JP5691164B2 - Antibody binding protein and method for producing the same - Google Patents

Description

  The present invention relates to a protein having a high binding affinity for a human antibody and a method for producing the protein using a genetic engineering technique.

Fc receptors are a group of protein molecules that bind to the Fc region of immunoglobulin molecules. Individual molecular species recognize a single or the same group of immunoglobulin isotypes by a binding domain on the Fc receptor by an Fc recognition domain belonging to the immunoglobulin superfamily. This determines which accessory cells are mobilized in a certain immune response (Non-Patent Document 1). Fc receptors can be further classified into subtypes, and the presence of FcγRI, FcγRIIa, FcγRIIb, and FcγRIII has been reported as a receptor for IgG (immunoglobulin G) (Non-patent Document 1). Among these, the binding affinity between FcγRI and IgG is high, and the equilibrium dissociation constant (K _D ) is 10 ⁻⁸ M or less (Non-patent Document 2). FcγRI is a receptor for IgG (immunoglobulin G) and is constitutively expressed on monocytes and macrophages and inducibly expressed on neutrophils and eosinophils. FcγRI is divided into an extracellular region, a transmembrane region, and an intracytoplasmic region, and binding to IgG occurs in the IgG molecule Fc region and the extracellular region of FcγRI, and then a signal is transmitted to the cytoplasm. FcγRI is composed of two types of subunits, α chain and γ chain that are directly involved in binding to IgG, and γ chain forms a homodimer by covalent bond via amino acid cysteine at the boundary between cell membrane and extracellular region. (Non-Patent Document 1).

  In recent years, the unexpected immunosuppressive biological properties of Fc receptors have been attracting attention as pharmaceuticals, particularly in the areas of autoimmune disease or autoimmune syndrome, transplant rejection and malignant lymphoproliferation (non- Patent Document 2).

  The amino acid sequence and gene base sequence of the human Fc receptor FcγRIα chain have been clarified by Non-patent Document 3, and then expression using E. coli (Patent Document 1) or animal cells has been reported by genetic recombination technology (Non-patent document 3). Patent Document 4).

JP-T-2002-531086

J. et al. V. Ravetch et al., Annu. Rev. Immunol. , 9, 457, 1991 Toshiyuki Takai, Jpn. J. et al. Clin. Immunol. , 28, 318, 2005 J. et al. M.M. Allen et al., Science, 243, 378, 1989 A. Paetz et al., Biochem. Biophys. Res. Commun. , 338, 1811, 2005 Yasukawa K .; J. et al. Biochem. , 108, 673, 1990

As described above, although the binding affinity of the human Fc receptor FcγRI to the IgG molecule Fc region is as high as 10 ⁻⁸ M or less as an equilibrium dissociation constant (K _D ), in order to capture and quantify IgG molecules contained in blood Needed to further improve antibody binding per molecule. Therefore, an object of the present invention is to provide a protein having improved binding affinity for a human IgG antibody and a method for producing the protein.

The present invention made in view of the above problems includes the following inventions:
(1) A protein obtained by linking a plurality of polypeptides including the entire extracellular region or almost the entire region of the human Fc receptor FcγRI consisting of the amino acid sequence set forth in SEQ ID NO: 1.

  (2) A protein comprising the amino acid sequence set forth in SEQ ID NO: 4 or 5.

  (3) A polynucleotide encoding the protein according to (1) or (2).

  (4) An expression vector comprising the polynucleotide according to (3).

  (5) A transformant obtained by transforming a host with the vector according to (4).

  (6) A method for producing a protein using the transformant according to (5).

  Hereinafter, the present invention will be described in detail.

