WO2011057437A1

WO2011057437A1 - Anti-epidemic growth factor receptor antibody and encoding genes and uses thereof

Info

Publication number: WO2011057437A1
Application number: PCT/CN2009/001606
Authority: WO
Inventors: 威孚·戴维; 瑞奇韦兹·米歇尔; 曹诚; 靳彦文
Original assignee: 中国人民解放军军事医学科学院生物工程研究所
Priority date: 2009-11-11
Filing date: 2009-12-30
Publication date: 2011-05-19
Also published as: CN101875695B; CN101875695A

Abstract

The present invention discloses an anti-epidemic growth factor receptor (EGFR) antibody, genes encoding said antibody, a method for preparing said antibody, inhibitors and medicaments comprising said antibody and/or encoding genes, and uses of said antibody and/or encoding genes for prevention and/or treatment of tumor.

Description

Anti-epidermal growth factor receptor antibody and coding gene thereof and application thereof

The invention relates to an antibody and its encoding gene and application.

Background technique

Epidemic growth factor receptor (EGFR) is a member of the epidermal growth factor gene (erbB) family and is overexpressed in approximately 30% of human tumors, especially non-small cell lung cancer, head and neck squamous cells. Cancer and colorectal cancer, etc. Many studies at home and abroad have shown that antibodies against EGFR can effectively inhibit the EGFR signal transduction pathway by blocking the binding of ligands, and the human body caused by EGFR overexpression or/and mutation. Tumors, especially head and neck squamous cell carcinoma (80%~100%), colorectal cancer (25%~77%), non-small cell lung cancer (40%~80%) have good curative effect. Epidermal growth factor receptor has become one of the most intensive and well-received cancer therapeutic targets. The use of genetic engineering to develop anti-EGFR monoclonal antibodies has become one of the research hotspots of tumor immunotherapy.

In 2004 and 2006, the US FDA approved the murine-human chimeric antibody cetuximab (pantuximab) and the human antibody panitumumab for EGFR, for colorectal cancer treatment; The humanized antibody of EGFR, nimotuzumab, has obtained a new class of drug certificate approved by the State Food and Drug Administration (SFDA) and is currently undergoing clinical trials in Π/ΙΠ. The murine monoclonal antibody can produce a human anti-mouse antibody response in human applications, thereby affecting its function. The mouse-human chimeric antibody engineered by genetic engineering technology can greatly attenuate the immunogenicity of murine monoclonal antibody, prolong the half-life of the antibody in vivo, and mediate immunomodulation and ADCC effect by human immunoglobulin Fc segment, thereby enhancing the antibody. Biological effect, but the ability of the chimeric antibody to bind antigen is lower than that of murine antibody

98. 7%. A large number of preclinical and clinical trials have confirmed that cetuximab monotherapy and combination chemotherapy / radiotherapy have a good effect, but simple CDR transplantation tends to cause a decrease in antigen-antibody affinity; panitumumab is a transgenic mouse technology The prepared fully human antibody has a human sequence close to 100% compared to the chimeric antibody and the humanized antibody, which greatly enhances the antibody target affinity, but the antibody has a mouse glycosylation pattern, a short half-life and a hypersensitivity reaction. And so on. Nimuzumab achieves humanized antibody by humanization of anti-EGFR mouse monoclonal antibody, and the light and heavy chain genes of the antibody are respectively linked to different expression vectors for expression, due to the expression of light and heavy chains. Large differences often result in extremely low levels of expression of intact antibody molecules. Invention disclosure

It is an object of the present invention to provide an antibody that binds to the epidermal growth factor receptor (EGFR).

The antibody provided by the present invention has the amino acid sequence of the heavy chain variable region as shown in SEQ ID NO: 2 in the sequence listing, and the amino acid sequence of the light chain is shown in SEQ ID NO: 3 in the Sequence Listing.

The antibody may consist of a heavy chain and the light chain, the heavy chain consisting of the heavy chain variable region and the heavy chain constant region.

