WO2010102518A1 - Polymer of fusion proteins - Google Patents

Abstract

The present invention provides a polymer of fusion proteins, in which each fusion protein consists of component A and component B; component A is a single domain antibody; and component B is a polypeptide which polymerizes fusion proteins, which is derived from TNF-alpha, ACRP30, p53, COMP, C4BP or mutants thereof.

Description

 Fusion protein multimer

 The present invention relates to the field of biotechnology, and in particular to a multivalent recombinant antibody. Background technique

 "Targeted therapy" is based on different specific sites of the tumor, and the anti-tumor drug acts in a targeted manner to kill the tumor cells, but has less effect on normal tissues. This is the most ideal treatment mode at present. "Targeted therapy" contains many different strategies, which can be divided into direct and indirect categories.

 A direct strategy is to directly alter the signaling of a tumor-associated or specific protein, either by antibody binding to the antigen or by small molecule drugs. For example, epidermal growth factor receptor (EGFR) and vascular endothelial growth receptor (VEGFR) are closely related to tumor cell proliferation, growth, infiltration, metastasis, etc., and both are present in many tumor cells and tumor vascular endothelial cells. High expression is an ideal target for anti-tumor, and antibodies can be used to bind these targets, thereby inhibiting the growth and metastasis of tumor cells.

 An indirect strategy is achieved by targeting a tumor-associated egg white expressed on the surface of tumor cells by a fusion protein carrying various effector molecules. Common effector molecules include small molecule drugs, toxins, immunomodulatory molecules, and the like. Since anti-human CD3 antibody has the function of binding and activating CTL, it can utilize its fusion with a targeting antibody to mediate CTL killing of tumor cells.

The smallest antigen recognition binding unit obtained after cloning the heavy chain variable region or the light chain variable region of the antibody is called a single domain antibody. (sdAb, single domain antibody) ₀ The single region antibody may be derived from different species as needed, for example Human, mouse, ''rabbit. Single-region antibodies derived from the variable regions of human antibodies should theoretically be immunogenic in view of clinical use. Usually, since human antibodies bind to heavy chains and light chains in vivo, human single-region antibodies are easy to aggregate when they are present alone. However, anti-aggregation human single-region antibody libraries can be screened by means of phage technology and in vitro heating. A larger library capacity anti-aggregation human single-region antibody library is further obtained by DNA amplification technology (Christ et al, Protein Eng Des Sel, 20, 2007, 413-416). We can screen human single-region antibodies with clinical application value from this library. · In addition to traditional antibodies, single-region antibodies can also be derived from a specific class of antibodies. In the presence of camelids [such as dromedary, camel, llama, alpaca] and cartilage (eg shark), there are naturally occurring antibodies that lack the light chain, of which The camelid family is called the heavy-chain antibody, which is called the Ig-NAR antibody (immunoglobulin-like novel antigen receptor). An antibody consisting of a variable region of a heavy chain antibody or an Ig-NAR consisting of only one heavy chain variable region is called a VHH antibody (variable domain of heavy chain of heavy-chain antibody, VHH) or V-NAR antibody (variable) Domain of lg-NAR ). VHH antibodies and V-NAR antibodies also belong to single-region antibodies.

 Single-region antibodies are the smallest antibodies currently found. Advantages of single-region antibodies include:

 1) The molecular weight is only about 15KD, only one tenth of the size of common antibodies. The small size makes the single-region antibody easy to penetrate into the body tissue when it is applied to the clinic. It is easy to operate when genetically engineering the antibody. At the same time, as the smallest antibody, there are only three complementary determination regions (CDRs), and the library construction process is simpler;

 2) The single-region antibody structure makes it more soluble than other small molecule antibodies, and it is difficult to form aggregates;

3) The structure of the single-region antibody is stable, and it has been confirmed that the VHH antibody is placed at 37 ° C for one week or under high temperature conditions (90 ° C). Area;

 4) Single-region antibodies can be expressed in large amounts in E. coli, which is advantageous for low-cost preparation.

 On the other hand, since a single-region antibody contains only one antigen-recognizing binding unit, its affinity is lower than that of a conventional antibody, which limits its clinical use. Experience in tumor targeting has shown that even high-affinity monovalent binding is rapidly cleared in the blood and is relatively short-lived with the target antigen. Summary of the invention

 It is an object of the present invention to provide a fusion protein multimer which is useful for solving the shortcomings of low affinity of a single region antibody and short binding time to a target antigen.

 The fusion protein multimer fusion fusion protein of the present invention comprises two parts, namely, a single-region antibody, and B is a polypeptide capable of multimerizing the fusion protein, including TNF a, ACRP30, P53, COMP and C4BP. The peptide sequence of the protein and its mutants. Specifically, these polypeptides are selected from the group consisting of AA80-235 of TNF ct, AA16-108 of ACRP30, AA319-360 of P53, AA29-76 of COMP, and C-terminal of C4BP α chain (AA541-597).

