JP5575463B2 - Antibody binding protein and method for producing the same - Google Patents

Description

  The present invention relates to a protein having a high binding affinity for a human antibody and a method for producing the protein using a genetic engineering technique.

Fc receptors are a group of protein molecules that bind to the Fc region of immunoglobulin molecules. Individual molecular species recognize a single or the same group of immunoglobulin isotypes by a binding domain on the Fc receptor by an Fc recognition domain belonging to the immunoglobulin superfamily. This determines which accessory cells are mobilized in a certain immune response (Non-Patent Document 1). Fc receptors can be further classified into subtypes, and the presence of FcγRI, FcγRIIa, FcγRIIb, and FcγRIII has been reported as a receptor for IgG (immunoglobulin G) (Non-patent Document 1). Among these, the binding affinity between FcγRI and IgG is high, and the equilibrium dissociation constant (K _D ) is 10 ⁻⁸ M or less (Non-patent Document 2). FcγRI is a receptor for IgG (immunoglobulin G) and is constitutively expressed on monocytes and macrophages and inducibly expressed on neutrophils and eosinophils. FcγRI is divided into an extracellular region, a transmembrane region, and an intracytoplasmic region, and binding to IgG occurs in the IgG molecule Fc region and the extracellular region of FcγRI, and then a signal is transmitted to the cytoplasm. FcγRI is composed of two types of subunits, α chain and γ chain that are directly involved in binding to IgG, and γ chain forms a homodimer by covalent bond via amino acid cysteine at the boundary between cell membrane and extracellular region. (Non-Patent Document 1).

  In recent years, the unexpected immunosuppressive biological properties of Fc receptors have been attracting attention as pharmaceuticals, particularly in the areas of autoimmune disease or autoimmune syndrome, transplant rejection and malignant lymphoproliferation (non- Patent Document 2).

  The amino acid sequence and gene base sequence of the human Fc receptor FcγRIα chain have been clarified by Non-patent Document 3, and then expression using E. coli (Patent Document 1) or animal cells has been reported by genetic recombination technology (Non-patent document 3). Patent Document 4).

Japanese translation of PCT publication No. 2002-531086

J. et al. V. Ravetch et al., Annu. Rev. Immunol. , 9, 457, 1991 Toshiyuki Takai, Jpn. J. et al. Clin. Immunol. , 28, 318, 2005 J. et al. M.M. Allen et al., Science, 243, 378, 1989 A. Paetz et al., Biochem. Biophys. Res. Commun. , 338, 1811, 2005 Yasukawa K .; J. et al. Biochem. , 108, 673, 1990

As described above, although the binding affinity of the human Fc receptor FcγRI to the IgG molecule Fc region is as high as 10 ⁻⁸ M or less as an equilibrium dissociation constant (K _D ), in order to capture and quantify IgG molecules contained in blood Needed to further improve antibody binding per molecule. Therefore, an object of the present invention is to provide a protein having improved binding affinity for a human IgG antibody and a method for producing the protein.

The present invention made in view of the above problems includes the following inventions:
(1) Among the human Fc receptor FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 2, the signal of human Fc receptor FcγRI is located on the N-terminal side of the polypeptide consisting of the entire antibody binding domain in the extracellular region or almost the entire sequence. Protein with added peptide.

  (2) Of the human Fc receptor FcγRI consisting of the amino acid sequence set forth in SEQ ID NO: 2, the entire sequence of the antibody binding domain in the extracellular region, or the N-terminal side of a polypeptide in which a plurality of polypeptides consisting of the entire sequence are linked, Protein added with signal peptide of human Fc receptor FcγRI.

  (3) A protein comprising the amino acid sequence set forth in SEQ ID NO: 6 or 8.

  (4) A polynucleotide encoding the protein according to any one of (1) to (3).

  (5) An expression vector comprising the polynucleotide according to (4).

  (6) A transformant obtained by transforming a host with the vector according to (5).

  (7) A method for producing a protein using the transformant according to (6).

  Hereinafter, the present invention will be described in detail.