1. 1. Protein of the Present Invention As shown in FIG. 1, the human Fc receptor FcγRI protein is a signal peptide region of 15 amino acids from the N-terminal side (SS, the region from the −15th to the −1st of the amino acid sequence described in SEQ ID NO: 1 ) Extracellular region of 277 amino acids (EC, region from 1 to 277 of the amino acid sequence described in SEQ ID NO: 1), transmembrane region of 21 amino acids (TM, of amino acid sequence described in SEQ ID NO: 1 278th to 298th region), an intracellular region of 61 amino acids (C, the 299th to 359th region of the amino acid sequence described in SEQ ID NO: 1). Among these, the extracellular region has binding affinity with the IgG molecule Fc region, and the IgG antibody is directly captured in this region.

  In the protein of the present invention, a plurality of polypeptides to be linked are the entire extracellular region sequence (regions from 1 to 277) or the extracellular region of human FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 1. The entire sequence may be included, and may include all or part of the signal sequence on the N-terminal side of the extracellular region, or may include part of the transmembrane region on the C-terminal side of the extracellular region. Good. The almost entire sequence of the extracellular region is the N-terminal side of the entire sequence of the extracellular region (the region from the 1st to the 277th) and / or C of human FcγRI consisting of the amino acid sequence set forth in SEQ ID NO: 1. This refers to a sequence obtained by deleting 1 to 10 amino acids on the terminal side.

  In the protein of the present invention, the total number of human FcγRI extracellular regions or the number of polypeptide linkages containing almost the entire sequence is two or three because the molecular weight of the protein exceeds about 100,000, which makes handling difficult. Is preferred. Further, when linking polypeptides containing the entire sequence of human FcγRI extracellular region or almost the entire sequence, the polypeptides may be linked directly, binding affinity for IgG molecule Fc region, and bacteria A linker peptide may be appropriately inserted as long as it is soluble enough to be secreted outside the body.

  As one aspect of the protein of the present invention, a signal peptide region of 15 amino acids from the N-terminal side, a first extracellular region (sequence from the first to 274th of the amino acid sequence described in SEQ ID NO: 1), a linking region (2 amino acids) The protein described in SEQ ID NO: 4 consisting of the second extracellular region (the 6th to 274th amino acids of the amino acid sequence described in SEQ ID NO: 1) can be mentioned.

  As another embodiment of the protein of the present invention, a signal peptide region of 15 amino acids from the N-terminal side, the first extracellular region (the first to 274th amino acids in the amino acid sequence described in SEQ ID NO: 1), ligation Region (2 amino acids), second extracellular region (the 6th to 274th amino acids in the amino acid sequence described in SEQ ID NO: 1), linking region (2 bases), third extracellular region (2 And the protein described in SEQ ID NO: 5 consisting of the same amino acid as the first extracellular region).

2. Polynucleotide encoding the protein of the present invention The polynucleotide encoding the protein of the present invention is a human FcγRI comprising the amino acid sequence set forth in SEQ ID NO: 1, comprising a polypeptide containing the entire extracellular region or the entire entire sequence. This refers to a polynucleotide encoding a plurality of linked proteins. In addition, when the protein of the present invention is produced using gene recombination technology, when converting the amino acid sequence of the protein into a nucleotide sequence, the conversion is performed in consideration of the codon usage in the recombination target host. preferable. For example, when using Brevibacillus choshinensis as the host, conversion to TCA for serine (Ser), CTA for leucine (Leu), CGG / AGA / AGG for arginine (Arg), and ATA for isoleucine (Ile) is avoided. (See Japanese Patent Application No. 2008-046438).

  As one embodiment of the polynucleotide encoding the protein of the present invention, the polynucleotide of SEQ ID NO: 2 converted from the amino acid sequence of SEQ ID NO: 4 to the nucleotide sequence, and the amino acid sequence of SEQ ID NO: 5 to the nucleotide sequence The converted polynucleotide of SEQ ID NO: 3 can be mentioned.

3. Protein production method of the present invention As a method for producing the protein of the present invention, a polypeptide comprising the entire extracellular region or almost the entire sequence using an appropriate reagent from human FcγRI consisting of the amino acid sequence set forth in SEQ ID NO: 1. And a method for producing the peptides directly or by peptide bonding via a linker peptide, and a polynucleotide sequence encoding the protein of the present invention, and producing the polynucleotide from the polynucleotide using a genetic engineering technique The latter production method is preferable in that the protein of the present invention can be produced easily and in large quantities. Hereinafter, the latter manufacturing method will be described in detail.