The amino acid sequence of the heavy chain constant region is shown as SEQ ID NO: 11 in the Sequence Listing.

The gene encoding the heavy chain variable region or the gene encoding the above light chain is also within the scope of the present invention.

The coding gene of the heavy chain variable region is as follows 1), 2) or 3):

1) the nucleotide sequence thereof is the DNA molecule shown in SEQ ID NO: 5 in the sequence listing;

2) a DNA molecule that hybridizes to a defined DNA sequence under stringent conditions and encodes the heavy chain variable region;

3) a DNA molecule encoding a heavy chain variable region, characterized in that the amino acid sequence encoding the heavy chain variable region contains amino acids 51-70 from the N-terminus of sequence 2 in the sequence listing (ie, sequence 5 from sequence 5 in the sequence listing) 'The 153bp-210bp nucleotide from the end) has more than 70% homologous sequence;

The coding gene of the light chain is as follows: I), 11) or III):

I) its nucleotide sequence is the DNA molecule shown in SEQ ID NO: 6 in the sequence listing;

II) a DNA molecule that hybridizes under defined conditions to a defined DNA sequence and encodes the light chain;

III) A DNA molecule encoding a light chain, characterized in that the amino acid sequence encoding the light chain contains amino acids 24-34 from sequence N in sequence 3 of the sequence listing (ie, sequence 72 in the sequence listing is 72 bp from the 5' end) a nucleotide of 102 bp) having more than 70% homologous sequences;

The gene encoding the heavy chain constant region is as follows: a) or b):

a) its nucleotide sequence is the DNA molecule shown in SEQ ID NO: 12 in the Sequence Listing;

b) The nucleotide sequence thereof is the DNA molecule shown in SEQ ID NO: 13 in the Sequence Listing.

A primer pair that amplifies the full length of any of the above-described coding genes or any fragment thereof is also within the scope of the present invention.

The primer pair is a primer pair as follows: the primer pair is amplifying the heavy chain variable region encoding gene of.

1) one primer sequence is shown in SEQ ID NO: 7 in the sequence listing, and the other primer sequence in the primer pair is as shown in SEQ ID NO: 8 in the sequence listing;

2) One primer sequence is shown in SEQ ID NO:9 in the Sequence Listing, and the other primer sequence in the primer pair is as shown in SEQ ID NO: 10 in the Sequence Listing.

A recombinant vector, recombinant strain, transgenic cell line or expression cassette containing any of the above-described coding genes is also within the scope of the present invention.

Another object of the present invention is to provide a method of preparing the above antibody.

The method for producing the above antibody according to the present invention is that the above-described coding gene is introduced into a host cell and cultured to obtain the antibody.

In the method, any one of the above-mentioned coding genes may be introduced into a host cell by a recombinant vector; the recombinant vector contains the coding gene of any of the heavy chain variable regions described above and contains any of the above A gene encoding a light chain, and the gene encoding the heavy chain variable region and the gene encoding the light chain are regulated by the same promoter in the recombinant vector.

Another object of the present invention is to provide an inhibitor which inhibits the epidermal growth factor receptor signal transduction pathway, an inhibitor which inhibits invasion of tumor cells or a medicament for preventing and/or treating tumors.

The active ingredient of the drug or inhibitor provided by the present invention is the above antibody and/or any of the coding genes.

In the above drug or inhibitor, the tumor may specifically be colon cancer; and the tumor cell may specifically be SW480 cells.

The use of the above antibodies and/or any of the above-described coding genes for the preparation of inhibitors which inhibit the epidermal growth factor receptor signal transduction pathway is also within the scope of the present invention.

The use of the above antibodies and/or any of the above-described coding genes for the preparation of inhibitors for inhibiting tumor cell invasion is also within the scope of the present invention.

The use of the above antibodies and/or any of the above-described coding genes in the preparation of a medicament for preventing and/or treating a tumor is also within the scope of the present invention.

The use of the above antibodies and/or any of the above-described coding genes for inhibiting the epidermal growth factor receptor signal transduction pathway is also within the scope of the present invention.

