 and transformed the antagonists of miR-449a to inhibit miR-499a, resulting in expression of LEF-1. This recovery was observed again (FIG. 10). Furthermore, co-transformation of miR-449a mimic and pGL3-LEF-1 constructs confirmed the regulation of miR-449a of LEF-1 by observing a concentration-dependent decrease in luciferase function (FIG. 11). As a result, the mutation of the miR-449a binding predictor site successfully confirmed the correct sequence of mi-449a for LEF-1, suggesting that miR-449a is a negative regulator of LEF-1 (Fig. 12).

In summary, this study suggests that a) LEF-1 is an important factor involved in the proper differentiation and maturation of cartilage in human BMSCs, as previously reported, and b) miR-449a is involved in the 3'UTR of LEF-1. It was successfully identified that it directly binds to effectively inhibit the expression of LEF-1 (FIG. 13).

Ultimately, this study confirmed that LEF-1 plays an important role not only in cartilage formation but also in a variety of biological processes, from tumor formation and development, to fully experimental identification of internal microRNAs targeting LEF-1. It must be a discovery that can be a big foundation for human physiology.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

References

Friedenstein AJ. Marrow stromal fibroblasts. Calcif Tissue Int 1995; 56 Suppl 1: S17.

2.Beyer Nardi N, da Silva Meirelles L. Mesenchymal stem cells: isolation, in vitro expansion and characterization. Handb Exp Pharmacol 2006: 249-82.

3. Delorme B, Charbord P. Culture and characterization of human bone marrow mesenchymal stem cells. Methods Mol Med 2007; 140: 67-81.

4. Javazon EH, Beggs KJ, Flake AW. Mesenchymal stem cells: paradoxes of passaging. Exp Hematol 2004; 32: 414-25.

5.Martin DR, Cox NR, Hathcock TL, Niemeyer GP, Baker HJ. Isolation and characterization of multipotential mesenchymal stem cells from feline bone marrow. Exp Hematol 2002; 30: 879-86.

6. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999; 284: 143-7.

7. Frith JE, Thomson B, Genever PG. Dynamic three-dimensional culture methods enhance mesenchymal stem cell properties and increase therapeutic potential. Tissue Eng Part C Methods 2010; 16: 735-49.

8. Clevers H. Wnt / beta-catenin signaling in development and disease. Cell 2006; 127: 469-80.

9. Miller JR. The Wnts. Genome Biol 2002; 3: REVIEWS 3001.

10. Hutvagner G, Zamore PD. A microRNA in a multiple-turnover RNAi enzyme complex. Science 2002; 297: 2056-60.

11.Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP. Vertebrate microRNA genes. Science 2003; 299: 1540.

12. Chen Y, Stallings RL. Differential patterns of microRNA expression in neuroblastoma are correlated with prognosis, differentiation, and apoptosis. Cancer Res 2007; 67: 976-83.

13. Thompson BJ, Cohen SM. The Hippo pathway regulates the bantam microRNA to control cell proliferation and apoptosis in Drosophila. Cell 2006; 126: 767-74.

14. Wu H, Neilson JR, Kumar P, Manocha M, Shankar P, Sharp PA, et al. miRNA profiling of naive, effector and memory CD8 T cells. PLoS One 2007; 2: e1020.

15. Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, et al. A pancreatic islet-specific microRNA regulates insulin secretion. Nature 2004; 432: 226-30.

16. Mello CC, Czech MP. Micromanaging insulin secretion. Nat Med 2004; 10: 1297-8.

17. Harris TA, Yamakuchi M, Ferlito M, Mendell JT, Lowenstein CJ. MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1.Proc Natl Acad Sci U S A 2008; 105: 1516-21.

18. Johnston RJ, Hobert O. A microRNA controlling left / right neuronal asymmetry in Caenorhabditis elegans. Nature 2003; 426: 845-9.

19. Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, et al. MicroRNA expression in zebrafish embryonic development. Science 2005; 309: 310-1.

20.Sokol NS, Ambros V. Mesodermally expressed Drosophila microRNA-1 is regulated by Twist and is required in muscles during larval growth. Genes Dev 2005; 19: 2343-54.

21.Huang TH, Zhu MJ, Li XY, Zhao SH. Discovery of porcine microRNAs and profiling from skeletal muscle tissues during development. PLoS One 2008; 3: e3225.

22. Woltering JM, Durston AJ. MiR-10 represses HoxB1a and HoxB3a in zebrafish. PLoS One 2008; 3: e1396.

23. Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, et al. The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages. PLoS One 2008; 3: e2997.

24. Morton SU, Scherz PJ, Cordes KR, Ivey KN, Stainier DY, Srivastava D. microRNA-138 modulates cardiac patterning during embryonic development. Proc Natl Acad Sci U S A 2008; 105: 17830-5.

25. Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, Zamore PD. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 2001; 293: 834-8.

26. Aukerman MJ, Sakai H. Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell 2003; 15: 2730-41.

27. Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A, et al. microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci U S A 2006; 103: 9136-41.

28. Ohgawara T, Kubota S, Kawaki H, Kondo S, Eguchi T, Kurio N, et al. Regulation of chondrocytic phenotype by micro RNA 18a: involvement of Ccn2 / Ctgf as a major target gene. FEBS Lett 2009; 583: 1006-10.