As a method for obtaining a polynucleotide encoding the protein necessary for producing the protein of the present invention using a genetic engineering technique,
(1) A method of converting an amino acid sequence of a target protein of the present invention into a nucleotide sequence and artificially synthesizing and obtaining a polynucleotide containing the nucleotide sequence,
(2) A human FcγRI extracellular region (58th to 888th of the nucleotide sequence shown in SEQ ID NO: 1), or a polynucleotide comprising almost the entire sequence, directly or artificially or human FcγRI a method of preparing from a cDNA or the like using a DNA amplification method such as a PCR method, and linking and obtaining the prepared polynucleotide by an appropriate method;
Can be illustrated.

  In the case of obtaining by the method of (1), when converting from an amino acid sequence to a nucleotide sequence, it is preferable to convert in consideration of the codon usage frequency in the recombination target host as described above. In the case of obtaining by the method of (2), when preparing a polynucleotide comprising the entire sequence of human FcγRI extracellular region or almost the entire sequence directly from the nucleotide sequence of human FcγRI described in SEQ ID NO: 1, In consideration of the frequency of codon usage in the host to be replaced, if it corresponds to a low-frequency codon, so-called rare codon, it is preferable to prepare it after converting it to a high-frequency codon in advance (Japanese Patent Application 2008). -046438).

  In addition, when the polynucleotide encoding the protein of the present invention is obtained by either method (1) or (2), the entire sequence of the human FcγRI extracellular region or a polypeptide encoding a polypeptide containing the entire sequence A restriction enzyme recognition sequence for linking an expression vector to nucleotides or the polynucleotide, or a tag sequence for enabling easy purification / quantification of expressed human FcγRI may be added. As the restriction enzyme recognition sequence to be added, an appropriate sequence may be selected in consideration of the polynucleotide sequence of the vector and the DNA fragment to be ligated. Examples of the tag sequence to be added include nucleotide sequences encoding oligopeptides such as polyhistidine tags and c-myc tags, which are frequently used in genetic engineering. Further, the tag sequence may be added to the 5 'end side of the polynucleotide or may be added to the 3' end side.

  The expression vector used for producing the protein of the present invention using genetic engineering techniques includes a polynucleotide encoding the protein of the present invention, a polynucleotide for expressing the polynucleotide, and an expression vector in the host. Any plasmid can be selected and used as long as it has an origin of replication for replication and can transform a selected host. Usually, an expression plasmid that is easy to handle is used. Examples of the polynucleotide for expressing the polynucleotide encoding the protein of the present invention include polynucleotides derived from a lactose promoter system, a tryptophan promoter system, a GAL4 promoter system, an SV40 promoter system, and an adenovirus promoter system. However, when the host is a cell such as a COS cell or a CHO cell, a polynucleotide derived from the SV40 promoter system is preferred as the promoter system. In addition, in order to enable selection between a host into which an expression vector has not been introduced and a host into which an expression vector has not been introduced during the transformation using the expression vector, the host is given resistance to drugs such as ampicillin. It is preferable that a polynucleotide (drug resistance gene) is included.

  Examples of the host used for producing the protein of the present invention using genetic engineering techniques include COS cells and CHO cells (Chinese hamster ovary cells) capable of stably expressing the protein. In addition, by introducing an expression plasmid containing a polynucleotide encoding the protein of the present invention into the cell and further imparting resistance to a specific drug, screening the cell from the strength of drug resistance Thus, cells that highly express the protein of the present invention can be obtained. In the screening, the drug is preferably methotrexate (MTX), and the tolerance concentration is preferably several μM or more. As a method for imparting resistance to MTX, a dihydrofolate reductase gene (dhfr) may be contained in an expression plasmid containing a polynucleotide encoding the protein of the present invention.