The use of the above antibodies and/or any of the above-described coding genes for inhibiting tumor cell invasion is also within the scope of the present invention.

The use of the above antibodies and/or any of the coding genes in the prevention and/or treatment of tumors also belongs to The scope of protection of the present invention.

The present invention is based on the establishment of a crystal structure of an antibody antigen, and mutates the murine variable region FR surface gene of cetuximab antibody by computer simulation to make it resemble the pattern of human antibody FR, thereby obtaining affinity compared to cetuximab. The monoclonal antibody is significantly increased against the humanized antibody against EGFR. The results confirmed that the antibody of the present invention has excellent binding activity (affinity of ^{2. 7 X 10- 8 mol / L} ) and inhibit growth of tumor cell migration; and foreign markets a common human anti-EGFR chimeric antibody cetuximab mAb affinities 1. 1 X 10- ⁹ M. The humanized antibody of the present invention can better bind to EGFR, thereby ensuring its antitumor effect. The method of the present invention for producing an antibody is capable of simultaneously expressing a light chain and a heavy chain such that the expression ratio of the light chain and the heavy chain is closer to 1:1, resulting in a higher ratio of mutually matched diabody. In conclusion, the antibody of the present invention and the preparation method thereof have broad application prospects in the field of preventing and/or treating tumors. DRAWINGS

Fig. 1 Agarose electrophoresis pattern of PCR product of light chain gene and heavy chain variable region gene.

Figure 2 is a schematic view showing the structure of an expression vector containing the antibody of the present invention.

Figure 3. Reduced SDS-PAGE detection of antibodies of the invention.

Figure 4. Immunoblot analysis of antibodies of the invention.

The best way to implement the invention

The experimental methods used in the following examples are all conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples can be obtained commercially, unless otherwise specified.

Example 1. Acquisition of the light chain and heavy chain variable region encoding genes of antibodies

According to computer simulation, the murine-human chimeric antibody cetuximab amino acid sequence was used as a template, and the human FR surface gene was humanized and designed to synthesize the light chain amino acid sequence L1 and the heavy chain variable region amino acid sequence HI. ;

Heavy chain variable region HI: The amino acid sequence is shown in SEQ ID NO: 1 in the sequence listing; the coding gene sequence is shown in SEQ ID NO: 4 in the sequence listing;

Heavy chain variable region H2: The amino acid sequence is shown in SEQ ID NO: 2 in the sequence listing; the coding gene sequence is shown in SEQ ID NO: 5 in the sequence listing;

Light chain L1: The amino acid sequence is shown in SEQ ID NO: 3 in the sequence listing; the coding gene sequence is shown in SEQ ID NO: 6 in the sequence listing;

The antibody of the present invention consists of a light chain L1 and a heavy chain variable region H2, and the antibody of the present invention is referred to as C2. The coding gene of the light chain L1 and the coding gene of the heavy chain variable region H2 are artificially synthesized. The coding gene of the heavy chain variable region H2: using the coding gene of the heavy chain variable region HI as a template, using the overlapping PCR method, and amplifying the primers 9, 10, 11 and 12 to obtain the coding gene of the heavy chain variable region H2. ;

Bow I: 9: 5, -gtgtctagagccgccaccatggactgga-3 ' (Xba I ); (Sequence 7)

10: 5, -gggatccacttacctgtagttttgtcaca-3 ' (BaiM I ); (sequence 8) 11:

5' -gaaggtgactctatcctggaatttggcgctgaagtctttgttaccaccactccagattcctc ccat-3' ; (sequence 9)

12:

5' -aaagacttcagcgccaaattccaggatagagtcaccttcaccagggacacgtccgctactac agcct-3' ; (sequence 10)

The amplified genes were detected by gel electrophoresis, and the results were consistent with the expected size. The L and H fragments were approximately 735 bp and 770 bp, respectively (Fig. 1). M. Relative molecular mass standard; A: Lane 1 is the light chain gene product LI; B: Lane 1 is the heavy chain variable region gene product H1, and lane 2 is the heavy chain variable region gene product H2.

