JP5177807B2 - Sdr4 gene regulating plant seed dormancy and use thereof - Google Patents

Description

  The present invention relates to an Sdr4 gene that controls plant seed dormancy and use thereof.

  When the seeds of plants acquire their germination ability with maturity, they have a function of suppressing germination on their own until an appropriate cultivation environment (temperature and light) is provided. In general, this phenomenon is called seed dormancy. Seed dormancy has become smaller as crops are cultivated, and many recent varieties and lines have weakened seed dormancy. When seed dormancy is weakened, germination occurs even when the seeds are harvested by giving a temperature and moisture suitable for germination (ear germination). In rice, the problem is that brown rice quality deteriorates due to the occurrence of ear germination. In addition, in the case of wheat that prefers a dry climate, quality deterioration due to ear germination is a particularly important issue in Japan, where rainfall is high. The seeds that have been sprouted in this manner have a large problem in agriculture because the quality of the seeds is greatly reduced, and imparting resistance to sprout germination is an important target for breeding cereals.

  Genetic research on seed dormancy (ear germination) has progressed through the analysis of easy germination mutants of maize, and ear germination mutant genes such as Vp1 have been isolated (Non-patent Document 1). In plants, abscisic acid (ABA) is known to inhibit seed germination. So far, Arabidopsis ABA insensitive mutation (abi), ABA-sensitive mutation at germination (ahg), ABA responsiveness Genes causing increased mutation (era) and abnormal ABA synthesis (aba) have been isolated (Non-patent Document 2). Moreover, since gibberellin (GA) promotes germination in Arabidopsis thaliana, analysis on susceptibility to GA and biosynthesis have been advanced, and related genes have been isolated (Non-patent Document 3). Although these mutants show changes other than seed dormancy, rdo1-4 and the like have been reported as mutants more specific to dormancy (Non-patent Document 4). In recent years, the identification of dormancy-related genes from Cvi, an Arabidopsis thaliana ecotype with strong dormancy, has progressed, and the existence of 14 QTLs (DOG: Delay of Germination) related to dormancy has been reported (non-patent literature) 5) More recently, the isolation of DOG1 gene was reported (Non-patent Document 6). DOG1 is a gene related to dormancy but is not similar to Sdr4.

  In rice, efforts have been made to identify genes involved in panicle germination tolerance or seed dormancy, and the genes involved have been isolated using easy germination mutations. That is, it is a mutant of zeoxanthin epoxidase (ZEP) corresponding to Arabidopsis aba1 mutant isolated from a rice mutant panel (Non-patent Document 7). In addition, five QTLs (quantitative trait loci) have been reported by genetic analysis of ear germination using natural mutation (Non-patent Document 8). In addition, a plurality of QTLs have been found by genetic analysis using a combination of weed rice and indica, which are closely related to japonica, or wild relatives (Non-patent Documents 9-11). Based on these backgrounds, in order to deepen the understanding of rice seed dormancy (ear germination) and to improve the efficiency of breeding for the improvement of ear germination tolerance, gene isolation using natural mutation and It is essential to understand the seed dormancy at the molecular level.

Prior art document information related to the invention of the present application is shown below.
McCarty Annual Review Plant Physiology & Plant Molecular Biology 46: 71-93, 1995 Review, Gubler et al. Current Opinion in Plant Biology 8: 183-187, 2005 Review, Peng and Harberd Current Opinion in Plant Biology 5: 376-381, 2002 Peeters et al. Physiologia Plantarum 115: 604-612, 2002 Alonso-Blanco et al. Genetics 164: 711-729 Bentsink et al. Proc Natl Acad Sci USA. 103, 17042-17047 Agrawal et al. Plant Physiology 125: 1248-1257, 2001 Lin et al. TAG 96: 997-1003, 1998; Takeuchi et al. TAG 107: 1174-1180, 2003 Gu et al. Genetics 166: 1503-1516, 2004 TAG 110: 1108-1118, 2005 Cai and Morishima TAG 100: 840-846 Lin et al. TAG 96: 997-1003, 1998

  This invention is made | formed in view of such a condition, The objective is to provide the novel gene which controls the seed dormancy of a plant. Another object of the present invention is to provide a method for controlling seed dormancy of a plant using the gene. Furthermore, it aims at providing the method of detecting the ear germination tolerance of a test plant.

  The Sdr4 locus is a QTL found in the long arm of rice chromosome 7 by QTL analysis using a backcross progeny of Kasalath, an indica with Nipponbare as the recurrent parent (Non-patent Document 12). In order to isolate Sdr4, a germination resistance gene, from a vast chromosomal region, the present inventors conducted extensive research using a map-based cloning method, and isolated and identified its base sequence. Successful.

  Specifically, individuals were selected from the backcross progenies of Nipponbare and Kasalath whose Sdr4 region was heterozygous and most of the other genomic regions were replaced with Nipponbare. Linkage analysis was performed by 100 self-propagating progenies (corresponding to F2 population) and progeny tests of selected individuals, followed by linkage analysis of the Sdr4 region by 2,515 large segregation populations (corresponding to F2 population) essential for map-based cloning. As a result of examining the germination level of the 28 progeny lines obtained (corresponding to the F3 line) at 6 weeks after heading, the Sdr4 gene was found in the 8.7 kbp region flanked by the markers Sdr4-SNP24 and Sdr4-SNP28. It was narrowed down. Furthermore, as a result of analysis of this candidate gene region, two candidate genes that are expressed in the ear were obtained. The complementation test, functional analysis using a knockdown line, and isolation of the mutant resulted in the Sdr4 body being candidate gene 2. In fact, Nipponbare's Sdr4 was also shown to have the ability to suppress germination.

Moreover, as a result of searching for Arabidopsis genes having high homology with the rice Sdr4 gene, it was found that AtSdr4L1 having the highest homology has a function of controlling germination.
Furthermore, Kasalath-derived NIL with Sdr4 (Sdr4) showed higher ear germination resistance than its recurrent parent, Nihonbare, indicating that Kasalath-derived Sdr4 has a higher ability to suppress germination. There are only two haplotypes of Sdr4 gene, Nipponbare type and Kasalath type, and chimera type in 60 cultivated rice. The present inventors have found that it can be used as a DNA marker for selecting a germinating difficulty gene.

  That is, the present inventors succeeded in isolating and identifying the base sequence of Sdr4, which is a panicle germination resistance gene, by a map-based cloning method. Furthermore, the present inventors have succeeded in developing a method for easily modifying the dormancy of rice, thereby completing the present invention.