1. Protein of the present invention As shown in FIG. 1, the human Fc receptor FcγRI protein is a signal peptide region consisting of 15 amino acids from the N-terminal side (SS, from −15 to −1 of the amino acid sequence described in SEQ ID NO: 2). Region) 277 amino acid extracellular region (EC, region 1 to 277 of the amino acid sequence described in SEQ ID NO: 2), 21 amino acid transmembrane region (TM, amino acid sequence of SEQ ID NO: 2 Among them, the region from the 278th to the 298th), an intracellular region of 61 amino acids (C, the region from the 299th to the 359th in the amino acid sequence described in SEQ ID NO: 2). Among these, the region having binding properties with the IgG molecule Fc region is an extracellular region, particularly an antibody binding domain (BR, 80th to 179th of the amino acid sequence described in SEQ ID NO: 2), and in this region IgG antibody is directly captured.

  In the protein of the present invention, the polypeptide consisting of the entire sequence of the antibody binding domain of the human FcγRI extracellular region is the 80th to 179th amino acids of the amino acid sequence described in SEQ ID NO: 2 (the amino acid sequence described in SEQ ID NO: 4). ), And the polypeptide consisting of almost the entire sequence of the antibody binding domain in the extracellular region is a polypeptide consisting of the 80th to 179th amino acids of the amino acid sequence set forth in SEQ ID NO: 2. A polypeptide in which 1 to 10 amino acids are added and / or deleted on the N-terminal side and / or C-terminal side.

  In the protein of the present invention, the total number of antibody binding domains in the human FcγRI extracellular region or the number of polypeptide linkages consisting almost of the entire sequence can be linked as long as the antibody binding activity is not impaired. Since handling will become difficult when 100,000 is exceeded, 2 to 10 is preferable. In addition, when linking polypeptides comprising the entire or almost entire sequence of the antibody binding domain of the human FcγRI extracellular region, the polypeptides may be directly linked to each other, or the antibody affinity for the IgG molecule Fc region A linker peptide may be inserted as appropriate within a range that is sexable and soluble enough to be secreted outside the cell.

  As one aspect of the protein of the present invention, a signal peptide region of 15 amino acids from the N-terminal side (regions from -15 to -1 of the amino acid sequence described in SEQ ID NO: 2), linking region (6 amino acids), cell The protein described in SEQ ID NO: 6 consisting of the antibody binding domain of the outer region (amino acid described in SEQ ID NO: 4) can be mentioned.

  As another aspect of the protein of the present invention, a signal peptide region of 15 amino acids from the N-terminal side (region from -15 to -1 of the amino acid sequence described in SEQ ID NO: 2), linking region (6 amino acids), It consists of the antibody binding domain of the first extracellular region (amino acid described in SEQ ID NO: 4), the linking region (2 amino acids), and the antibody binding domain of the second extracellular region (amino acid described in SEQ ID NO: 4). And the protein described in SEQ ID NO: 8.

2. Polynucleotide encoding the protein of the present invention The polynucleotide encoding the protein of the present invention is the entire sequence or almost the entire sequence of the antibody binding domain in the extracellular region of the human Fc receptor FcγRI consisting of the amino acid sequence set forth in SEQ ID NO: 2. A protein in which a signal peptide of human Fc receptor FcγRI is added to the N-terminal side of a polypeptide comprising, or the entire sequence of the antibody binding domain in the extracellular region of human Fc receptor FcγRI consisting of the amino acid sequence of SEQ ID NO: 2 or This refers to a polynucleotide encoding a protein in which a signal peptide of human Fc receptor FcγRI is added to the N-terminal side of a polypeptide in which a plurality of polypeptides each having a substantially entire sequence are linked. When the protein of the present invention is produced using genetic recombination technology, it is preferable to convert the amino acid sequence of the protein into a nucleotide sequence in consideration of the frequency of codon usage in the recombination target host cell. . For example, when using Brevibacterium choshinensis as a host, conversion to TCA for serine (Ser), CTA for leucine (Leu), CGG / AGA / AGG for arginine (Arg), and ATA for isoleucine (Ile) is avoided. (See Japanese Patent Application No. 2008-046438).

  As one embodiment of the polynucleotide encoding the protein of the present invention, the polynucleotide of SEQ ID NO: 5 converted from the amino acid sequence of SEQ ID NO: 6 to the nucleotide sequence, and the amino acid sequence of SEQ ID NO: 8 to the nucleotide sequence And the polynucleotide described in SEQ ID NO: 7.