  Since the protein of the present invention is composed of the extracellular region of human FcγRI, it can be separated and purified from the culture solution or culture supernatant used for production by a normal physiologically active protein recovery method. Examples of separation and purification methods include commercially available HPLC and column chromatography. In addition, when the protein is produced from the culture solution, other proteins in the culture solution are reduced, for example, when the host is a cell, the cultured cell is cultured in a serum-free medium to express the protein. The efficiency of separation and recovery can be increased.

  The protein of the present invention captures the polypeptide containing the entire or almost entire region of the extracellular region having the function of directly capturing the IgG antibody of the human Fc receptor FcγRI consisting of the amino acid sequence shown in SEQ ID NO: 1. The human FcγRI described in SEQ ID NO: 1 and a protein consisting of only one extracellular region of human FcγRI have an affinity for an IgG antibody. It has improved. This has great significance for the study of ontogeny and immune mechanism, and development of therapeutic diagnostic agents based on the above results. It can also be used as an immunogen for preparing anti-FcγRI antibodies and as a standard substance for FcγRI immunochemical measurement methods.

  In addition, the protein of the present invention can be obtained by using an appropriate chromatography carrier (for example, His / Bind Resin gel (manufactured by Novagen), HisTrap NHS-Activated HP (manufactured by GE Healthcare Biosciences), tresyl group activated dynabeads (Dynal). And can be used as an adsorbent for purifying an antibody such as a human monoclonal antibody.

  Furthermore, by producing the protein of the present invention using an expression vector comprising a polynucleotide encoding the protein of the present invention and a transformant obtained by transforming a host with the vector, the binding affinity for IgG antibody Proteins with improved properties can be produced easily and in large quantities.

The figure which shows the structure of human Fc receptor FcγRI. SS is a signal peptide, EC is an extracellular region, TM is a transmembrane region, and C is a region encoding a cytoplasmic region. The numbers at the top of the figure indicate the number of amino acids in each region. The figure which shows the structure of expression plasmid pECEFcRdhfr. The figure which shows the structure of expression plasmid pECEFcRdhfrn2. The figure which shows the structure of expression plasmid pECEFcRdhfrn3. The figure which shows the preparation outline of an expression plasmid. The figure which shows the antibody binding activity of the transformed COS7 culture supernatant. The horizontal axis represents the antibody immobilized concentration, and the vertical axis represents the absorbance at 450 nm.

  Hereinafter, examples will be shown to describe the present invention in more detail, but the present invention is not limited to the examples.

Example 1 Preparation of Expression Plasmid (Part 1)
A plasmid capable of expressing a protein consisting of the human Fc receptor FcγRI extracellular region was prepared by the following method.
(1) A polynucleotide encoding human FcγRI was prepared by the following method.
(1-1) Human cDNA clone SC119841 plasmid (manufactured by Origen) was used as a template, SEQ ID NO: 6 (5′-GA [AGATCT] ATGTTGGTTCTTGACAACTCTGCCTCC-3 ′: brackets are restriction enzyme BglII sites) and SEQ ID NO: 7 (5 '-CG [TCTAGA] TCAGTGGGTGGGTGTGTGGGTG [ACTAGT] GACAGGAGTTGGTAACTGGAGGGCC-3': The brackets are oligonucleotides of restriction enzyme XbaI and SpeI sites, respectively, as PCR primers. In order to prepare and quantify human FcγRI, PCR primers were designed so that a polyhistidine tag was added to the C-terminal side of the protein to be expressed.
(1-2) After the heat treatment at 94 ° C for 5 minutes, the PCR reaction is 25 cycles of the first step at 94 ° C for 30 seconds, the second step at 65 ° C for 30 seconds, and the third step at 72 ° C for 1 minute. Finally, the test was performed at 72 ° C. for 7 minutes. The reaction solution composition is shown in Table 1.