More specifically, the present invention provides the following [1] to [27].
[1] The DNA according to any one of (a) to (h) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6
(B) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence of SEQ ID NO: 1, 2, 4 or 5
(E) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 9
(F) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 8
(G) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9
(H) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8
[2] The DNA according to [1], wherein the plant is a monocotyledonous plant or a dicotyledonous plant.
[3] The DNA according to any one of (a) to (d) below.
(A) DNA encoding an antisense RNA complementary to the transcription product of DNA according to [1] or [2]
(B) DNA encoding an RNA having ribozyme activity that specifically cleaves the transcript of the DNA of [1] or [2]
(C) DNA encoding an RNA that suppresses the expression of the DNA according to [1] or [2] due to an RNAi effect during expression in a plant cell
(D) DNA encoding an RNA that suppresses the expression of the DNA according to [1] or [2] due to a co-suppression effect during expression in plant cells
[4] The DNA according to any one of [1] to [3], which is used for controlling seed dormancy of a plant.
[5] The DNA according to (a) or (b) below, which is a mutant of the protein according to [1] and encodes a plant-derived protein lacking the function of controlling seed dormancy of the plant.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 7
(B) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 7
[6] A vector comprising the DNA according to any one of [1] to [5].
[7] A transformed plant cell carrying the DNA according to any one of [1] to [5] or the vector according to [6].
[8] A transformed plant comprising the transformed plant cell according to [7].
[9] A transformed plant that is a descendant or clone of the transformed plant according to [8].
[10] A propagation material for the transformed plant according to [8] or [9].
[11] A method for producing a transformed plant according to [8] or [9], wherein the DNA according to any one of [1] to [5] or the vector according to [6] is applied to a plant cell. A method comprising introducing and regenerating a plant from the plant cell.
[12] [1] A method for suppressing germination of a plant, characterized in that the DNA according to any one of (a) to (d) is expressed in cells of the plant body.
[13] A method for promoting germination of a plant, comprising suppressing endogenous DNA expression according to any one of (a) to (d) in a plant cell.
[14] The method according to [13], wherein the DNA according to [3] is introduced into a plant.
[15] [1] A method for promoting plant germination, which comprises expressing the DNA according to any one of (e) to (h) in a cell of a plant body.
[16] A method for suppressing germination of a plant, comprising suppressing endogenous DNA expression according to any one of (1) to (h) in a plant cell.
[17] The method according to [16], wherein the DNA according to [3] is introduced into a plant.
[18] A method for detecting ear germination resistance of a test plant, comprising detecting a mutation at a site corresponding to the DNA of [1] for the test plant.
[19] The method according to [18], wherein the mutation is a single nucleotide polymorphism mutation.
[20] A method for detecting ear germination resistance of a test plant, comprising the following steps (a) and (b).
(A) Step of determining the base type of the polymorphic site in the site corresponding to the DNA according to [1] in the test plant (b) In the base type of the polymorphic site determined in (a), SEQ ID NO: The step of determining that the test plant is resistant to sprout germination when a mutation having the same type as 4 or 5 is detected [21], the polymorphic site is position 223 in the base sequence set forth in SEQ ID NO: 2, 297, 531, 1145, 1156-1157, 1411, 1624, 1945, 2027, 2182-2184, 2188, 2190, 2191, 2193, 2194, 2195, 2280 The method according to any one of [18] to [20], wherein the site is a site corresponding to at least one polymorphic site selected from position, 2494, and 3092.
[22] In the base sequence described in SEQ ID NO: 2, the variation of the base type at the polymorphic site is from G to A for the 223rd base, from A to G for the 297th base, between 530 and 531 1 base (A) insertion, 1145 position base species from A to G, 1156-1157 position 2 base deletion, 1411 position 4 base (ACCC) insertion, 1624 position base type from C G, 1945 position base species G to T, 2027 position base species A to G, 2182-2184 position 3 bases (CGG) deletion, 2188 position base species C to G, 2190 position base Species is G to C, 2191th base type is C to A, 2193rd base type is G to C, 2194th base type is G to T, 2195th base type is A to C, 2280th base When the species is at least one mutation selected from C to T, the base species at position 2494 is G to C, and the base species at position 3092 is C to T, The method according to [21], wherein the determination is performed.
[23] A primer for detecting ear germination resistance, which comprises an oligonucleotide that specifically hybridizes with the DNA of [1] under stringent conditions and has a chain length of at least 15 nucleotides.
[24] The primer according to [23], comprising the base sequence according to SEQ ID NO: 11 or 12.
[25] A probe for detecting ear germination resistance, comprising an oligonucleotide that specifically hybridizes with the DNA of [1] under stringent conditions and has a chain length of at least 15 nucleotides.
[26] The probe according to [25], which specifically hybridizes to a region containing the polymorphic site according to [21].
[27] A method for selecting a plant having a function of controlling seed dormancy, which comprises the steps of (a) and (b) below:
(A) a step of producing a variety in which a plant having an ear germination resistance and a plant having an arbitrary function are crossed,
(B) The process of detecting the ear germination tolerance of the plant produced at the process (a) by the method as described in [18].

  Over-expression of this gene or introduction of Kasalath type or Nipponbare type Sdr4 can enhance rice germination tolerance. The period required for transformation is extremely short compared to gene transfer by mating, which can contribute to the improvement of resistance to ear germination without changing other traits and contribute to the breeding of rice varieties. .

  In addition, since Sdr4 homologous gene AtSdr4L1 in Arabidopsis thaliana was also found to be involved in germination control, the Sdr4 gene revealed in the present invention is germinated in all plants from monocotyledonous plants to dicotyledonous plants. It can be said that it is a factor that regulates. Therefore, this gene is also useful for improving the germination resistance of barley and wheat, which are gramineous crops.

[Embodiment of the Invention]
The present invention relates to a novel gene Sdr4 that controls plant seed dormancy, and a method for controlling plant seed dormancy using the gene. The present inventors have clarified the relationship with seed dormancy, the nucleotide sequence of cDNA of Nipponbare Sdr4 gene is SEQ ID NO: 1, the nucleotide sequence of genomic DNA is SEQ ID NO: 2, and the proteins encoded by these genes Is shown in SEQ ID NO: 3. The nucleotide sequence of the Kasalath Sdr4 gene cDNA is shown in SEQ ID NO: 4, the nucleotide sequence of genomic DNA is shown in SEQ ID NO: 5, and the amino acid sequence of the protein encoded by these genes is shown in SEQ ID NO: 6. In addition, the base sequence of the genomic DNA of the AtSdr4L1 gene of Arabidopsis thaliana is shown in SEQ ID NO: 8, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 9.

  The rice quantitative trait locus (QTL), Sdr4, has been known as a locus involved in rice seed dormancy, located in one of the vast regions of the long arm of rice chromosome 7. It was. The present inventors narrowed down the region where the Sdr4 gene is present in rice chromosome 7 by utilizing a map-based cloning technique, and finally succeeded in identifying it as a single gene. Furthermore, we found that the Arabidopsis AtSdr4L1 gene, which is highly homologous to the Sdr4 gene, is involved in seed dormancy.