3. Protein Production Method of the Present Invention As a method for producing the protein of the present invention, a polypeptide containing an antibody binding domain in the extracellular region is obtained from human Fc receptor FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 2 using an appropriate reagent. A method of preparing and producing the peptides directly or by peptide bonding via a linker, and a method of designing a polynucleotide encoding the protein of the present invention and producing the same from the polynucleotide using a genetic engineering technique. However, the latter production method is preferable in that the protein of the present invention can be produced easily and in large quantities. Hereinafter, the latter manufacturing method will be described in detail.

As a method for obtaining a polynucleotide encoding the protein of the present invention necessary for producing the protein of the present invention by genetic engineering techniques,
(1) A method of converting an amino acid sequence of a target protein of the present invention into a nucleotide sequence and artificially synthesizing and obtaining a polynucleotide containing the nucleotide sequence,
(2) Human FcγRI extracellular region of the antibody binding domain (nucleotide sequence shown in SEQ ID NO: 3), or a polynucleotide consisting of almost the entire sequence, PCR method from human FcγRI cDNA or the like directly A method of preparing by using a DNA amplification method and ligating and obtaining the prepared polynucleotide by an appropriate method;
Can be illustrated.

  In the case of obtaining by the method of (1), when converting from an amino acid sequence to a nucleotide sequence, it is preferable to convert in consideration of the codon usage in the recombination target host cell as described above. In the case of obtaining by the method of (2), when preparing a polynucleotide consisting of the entire sequence of human FcγRI extracellular domain or artificially directly from the nucleotide sequence of human FcγRI described in SEQ ID NO: 1, Considering the frequency of codon usage in the host cell to be recombined, if it is a low-frequency codon, so-called rare codon, it is preferable to prepare it after converting it to a high-frequency codon in advance. 2008-046438).

  In addition, in the case of obtaining a polynucleotide encoding the protein of the present invention by any of the methods (1) and (2), a polypeptide consisting of the entire antibody binding domain in the extracellular region of human FcγRI extracellular region or a substantially entire sequence is used. A restriction enzyme recognition sequence for linking an expression vector to the polynucleotides to be encoded, or a tag sequence for enabling easy purification and quantification of the expressed antibody binding domain of human FcγRI is added. May be. As the restriction enzyme recognition sequence to be added, an appropriate sequence may be selected in consideration of the polynucleotide sequence of the vector and the DNA fragment to be ligated. Examples of the tag sequence to be added include nucleotide sequences encoding oligopeptides such as polyhistidine tags and c-myc tags, which are frequently used in genetic engineering. Further, the tag sequence may be added to the 5 'end side of the polynucleotide or may be added to the 3' end side.

  The expression vector used for producing the protein of the present invention using genetic engineering techniques includes a polynucleotide encoding the protein of the present invention, a polynucleotide for expressing the polynucleotide, and an expression vector in a host. As long as it has an origin of replication for replicating and can transform a selected host, it can be selected and used as appropriate, but an expression plasmid that is easy to handle is usually used. Examples of the polynucleotide for expressing the polynucleotide encoding the protein of the present invention include polynucleotides derived from a lactose promoter system, a tryptophan promoter system, a GAL4 promoter system, an SV40 promoter system, and an adenovirus promoter system. However, when the host is a cell such as a COS cell or a CHO cell, a polynucleotide derived from the SV40 promoter system is preferred as the promoter system. In addition, in order to enable selection between a host into which an expression vector has not been introduced and a host into which an expression vector has not been introduced during the transformation using the expression vector, the host is given resistance to drugs such as ampicillin. It is preferable that a polynucleotide (drug resistance gene) is included.

  Examples of the host used for producing the protein of the present invention using genetic engineering techniques include COS cells and CHO cells (Chinese hamster ovary cells) capable of stably expressing the protein. In addition, by introducing an expression plasmid containing a polynucleotide encoding the protein of the present invention into the cell and further imparting resistance to a specific drug, screening the cell from the strength of drug resistance Thus, cells that highly express the protein of the present invention can be obtained. In the screening, the drug is preferably methotrexate (MTX), and the tolerance concentration is preferably several μM or more. As a method for imparting resistance to MTX, a dihydrofolate reductase gene (dhfr) may be contained in an expression plasmid containing a polynucleotide encoding the protein of the present invention.