The coding gene of the light chain L1 and the coding gene of the heavy chain variable region H2 were cloned into the PMD18-T vector (respectively referred to as recombinant vectors pMD18-T/Ll, pMD18-T/H2), and transformed into E. coli DH5a. The plasmid was cloned, extracted and sequenced, and the results showed that the obtained gene sequences were correct.

Example 2. Preparation of antibodies

First, the construction of recombinant expression vector:

The pIRES double expression vector was purchased from Clontech, Inc., catalog number 631605; the pMD18-T expression vector was purchased from Takar'a Bio Company, catalog number: D504 CA. The pIRES vector itself contains a heavy chain constant region gene. The amino acid sequence of the heavy chain constant region is shown in SEQ ID NO: 11 in the sequence listing, and the genomic DNA sequence encoding the gene is shown in SEQ ID NO: 12 in the sequence listing, and the cDNA sequence of the coding gene is shown in SEQ ID NO: 13 in the Sequence Listing. The heavy chain constant region gene in the pIRES vector is the genomic gene shown in SEQ ID NO: 12.

The recombinant vector PMD18-T/L1 and pIRES double expression vectors were digested with the corresponding restriction enzymes (zel and ^^?1) respectively, and the purified target fragment was recovered by agarose gel electrophoresis; The fragment L1 was mixed with the vector fragment, and reacted at 16 ° C for 12 h under the action of a linking reagent. Escherichia coli DH5a was transformed, the clone was picked, the plasmid was extracted and sequenced. As a result, the insertion direction of the gene in the recombinant expression vector was correct and the inserted sequence was correct, and it was recorded as the recombinant expression vector pIRES/Ll. Using pIRES/Ll as a template, digesting with ^ ₃ 1 and /1⁄2^1, recovering a large fragment of the plasmid, which is recorded as fragment 1; using PMD18-T/H2 cloned with the heavy chain variable region gene as a template, using Xba I Digestion with fe i I, recovery of the heavy chain variable region fragment, which is recorded as fragment 2; digestion of the heavy chain constant region fragment by digestion with fe i I and Λ3⁄4 I using the pIRES vector cloned with the heavy chain constant region gene as a template (The heavy chain constant region fragment digested with fe i I and Not I is the sequence shown in SEQ ID NO: 12), which is designated as fragment 3; and the fragments 1, 2 and fragment 3 are ligated to obtain a recombinant vector, which is transformed into Escherichia coli DH5a. Clones were picked, plasmids were extracted and identified by sequencing. The results showed that the recombinant expression vector was correct in structure, and the direction and sequence of the inserted gene were correct. The light and heavy chain genes of the antibody shared the same promoter and were ligated by the IRES sequence to construct the expression plasmid. The recombinant expression vector was recorded as pIRES/LI/H2 (Fig. 2).

Second, cell transformation and protein expression

293T cells (293T human embryonic kidney T cells) were purchased from the American Type Culture Collection (also known as the American Model Collection Center 'ATCC), catalog number CRL-11268; Lipofectamine 2000 was purchased from Invitrogen, catalog number 12566014 HyQSFM4CH0 medium was purchased from HyClone Company, catalog number SH30518.02; rProtein A column was purchased from GE Company, catalog number 17- 5079-01.

293T cells were inoculated in a 10 cm diameter culture dish in IX OVml, cultured in DMEM medium containing 10% fetal bovine serum at 37 ° C, 5% CO ₂ incubator. 5 g of the plasmid pIRES/LI/H2 obtained in the step 1 was transfected into 293T cells, and the specific procedure was described with reference to the reagent of Lipofectamine 2000. Recombinant cells 293T- pIRES/ LI/H2 were obtained.