  In the present invention, “seed dormancy” refers to a function of suppressing the germination of plant seeds until a suitable cultivation environment is provided. In other words, germination is promoted by suppressing seed dormancy. A suitable cultivation environment preferably includes, but is not limited to, temperature, light, and moisture supply suitable for germination.

The present invention relates to a plant-derived Sdr4 gene and AtSdr4L1 gene having a function of controlling plant seed dormancy.
Specifically, the Sdr4 gene of the present invention includes a DNA described in any of (a) to (d) below, which encodes a plant-derived protein having a function of promoting plant seed dormancy.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1, 2, 4 or 5.
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6.
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5.

In addition, the AtSdr4L1 gene of the present invention specifically includes the DNA described in any of (e) to (h) below, which encodes a plant-derived protein having a function of suppressing plant seed dormancy. It is.
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9.
(F) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 8.
(G) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9.
(H) A DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8.

By using the Sdr4 gene or the AtSdr4L1 gene of the present invention, for example, it becomes possible to prepare a recombinant protein or to produce a transformed plant having a modified germination ability.
In the present invention, the plant from which the gene of the present invention is derived is not particularly limited, for example, rice, corn, wheat, barley, oat, pearl barley, Italian ryegrass, perennial ryegrass, timothy, meadow fescue, millet, millet, sugar cane, Examples thereof include monocotyledonous plants such as pearl millet and dicotyledonous plants such as rapeseed, soybean, cotton, tomato and potato. Examples of flowering plants include chrysanthemum, roses, carnations, and cyclamen, but are not limited thereto. The plant from which the gene of the present invention is derived is preferably a monocotyledonous plant or a dicotyledonous plant, and more preferably rice, wheat, and Arabidopsis thaliana.

  The `` Sdr4 gene '' and `` AtSdr4L1 gene '' of the present invention are not particularly limited in form as long as they can encode `` Sdr4 protein '' and `` AtSdr4L1 protein '', respectively, `` Sdr4 gene '', `` AtSdr4L1 gene '' In addition to cDNA, each includes genomic DNA, chemically synthesized DNA, and the like. In addition, as long as the Sdr4 gene encodes the Sdr4 protein and the AtSdr4L1 gene encodes the AtSdr4L1 protein, DNA having an arbitrary base sequence based on the degeneracy of the genetic code is included.

  The coding region of the gene of the present invention has, for example, positions 69 to 1100 in the base sequence described in SEQ ID NO: 1, positions 1675 to 2706 in the base sequence described in SEQ ID NO: 2, and the base sequence described in SEQ ID NO: 4. The region of positions 69 to 1097 in SEQ ID NO: 5, positions 1678 to 2706 in the base sequence of SEQ ID NO: 5, and positions 1930 to 2994 in the base sequence of SEQ ID NO: 8 can be exemplified.

  Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. For genomic DNA, for example, genomic DNA is extracted from a plant, a genomic library (vectors such as plasmids, phages, cosmids, BACs, PACs, etc. can be used), expanded, and Sdr4 gene (for example, Colony hybridization or plaque hybridization using a probe prepared on the basis of the AtSdr4L1 gene (for example, the DNA described in SEQ ID NO: 8). It is possible to prepare by performing. It is also possible to prepare a primer specific for the Sdr4 gene or AtSdr4L1 gene and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from a plant, inserted into a vector such as λZAP to create a cDNA library, developed, and colony hybridization in the same manner as described above. Alternatively, it can be prepared by performing plaque hybridization or by performing PCR.

  Furthermore, since the Sdr4 gene or AtSdr4L1 gene is considered to exist widely in the plant kingdom, the Sdr4 gene or AtSdr4L1 gene includes homologous genes present in various plants. Here, the “homologous gene” refers to a gene encoding a protein functionally equivalent to the Sdr4 gene product or the AtSdr4L1 gene product in rice or Arabidopsis thaliana in various plants. Examples of such proteins include mutants, alleles, variants, homologs of Sdr4 protein or AtSdr4L1 protein, partial peptides of Sdr4 protein or AtSdr4L1 protein, or fusion proteins with other proteins. It is not limited.

  The mutant of Sdr4 protein or AtSdr4L1 protein in the present invention consists of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3, 6 or 9. Mention may be made of naturally occurring proteins that are functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 3, 6 or 9. A protein encoded by a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4, 5 or 8, comprising SEQ ID NO: 1, A protein functionally equivalent to the protein consisting of the amino acid sequence described in 2, 4, 5 or 8 can also be mentioned as a variant of Sdr4 protein or AtSdr4L1 protein.

  In the present invention, the number of amino acids to be mutated is not particularly limited, but is usually within 30 amino acids, preferably within 15 amino acids, and more preferably within 5 amino acids (for example, within 3 amino acids). The amino acid residue to be mutated is preferably mutated to another amino acid in which the properties of the amino acid side chain are conserved. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids having amino acids (C, M), amino acids having carboxylic acid and amide-containing side chains (D, N, E, Q), amino acids having base-containing side chains (R, K, H), aromatic-containing side chains The amino acids (H, F, Y, W) that can be used can be listed (the parentheses indicate the single letter of the amino acid). It is already known that a polypeptide having an amino acid sequence modified by deletion, addition and / or substitution by one or more amino acid residues to a certain amino acid sequence maintains its biological activity. Yes.

  In the present invention, “functionally equivalent” means that the target protein has a biological function or biochemical function equivalent to that of the Sdr4 protein or AtSdr4L1 protein. In the present invention, examples of the biological function and biochemical function of the Sdr4 protein include seed dormancy, and examples of the biological function and biochemical function of the AtSdr4L1 protein include seed germination. Biological properties include the specificity of the site to be expressed and the expression level.

  Methods well known to those skilled in the art for isolating homologous genes include hybridization techniques (Southern, EM, Journal of Molecular Biology, Vol. 98, 503, 1975) and polymerase chain reaction (PCR) techniques (Saiki). , RK, et al. Science, vol. 230, 1350-1354, 1985, Saiki, RK et al. Science, vol. 239, 487-491, 1988). That is, for those skilled in the art, the nucleotide sequence of the Sdr4 gene (for example, the DNA described in any of SEQ ID NOs: 1, 2, 4, or 5) or the nucleotide sequence of the AtSdr4L1 gene (for example, the DNA of SEQ ID NO: 8). It is usually possible to isolate homologous genes of Sdr4 gene or AtSdr4L1 gene from various plants using a part of them as probes and oligonucleotides that specifically hybridize to Sdr4 gene or AtSdr4L1 gene as primers. It is.