  Since the protein of the present invention is composed of an antibody binding domain in the extracellular region, it can be separated and purified from the culture solution or culture supernatant used for production by a normal physiologically active protein recovery method. Examples of the separation and purification method include commercially available HPLC and column chromatography. In addition, the aforementioned protein separation and recovery efficiency can be increased by reducing other proteins in the culture medium using a culture-free serum medium.

  Among the human Fc receptor FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 2, the protein of the present invention has a human Fc receptor on the N-terminal side of a polypeptide consisting of the entire antibody binding domain in the extracellular region or a substantially entire sequence. It is characterized by the addition of a signal peptide of FcγRI, and has antibody binding properties like human FcγRI described in SEQ ID NO: 2. This has great significance in the study of ontogeny and immune function, and the development of therapeutic diagnostic agents based on these research results. It can also be used as an immunogen for preparing anti-FcγRI antibodies and as a standard substance for FcγRI immunochemical measurement methods.

  In addition, the protein of the present invention can be obtained by using a suitable chromatography carrier (for example, His / Bind Resin gel (manufactured by Novagen), HisTrap NHS-Activated HP (manufactured by GE Healthcare Bioscience), tresyl group activated dynabeads (Dynal). The product can also be used as an adsorbent for purifying antibodies such as human monoclonal antibodies.

  In addition, the protein of the present invention can reduce the molecular weight as compared with human FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 2 while having affinity for IgG antibody. Therefore, among the human Fc receptor FcγRI consisting of the amino acid sequence set forth in SEQ ID NO: 2, which is another embodiment of the protein of the present invention, a plurality of polypeptides consisting of the entire antibody binding domain in the extracellular region or almost the entire sequence are included. In a protein in which the signal peptide of human Fc receptor FcγRI is added to the N-terminal side of the linked polypeptide, the number of linked polypeptides consisting of the entire antibody binding domain in the extracellular region or the entire sequence can be increased. It is possible to further improve the binding affinity for IgG antibodies.

  Furthermore, the polynucleotide encoding the protein of the present invention is linked to an appropriate expression vector, and the protein of the present invention is produced using a transformant obtained by transforming this vector into a host cell. Proteins with high binding affinity for antibodies can be produced easily and in large quantities.

It is a figure which shows the structure of soluble FcγRI which is an extracellular region of human Fc receptor FcγRI, and an antibody binding domain. SS is a signal peptide, EC is an extracellular region, TM is a transmembrane region, C is a region encoding an intracytoplasmic region, and BR is an antibody binding domain. The numbers at the top of the figure indicate the number of amino acids encoding the nucleotides in each region. It is a figure which shows the gene map of plasmid pECEFcB1dhfr. It is a figure which shows the gene map of plasmid pECEFcB2dhfr. It is a figure which shows the ELISA measurement result of the protein solution containing one antibody binding domain of the human FcγRI extracellular region prepared from the culture supernatant of COS7 cells transformed with the plasmid pECEFcB1dhfr. It is a figure which shows the ELISA measurement result of the protein solution containing one antibody binding domain of the human FcγRI extracellular region prepared from the culture supernatant of COS7 cells transformed with the plasmid pECEFcB1dhfr. It is a figure which shows the measurement result of the antibody binding activity of the protein solution which connected two antibody binding domains of the human FcγRI extracellular region prepared from the culture supernatant of COS7 cells transformed with the plasmid pECEFcB2dhfr.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated further in detail, this invention is not limited to these.

Example 1 Preparation of Expression Plasmid (Part 1)
A plasmid capable of expressing a protein containing an antibody binding domain in the extracellular region of the human Fc receptor FcγRI was prepared by the following method.
(1) A polynucleotide encoding a protein containing an antibody binding domain in the extracellular region of human FcγRI was prepared by the following method.
(1-1) Human cDNA clone SC119841 plasmid (manufactured by Origen) as a template, SEQ ID NO: 9 (5′-CCCATACAGCTGGAAATCCACAGAGGC-3 ′, corresponding to the bases 283 to 309 of SEQ ID NO: 1) and SEQ ID NO: 10 (5 '-GC [TCTAGA] TCAGTGGTGGGTGGTGGGTGTG [ACTAGT] AGTGACAGATATCTCCGCTGATGTG-3': the brackets are the recognition sequences of the restriction enzymes XbaI and SpeI, and the 36th to 60th bases are complementary to the 528th to 552th bases of SEQ ID NO: 1. Equivalent) oligonucleotides were used as PCR primers. In order to prepare and quantify human FcγRI, PCR primers were designed so that a polyhistidine tag was added to the C-terminal side of the protein to be expressed.
(1-2) After the heat treatment at 94 ° C for 5 minutes, the PCR reaction is 25 cycles of the first step at 94 ° C for 30 seconds, the second step at 65 ° C for 30 seconds, and the third step at 72 ° C for 1 minute. Finally, the test was performed at 72 ° C. for 7 minutes. The reaction solution composition is shown in Table 1.