The recombinant cell 293T- pIRES/ LI/H2 was cultured in serum-free DMEM medium, and cultured 6~

After 8 h, the serum-free medium was aspirated and replaced with HyQSFM4CH0 medium. Under the same conditions, co-culture was continued for 84 hours, cell supernatant was collected once every 12 hours, and antibody expression was detected by ELISA. Expand the transfection system, collect the cell culture supernatant 4.5L, adjust the pH to 6.0~7.0, filter with 0.45 μηι filter, and then purify the antibody with rProtein A column. For details, see the product manual.

ELISA method:

1. Coat: The antibody (primary antibody goat anti-human IgG) was diluted to a protein content of l~10 g/ml with 0.05 M PH9.0 carbonate coating buffer. 0.1 ml was added to the reaction well of each polystyrene plate at 4 ° C overnight. The next day, the solution in the well was discarded and washed 3 times with washing buffer for 3 minutes each time. (referred to as washing, the same below).

2. Loading: Add 0.1ml of the sample to be tested to the above-mentioned coated reaction well. Incubate for 1 hour at 37 °C. Then wash. (Do blank holes, negative control wells and positive control wells at the same time).

3. Add the enzyme-labeled antibody (the second antibody is goat anti-human IgG-HRP (goat anti-human IgG-horseradish peroxidase)): add freshly diluted enzyme-labeled antibody to each well (diluted by titration) Degree) 0. lml. Incubate at 37 ° C for 0.5 to 1 hour and wash.

4. Adding a substrate solution to the reaction well: Add a temporarily prepared TMB substrate solution to each reaction well.

37 ° C 10~30 minutes.

5. Stop the reaction: Add 0.05 ml of 2M sulfuric acid to each reaction well.

6. Judgment of results: The results can be observed directly on the white background with the naked eye: The darker the color in the reaction well, the stronger the positive degree, the negative reaction is colorless or very light, according to the depth of the color, with "+", The "-" sign indicates. The 0D value can also be measured: On the ELISA detector, at 450 nm (if the color is developed by ABTS, 410 nm), the 0D value of each well is measured after zero adjustment in the blank control well, which is 2.1 times larger than the 0D value of the specified negative control. , that is, positive.

Reagent

(1) Coating buffer 03⁄49.6 0.05 Μ carbonate buffer): Na ₂ C0 ₃ 1.59 g, NaHC0 ₃ 2.93 g, add distilled water to 1000 ml.

(2) Wash buffer (pH 7.4 PBS): 0.15 M : ΚΗ ₂ Ρ 0 ₄ 0 · 2 g, Na ₂ HP0 ₄ · 12H ₂ 0 2.9 g, NaCl 8.0 g, KC1 0.2 g, Tween- 20 0.05% 0.5 Ml , add distilled water to 1000ml.

(3) Diluent: Bovine serum albumin (BSA) 0.1 g plus washing buffer to 100 ml or with serum of sheep serum, rabbit serum and washing solution and 5~10%.

(4) Stop solution (2M H ₂ S04 ): 178.3 ml of distilled water, 22.7 ml of concentrated sulfuric acid (98%) was added dropwise.

Purification of the antibody using the rProteinA column: Purification medium: HiTrap rProtein AFF, 5 ml, purchased from GE, catalog number 17-5079-01, please refer to the instructions provided by the company for detailed instructions.

Operation:

1) Washing, washing the pipeline with lM NaOH and ddH ₂ O successively, boiling the small filter with 0.1M NaOH for 10 min, then soaking with ddH ₂ O for l~ ₂ min;

2) Set the program, connect the rProteinA affinity column;

3) equilibrate the column with 20 mM binding buffer (pH 7.0); 4) The prepared cell supernatant was loaded at a flow rate of 1 to 2 ml/min; cell supernatant preparation: centrifugation at 12000 g for 15 minutes, the supernatant was taken out, and sterilized by filtration through a 0.22 um nitrocellulose filter.

5) At the end of the loading, the target protein is eluted with 1M elution buffer (pH 3.0);

6) Collect the protein, adjust its pH to 7.0 with Trise base (pH 9.0), and test by electrophoresis;

7) Follow steps 1) to clean the pipe and small filter.