  In order to isolate DNA encoding such a homologous gene, a hybridization reaction is usually carried out under stringent conditions. Those skilled in the art can appropriately select stringent hybridization conditions. An example is 25% formamide, 50% formamide under more severe conditions, 4 × SSC, 50 mM Hepes pH 7.0, 10 × Denhardt's solution, 20 μg / ml denatured in a hybridization solution containing denatured salmon sperm DNA at 42 ° C. After overnight prehybridization, a labeled probe is added and hybridization is performed by incubating overnight at 42 ° C. The cleaning solution and temperature conditions for the subsequent cleaning are about 1xSSC, 0.1% SDS, 37 ° C, more severe conditions are about 0.5xSSC, 0.1% SDS, 42 ° C, and more severe conditions are about 0.2xSSC. , 0.1% SDS, about 65 ° C. ”. Thus, isolation of DNA having high homology with the probe sequence can be expected as the conditions for washing hybridization are more severe. However, combinations of the above SSC, SDS, and temperature conditions are exemplary, and those skilled in the art will understand the above or other factors that determine the stringency of hybridization (eg, probe concentration, probe length, hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.

  The homology of the isolated DNA is at least 50% or more, more preferably 70% or more, more preferably 90% or more (for example, 95%, 96%, 97%, 98%, 99%) in the entire amino acid sequence. And the like). Sequence homology can be determined using BLASTN (nucleic acid level) and BLASTX (amino acid level) programs (Altschul et al. J. Mol. Biol., 215: 403-410, 1990). The program is based on the algorithm BLAST by Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 87: 2264-2268, 1990, Proc. Natl. Acad. Sci. USA, 90: 5873-5877, 1993). Yes. When analyzing a base sequence by BLASTN, parameters are set to score = 100 and wordlength = 12, for example. Further, when the amino acid sequence is analyzed by BLASTX, the parameters are, for example, score = 50 and wordlength = 3. When the amino acid sequence is analyzed using the Gapped BLAST program, it can be performed as described in Altschul et al. (Nucleic Acids Res. 25: 3389-3402, 1997). When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods of these analysis methods are known.

The present invention also provides a DNA described in any one of (a) to (d) below for use in controlling seed dormancy of a plant.
(A) DNA encoding an antisense RNA complementary to a transcript of the Sdr4 gene or AtSdr4L1 gene.
(B) DNA encoding an RNA having a ribozyme activity that specifically cleaves a transcript of the Sdr4 gene or AtSdr4L1 gene.
(C) DNA encoding RNA that suppresses the expression of the Sdr4 gene or AtSdr4L1 gene due to the RNAi effect during expression in plant cells.
(D) DNA encoding RNA that suppresses Sdr4 gene or AtSdr4L1 gene expression due to a co-suppression effect during expression in plant cells.

  In the present invention, the plant that suppresses the expression of the Sdr4 gene or AtSdr4L1 gene is not particularly limited, and a desired plant for controlling the seed dormancy of the plant can be used. is there. There are no particular restrictions on useful crops, but examples include monocotyledonous plants such as rice, corn, wheat, barley, oat, pearl barley, Italian ryegrass, perennial ryegrass, timothy, meadow fescue, millet, millet, sugarcane, pearl millet, And dicotyledonous plants such as soybean, cotton, tomato and potato.

  In the present specification, “suppression of Sdr4 gene or AtSdr4L1 gene expression” includes suppression of gene transcription and suppression of protein translation. Also included is a decrease in expression as well as complete cessation of DNA expression.

  One embodiment of “DNA used to suppress expression of Sdr4 gene or AtSdr4L1 gene” is DNA encoding an antisense RNA complementary to the Sdr4 gene or AtSdr4L1 gene. The antisense effect in plant cells was demonstrated for the first time by the antisense RNA introduced by electroporation using a transient gene expression method to exert an antisense effect in plants (Ecker and Davis, Proc. Natl Acad. USA, 83: 5372, 1986). Subsequently, tobacco and petunia have been reported to decrease the expression of target genes by expressing antisense RNA (Krol et. Al., Nature 333: 866, 1988), and currently suppress gene expression in plants. Established as a means to

  There are several factors as described below for the action of an antisense nucleic acid to suppress the expression of a target gene. That is, transcription initiation inhibition by triplex formation, transcription inhibition by hybridization with a site where an open loop structure is locally created by RNA polymerase, transcription inhibition by hybridization with RNA that is undergoing synthesis, intron and exon Of splicing by hybrid formation at the junction with the protein, suppression of splicing by hybridization with the spliceosome formation site, suppression of transition from the nucleus to the cytoplasm by hybridization with mRNA, hybridization with capping sites and poly (A) addition sites Splicing suppression by formation, translation initiation suppression by hybridization with the translation initiation factor binding site, translation suppression by hybridization with the ribosome binding site near the initiation codon, peptization by hybridization with the mRNA translation region and polysome binding site For example, inhibition of gene chain elongation is prevented, and hybridization between nucleic acid and protein interaction sites is performed. They inhibit transcription, splicing, or translation processes and suppress target gene expression (Hirashima and Inoue, "Neurochemistry Experiment Course 2, Nucleic Acid IV Gene Replication and Expression", edited by the Japanese Biochemical Society, Tokyo Kagaku Dojin , pp.319-347, 1993).

  The antisense sequence used in the present invention may suppress the expression of the target gene by any of the actions described above. In one embodiment, if an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the gene is designed, it will be effective for inhibiting translation of the gene. However, sequences complementary to the coding region or the 3 ′ untranslated region can also be used. As described above, a DNA containing an antisense sequence of a non-translated region as well as a translated region of a gene is also included in the antisense DNA used in the present invention. The antisense DNA to be used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side.

  Antisense DNA is, for example, a phosphorothioate method (Stein, Nucleic Acids Res., 16: 3209-3221, 1988) based on the sequence information of DNA set forth in SEQ ID NO: 1, 2, 4, 5 or 8. Or the like. The prepared DNA can be transformed into a desired plant by a known method. The sequence of the antisense DNA is preferably a sequence complementary to the transcription product of the endogenous gene of the plant to be transformed, but may not be completely complementary as long as the gene expression can be effectively inhibited. . The transcribed RNA preferably has a complementarity of 90% or more (eg, 95%, 96%, 97%, 98%, 99% or more) to the transcript of the target gene. In order to effectively inhibit the expression of the target gene using the antisense sequence, the length of the antisense DNA is at least 15 bases or more, preferably 100 bases or more, more preferably 500 bases or more. is there. Usually, the length of the antisense DNA used is shorter than 5 kb, preferably shorter than 2.5 kb.

  Suppression of endogenous Sdr4 gene or AtSdr4L1 gene expression can also be carried out using DNA encoding a ribozyme. A ribozyme refers to an RNA molecule having catalytic activity. Some ribozymes have a variety of activities. Among them, research on ribozymes as enzymes that cleave RNA has made it possible to design ribozymes for site-specific cleavage of RNA. Some ribozymes have a group I intron type or a size of 400 nucleotides or more like M1RNA contained in RNaseP, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type ( Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzymes, 35: 2191, 1990).