The single-region antibody is a melanoma antigen MART-1 antibody, a melanoma antigen gplOO antibody, a CEA-6 antibody, an EGFR antibody or a VEGFR antibody. The fusion protein multimer of the present invention can be produced by: recombining the DNA encoding the A polypeptide with the DNA encoding the B polypeptide to obtain a fusion gene, cloning the gene into an expression vector, introducing the expression vector into a host, and culturing The fusion protein is induced and expressed, and the fusion protein multimer is obtained after separation and purification. In one embodiment of the present invention, the MT1 (anti-MART-1) encoding gene is fused to the COMP polypeptide encoding gene, operably linked to the pVT2 expression vector, and the recombinant expression plasmid MT1COMP is obtained, and the recombinant expression plasmid is obtained. The Escherichia coli was transformed, and after culture and induction expression, the MT1COMP protein pentamer was isolated and purified. Experiments have shown that MT1 as a TCR-like antibody, MT1COMP pentameric protein fused with COMP motif can specifically recognize the MART-1-derived polypeptide ELAGIGILTV presented on the cell surface by HLA-A2, and specifically binds to MART. - The affinity of 1-HLA-A2 complex is more than 10 ⁵ times that of monomer binding; the fusion protein of COMP and single-region antibody is well soluble, 40mg/ml MT1COMP is stored in 50mM Tris, 500mM Nacl, 200mM imidazole, No obvious precipitation was observed within 4 °C for one year.

In another embodiment, the MT1 (anti-MART-1) encoding gene and the anti-CD3 single chain antibody encoding gene are fused to a COMP polypeptide encoding gene, and operably inserted into a PEF-Myc-ER expression vector to obtain a recombinant expression vector PEF- MCC was transiently transfected into 293T cells, and the cells were collected after culture, and then isolated and purified to obtain a bispecific antibody MCC. In vitro killing experiments showed that MCC can mediate non-specific T cell-specific killing of T2 cells expressing MART-1-HLA-A2 complex on the surface. In a similar manner, the present invention obtained the gpa7COMP fusion protein pentamer (the fusion of the single-region antibody gpa7 with CO P AA29-76, anti-gpl00) and the ES1COMP fusion protein pentamer (the single-region antibody ESI and COMP AA29-76 fusion, anti-CEA-6), E2COMP fusion protein pentamer (fusion of single-region antibody E2 with COMP AA29-76, anti-EGFR), V21COMP fusion protein pentamer (single region antibody V21) Fusion with COMP AA29-76, anti-VEGFR), ES1TNF fusion protein trimer (fusion of single-region antibody ES1 with TNF-alpha ΑΑ80-235, anti-CEA-6), E2TNF fusion protein trimer (single region antibody) Ε2 fusion with TNF80-235 of TNF cc, anti-EGFR), ES1 ACRP fusion protein trimer (fusion of single-region antibody ES1 with ACRP30 AA16-108, anti-CEA-6), E2ACRP fusion protein trimer (will Single-zone anti-# ( ^ AA16-108 fusion, anti-EGFR), ES1P53 fusion egg

ES1 and P53 AA319-360 fusion, anti-CEA-6), E2P53 fusion protein tetramer (single region antibody E2 and P53: AA319-360 fusion, anti-EGFR), ES1C4BP fusion protein heptamer (single region) Antibody ES1 was fused to C4BP a chain C-terminal AA541-597, anti-CEA-6), E2C4BP fusion protein heptamer (single region antibody E2 was fused to C4BP a chain C-terminal AA541-597, anti-EGFR). The results showed that the affinity of these multimeric antibodies was significantly improved and the solubility was good.

 The fusion protein multimer of the invention can be successfully expressed in E. coli, and the expression amount is high. Compared with lymphocyte hybridoma technology or eukaryotic expression, the prokaryotic expression preparation engineering antibody technology is relatively simple and the cost is lower; The polypeptide for multimerizing the fusion protein is derived from a human protein, and when the polyclonal antibody is used in clinical practice, there should be no problem of strong immunogenicity; the multimeric antibody of the invention has good solubility and biological activity, and greatly improves The affinity of the antibody protein. The fusion protein multimer of the present invention can be made into various biotechnological products, for example, as a diagnostic reagent, for diagnosis such as melanoma, carrying a therapeutic drug with the protein multimer, for targeted therapy such as melanoma, etc. Wait. : BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the structure of single-region antibody and multi-antibody, MT1S in Figure A, single-region antibody, specifically recognizes the polypeptide from melanoma antigen MART-1 presented by HLA-A2 complex; MT1C0MP, single-region antibody MT1 a pentameric; '_;' gpa7C0MP, a pentameric single-region antibody that specifically recognizes a polypeptide derived from the melanoma antigen gplOO presented by the HLA-A2 complex; E2COMP, a pentameric single-region antibody that specifically recognizes epidermal growth factor MCC, MT1COMP carries a functional molecule against a CD3 single-chain antibody to form a multivalent bispecific antibody; COMPcc, a coiled-coil sequence from a cartilage matrix protein; L, a linker; myc, c-myc tag; H, His ₅ purification label. Panel B is a schematic representation of the structure of different antibodies.

 Figure 2 shows the chromatographic analysis of the purity of MT1COMP.

 Figure 3 shows the protein electrophoresis of MT1COMP under both reducing and non-reducing conditions.

Figure 4 (A) shows a schematic of an enzyme-linked immunosorbent assay (ELISA). Figure 4 (B) ELISA detects the recognition specificity of MT1 COMP, and BBM.1 (anti-β ₂ ηι ) was used as a positive control to verify whether the HLA-A2 complex was correctly folded and coated in the well. Figure 5 shows the affinity determination of antibodies.亲 The affinity of MT1COMP and MT1S was determined by surface plasmon resonance technique. All samples were simultaneously flowed through the same density of gpl00/HLA-A2 complex coated channels for background analysis of binding. (A) A 1000 RU MART 1/HLA-A2 complex was immobilized on the chip, and 5 concentration gradients (0.125 μ Μ, 0.25 μ Μ, 0.5 μ Μ, 1 μ Μ, 2 μ Μ) were set to analyze the affinity of MT1S. (Β) Fix the 1000RU MART-1/HLA-A2 complex on the chip and analyze the response of the 15nM MT1COMP flowing through the channel. (C) Increasing the density of the MART-1/HLA-A2 complex immobilized on the chip to 3000 RU, and also analyzing the response of the 15 nM MTlCOMP flowing through the channel. Figure 6 shows that MT1COMP specifically recognizes T2 cells expressing the MART-1-HLA-A2 complex. Figure (A) T2: MT1COMP recognizes only MART-1 after stimulation with MART-1, gpl00 or without peptide. Panel (B) BB7.2 antibody verified that T2 stably expressed peptide-HLA-A2 complex on the cell surface after polypeptide stimulation.