Sodium Phosphate Buffer (Binding Buffer): Used as a binding buffer for ProteinA purification. The preparation method is as follows: 1 M Na ₂ HPO ₄ 57.7 ml and 1 M NaH ₂ PO ₄ 42.3 ml are mixed, that is, 0.1 ml of sodium phosphate buffer solution of pH 7.0, and diluted with distilled water to 20 Mm for use.

Citric Acid-Sodium Citrate Buffer (Eluent Buffer): Used as an elution buffer for ProteinA purification. The preparation method is as follows: Take 0.1M citric acid 186ml and 0.1M sodium citrate 14 ml and mix well, which is 0.1 ml of pH 3.0 citrate buffer 200 ml.

Third, protein detection

Goat anti-human IgG-HRP antibody was purchased from Sigma, catalog number (046K4801); goat anti-mouse IgGl was purchased from SBA (Southern Biotechnology Associates, Inc.), catalogue number (1010-05);

SDS-PAGE: 15 μl of the eluate (i.e., antibody solution) was subjected to reduction on a 12% gel by SDS-PAGE electrophoresis, and stained with Coomassie Brilliant R-250.

The results showed that the relative molecular masses of the heavy and light chains of the purified antibody were 25 Χ 10 ³ and 50 X 10 ^{3 , respectively} (Fig. 3, Fig. 4), which was consistent with the expected results. In Figure 3, lane 1 represents the antibody C2 of the invention, and lane 3 represents the control cetuximab.

Western blot analysis: Another eluate was subjected to reduction SDS-PAGE electrophoresis on a 12% gel, transferred to a nitrocellulose membrane, and the membrane blocking solution (1 X PBST containing 5% skim milk powder) was taken out and sealed at room temperature. For 2 h, the goat anti-human IgG-HRP antibody diluted 1:5000 was incubated for 2 h (room temperature), and the membrane was washed 3 times with 1 X PBST. Finally, color development was performed with ECL, and exposure was performed using X-ray films. At the same time, a control for adding anti-mouse IgG1 was added. In Fig. 4, lane 1 represents the antibody C2 of the present invention; lane 2 represents a murine monoclonal antibody negative control; and lane 4 represents a positive control cetuximab.

Immunoblot (12%) analysis indicated that the antibody specifically binds to goat anti-human IgG. However, some non-specific hybridization bands (including commercial cetuximab) that partially react with anti-human IgG secondary antibodies have also emerged, possibly due to the mixing of some non-full length heavy chain fragments in the purification. However, the above results did not affect the evaluation of antibody affinity. None of the above antibodies reacted with the anti-mouse IgG1 antibody. Since the light and heavy chains of the present antibody are expressed in a proportional manner on an expression vector, an intact antibody containing two light and heavy chains is automatically composed.

Example 3, Functional detection of antibodies

The EGFR protein was purchased from (Sigma) and the catalog number was (E2645-500UN).

First, Biacore detects the binding ability of antibodies to antigens

The affinity of antibody C2 to EGFR was determined using a Biacore 3000 apparatus. The EGFR protein was diluted with 10 mmol/L NaAc at different pH values (4.0, 4.5, 5.0 and 5.5), preconcentrated on a CM5 chip, and the NaAc diluted protein at the optimum pH was selected. The purified antibody (i.e., the eluate obtained in the second step of Example 2) was covalently coupled to a CM5 sensor chip, and the mobile phase was HBS-EP (pH 7.4) at a flow rate of 20 μl/min. Detection of binding affinities of antibodies to C2 (0, 10.55, 2.11, 42.2, and 84.4 nmol/L). Affinity is calculated using the software included with Bi _aCO re3000. At the same time, cetuximab was used as a control.

The experiment was set up with 3 repetitions and the results were averaged.

The results show that C2 has good binding activity to the antigen EGFR, affinity of 2.7 X 10- ⁸ mol / L ₀ cetuximab affinity of 1.1X10- ⁹ M.