  For example, the self-cleaving domain of hammerhead ribozyme cleaves on the 3 ′ side of C15 of G13U14C15, but it is important for U14 to form a base pair with A at position 9, and the base at position 15 is In addition to C, it has been shown to be cleaved by A or U (Koizumi et. Al., FEBS Lett. 228: 225, 1988). If the ribozyme substrate binding site is designed to be complementary to the RNA sequence near the target site, it is possible to create a restriction enzyme-like RNA-cleaving ribozyme that recognizes the UC, UU, or UA sequence in the target RNA. (Koizumi et. Al., FEBS Lett. 239: 285, 1988, Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzyme, 35: 2191, 1990, Koizumi et. Al., Nucleic. Acids. Res. 17: 7059, 1989).

  Hairpin ribozymes are also useful for the purposes of the present invention. Hairpin ribozymes are found, for example, in the minus strand of satellite RNA of tobacco ring spot virus (Buzayan, Nature 323: 349, 1986). It has been shown that this ribozyme can also be designed to cause target-specific RNA cleavage (Kikuchi and Sasaki, Nucleic Acids Res. 19: 6751, 1992, and Hiroshi Kikuchi, Chemistry and Biology 30: 112, 1992).

  A ribozyme designed to cleave the target is linked to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence so that it is transcribed in plant cells. However, at that time, if an extra sequence is added to the 5 ′ end or 3 ′ end of the transcribed RNA, the ribozyme activity may be lost. In such a case, in order to accurately cut out only the ribozyme part from the RNA containing the transcribed ribozyme, another trimming ribozyme that acts in cis for trimming is placed on the 5 'side or 3' side of the ribozyme part. (Taira et.al., Protein Eng. 3: 733, 1990, Dzianott and Bujarski, Proc. Natl. Acad. Sci. USA, 86: 4823, 1989, Grosshans and Cech, Nucleic Acids Res. 19 : 3875, 1991, Taira et. Al., Nucleic Acids Res. 19: 5125, 1991).

  In addition, such structural units can be arranged in tandem so that multiple sites in the target gene can be cleaved, thereby further enhancing the effect (Yuyama et al., Biochem. Biophys. Res. Commun. 186: 1271 , 1992). Such a ribozyme can be used to specifically cleave the transcription product of the target gene in the present invention, thereby suppressing the expression of the gene.

  Suppression of endogenous gene expression can also be achieved by “co-suppression” resulting from transformation of DNA having a sequence identical or similar to the target gene sequence. “Co-suppression” refers to a phenomenon in which the expression of both a foreign gene and a target endogenous gene to be introduced is suppressed when a gene having the same or similar sequence as that of the target endogenous gene is introduced into a plant by transformation. Say. Details of the mechanism of co-suppression are not clear, but are often observed in plants (Curr. Biol. 7: R793, 1997, Curr. Biol. 6: 810, 1996).

  For example, in order to obtain a plant body in which the Sdr4 gene or AtSdr4L1 gene is co-suppressed, the vector DNA prepared so that the Sdr4 gene or AtSdr4L1 gene or a DNA having a similar sequence can be expressed is transformed into the target plant. Then, a plant having an Sdr4 mutant or AtSdr4L1 mutant trait may be selected from the obtained plant body. The gene used for co-suppression need not be completely identical to the target gene, but is at least 70% or more, preferably 80% or more, more preferably 90% or more (eg, 95%, 96%, 97%, 98 %, 99% or more).

  Furthermore, suppression of the expression of the endogenous gene in the present invention can also be achieved by transforming a gene having a dominant negative trait of the target gene into a plant. A gene having a dominant negative trait refers to a gene having a function of eliminating or reducing the activity of an endogenous wild-type gene inherent in a plant by expressing the gene.

  Another embodiment of “DNA used to suppress the expression of Sdr4 gene or AtSdr4L1 gene” is DNA encoding a dsRNA complementary to a transcription product of endogenous Sdr4 gene or AtSdr4L1 gene. RNAi is a phenomenon in which, when a double-stranded RNA (hereinafter referred to as dsRNA) having the same or similar sequence as a target gene sequence is introduced into a cell, the expression of the introduced foreign gene and target endogenous gene are both suppressed. When dsRNA of about 40 to several hundred base pairs is introduced into a cell, a RNaseIII-like nuclease called Dicer with a helicase domain is present in the presence of ATP, and dsRNA is about 21 to 23 base pairs from the 3 ′ end. Cut out and produce siRNA (short interference RNA). A protein specific to this siRNA binds to form a nuclease complex (RISC: RNA-induced silencing complex). This complex recognizes and binds to the same sequence as siRNA, and cleaves the mRNA of the target gene at the center of siRNA by RNaseIII-like enzyme activity. In addition to this pathway, the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RsRP) to synthesize dsRNA. There is also a possibility that this dsRNA becomes Dicer's substrate again to generate new siRNA and amplify the action.

  The RNA of the present invention can be expressed from an antisense coding DNA that encodes an antisense RNA to any region of the target gene mRNA and a sense code DNA that encodes a sense RNA of any region of the target gene mRNA. . Moreover, dsRNA can also be produced from these antisense RNA and sense RNA.

  When the dsRNA expression system of the present invention is retained in a vector or the like, the antisense RNA and sense RNA are expressed from the same vector, and the antisense RNA and sense RNA are expressed from different vectors, respectively. There is. For example, antisense RNA and sense RNA can be expressed from the same vector as an antisense RNA in which a promoter capable of expressing a short RNA such as polIII is linked upstream of the antisense code DNA and the sense code DNA. It can be constructed by constructing an expression cassette and a sense RNA expression cassette, respectively, and inserting these cassettes into the vector in the same direction or in the opposite direction. It is also possible to construct an expression system in which the antisense code DNA and the sense code DNA are arranged in opposite directions so as to face each other on different strands. In this configuration, one double-stranded DNA (siRNA-encoding DNA) in which an antisense RNA coding strand and a sense RNA coding strand are paired is provided, and antisense RNA and sense RNA from each strand are provided on both sides thereof. A promoter is provided oppositely so that it can be expressed. In this case, in order to avoid adding extra sequences downstream of the sense RNA and antisense RNA, a terminator is added to the 3 ′ end of each strand (antisense RNA coding strand, sense RNA coding strand). It is preferable to provide. As this terminator, a sequence in which four or more A (adenine) bases are continued can be used. Moreover, in this palindromic style expression system, it is preferable that the types of the two promoters are different.

  In addition, as a configuration for expressing antisense RNA and sense RNA from different vectors, for example, antisense coding DNA and an antisense in which a promoter capable of expressing a short RNA such as polIII is linked upstream of sense coding DNA. An RNA expression cassette and a sense RNA expression cassette can be constructed, and these cassettes can be held in different vectors.