(1-3) After the PCR reaction, a band corresponding to the designed size was confirmed by 0.9% agarose electrophoresis.
(1-4) A band corresponding to the target product was extracted from an agarose gel (QIAquick Gel extraction kit (trade name) manufactured by Qiagen) to prepare a polynucleotide encoding human FcγRI.
(2) The polynucleotide prepared in (1) is digested with restriction enzymes BglII and XbaI, and ligated with a plasmid pECEdhfr (Non-patent Document 5) previously digested with these restriction enzymes (Ligation Kit Ver. 2: Takara Bio). Escherichia coli JM109 strain was transformed using an LB agar medium supplemented with 50 μg / mL antibiotic carbesinillin.
(3) The transformant of (2) was cultured (37 ° C., 18 hours) in an LB medium containing 50 μg / mL of the antibiotic carbesinillin, and a plasmid was extracted with QIAprep Spin Miniprep Kit (trade name, manufactured by Qiagen). .
(4) The extracted plasmid was digested with restriction enzymes BglII and XbaI and subjected to 0.9% agarose electrophoresis.

  As a result, it was confirmed from the insert size that it was as designed, and this was designated as pECEFcRdhfr. FIG. 2 shows a schematic structure of pECEFcRdhfr.

Example 2 Production of Expression Plasmid (Part 2)
From the expression plasmid pECEFcRdhfr (FIG. 2) prepared in Example 1, a plasmid capable of expressing a protein in which a plurality of polypeptides comprising almost the entire sequence of the human FcγRI extracellular region was linked was prepared by the following method.
(1) In order to functionally link almost the entire sequence of the human FcγRI extracellular region, Human cDNA clone SC119841 plasmid (manufactured by Origen) was used as a template, and SEQ ID NO: 8 (5′-CG [GCTAGC] GCAGTGATCACTTTGCAGCCCTCATTG-3 ′: The polynucleotide is obtained by PCR using the oligonucleotides of the square bracket part as the restriction enzyme NheI site) and SEQ ID NO: 9 (5′-GG [ACTAGT] GACAGGAGTTGGTAACTGGAGGC-3 ′: the square bracket part is the restriction enzyme SpeI site) as PCR primers. Was amplified. In order to prepare and quantify human FcγRI, PCR primers were designed so that a polyhistidine tag was added to the C-terminal side of the protein to be expressed. The reaction conditions for the PCR reaction were the same as in Example 1.
(2) The polynucleotide prepared in (1) was digested with restriction enzymes NheI and SpeI and inserted into pECEFcRdhfr (FIG. 2) previously digested with the restriction enzyme SpeI.
(3) E. coli JM109 strain was transformed in the same manner as in Example 1, and two polynucleotides containing almost the entire sequence of the human FcγRI extracellular region were prepared by preparing a plasmid from the transformed E. coli strain. A ligated expression plasmid pECFFcRdhfrn2 was prepared. FIG. 3 shows a schematic structure of pECEFcRdhfrn2.
(4) Furthermore, by inserting the polynucleotide prepared in (1) into pECEFcRdhfrn2 (FIG. 3) previously digested with the restriction enzyme SpeI, three polynucleotides containing almost the entire sequence of the human FcγRI extracellular region are linked. The resulting expression plasmid pECEFcEdhfrn3 was prepared. FIG. 4 shows a schematic structure of pECEFcEdhfrn3. Moreover, the production procedure up to pECEFcRdhfrn3 is shown in FIG.

  Although an attempt was made to produce an expression plasmid in which four or more polynucleotides containing almost the entire sequence of the human Fc receptor FcγRI extracellular region were ligated in the same manner as in this example, the plasmid could not be produced. It was.