 Figure 7 shows the Western blot of MCC.

Figure 8 shows the killing effect of PBMC on T2 containing MART-1-HLA-A2 complex on the surface by MCC in vitro. Figure (A) shows the killing of MCC, PBS, MT1S and MT1COMP in the killing system under different effect ratios. The latter three groups are negative controls. Figure (B) fixed effective target ratio of 10, analysis of different concentrations of MCC for killing Mediated g

 Figure 9 shows that gpa7C0MP specifically recognizes T2 cells expressing the gpl00-HLA-A2 complex. Figure (A) T2 cells gpa7C0MP only recognizes gplOO after stimulation with gplOO, CMV, HBV or without peptide. Figure (B) BB7.2 antibody verification T2 After peptide stimulation, the cell surface stably expressed peptide-HLA-A2 complex.

 Figure 10 shows the FACS analysis of E2COMP binding to colon cancer cell line colon205.

 Figure 11 shows that E2COMP inhibits the proliferation of human epidermoid carcinoma cell line A431. detailed description

The following examples are intended to further illustrate the invention, but are not to be construed as limiting the invention. Modifications or substitutions of the methods, steps or conditions of the invention are intended to be within the scope of the invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise specified. _,,; The present invention relates to a percent sign "%", if not otherwise specified, refers to mass percent; however, the percentage of the solution, unless otherwise specified, refers to a solution containing 100ml of several grams of solute; between the liquid The percentage refers to the ratio of capacity at 20 °C.

 The invention obtains the gpa7COMP fusion protein pentamer (the single-region antibody gpa7 is fused with the COMP AA29-76, anti-gpl00), and the ESI COMP fusion protein pentamer (the single-region antibody ES1 is fused with the COMP AA29-76, Anti-CEA-6 \ E2COMP fusion protein pentamer (fused with single-region antibody E2 and COMP AA29-76, anti-EGFR), V21COMP fusion protein pentamer (conjugated single-region antibody V21 with COMP AA29-76, anti- VEGFR), ES1TNF fusion protein trimer (fused with single-region antibody ES 1 to AA80-235 of TNF oc, anti-CEA-6), E2TNF fusion protein trimer (AA80-235 with single-region antibody E2 and TNF a) Fusion, anti-EGFR), ES1ACRP fusion protein trimer (fused with single-region antibody ES1 to ACRP30 AA16-108, anti-CEA-6), E2ACRP fusion protein trimer (AA16-108 with single-region antibody E2 and ACRP30) Fusion, anti-EGFR), ES1P53 fusion protein tetramer (conjugation of single-region antibody ES1 to P53 AA319-360, anti-CEA-6), E2P53 fusion protein tetramer (AA-21-360 with single-region antibody E2 and P53) Fusion, anti-EGFR), ES1C4BP fusion protein heptamer The antibody ES I was fused to the C4BP a chain C-terminal AA541-597, anti-CEA-6), E2C4BP fusion protein heptamer (the single-region antibody E2 was fused to the C4BP a chain C-terminal AA541-597, anti-EGFR). The affinity of these multimeric antibodies is significantly improved and the solubility is good.

 The construction of the fusion protein multimer of the present invention and the activity assay are described in detail below by taking COMP as an example. Example 1 Preparation and verification of single-region antibody pentamer protein

 1. Clone MT1COMP and MT1 S:

 MT1 was fused with COMP to make a pentamer (see Figure 1 for the method). The gene fragment expressing MT1 was first amplified by PCR. The primers used were:

 MT1F: 5' TAATAAGAAGACCGCAGGCCGATGTGCAGCTGCAGGCGTCTGG 3'; sdAbR: 5' ATTATTATGGGCCCTGAGGAGACGGTGACCTGGGT 3'

 Template: Phage expressing MT1 (Beijing Biyuan Biotechnology Co., Ltd.)

Reaction system: lOxpfo buffer ΙΟμΙ, pf i Ιμΐ, dNTP 8μ1, MT1F 20μ1, sdAbR 20μ1, template Ιμΐ , . Η ₂ 0 40μ1.

Reaction procedure: 94. C 5 min; 94 °C 30s, 60 °C, 30s, 72 °C 40s, 30 cycles; 72 °C lOmin with Bbs I and ^ w I restriction sites at both ends, insert Bbs I after digestion and digestion ^ ?a I digested pVT2 ( Zhang , JM, , 2004, 49-56), to MT1VT1B. PCR

Primers are:

 compF : 5' compR: 5' GAAGTCCGGACCCACCTCCGCCCTGCTGCATCCCGCACGC 3'

 Template: b2mcomp-PET28a (Beijing Table Source Biotechnology Co., Ltd.)

 Reaction system: lOxpfu buffer ΙΟμΙ, pfu Ιμΐ, dNTP 8μ1, compF 20μ1, compR 20μ1, template Ιμΐ, 3⁄4040μ1.