  In the RNAi of the present invention, siRNA may be used as dsRNA. “SiRNA” means a double-stranded RNA consisting of short strands that are not toxic in cells, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, and more preferably 21 Can be ~ 30 base pairs. Alternatively, the siRNA to be expressed is transcribed and the length of the final double-stranded RNA portion is, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, more preferably 21 to 30 base pairs. be able to. The DNA used for RNAi need not be completely identical to the target gene, but has at least 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more sequence homology. . Specific examples of the siRNA of the present invention include the siRNA described in SEQ ID NO: 10.

  The part of the double-stranded RNA in which the RNAs in dsRNA are paired is not limited to a perfect pair, but mismatch (corresponding base is not complementary), bulge (no base corresponding to one strand) ) Or the like may include an unpaired portion. In the present invention, both bulges and mismatches may be included in the double-stranded RNA region where RNAs in dsRNA pair with each other.

The present invention includes Sdr4 mutants or AtSdr4L1 mutants that are deficient in the function of controlling plant seed dormancy.
Sdr4 mutants or AtSdr4L1 mutants are produced by introducing mutations by substituting amino acid residues in the amino acid sequence of Sdr4 protein or AtSdr4L1 protein, respectively. Specifically, the secondary structure of the amino acid sequence of the Sdr4 protein or AtSdr4L1 protein is obtained using a known molecular modeling program such as WHATIF (Vriend et al., J. Mol. Graphics (1990) 8, 52-56). And evaluating the influence on the total number of amino acid residues to be substituted. After determining the appropriate substitution amino acid residue, Sdr4 mutation is introduced by introducing a mutation using a vector containing a nucleotide sequence encoding Sdr4 protein or AtSdr4L1 protein as a template so that the amino acid is substituted by a conventional PCR method. Or genes encoding the AtSdr4L1 mutant, respectively.

More specifically, the Sdr4 mutant of the present invention is an Sdr4 mutant lacking a function of controlling seed dormancy of a plant, which encodes a plant-derived protein, as described in (a) or (b) below: Can be mentioned.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 7.
(B) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 7.
The Sdr4 mutant can be used to improve the germination ability of cultivars with low germination rates. In other words, the germinating ability of a variety having strong dormancy can be improved by the mutant.

  According to the present inventors, the Sdr4 mutant has 7 amino acids corresponding to positions 309 to 315 in the amino acid sequence shown in SEQ ID NO: 3 or positions 308 to 314 in the amino acid sequence shown in SEQ ID NO: 6. It was found to be deleted. Therefore, the Sdr4 protein of the present invention preferably has the 7 amino acids.

  The present invention also provides a vector comprising Sdr4 gene, AtSdr4L1 gene, or DNA that suppresses expression of Sdr4 gene or AtSdr4L1 gene, and transformed plant cells.

  The vector of the present invention includes a vector constructed for inducing the above-mentioned RNAi. Since the vector of the present invention contains the DNA of the present invention, when introduced into a cell, single-stranded RNA formed by transcription in the cell paired within the molecule to form dsRNA. A vector constructed for inducing such RNAi can consequently induce transcriptional activation of the endogenous gene.

As the vector of the present invention, in addition to the above-mentioned vector used for the transcriptional activation of the endogenous gene, a vector for expressing the DNA of the present invention in a cell for preparing a transformant, for example, for preparing a transformed plant body Also included are vectors for expressing the DNA of the present invention in plant cells. The vector used for the transformation of plant cells is not particularly limited as long as the inserted gene can be expressed in the cells. For example, a plasmid, a phage, or a cosmid can be exemplified.
The “plant cell” includes various forms of plant cells such as suspension culture cells, protoplasts, leaf sections, callus and the like.

The vector of the present invention may contain a promoter for constitutively or inducibly expressing the DNA of the present invention.
Those skilled in the art can appropriately prepare a vector having a desired DNA by a general genetic engineering technique. Usually, various commercially available vectors can be used.
The vector of the present invention is also useful for retaining or expressing the DNA of the present invention in a host cell.

  The DNA in the present invention is usually carried (inserted) into an appropriate vector and introduced into a host cell. That is, the present invention provides a host cell carrying the DNA or vector of the present invention. The vector is not particularly limited as long as it can stably hold the inserted DNA. For example, if Escherichia coli is used as a host, a pBluescript vector (Stratagene) is preferred as a cloning vector, but commercially available. Various vectors can be used. An expression vector is particularly useful when a vector is used for the purpose of introducing and expressing the DNA of the present invention into a cell having an endogenous gene. The expression vector is not particularly limited as long as it is a vector that expresses DNA in vitro, in E. coli, in cultured cells, or in an individual organism. For example, in the case of in vitro expression, pBEST vector (manufactured by Promega), E. coli PET vector (manufactured by Invitrogen) if present, pME18S-FL3 vector (GenBank Accession No. AB009864) for cultured cells, pME18S vector (Mol Cell Biol. 8: 466-472 (1988)) for individual organisms, plants If it is an individual, a pBINPLUS vector (van Engelen, FA et al., (1995). PBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res. 4, 288-290.) May be exemplified. The DNA of the present invention can be inserted into a vector by a conventional method (Molecular Cloning, 5.61-5.63), for example, by a ligase reaction using a restriction enzyme site.

  There is no restriction | limiting in particular as said host cell, According to the objective, various host cells are used. Examples of the cells for expressing the DNA of the present invention include bacterial cells (eg, Streptococcus, Staphylococcus, E. coli, Streptomyces, Bacillus subtilis), insect cells (eg, Drosophila S2, Spodoptera SF9), animal cells ( Examples: CHO, COS, HeLa, C127, 3T3, BHK, HEK293, Bowes melanoma cells) and plant cells.

In addition, as a method for expressing the DNA of the present invention in vivo, the DNA of the present invention is incorporated into an appropriate vector, for example, polyethylene glycol method, electroporation method, Agrobacterium method, liposome method, cationic liposome method. , Calcium phosphate precipitation method, electric pulse perforation method (electroporation) (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 9.1-9.9), lipofection method (GIBCO-BRL) ), A method of introducing into a living body by a method known to those skilled in the art, such as a microinjection method and a particle gun method.
Administration into a plant may be an ex vivo method or an in vivo method.

In addition, when the DNA of the present invention is introduced into a plant body, the DNA can be directly introduced into a plant cell using a microinjection method, an electroporation method, a polyethylene glycol method, etc. It can also be introduced into a plant cell indirectly via a virus or bacterium capable of infecting a plant as a vector. Examples of such viruses include cauliflower mosaic virus, tobacco mosaic virus, gemini virus and the like as typical viruses, and Agrobacterium and the like as bacteria. When introducing a gene into a plant by the Agrobacterium method, a commercially available plasmid can be used. As a method for introducing the DNA of the present invention into a plant body using such a vector, the leaf disk method (Jorgensen, RA et al., (1996), preferably introducing a gene via Agrobacterium. ). Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and single-copy vs. complex T-DNA sequences. Plant Mol. Biol. 31, 957-973.).
These transformation methods described above are preferably selected as appropriate depending on the type of plant or the like that serves as the host (for example, monocotyledonous plants or dicotyledonous plants).