(1-3) After the PCR reaction, a band corresponding to the designed size was confirmed by 2% agarose electrophoresis.
(1-4) A band corresponding to a target product was extracted from an agarose gel (QIAquick Gel extraction kit (trade name) manufactured by Qiagen) to prepare a polynucleotide encoding a protein containing an antibody binding domain of human FcγRI.
(2) The polynucleotide encoding the signal peptide region of human FcγRI was ligated to the polynucleotide prepared in (1) by the following method.
(2-1) The polynucleotide prepared in (1) and SEQ ID NO: 11 (5′-GA [AGATCT] ATGTGGTTTCTTGACAACTCTGCTCCTTTGGGTTCAGTTGATGGGCAAGTGGACACCCAAAAGCCCATACAGCTGGGAATCCACAGAGG-3 ′: restriction bracket 9 (Equivalent to the 1st to 63rd bases of No. 1) with an equimolar amount, and PCR was performed under the conditions described in (1-2) with the number of cycles changed to 5 times. Nucleotides were ligated. The oligonucleotide of SEQ ID NO: 11 is designed such that a polynucleotide encoding a signal peptide region of human FcγRI is added to the 5 ′ end side, and the 3 ′ end side is a polynucleotide encoding the N terminal side of the antibody binding domain. did.
(2-2) Using the PCR reaction solution of (2-1) as a template, SEQ ID NO: 10 and SEQ ID NO: 12 (5′-GA [AGATCT] ATGTGGTTTCTTGACAACTCTGCCTCC-3 ′: the brackets are recognition sequences for the restriction enzyme BglII, 9 The 33rd base from 1 to 25 corresponds to the 1st to 25th bases of SEQ ID NO: 1), except that an oligonucleotide (PCR primer) was used.
(2-3) After completion of PCR, a polynucleotide encoding a protein containing an antibody binding domain linked to a signal peptide region of human FcγRI was prepared by the same method as (1-3) and (1-4).
(3) The polynucleotide prepared in (2) is digested with restriction enzymes BglII and XbaI, and then ligated with the plasmid pECEdhfr (Non-patent Document 5) previously digested with these restriction enzymes (Ligation Kit Ver. 2: Takara Bio). Escherichia coli JM109 strain was transformed using an LB agar medium supplemented with 50 μg / mL antibiotic carbesinillin.
(4) The transformant of (3) was cultured (37 ° C., 18 hours) in an LB medium containing 50 μg / mL of the antibiotic carbesinillin, and a plasmid was extracted with QIAprep Spin Miniprep Kit (trade name, manufactured by Qiagen). .
(5) The extracted plasmid was digested with restriction enzymes BglII and XbaI and subjected to 2% agarose electrophoresis.

  As a result, it was confirmed from the insert size that it was as designed, and this was designated as pECEFcB1dhfr. FIG. 2 shows a schematic structure of pECEFcB1dhfr.