 Reaction procedure: 94 °C 5 min; 94 °C 30s, 55 °C, 30s, 72 °C 30s, 30 cycles; 72 °C lOmin ': Both ends with ^^1 and 3⁄4^1 restriction sites, After digestion and digestion, MT1VT1B digested with ^^ I and S^EI was inserted, and VT1B was replaced, and plasmid MT1C0MP was obtained. 'To verify the functional change of the single-region antibody pentamer relative to the monomer, synthesize the prokaryotic expression single-region antibody MT1S as a reference, 'synthetic primers ABF and ABR (ABF: 5* CGGCGGCGGCT 3', ABR: 5* CCGGAGCCGCCGCCGGGCC 3') After annealing, both ends contain I and BspE I cohesive ends, three glycines are encoded in the middle, and MT1VT1B after digestion of ^^ 1 and /^ I is inserted, and VT1B is deleted, and plasmid MT1S is obtained.

 2. Expression purification MT1COMP and MT1S:

The plasmids MT1COMP and MT1S were transformed into E. coli TG1 and induced to express, respectively, according to the method (J. Sambrook, Guide to Molecular Cloning, Science Press, 2002, 96-99). After expression of these proteins, they are secreted into the periplasmic cavity of TG1, and the target protein having a purity of 95% or more can be obtained by the IMAC method using the His ₅ tag.

 The clone was inoculated to 10 ml LB (containing 100 g/ml Amp), 37 ° C, overnight, 220 rpm; the overnight culture was diluted 1:100 to 1 LLB (containing 100 g/ml Amp), 37 ° C 220 rpm, cultured for 5 h; The final concentration is 1 mM IPTG, 24 . C, 180 rpm, continue to culture for 22 h; 8000 g, 15 min, centrifuged at 4 ° C; the cells were suspended to 25 ml with 20 mM Tris-cl, pH 8.0, 5 mg lysozyme was added, RT, 0.5 h; The solution was clarified and centrifuged 3 times at 12,000 rpm for 20 minutes. The supernatant was purified using GE Healthcare's chelating sepharose Fast Flow column, following the instructions provided by the manufacturer. ,

MT1COMP eluted at 200 mM imidazole and MT1S eluted at approximately 60 mM imidazole. Among them, the yield of MT1S is as high as 50-100 mg per liter of culture, and the pentamer MT1COMP is relatively low, about 5-10 g per liter of culture.

 To analyze the homogeneity of MT1COMP in solution, 2 mg MTlCOMP was exchanged in 20 mM Tris-cl, pH 8.0, 50 mM NaCl buffer. The sample was passed through a superdex 200 column equilibrated with 20 mM Tris-cl, pH 8.0, 50 mM NaCl. Refer to the manual provided by AKTA Purifier for the entire operation. The results showed that the purified MT1COMP did not show obvious aggregates or degradation products when passing through the superdex 200 column, mainly with a uniform peak (see Figure 2).

From the crystal structure of the COMP protein, there is an interchain disulfide bond between the monomers, which are connected to each other to form a pentamer, and the cys required for the disulfide bond are located on the COMP motif. When the COMP motif carries other polypeptides to form pentamers, the interchain disulfide bonds are still present and can be readily detected by non-reducing SDS-PAGE. MT1 COMP was treated with loading buffer without DTT, and then electrophoresed in 6% SDS-PAGE to analyze whether MT1COMP forms a polymer by means of disulfide bond. In the case of non-reduction electrophoresis, MT1COMP has a molecular weight much larger than that of monomer. The strip appears (see Figure 3). As a result, MT1COMP exists in the form of a multimer, and the monomers are connected by an interchain disulfide bond. : Analysis of the molecular weight of MT1 COMP by mass spectrometry by changing the MT1COMP to 25 mM NH ₄ HC0 ₃ , then The molecular weight was analyzed by MALD mass spectrometer (MALDI-TOF-TOF), and the result was

The amount is 109 kD, and the theoretical molecular weight of MT1COMP as a monomer is 21.7 kD, so MT1COMP is present as a 'pentamer' in terms of molecular weight.

Example 2 Antigen specificity experiment of MT1COMP pentameric fusion protein

 The antigen specificity of MT1 COMP was analyzed by ELISA.

 1) Preparation of biotinylated bovine serum albumin and HLA-A2 complexes:

Biotinylated bovine serum albumin (BSA-biotin) was obtained by labeling BSA with sulfo-NHS-LC-Biotin (ierce, Rockford), which was specifically followed by the manufacturer's instructions. The preparation of the biotinylated HLA-A2 complex is based on the relevant steps in the preparation of HLA-A2 complex tetramers according to Dirk Busch (http://www.milcrobio.med.tu-muenchen.de/category/laboratory-group -busch/ ) (Parts, 3⁄4 :: The inclusion bodies of HLA-A2 and β ₂ ιη expressed in E. coli (HLA-A2 and β ₂ ηι genes are provided by Beijing Bianyuan), after purification, with different peptides ( HLA-A2 restricted, including: MART-1 (ELAGIGILTV), gplOO (IMDQVPESV), CMV (NLVPMVATV), FLU (GILGFVFTL), all synthesized in Beijing Cypress Co., Ltd. for refolding, folded peptide-HLA-A2 The complex was biotinylated in vitro using the BirA enzyme (Beijing surface source), and finally the biotinylated HLA-A2 complex was purified by superdex200 column).