  In the present invention, the “plant” is not particularly limited, but monocotyledonous plants such as rice, corn, wheat, barley, oat, pearl barley, Italian ryegrass, perennial ryegrass, timothy, meadow fescue, millet, millet, sugarcane, pearl millet, etc. And dicotyledonous plants such as rapeseed, soybean, cotton, tomato and potato. Examples of flower plants include chrysanthemum, roses, carnations, and cyclamen.

The present invention also provides a plant cell carrying the DNA of the present invention or the vector of the present invention. Furthermore, this invention provides the transformed plant body containing the plant cell of this invention. The cells into which the DNA of the present invention or the vector of the present invention is introduced include plant cells for producing transformed plants. There is no restriction | limiting in particular as a plant cell.
The plant cells of the present invention include cultured cells as well as cells in the plant body. Also included are protoplasts, shoot primordia, multi-buds, and hairy roots.

  Regeneration of plant bodies from transformed plant cells can be performed by methods known to those skilled in the art depending on the type of plant cells. For example, with regard to the technique for producing a transformed plant body, a method for regenerating a plant body by introducing a gene into protoplasts using polyethylene glycol, a method for regenerating a plant body by introducing a gene into protoplasts using an electric pulse, or a gene for cells by a particle gun method. Can be mentioned, and a method for regenerating a plant body and a method for regenerating a plant body by introducing a gene via Agrobacterium are not particularly limited. Some techniques have already been established and are widely used in the technical field of the present invention. In the present invention, these methods can be suitably used.

In order to efficiently select plant cells transformed by introduction of a vector containing the DNA of the present invention, the above recombinant vector contains an appropriate selection marker gene or is introduced into a plant cell together with a plasmid vector containing a selection marker gene. It is preferable to do. Selectable marker genes used for this purpose include, for example, the neomycin phosphotransferase gene that is resistant to the antibiotics kanamycin or gentamicin, the hygromycin phosphotransferase gene that is resistant to hygromycin, and the acetyl that is resistant to the herbicide phosphinothricin. Examples include transferase genes.
Plant cells into which the recombinant vector has been introduced are placed on a known selection medium containing a suitable selection agent according to the type of the introduced selection marker gene and cultured. As a result, transformed plant cultured cells can be obtained.

  Transformed plant cells can regenerate plant bodies by redifferentiation. The method of redifferentiation varies depending on the type of plant cell. For example, Fujimura et al. (Plant Tissue Culture Lett. 2:74 (1995)) can be used for rice, and Shillito et al. (Bio / Technology 7) for maize. : 581 (1989)) and Gorden-Kamm et al. (Plant Cell 2: 603 (1990)), and for potatoes, Visser et al. (Theor. Appl. Genet 78: 594 (1989)). In the case of tobacco, the method of Nagata and Takebe (Planta 99:12 (1971)) can be cited, and in the case of Arabidopsis, the method of Akama et al. (Plant Cell Reports 12: 7-11 (1992)) can be cited as eucalyptus. Then, the method of Toi et al. (Japanese Patent Laid-Open No. 8-89113) can be mentioned.

In addition, the presence of introduced foreign DNA in a transformed plant that has been regenerated and cultivated in this way can be analyzed by a known PCR method or Southern hybridization method, or by analyzing the base sequence of the DNA in the plant body. Can be confirmed.
In this case, extraction of DNA from the transformed plant body can be performed according to a known method of J. Sambrook et al. (Molecular Cloning, 2nd edition, Cold Spring Harbor Laboratory Press, 1989).

  When the foreign gene comprising the DNA of the present invention present in the regenerated plant body is analyzed using the PCR method, the amplification reaction is performed using the DNA extracted from the regenerated plant body as a template as described above. In addition, an amplification reaction is carried out in a reaction mixture in which the DNA of the present invention or a synthesized oligonucleotide having a base sequence appropriately selected according to the base sequence of the DNA modified according to the present invention is used as a primer. You can also. In the amplification reaction, DNA denaturation, annealing, and extension reactions are repeated several tens of times to obtain an amplification product of a DNA fragment containing the DNA sequence of the present invention. When the reaction solution containing the amplification product is subjected to, for example, agarose electrophoresis, it is possible to confirm that the amplified DNA fragments are fractionated and the DNA fragments correspond to the DNA of the present invention.

  Once a transformed plant into which the DNA of the present invention is introduced into the genome is obtained, offspring can be obtained from the plant by sexual reproduction or asexual reproduction. It is also possible to obtain a propagation material (for example, seeds, fruits, cuttings, tubers, tuberous roots, strains, callus, protoplasts, etc.) from the plant body, its descendants or clones, and mass-produce the plant body based on them. Is possible. The present invention includes plant cells into which the DNA or vector of the present invention has been introduced, plant bodies containing the cells, progeny and clones of the plant bodies, and propagation materials for the plant bodies, their progeny, and clones. These plant cells, plants containing the cells, progeny and clones of the plants, and propagation materials of the plants, progeny and clones thereof can be used in a method for controlling seed dormancy of plants. .

In the present invention, plant germination can be suppressed by promoting the expression of the plant Sdr4 gene. The plant produced by the method of the present invention can increase the resistance to sprout germination in useful crops, for example.
Furthermore, it is conceivable to suppress plant germination by introducing an exogenous Sdr4 gene into the plant. Production of a transformant of a plant introduced with an exogenous Sdr4 gene can be performed by the method described above. That is, a target transformed plant can be produced by inserting the gene into a vector that functions in a plant cell, introducing the vector into the plant cell, and regenerating the plant from the plant cell.

  Furthermore, DNA encoding antisense RNA, DNA encoding dsRNA, and DNA encoding ribozyme activity are used to suppress the expression of endogenous Sdr4 gene in plants based on the sequence information of Sdr4 gene. Furthermore, it is possible to prepare DNA encoding RNA having a co-suppression effect. The produced DNA can be used to promote germination of plants.

  On the other hand, in the present invention, the germination of a plant can be promoted by promoting the expression of the plant AtSdr4L1 gene. Plants produced by the method of the present invention can promote germination in useful crops and ornamental plants, for example.

  Furthermore, it may be possible to promote germination of plants by introducing an exogenous AtSdr4L1 gene into plants. Production of a transformant of a plant into which an exogenous AtSdr4L1 gene has been introduced can be performed by the method described above. That is, a target transformed plant can be produced by inserting the gene into a vector that functions in a plant cell, introducing the vector into the plant cell, and regenerating the plant from the plant cell. By this method, a transformed plant body having high ear germination resistance can be obtained.

  Furthermore, DNA encoding antisense RNA, DNA encoding dsRNA, and DNA encoding ribozyme activity are used to suppress the expression of endogenous plant AtSdr4L1 gene based on the sequence information of AtSdr4L1 gene. Furthermore, it is possible to prepare DNA encoding RNA having a co-suppression effect. The produced DNA can be used to suppress germination of plants.