Example 3 Confirmation of nucleotide sequence of expression plasmid The chain terminator is a nucleotide terminator encoding human FcγRI inserted into pECEFcRdhfr (FIG. 2), pECEFcRdhfrn2 (FIG. 3) and pECEFcRdhfrn3 (FIG. 4) prepared in Examples 1 and 2. Using the Big Dye Terminator v3.1 Cycle Sequencing kit (trade name, manufactured by PE Applied Biosystems) based on the method, in a fully automated DNA sequencer ABI Prism 310 DNA analyzer (manufactured by PE Applied Biosystems) Analyzed. As a sequencing primer, SEQ ID NO: 10 (5′-AGCTGTATGGGGTCACTTCG-3 ′), SEQ ID NO: 11 (5′-TTTTTCACTACTGAGATCTAACC-3 ′), SEQ ID NO: 12 (5′-AGTGGGGATGTCACAGATGC-3 ′) and SEQ ID NO: 13 ( The oligonucleotide shown in 5′-AGGAACACATCCCTCTGAATACC-3 ′) was used.

  As a result of the analysis, it was confirmed that all nucleotide sequences encoding human FcγRI inserted into pECEFcRdhfr, pECEFcRdhfrn2, and pECEFcRdhfrn3 were as designed. A nucleotide sequence encoding a protein obtained by linking two polypeptides containing almost the entire sequence of the human FcγRI extracellular region is linked to SEQ ID NO: 2 (pECEFcRdhfrn2), and three polypeptides containing the almost entire sequence of the human FcγRI extracellular region are linked. The nucleotide sequence encoding the obtained protein is shown in SEQ ID NO: 3 (pECEFcRdhfrn3), respectively.

Example 4 Confirmation of antibody binding activity of expressed protein The plasmids pECEFcRdhfr, pECEFcRdhfrn2 and pECEFcRdhfrn3 prepared in Examples 1 and 2 were introduced into COS7 cells by lipofectamine (Invitrogen), respectively. D- containing 10% FCS By culturing in a MEM medium (GIBCO) (37 ° C., 3 days), the protein was transiently expressed extracellularly, and after culturing, the culture solution was recovered. The antibody binding activity of the collected culture supernatant was evaluated by the ELISA method as follows.
(1) Gamma globulin preparation (manufactured by Chemo-Serum Therapy Laboratories) serially diluted from 100 μg / mL to 96 well ELISA plate (manufactured by Nunc) was added 100 μL to each well and allowed to stand at 4 ° C. for 18 hours. The gamma globulin was immobilized on the solid phase.
(2) After washing with TBS buffer (Tris-HCl buffer (pH 8.0) containing 0.2% (w / v) Tween 20, 150 mM NaCl), blocking operation is performed with Starting Block Blocking Buffers (manufactured by PIERCE). Was done.
(3) After washing with TBS buffer, 100 μL of the prepared culture supernatant was added and reacted with the human gamma globulin immobilized in (1) (30 ° C., 2 hours).
(4) After completion of the reaction of (3), the plate was washed with TBS buffer, and His-probe (H-15) HRP antibody (manufactured by Santa Cruz Biotechnology) was added.
(5) After completion of the reaction of (4), the plate was washed with TBS buffer, TMB Peroxidase Substrate (manufactured by KPL) was added, and the absorbance at 450 nm was measured.

  The evaluation results are shown in FIG. As shown in FIG. 6, on the culture of COS7 cells transformed with pECEFcRdhfr (monomer shown in FIG. 6), pECEFcRdhfrn2 (dimer shown in FIG. 6), and pECEFcRdhfrn3 (trimer shown in FIG. 6). Antibody binding activity was detected in all cases. That is, a plurality of polypeptides containing almost the entire sequence of the human FcγRI extracellular region are obtained by using a polynucleotide encoding a protein inserted in pECEFcRdhfrn2 and pECEFcRdhfrn3 and linking a plurality of polypeptides containing the entire entire sequence of the human FcγRI extracellular region. It shows that a linked protein can be obtained and that the protein retains the binding activity to human antibodies. As a control, a COS7 culture solution transformed with pECEFcRdhfr was used.