29. Lin EA, Kong L, Bai XH, Luan Y, Liu CJ. miR-199a, a bone morphogenic protein 2-responsive MicroRNA, regulates chondrogenesis via direct targeting to Smad1. J Biol Chem 2009; 284: 11326-35.

30. Chun JS, Oh H, Yang S, Park M. Wnt signaling in cartilage development and degeneration. BMB Rep 2008; 41: 485-94.

31. Church V, Nohno T, Linker C, Marcelle C, Francis-West P. Wnt regulation of chondrocyte differentiation. J Cell Sci 2002; 115: 4809-18.

32. Enomoto-Iwamoto M, Kitagaki J, Koyama E, Tamamura Y, Wu C, Kanatani N, et al. The Wnt antagonist Frzb-1 regulates chondrocyte maturation and long bone development during limb skeletogenesis. Dev Biol 2002; 251: 142-56.

33. Hartmann C, Tabin CJ. Wnt-14 plays a pivotal role in inducing synovial joint formation in the developing appendicular skeleton. Cell 2001; 104: 341-51.

34.Kawakami Y, Wada N, Nishimatsu SI, Ishikawa T, Noji S, Nohno T. Involvement of Wnt-5a in chondrogenic pattern formation in the chick limb bud. Dev Growth Differ 1999; 41: 29-40.

35.Lako M, Lindsay S, Bullen P, Wilson DI, Robson SC, Strachan T. A novel mammalian wnt gene, WNT8B, shows brain-restricted expression in early development, with sharply delimited expression boundaries in the developing forebrain. Hum Mol Genet 1998; 7: 813-22.

36.Rudnicki JA, Brown AM. Inhibition of chondrogenesis by Wnt gene expression in vivo and in vitro. Dev Biol 1997; 185: 104-18.

37. Yano F, Kugimiya F, Ohba S, Ikeda T, Chikuda H, Ogasawara T, et al. The canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner. Biochem Biophys Res Commun 2005; 333: 1300-8.

38. Hartmann C, Tabin CJ. Dual roles of Wnt signaling during chondrogenesis in the chicken limb. Development 2000; 127: 3141-59.

39. Fischer L, Boland G, Tuan RS. Wnt-3A enhances bone morphogenetic protein-2-mediated chondrogenesis of murine C3H10T1 / 2 mesenchymal cells. J Biol Chem 2002; 277: 30870-8.

40. Fischer L, Boland G, Tuan RS. Wnt signaling during BMP-2 stimulation of mesenchymal chondrogenesis. J Cell Biochem 2002; 84: 816-31.

41. Nagayama M, Iwamoto M, Hargett A, Kamiya N, Tamamura Y, Young B, et al. Wnt / beta-catenin signaling regulates cranial base development and growth. J Dent Res 2008; 87: 244-9.

42. Tamamura Y, Otani T, Kanatani N, Koyama E, Kitagaki J, Komori T, et al. Developmental regulation of Wnt / beta-catenin signals is required for growth plate assembly, cartilage integrity, and endochondral ossification. J Biol Chem 2005; 280: 19185-95.

Attach an electronic file to a sequence list

Claims (20)

Composition for promoting chondrocyte differentiation from stem cells comprising an antisense oligonucleotide having a sequence complementary to microRNA-449a of SEQ ID NO: 1 sequence.
The composition of claim 1, wherein the antisense oligonucleotide has a sequence complementary to the 1st to 22nd nucleotide sequences of the first sequence of the Sequence Listing.
The composition of claim 2, wherein the antisense oligonucleotide has a nucleotide sequence of SEQ ID NO: 2.
The composition of claim 1, wherein the stem cells are multipotent stem cells.
The method of claim 4, wherein the pluripotent stem cells are mesenchymal stem cells, muscle stem cells, hematopoietic stem cells, neural stem cells, liver stem cells, pancreatic stem cells, endothelial stem cells or epidermal stem cells, characterized in that Composition.
The composition of claim 5, wherein the pluripotent stem cells are mesenchymal stem cells.
The composition of claim 6, wherein the mesenchymal stem cells are bone marrow-derived mesenchymal stem cells.
A pharmaceutical composition for treating cartilage damage, comprising the composition for promoting cartilage differentiation according to any one of claims 1 to 7.
A method of differentiating chondrocytes from stem cells comprising inducing differentiation from stem cells transformed with antisense oligonucleotides having a sequence complementary to microRNA-449a of SEQ ID NO: 1 to chondrocytes.
10. The method of claim 9, wherein inducing differentiation is performed by increasing expression of Lymphoid Enhancer Binding Factor 1 (LEF-1) by the antisense oligonucleotide.
10. The method of claim 9, wherein the antisense oligonucleotide is characterized in that it has a sequence complementary to the 1 to 22 nucleotide sequence of SEQ ID NO: 1 sequence.
The method of claim 11, wherein the antisense oligonucleotide is characterized in that it has a nucleotide sequence of SEQ ID NO: 2 sequence.
The method of claim 9, wherein the stem cells are multipotent stem cells.
The method of claim 13, wherein the pluripotent stem cells are mesenchymal stem cells, muscle stem cells, hematopoietic stem cells, neural stem cells, liver stem cells, pancreatic stem cells, endothelial stem cells or epidermal stem cells, characterized in that Way.
The method of claim 14, wherein the pluripotent stem cells are mesenchymal stem cells.
16. The method of claim 15, wherein said mesenchymal stem cells are bone marrow-derived mesenchymal stem cells.
delete delete delete delete

Images