 2) ELISA experiment:

 The experimental method mainly refers to the description of Paula Henderikx (Cancer Research, 1998, 58, 4324-4332) with slight modifications (see Figure 4Α). The process is as follows:

The overnight coating was bSA-biotin (10 g/ml, dissolved in PBS, pH 7.4) in 96-well microtiter plate (NU C, DENMARK, maxisorp); washed 3 times with PBST, and streptavidin was added ( ΙΟμξ/ηύ, dissolved in PBS, ρΗ7.4), l; Washed 3 times with PBST, added biotinylated HLA-A2 complexes with different peptides (MART-1, gplOO, CMV and FLU) in different wells (5 g/ml, PBS, pH 7.4), incubate for 1 h; wash once with PBST, and add 2% MPBS (2% skim milk powder PBS buffer, pH 7.4:) for 30 min. 2% MPBS was removed, MTlCOMP (50 g/ml, dissolved in PBS) was added, and incubated for 1 h. Wash PBST 3 times, add appropriate anti-c-myc (9E10, Beijing source, diluted in 2% MPBS), and incubate for 1 h. Wash 3 times with PBST, add appropriate concentration of goat anti-mouse-horseradish peroxidase (diluted in 2% MPBS), and incubate for 1 h. Wash PBST 3 times, wash PBS 3 times, add 50μ1 coloring solution (ΤΜΒ, Jingmei), incubate for 10 min; add 50 l 2M H ₂ SO _{4 to} stop the reaction, measure the absorbance A ₄₅₀ value at ₄₅₀ nm. At the same time, for the biotinylated HLA-A2 complex presenting different peptides, BBM.1 (anti-β ₂ m ) was used as a positive control to verify whether the HLA-A2 complex was correctly folded and coated in the well.

 From the ELISA results, MT1C0MP has recognition specificity for different peptides presented by HLA-A2 complex, MT1C0MP only binds to polypeptides from MART-1, and does not bind peptides from gplOO, CMV and FLU (see Figure 4B). : Further analysis of the ability of pentameric TCR-like antibodies to recognize cells by flow cytometry (FACS).

1) T2 cells were subcultured in R10 medium (RPMI 1640 medium supplemented with 10% FBS, glutamine, penicillin/streptomycin), centrifuged at 700 rpm for 3 min, and the appropriate concentration of R10 was 2 x 10 ⁶ /ml, add peptide gp 100 or MART-1

(final concentration is 20 μΜ), 37 'C, 4 h. '-

2) Wash the cells twice with SB buffer (staining buffer, PBS + 0.5% BSA + 2 mM EDTA) and suspend to a concentration of 5 < 10 ⁶ /ml. Add MT1C0MP ( l(^g/ml ) as primary antibody, 30 min, on ice; after SB wash, add anti-c-myc as secondary antibody, 30 min, on ice; after SB wash, add goat anti-mouse-HTC as secondary antibody , 30min, on ice; after SB wash, perform FACS analysis. ₀ software processing.

 The experimental results are shown in Fig. 6. After stimulation with peptide gplOO or MART-1, Τ2 cells can stably express a large amount of gpl00-HLA-A2 complex or MART-1 -HLA-A2 complex on the cell surface, and MT1COMP can specifically recognize and bind to MART. -1 stimulated T2, does not recognize gplOO stimulated T2.

Example 3 Affinity experiment of MT1COMP pentameric fusion protein

The surface plasmon resonance (SPR) technique was used to determine the affinity of MT1COMP pentameric fusion protein and MT1S. The detection equipment was Biacore 3000 (Biacore AB, Sweden). The chip used was Sensor chip SA (Bia _COT e AB). , Sweden), the chip is prepared according to the instructions provided by the manufacturer, the whole process uses PBST as the running buffer. The biotinylated MART-1-HLA-A2 complex was added, and the biotinylated gpl00-HLA-A2 complex was added to the other channel to calculate the background at the time of detection. The density of the complex was fixed as shown in Fig. 5. Description. MT1S has five concentration gradients of 0.125 μ Μ, 0.25 μ Μ, 0.5 μ Μ, 1 μ Μ, 2 μ Μ, flowing from low to high through the chip, with 10 mM ''acid buffer buffer between the two concentrations (PH8) .5 , containing 1M NaOH and 0.1% Tween-20) Regenerate the surface of the HLA-A2 complex. The 15 nM MT1 COMP was used to analyze the affinity of the fixed low density (1000 RU) and saturated (3000 RU) HLA-A2 complexes in the chip. The data obtained were analyzed by the accompanying software to obtain the equilibrium constant (K _D ).

To analyze whether the COMP motif-mediated MT1 pentamerization increased its affinity, the affinity of MT1S and MT1COMP for antigen was obtained by BIACORE analysis. The equilibrium constant of MT1S specifically binding to its antigen MART-1-HLA-A2 complex was 1.48 μΜ (see Figure 5A). After MT1COMP specifically binds to MART-1-HLA-A2 complex (1000RU), the dissociation is slow; the two segments in the dissociation curve are selected, and the instantaneous equilibrium constants calculated are 419ρηι and 34.8pm, respectively (see Figure 5Β). When MT1COMP is combined with an excess of MART-1-HLA-A2 complex, the dissociation is slower and almost impossible to detect (see Figure 5C; therefore, MT1 COMP is fully integrated with the MART-1 -HLA-A2 complex, balanced The absolute value of the constant should be less than 34.8 pM, that is, the affinity is more than 10 ⁵ times that of the monomer MT1S. Example 4 Preparation and Activity Detection of Bispecific Fusion Protein Multimer MCC

1. Construct an expression vector

Gene synthesis of DNA coding sequence against human CD3 single chain antibody:

 The anti-human CD3 single-chain antibody sequence 'described in the reference (Arakawa et al, J Biochem, 1996, 120, 657-62), according to the literature (Young et al, Nucl. Acids Res. 2004, 32, & 59) In the method, a nucleotide fragment of 50 bp in length is synthesized, wherein the linker peptide sequence is included in the light chain synthesis sequence. The adjacent sense and antisense nucleotide strands have a 10 bp complementary region, and the heavy chain variable region VH and light chain variable region of the antibody are separately synthesized by DA-PCR, OE-PCR, and FulI-Iength-PCR. VL, and then VH and VL are linked into a single-chain antibody molecule by a suitable cleavage site. The cleavage site VH 5' used was BspE I , 3' was Hindlll , VL 5' was Hindlll , and 3' was BamH I .