Example 2 Production of Expression Plasmid (Part 2)
In the human Fc receptor FcγRI extracellular region, a plasmid capable of expressing a protein in which two antibody binding domains were linked was prepared by the following method.
(1) A polynucleotide encoding a protein containing the antibody binding domain of human FcγRI was prepared by the following method.
(1-1) Human cDNA clone SC119841 plasmid (manufactured by Origen) as a template, SEQ ID NO: 13 (5'-CG [GCTAGC] CCCATACAGCTGGAAATCCACAGAGGC: brackets are recognition sequences for restriction enzyme NheI, 9th to 35th bases are SEQ ID NO: 1 corresponding to nucleotides 283 to 309) and SEQ ID NO: 14 (5′-GG [ACTAGT] AGTGACAGATATTCCCTCGTGTGTG-3 ′: brackets are recognition sequences for restriction enzyme SpeI, and nucleotides 9 to 33 are SEQ ID NO: PCR was carried out in the same manner as in (1-2) of Example 1 except that the oligonucleotide (corresponding to the complementary strand of nucleotides 528 to 552 of No. 1) was used as the PCR primer.
(1-2) The target product was purified by the same method as in (1-3) and (1-4) of Example 1, and a polynucleotide encoding a protein containing the antibody binding domain of human FcγRI was prepared.
(2) From the plasmid pECEFcB1dhfr (FIG. 2) prepared in Example 1 and (3) of Example 1, which was prepared by digesting the polynucleotide prepared in (1) with the restriction enzymes NheI and SpeI and preliminarily digesting with the restriction enzyme SpeI. Ligation was performed in the same manner as in (5), and transformation and plasmid extraction were performed. A fragment digested with restriction enzymes NheI and SpeI can be ligated but cannot be digested again. Using this property, when linking a plurality of polypeptides, the insertion direction of the inserted fragment can be confirmed by digestion with restriction enzymes SpeI and BglII.
(3) The extracted plasmid was digested with restriction enzymes BglII and XbaI, subjected to 2% agarose electrophoresis, and confirmed to be as designed from the insert size. In addition, it is digested with restriction enzymes BglII and SpeI, and subjected to electrophoresis in the same manner. The digested fragment is the same as the digested fragment of restriction enzymes BglII and XbaI, that is, the polynucleotide encoding the protein containing the inserted antibody binding domain is NheI. And SpeI were selected, and a plasmid pECEFcB1dhfr (FIG. 2) having the same orientation as the antibody binding domain DNA sequence was selected.

  As a result, it was confirmed from the insert size and restriction enzyme BglII and SpeI digested fragment length that it was as designed, and this was designated as pECEFcB2dhfr. FIG. 3 shows a schematic structure of pECEFcB2dhfr.

Example 3 Confirmation of the base sequence of the expression plasmid Encoding a protein containing the antibody binding domain of human Fc receptor FcγRI inserted in the plasmids pECEFcBCldhdh (Fig. 2) and pECEFcBB2dhfr (Fig. 3) prepared in Examples 1 and 2 The nucleotide sequence was subjected to a cycle sequence reaction using the Big Dye Terminator v3.1 Cycle Sequencing kit (trade name, manufactured by PE Applied Biosystems) based on the chain terminator method, and a fully automatic DNA sequencer ABI Prism 310 DNA analyzer (PE Apply Bioanalyzer). System)). In the sequence, the inserted sequence was digested with restriction enzymes BglII and XbaI, the DNA ends were blunted using DNA Blunting Kit (manufactured by Takara Bio Inc.), and inserted into a plasmid pUC19 (manufactured by Takara Bio Inc.) which had been treated with SmaI in advance. It was done. As the sequencing primer, the oligonucleotides shown in SEQ ID NO: 15 (5′-CGCCAGGGTTTCCCAGTCACGAC-3 ′) and SEQ ID NO: 16 (5′-GAGCGGATACAAATTTCACACAGGG-3 ′) were used.

  As a result of the analysis, it was confirmed that the base sequences of the DNAs encoding the protein comprising the antibody binding domain of human FcγRI inserted into the plasmids pECEFcB1dhfr and pECEFcB2dhfr were as designed. A nucleotide sequence encoding a protein containing an antibody binding domain of the human FcγRI extracellular region is shown in SEQ ID NO: 5, and a nucleotide sequence encoding a protein in which two domains are linked is shown in SEQ ID NO: 7, respectively.