Example 5 Preparation of Expressed Protein A protein in which a plurality of polypeptides including almost the entire sequence of the human FcγRI extracellular region were linked was separated and purified from the culture supernatant obtained in Example 4 by the following method.
(1) About 1 L of a culture supernatant containing a protein obtained by linking a plurality of polypeptides including almost the entire sequence of the human FcγRI extracellular region obtained in Example 4 is washed with 20 mM acetate buffer (pH 5.2). Dialyzed and desalted.
(2) An adsorption fluidized bed system (manufactured by GE Healthcare Bioscience) equipped with 300 mL of Streamline SP gel (trade name, manufactured by GE Healthcare Bioscience) equilibrated with 20 mM acetate buffer (pH 5.2) After adding and washing with the same buffer, a protein linked with a plurality of polypeptides eluted with 20 mM phosphate buffer (pH 7.4) containing 10% glycerol and 1M NaCl and containing almost the entire sequence of the human FcγRI extracellular region was obtained. Concentrated fractions contained were prepared.
(3) HisTrap HS column dialyzed against 20 mM phosphate buffer (pH 7.4) containing 20 mM imidazole and 0.5 M NaCl and equilibrated with the same buffer (product) Name, manufactured by GE Healthcare Biosciences), washed, and eluted with 20 mM phosphate buffer (pH 7.4) containing 500 mM imidazole and 0.5 M NaCl. About 500 μg of a purified protein preparation in which a plurality of polypeptides containing the sequence were linked was obtained. The protein concentration was quantified using a protein assay kit (manufactured by Bio-Rad) based on the Bradford method using bovine gamma globulin as a standard protein. As a control, a protein containing only one human FcγRI extracellular region was prepared from a culture solution prepared from COS7 cells transformed with pECEFcRdhfr in the same manner as described above.

Example 6 Surface Plasmon Resonance Analysis of Expressed Protein The antibody binding characteristics of the purified protein produced in Example 5 were analyzed using a surface plasmon resonance analyzer BIAcore T100 (trade name, manufactured by GE Healthcare Biosciences).
(1) Chip fixation of human antibody Human antibody IgG1 (manufactured by Cosmo Bio) was diluted with running buffer HBS-EP to a final concentration of about 5 μg / mL. Subsequently, 390RU was fixed to sensor chip CM5 (manufactured by GE Healthcare Bioscience) according to the instruction manual of BIAcore T100.
(2) Analysis of purified FcγRI binding to human antibody IgG1 In order to perform binding analysis with an antibody, a protein in which a plurality of polypeptides containing almost the entire sequence of human FcγRI extracellular region, optionally diluted with a running buffer, is linked. And subjected to BIAcore T100. Antibody binding (RU) varied with diluted protein concentration. Using this result, the reaction characteristic of the protein to a human antibody was analyzed by BIAcore T100 Evaluation Software, which is dedicated software for the above analysis apparatus.

  The analysis results are shown in Table 2. As shown in Table 2, the human FcγRI extracellular region produced in this time has a plurality of proteins linked to almost the entire sequence compared to human FcγRI (monomer shown in Table 2) containing only one extracellular region. The binding affinity with respect to the protein is improved, and in comparison with the equilibrium dissociation constant, a monomer (a dimer described in Table 2) in which two polypeptides containing almost the entire sequence of the human FcγRI extracellular region are linked. The protein (trimer described in Table 2) in which three polypeptides including almost the entire sequence of the human FcγRI extracellular region were improved by about 85 times that of the monomer.

Claims (6)

A human Fc receptor FcγRI comprising the amino acid sequence set forth in SEQ ID NO: 1 comprising a whole extracellular region or a region in which 1 to 10 amino acids are deleted from the N-terminal side and / or C-terminal side of the whole region A protein in which two peptides are linked. A protein comprising the amino acid sequence set forth in SEQ ID NO: 4 . A polynucleotide encoding the protein according to claim 1 or 2. An expression vector comprising the polynucleotide according to claim 3. A transformant obtained by transforming a host with the vector according to claim 4. A method for producing a protein using the transformant according to claim 5.

Images