 The following are the oligonucleotide fragments used to construct single-chain antibodies:

VH: plO GAGAAGCTTGGGTGTTGTTTTGGCTGAGGAG

VL:

Primer 1

Primer 10 ACGTGGATCCAGTTGGTGCAGTATCAGCC

 The underlined portion is an enzyme cleavage site.

Specific steps are as follows:

 1 DA-PCR:

 Both the heavy and light chains were synthesized from 10 oligonucleotide strands using the same method.

 In this step, four fragments were synthesized, and the primer synthesized by Invitrogen was dissolved in water to a primer concentration of 100 μM. PGR was carried out in a 50 μl reaction system. Other reagents required for PCR were purchased from Tiangen Biochemical. The concentration of the outer primer is 5 times that of the inner primer. Each primer was grouped as follows: 1-2-3-4, 3-4-5-6, 5-6-7-8, 7-8-9-10.

 E.g:

 The reaction system of the fragment 1 synthesis is:

lO pfu buffer 5μ1, dNTP 4μ1, pfu 0.5μ1, H ₂ 0 28.5μ1, primer 1 5μ1, primer 4 5 μΐ, primer 2 Ιμΐ, primer 3 1μ1. Reaction conditions:

 94 °C lmin

 94 °C 20s, 45 °C 30s, 72 °C 30s, 20 cycles

 72 °C 5min

 A DNA fragment 1 of approximately 170 bp in size was obtained. The same method yields fragments 2, 3, and 4.

 2 OE-PCR

Each of the above DA-PCR products was 20 μl, that is, the total volume was 80 μl, and 220 μ1 Η ₂补 was added, and the total volume was 300 μl. The phenol chloroform extraction was carried out by a standard method, the phenol was repeatedly extracted by chloroform, and the DNA was finally collected by ethanol precipitation. After the obtained DNA was dissolved in 81 μl 3⁄40, 1 Oxpfu buffer ΙΟμΙ, dNTP 8μ1, pfu Ιμΐ, and a total volume of 100 μl were added. Perform the following reactions:

94 °C lmin

 94 °C 20s, 60V, 30s, 72 Ό 90s, 15 cycles

 72 °C 5min

Relatively complete VH and VL sequences are available. 3 Full-length PGR:

Take OE-PCR product 2μ1, add lOxpfu buffer ΙΟμΙ, pfu Ι μΐ, dNTP 8μ1, primer 1 20μ1, primer 10 20μ1, Η ₂ 0 39μ1. The total system is 100 μl.

 Reaction conditions:

 94 °C lmin

 94 °C 20s, 60V, 30s, 72 °C 90s, 30 cycles

 72 °C 5min

 1% agarose gel electrophoresis showed that the correct size VH and VL fragments were obtained. Sequencing has one amino acid difference from the anti-human CD3 single-chain antibody described in the literature, that is, the first amino acid of the N-terminus of the light chain is mutated from D to Q.

Construction of prokaryotic and eukaryotic expression vectors for bispecific antibodies:

 VH and VL were digested with BspEi, HmdIII and HiftdlU, and BamUl, respectively, and the DNA fragment was recovered by a gel recovery kit. It was ligated with the vector MT1COMP digested with BspEl and Bcimiil. A prokaryotic expression vector for the bispecific antibody MCC was obtained.

 The MCR and the myc tag on the prokaryotic vector were identified by the SaR and Not\ cleavage sites and the following two primers, smccsall and apef otl (amplification of the coding sequence of the antibody MCC and its downstream myc tag and his tag as a whole fragment) And his tag was cloned into PEF-Myc-ER (Invitrogen), and a stop codon was introduced at the 3' end, and finally the eukaryotic expression vector PEF-MCC of MCC was obtained. The specific construction process is as follows:

 First, a complete long fragment was amplified by PCR, including: and Nort restriction sites, MCC antibody gene, myc tag, his tag and stop codon at the 3' end.

 Primer:

 Smccsall: ACGCGTCGACGATGTGCAGCTGCAGGCG

 Apefhotl: AAGGAAAAAAGCGGCCGCCTAATGGTGATGGTGATGGTTCAGATC Template: Prokaryotic expression vector of MCC constructed in the previous step

Reaction system: lOxpfo buffer ΙΟμΙ, pfu Ι μΐ, dNTP 8μ1, smccsall 20μ1, apefnotl 20μ1, template Ιμΐ, Η ₂ 0 40μ1.

 Reaction procedure: 94 ° C for 5 min; 94 ° C for 30 s, 60 ° C, 30 s, 72 ° C for 2 min, 30 cycles; 72 ° C for 10 min.

 Then, Sail and ΝοΛ were separately used to digest the PCR product and the expression vector PEF-Myc-ER, and the DNA recovery kit was used to recover the DNA fragment. The ligated fragment was used to obtain the eukaryotic expression vector PEF-MCC of MCC.