Example 4 Protein Expression Using COS Cells A protein having one or two antibody binding domains in the extracellular region of the human Fc receptor FcγRI was separated and purified. Specifically, it is as follows.
(1) The plasmids pECEFcB1dhfr (FIG. 2) and pECEFcB2dhfr (FIG. 3) prepared in Examples 1 and 2 were introduced into COS7 cells using lipofectamine (Invitrogen) and D-MEM containing 10% FCS. By culturing in a medium (GIBCO) (37 ° C., 3 days), the protein was transiently expressed extracellularly, and after culturing, the culture solution was recovered.
(2) About 1 L of the culture supernatant was dialyzed against 20 mM acetate buffer (pH 5.2) for desalting.
(3) An adsorption fluidized bed system (manufactured by GE Healthcare Bioscience) equipped with 300 mL of Streamline SP gel (trade name, manufactured by GE Healthcare Bioscience) equilibrated with 20 mM acetate buffer (pH 5.2). After adding and washing with the same buffer, elution was performed with 20 mM phosphate buffer (pH 7.4) containing 10% glycerol and 1M NaCl to prepare a concentrated fraction of protein containing human IgG binding activity.
(4) The HisTrap HS column (trade name, trade name, dialyzed with 20 mM phosphate buffer (pH 7.4) containing 20 mM imidazole and 500 mM NaCl and dialyzed with the concentrated fraction obtained in (3). GE Healthcare Biosciences Inc.), washed, and eluted with 20 mM phosphate buffer (pH 7.4) containing 500 mM imidazole and 500 mM NaCl to obtain a poly-containing antibody binding domain in the human FcγRI extracellular region. A purified preparation of a peptide (about 30 μg) or a protein (about 50 μg) linking two of the peptides was obtained. The protein concentration was quantified using a protein assay kit (manufactured by Bio-Rad) based on the Bradford method using bovine gamma globulin as a standard protein.

Example 5 Evaluation of Antibody Binding Activity of Expressed Protein Using the protein prepared in Example 4, antibody binding activity was evaluated by the ELISA method according to the following method.
(1) Add 100 μL of gamma globulin preparation (manufactured by Chemo-Serum Therapy Laboratories) or 10 μg / mL gamma globulin preparation diluted in stages from 100 μg / mL to 96-well ELISA plate (Nunc) The gamma globulin was immobilized on the solid phase by allowing to stand at 4 ° C. for 18 hours.
(2) After washing with TBS buffer (Tris-HCl buffer (pH 8.0) containing 0.2% (w / v) Tween 20, 150 mM NaCl), blocking operation is performed with Starting Block Blocking Buffers (manufactured by PIERCE). Was done.
(3) After washing with TBS buffer, 100 μL of the prepared culture supernatant purified concentrate was added and reacted with the human gamma globulin immobilized in (1) (30 ° C., 2 hours).
(4) After completion of the reaction of (3), the plate was washed with TBS buffer, and His-probe (H-15) HRP antibody (manufactured by Santa Cruz Biotechnology) was added.
(5) After completion of the reaction of (4), the plate was washed with TBS buffer, TMB Peroxidase Substrate (manufactured by KPL) was added, and the absorbance at 450 nm was measured.

  The evaluation results are shown in FIGS. As shown in FIGS. 4 and 5, antibody binding activity was detected in the purified concentrate of the culture supernatant of COS7 cells transformed with the plasmid pECEFcB1dhfr. That is, a protein comprising a polypeptide comprising an antibody binding domain of the human FcγRI extracellular region is inserted into pECEFcB1dhfr, and a protein comprising a polypeptide comprising an antibody binding domain of the human Fc receptor FcγRI extracellular region is used. It can be obtained and shows that the protein retains the binding activity to the human antibody. Further, as shown in FIG. 6, antibody binding activity was detected in the purified concentrate of the culture supernatant of COS7 cells transformed with the plasmid pECEFcB2dhfr. That is, two polypeptides containing an antibody binding domain of human FcγRI extracellular region are inserted into pECEFcB2dhfr by a polynucleotide encoding a protein linked with two polypeptides containing an antibody binding domain of human FcγRI extracellular region. It shows that a linked protein can be obtained and that the protein retains binding activity to human antibodies.

Claims (7)

Of the human Fc receptor FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 2, the signal peptide of human Fc receptor FcγRI is added to the N-terminal side of the polypeptide consisting of the entire antibody binding domain in the extracellular region or almost the entire sequence Protein. Of the human Fc receptor FcγRI comprising the amino acid sequence set forth in SEQ ID NO: 2, the human Fc receptor is located on the N-terminal side of a polypeptide in which a plurality of polypeptides comprising the entire antibody binding domain in the extracellular region or a substantially entire sequence are linked. A protein to which a signal peptide of FcγRI is added. A protein comprising the amino acid sequence set forth in SEQ ID NO: 6 or 8. A polynucleotide encoding the protein according to any one of claims 1 to 3. An expression vector comprising the polynucleotide according to claim 4. A COS cell or CHO cell obtained by transforming a host with the vector according to claim 5. A method for producing a protein using the COS cell or CHO cell according to claim 6.

Images