Second, tumor cell invasion experiment

SW480 cells were purchased from the American Type Culture Collection (also known as the American Model Collection Center, ATCC), catalog number (ATCC ^S Number: CCL-228TM); cetuximab antibody was purchased from Mercurion Pharmaceuticals, Germany Company (original English trade name: ERBITUX; country of origin English drug name: Cetuximab; Chinese reference product translation: Erbitux; molecular structure name: cetuximab; country of origin: Germany; manufacturer: Mercurion Pharmaceuticals, Germany the company) .

SW480 cells were cultured in RPMI 1640 medium (purchased from Invitrogen, catalog number 31800-022). The invasion chamber was hydrated with serum-free RPMI 1640 medium and incubated for 2 h (37 ° C, 5% C0 ₂ ). Discard serum-free RPMI1640, add 750 μΐ RPMI 1640 (containing 10% serum) to the chamber of the invasion chamber (BD BioCoatTM MatrigelTM Invasion Chamber, catalogue 354480); in the insert chamber Add 475 μM RPMI1640 (containing 1% serum), then add 25 μl of digested SW480 cells (cell number>10 ⁵ /500 μ 1), and finally add negative control PBS and the antibody of the present invention to the insertion chamber, respectively. Each sample has two replicate wells with a final antibody concentration of 100 ng/ml. After incubation for 24 hours, the cells that failed to penetrate the basement membrane of the invasion cassette were wiped off with a sterile cotton swab; the cells penetrating the basement membrane were fixed, stained, and allowed to dry at room temperature. After drying, the light microscope counts.

The corresponding number of cells in each insert chamber was calculated under a 100x microscope. The Dunnett t3 (bilateral analysis) test was used to compare the antibody group with the PBS group. If the result was P < 0.05, the difference in the two treatment effects was considered statistically significant.

Single-factor 4-level ANOVA was performed on the cell invasion test data using SPSS 12. 0 statistical software. The results of single factor 4 level ANOVA showed: ^. ₅ ( ₃ , ₄₄ ) = 2. 82, P < 0.05, it is considered that the number of cells is not equal or not equal.

Dunnett t3 (two-sided analysis, hereinafter referred to as t) test results (Table 1) shows that the t value of the PBS group and the C2 group is 3.32, and the P value is less than 0.01, indicating that the anti-EGFR antibody C2 invades the SW480 tumor cells. Has a certain inhibition. Table 1. Dunnett's t3 test results for cell invasion experiments Group n Number of cells (number)

PBS group 12 86±16.222

Group C2 12 57±13.3750*

Note: Compared with the PBS group, *P=0.008,

Industrial application

Antibodies of the invention have a good binding activity (affinity of ^{2. 7 X 10- 8 mol / L} ) and inhibit growth of tumor cell migration; and foreign markets a common human anti-EGFR chimeric antibody cetuximab affinity 1. 1 X 10- ⁹ M. The humanized antibody of the present invention can better bind to EGFR, thereby ensuring its antitumor effect. The method of the present invention for producing an antibody is capable of simultaneously expressing a light chain and a heavy chain such that the expression ratio of the light chain and the heavy chain is closer to 1:1, resulting in a higher ratio of mutually matched diabody. In conclusion, the antibody of the present invention and the preparation method thereof have broad application prospects in the field of preventing and/or treating tumors.

Claims

Rights request

An antibody having an amino acid sequence of a heavy chain variable region as shown in SEQ ID NO: 2 in the Sequence Listing, wherein the amino acid sequence of the light chain is as shown in SEQ ID NO:3 in the Sequence Listing.

The antibody according to claim 1, wherein the antibody consists of a heavy chain and the light chain, and the heavy chain is composed of the heavy chain variable region and the heavy chain constant region.

The antibody according to claim 2, wherein the amino acid sequence of the heavy chain constant region is as shown in SEQ ID NO: 11 in the Sequence Listing.

4. A gene encoding a heavy chain variable region according to claim 1, 2 or 3 or a coding gene for a light chain according to claim 1, 2 or 3.