2. Transforming the host and expressing the antibody

When 293T cells were grown to a density of about 80%, the medium was decanted, 6 ml of serum-free DMEM was added to a 10 cm dish, and 20 μ _β PEF-MCC plasmid was dissolved in 250 μl Η ₂ 0 and mixed with 250 μl 0.5 Μ CaCl ₂ . Then slowly drip into 500μ1 2xHepes (0.05M Hepes, 0.28M Nacl, 1.5mM Na ₂ HP0 ₄ , pH 7.00) buffer, while shaking vigorously, let stand for 15 minutes, shake for a few seconds, then add the culture dish Mix gently and place the cells in an incubator. After 4 hours, the culture was changed to D10 (DMEM, supplemented with antibiotics and 10% calf serum). After 48 hours, the cells were harvested, washed once with PBS buffer, and resuspended in lysate (50 mM Tris-Cl, 500 mM NaCl, 1% NP40, ImM PMSF, ^g/ml leupeptin, ^g/ml pepstatin, pH 8.0). The cell density is approximately 10 ⁶ /ml. After standing on ice for 30 min, the ultrasound continued to break the cells. 13000rpm, After centrifugation at 20 min, the supernatant was taken and the protein was purified by metal ion affinity chromatography. The protein eluted at 100 mM, 200 mM, 500 mM imidazole was collected, and the lysis buffer was replaced with PBS overnight, centrifuged to precipitate, concentrated, and subjected to westem blot detection. The primary antibody was anti-myc (Beijing table) Source Biotechnology Co., Ltd.), the secondary antibody is HRP-goat anti-mouse antibody.

 The results are shown in Figure 7. After transient transfection of the eukaryotic expression vector pEF-MCC in 293T cells, MCC was expressed and detected by Western blot. Poly MCC can be detected by treating the sample with a loading buffer without DTT.

3, in vitro killing experiment

 Take 10 million T2 cells, wash once with PBS, and suspend the cells in 200 μl PBS. Prepare CFSE solution (take 0.5μ1 5mM CFSE stock solution into 1.25ml HBSS), add 200μ1 CFSE solution to T2, dye at 37 degrees for 10 minutes, and add 500μl calf serum to stop the reaction for one minute. Wash the cells once with HBSS. R10 was suspended from Τ2 to a concentration of 2 million per ml, then stimulated with the addition of the polypeptide MART-1 (final concentration 20 μΜ), and cultured at 37 °C for 4 hours.

 PBMC (peripheral blood mononuclear cells) stimulated by ΟΚΤ3 and IL2 were suspended with RIO (RPMI 1640, supplemented with antibiotics and 10% calf serum), and PBMC was added to the 96-well plate at the appropriate target ratio (Ε: Τ). In this case, the target cells (the above T2 of the polypeptide thorn i) were fixed to 10,000 per well. Effector cells, target cells and antibodies (MCC or control) were co-incubated in the wells and the reaction volume was supplemented to 200 μl with R10. The experiment was carried out according to two schemes: one was to design different target ratios, the experimental group added about 2 ng of MCC antibody per well, the control group replaced MSC with PBS, lOOng MT1COMP or 100 ng MT1S; the other was fixed-target ratio 10. Add different concentrations of MCC. Incubate for 4 hours at 37 degrees.

 The cells were stained with ^g/ml PI, and after 3 minutes on ice, the killing was analyzed by FACS. Mortality (%) = number of cells stained with CFSE and PI / number of CFSE-positive cells xl 00.

 The result is shown in Figure 8. As can be seen from Figure A, compared with the control group, MCC can effectively mediate T2 containing MART-1-HLA-A2 complex on the surface of PBMC-killing cells after OKT3 and IL2 stimulation. As can be seen from the map, as the concentration of MCC increases, its mediated killing effect also increases. Example 5. Preparation and detection of gpa7COMP multimer: gpa7COMP was obtained using the same strategy as MT1COMP except that the antibody was anti-melanoma antigen gpl00. :

FACS analysis gpa7COMP recognizes the gplOO-HLA-A2 complex on the cell surface.

T2 was subcultured in R10 (RPMI 1640 medium supplemented with 10% FBS, glutamine, penicillin/streptomycin). At the time of experiment, the cells were centrifuged at 700 rpm for 3 min, and the appropriate concentration of R10 was 2 x 10 ⁶ /ml. Add peptides gpl00, CMV and

HBV (final concentration 20 μΜ), 37 °C, 4 h.

The cells were washed twice with SB (staining buffer, PBS + 0.5% BSA + 2 mM EDTA) and suspended at a concentration of 5 x 10 ⁶ /ml. Gpa7COMP (10 g/ml) was added as a primary antibody for 30 min on ice. After SB washing, anti-c-myc was added as a secondary antibody for 30 min on ice. After SB washing, goat anti-mouse-FITC was added as a third antibody for 30 min on ice. After SB washing, FACS analysis was performed. FACS results were processed using flowjo software.

 The results are shown in Fig. 9. From the FACS results, gpa7COMP specifically recognizes T2 stimulated by gplOO polypeptide, and does not recognize CMV and HBV polypeptide-stimulated T2.

 EXAMPLES Preparation and Detection of E2COMP Protein Multimers

 E2COMP was obtained using the same strategy as MT1 COMP in Example 1, except that the antibody was anti-EGFR.

FACS analysis of E2COMP binding to colon cancer cell line colon205: The cells were washed twice with SB (staining buffer, PBS + 0.5% BSA + 2 mM EDTA) and suspended to a concentration of 5 x 10 ⁶ /ml. Add E2COMP (10 g/ml) as primary antibody, 30 min, on ice. After SB washing, anti-c-myc was added as a secondary antibody for 30 min on ice. After SB washing, goat anti-mouse-FITC was added as a third antibody for 30 min on ice. After SB washing, FACS analysis was performed. The control only added anti-c-myc and goat anti-mouse-FITC. FACS results were processed using flowjo software.

 The results are shown in Fig. 10. From the FACS results, E2COMP can bind colon cancer cell line colon205.

 Example 7 E2COMP protein multimer inhibits human epidermal-like cancer cell line A431 proliferation assay

 Cell Counting Kit-8 (CCK-8, Japan Institute of Chemical Research) was used to detect changes in cell number.

A 96-well plate was inoculated with a suspension of human 表μΙ human epidermoid carcinoma cell line 431 (cell medium was D10 containing 2 ng/ml epidermal growth factor) at 10,000 per well, and the blank well contained only the cell culture medium. The plates were pre-incubated in an incubator for 24 hours. Replace the medium with fresh cell culture medium containing 2μ _§ /ιη1 mitomycin C (used as a positive control in this experiment) or 10 (^g/ml E2COMP, and set a group without adding the above two drugs. Negative control wells. Continue incubation for 48 hours. Add ΙΟμΙ CCK-8 solution to each well. Incubate the plate for 4 hours in the incubator. Measure the absorbance at 450 nm (A _45D ) with a microplate reader. The inhibition rate was calculated according to the following formula: Inhibition rate (%) = (drug group OD _45Q - blank group OD ₄₅₀ ) I (negative control group OD ₄₅₀ - blank group OD ₄₅₀ ) xl00.

 The results are shown in Fig. 11. As can be seen from the figure, the E2COMP protein multimer can inhibit the proliferation of the human epidermoid carcinoma cell line A431 to a certain extent, and the inhibition rate is about 20%.

 Sequence Listing Description: ' ;

SEQ ID N0.1&2 is an anti-melanoma antigen MART-1 gene and its protein sequence, SEQ ID No. 3 & 4 are anti-melanoma antigen gplOO gene and its protein sequence, and SEQ ID No. 5 & 6 are anti-CEA-6 Gene and its protein sequence, SEQ ID No. 7 & 8 are anti-EGFR genes and their protein sequences, SEQ ID No. 9 & 10 are anti-VEGFR genes and their protein sequences, and SEQ ID N0.11 & 12 are anti-CD3 genes and their protein sequences SEQ ID Νο. 13 & 14 are the AA80-235 gene of mTNF a and its protein sequence, SEQ ID N0.15 & 16 are the AA16-108 gene of hACRP30 and its protein sequence, and SEQ ID Νο. 17 & 18 are the AA319-360 gene of P53 and The protein sequence, SEQ ID No. 1 9 & 20 is the AA29-76 gene of COMP and its blunt sequence, SEQ ID No. 21 & 22 is the C4BP a chain C-terminal (AA54 597) gene and its protein sequence, SEQ ID No. 23 & 24 is a primer for amplifying a gene fragment of MT1, SEQ ID No. 25 & 26 are primers for amplifying a COMP fragment, and SEQ ID No. 27 & 28 are primers ABF and ABR; SEQ ID No. 29-48 Primers for synthesizing DNA against human CD3 single chain antibody; SEQ ID No. 49 to 50 are primers smccsall, apefnotl. Industrial applicability

 The fusion protein multimer disclosed by the invention has good solubility and biological activity, and greatly improves the affinity of the antibody protein, and can be made into various biotechnological products, for example, into a diagnostic reagent for diagnosis such as melanoma. The protein multimer is used to carry a therapeutic drug for targeted therapy such as melanoma.

Claims

Claim

A fusion protein multimer characterized in that a fusion protein constituting a fusion protein multimer is composed of a component A and a component B, wherein component A is a single-region antibody, and component B is a multimerization of the fusion protein. A polypeptide sequence derived from TNF c, ACRP30, P53, COMP and C4BP proteins and mutants thereof.

The fusion protein multimer according to claim 1, wherein the single-region antibody is derived from a heavy chain variable region or a light chain variable region of an antibody.

3. The fusion protein multimer according to claim 1, wherein the single-region antibody is derived from a variable region of a heavy chain antibody or a cartilage fish Ig-NAR antibody in camelids, or is derived from The variable region of antibodies in humans.

 The fusion protein multimer according to claim 1, wherein the single-region antibody is a melanoma antigen MART-1 antibody, a melanoma antigen gplOO antibody, a CEA-6 antibody, an EGFR antibody or a VEGFR antibody. .

 5. The fusion protein multimer according to claim 4, wherein the fusion protein further comprises an anti-human CD3 single chain antibody.

 6. The fusion protein multimer of claim 5 which is a MCC fusion protein multimer.

 7. The fusion protein multimer according to any one of claims 1 to 6, wherein the component B is selected from the group consisting of AA80-235 ACRP30 of AA16-108 of TNFc, AA319-360 of P53, COMP AA29-76 and C4BP alpha chain C-terminal ΑΑ541-597.

 A DNA sequence, characterized in that the DNA sequence encodes a fusion protein comprising the fusion protein multimer of any of claims 1-7.

 An expression vector, characterized in that the expression vector comprises the DNA sequence of claim 8.

 A host cell characterized in that said host cell is transfected with the expression vector of claim 9.