The coding gene according to claim 4, wherein the coding gene of the heavy chain variable region is as follows: 1), 2) or 3):

3) a DNA molecule having 70% or more homology with the nucleotide 153bp-210bp from the 5' end in the sequence listing and encoding the heavy chain variable region;

The coding gene of the light chain is as follows: I), 11) or III):

III) a DNA molecule having 70% or more homology with the nucleotide of the 72 bp to 102 bp nucleotide from the 5' end in the sequence listing and encoding the light chain;

The coding gene of the heavy chain constant region is as follows: a) or b): a) its nucleotide sequence is the DNA molecule shown in SEQ ID NO: 12 in the sequence listing; b) its nucleotide sequence is the DNA molecule shown in SEQ ID NO: 13 in the Sequence Listing.

6. A primer pair encoding the full length of the gene encoding the claim 4 or 5 or any fragment thereof.

7. The primer pair according to claim 6, wherein: the primer pair is a primer pair as follows:

A recombinant vector, recombinant strain, transgenic cell line or expression cassette comprising the gene of claim 4 or 5.

A method for producing the antibody according to claim 1, 2 or 3, which comprises introducing the gene encoding according to claim 4 or 5 into a host cell and culturing the antibody.

10. The method according to claim 9, wherein: in the method, the coding gene of claim 4 or 5 is introduced into a host cell by a recombinant vector; the recombinant vector contains claim 4 Or the coding gene of the heavy chain variable region further comprises the coding gene of the light chain of claim 4 or 5, and the coding gene of the heavy chain variable region and the coding gene of the light chain are in the recombination The vector is regulated by the same promoter.

An inhibitor for inhibiting an epidermal growth factor receptor signal transduction pathway, the active ingredient of which is the antibody of claim 1, 2 or 3 and/or the gene of claim 4 or 5.

An inhibitor for inhibiting invasion of a tumor cell, wherein the active ingredient is the antibody of claim 1, 2 or 3 and/or the gene of claim 4 or 5.

The inhibitor according to claim 12, wherein the tumor is colon cancer.

The inhibitor according to claim 13, wherein the tumor cell is a SW480 cell.

A medicament for preventing and/or treating a tumor, wherein the active ingredient is the antibody of claim 1, 2 or 3 and/or the gene of claim 4 or 5.

The drug according to claim 15, wherein the tumor is colon cancer.

The drug according to claim 16, wherein the tumor cell is a SW480 cell.

18. Use of an antibody as claimed in claim 1, 2 or 3 and/or a gene encoding according to claim 4 or 5 for the preparation of an inhibitor which inhibits the epidermal growth factor receptor signal transduction pathway.

Use of the antibody of claim 1, 2 or 3 and/or the gene of claim 4 or 5 for the preparation of an inhibitor which inhibits invasion of tumor cells.

20. The use according to claim 19, wherein: the tumor is colon cancer.

21. The use according to claim 20, wherein: said tumor cells are SW480 cells.

22. Use of the antibody of claim 1, 2 or 3 and/or the gene of claim 4 or 5 for the preparation of a medicament for the prophylaxis and/or treatment of a tumor.

23. The use according to claim 22, wherein: said tumor is colon cancer.

24. The use according to claim 23, wherein: said tumor cells are SW480 cells.

25. Use of an antibody according to claim 1, 2 or 3 and/or a coding gene according to claim 4 or 5 for inhibiting an epidermal growth factor receptor signal transduction pathway.

26. Use of an antibody as claimed in claim 1, 2 or 3 and/or a gene encoding according to claim 4 or 5 for inhibiting tumor cell invasion.

27. The use according to claim 26, wherein: said tumor is colon cancer.

28. The use according to claim 27, wherein: said tumor cells are SW480 cells.

29. Use of an antibody as claimed in claim 1, 2 or 3 and/or a gene encoding according to claim 4 or 5 for the prevention and/or treatment of a tumor.

30. The use according to claim 29, wherein: the tumor is colon cancer.

31. The use according to claim 30, wherein: said tumor cells are SW480 cells.