  The inventors of the present invention showed that NIL (Sdr4) having Sdr4 gene derived from Kasalath showed higher ear germination resistance than its recurrent parent, Nipponbare. Therefore, Sdr4 protein derived from Kasalath has higher germination suppression ability. I found out. Therefore, it is possible to select a gene having difficulty in germinating spikes by discriminating the Nipponbare type and Kasalath type Sdr4 genes.

Based on the above findings, the present invention corresponds to the DNA according to any one of (a) to (h) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy for the test plant. Provided is a method for detecting panicle germination resistance of a test plant, which comprises detecting a mutation at a site.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1, 2, 4 or 5.
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6.
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5.
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9.
(F) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 8.
(G) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9.
(H) A DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8.

  In the present invention, the “base sequence described in any one” means at least one or more base sequences of the above DNA. That is, the present invention also includes a case where the germination resistance is detected by detecting mutations in the plurality of base sequences of the DNA or in the vicinity of the respective DNA regions.

  In addition, the “corresponding site” of the DNA described in any of (a) to (h) above refers to a corresponding site in a homologous gene of the gene present in the plant in various plants.

  In the present invention, “detection of ear germination resistance” includes a test for determining whether ear germination resistance is high or low. In the method of the present invention, when a mutation of the same type as SEQ ID NO: 4 or 5 is detected in the gene of SEQ ID NO: 4 or 5 or a DNA region in the vicinity of the gene, Determined. On the other hand, when a mutation of the same type as SEQ ID NO: 1 or 2 is detected in the gene of SEQ ID NO: 1 or 2 or a DNA region in the vicinity of the gene, it is determined that the germination resistance is low.

  In the present invention, whether or not the ear germination resistance is high can be determined by a known method. An example is a method of measuring the germination rate of plant seeds. Koshihikari, which is the standard for rice germination difficulty (high germination tolerance), has a germination rate of 47% 9 days after maturation, that is, 50 days after heading. Kinuhikari, which is easy, was 97% (Reference: Fujita et al., Ear germination of rice varieties in Kagawa Prefecture and the factors behind them. Kagawa Prefectural Agricultural Research Report 44: 1-11). On the other hand, Nipponbare (early germinating somewhat easy) 49 days after heading showed a germination rate of 89% ± 0.8%, and NIL (Sdr4) with Sdr4 against Nihonbare in the background was 15.5% ± 2. The value was as low as 3%, that is, the ear germination resistance was stronger than Koshihikari.

By detecting the mutation in the test plant by the method of the present invention, it is possible to determine whether the test plant has high ear germination resistance without actually observing the ear germination resistance.
In the present invention, the “near DNA region of a gene” usually refers to a region on a chromosome in the vicinity of the gene. The vicinity is not particularly limited, but is usually a DNA region containing the polymorphic site of the present invention.

  The position of the “mutation” in the detection method of the present invention is difficult to pre-define, but is usually in the ORF of the gene or a region that controls the expression of the gene (eg, promoter region, enhancer region, etc.) ), But is not limited thereto. In addition, the “mutation” is a mutation that changes the expression level of the gene, changes properties such as mRNA stability, or changes the activity of the protein encoded by the gene. Many, but not particularly limited. Examples of the mutation of the present invention include base addition, deletion, substitution, insertion mutation and the like.

In the DNA region according to any one of (a) to (h) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy in the test plant, Succeeded in finding polymorphic mutations significantly related to.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1, 2, 4 or 5.
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6.
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5.
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9.
(F) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 8.
(G) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9.
(H) A DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8.
Therefore, it is possible to detect panicle germination resistance by using the presence or absence of mutation as an index (determining the base type) for any of the above-described base sequences or polymorphic sites in the DNA region near the gene. It is.

  The “near DNA region of the gene” mentioned above usually refers to a region on the chromosome in the vicinity of the gene. Although the neighborhood is not particularly limited, it is usually a DNA region containing the polymorphic site of the present invention, preferably from the polymorphic site or the end site of the LD block (linkage disequilibrium block) containing the polymorphic site. Refers to a region within 10 kb.

  As reported by Gabriel et al., Polymorphisms in the range of 10 kb before and after, that is, within 20 kb are likely to be linked (Gabriel SB, Schaffner SF, Nguyen H et al. The structure of haplotype blocks in the human genome. Science 296, 2225-9. 2002).

  A polymorphism is generally defined genetically as a base change in one gene that is present at a frequency of 1% or more. However, the “polymorphism” in the present invention is limited to this definition. Not. Examples of the polymorphism in the present invention include a single nucleotide polymorphism and a polymorphism in which one to several tens of bases (sometimes several thousand bases) are deleted or inserted. Furthermore, the number of polymorphic sites is not limited to one, and may be a plurality of polymorphs.

The present invention also relates to a nucleotide sequence corresponding to a DNA region according to any one of the following (a) to (h), which encodes a plant-derived protein having a function of controlling plant seed dormancy for a subject. Provided is a method for detecting panicle germination resistance, which comprises determining a base type of a polymorphic site in a DNA region in the vicinity of the base sequence.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1, 2, 4 or 5.
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6.
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5.
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9.
(F) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 8.
(G) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9.
(H) A DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8.

  The “polymorphic site” in the method for detecting panicle germination resistance of the present invention is not particularly limited as long as it is a polymorphism present in the base sequence described in any of the above DNAs or a DNA region in the vicinity of the base sequence. Specifically, as a polymorphic site that can be used in the method for detecting panicle germination resistance of the present invention, positions 223, 297, 531, 1145, 1156-1157 in the base sequence described in SEQ ID NO: 2 are used. Rank, 1411, 1624, 1945, 2027, 2182-2184, 2188, 2190, 2191, 2193, 2194, 2195, 2195, 2280, 2494, 3092 A polymorphic site corresponding to one polymorphic site can be mentioned. (In the present specification, these polymorphic sites may be simply referred to as “polymorphic sites of the present invention”).

  The base type of the polymorphic site shown in the above table may indicate a base type on the complementary strand side with respect to the sequence shown in the sequence table, but if the sequence before and after described in this specification is used, It is easy for those skilled in the art to confirm the difference, and when performing detection, the other result can be determined inevitably by examining either the plus strand or the minus strand.

  In a preferred embodiment of the present invention, the base type mutation at the polymorphic site described above is such that the base type at position 223 is G to A and the base type at position 297 is A to G in the base sequence shown in SEQ ID NO: 2. , Insertion of 1 base (A) between positions 530 and 531, base type 1145 at position A to G, deletion of 2 bases at positions 1156-1157, insertion of 4 bases (ACCC) at position 1411, 1624 The base type at position C is G, the base type at position 1945 is G through T, the base type at position 2027 is A through G, the 3 bases at positions 2182-2184 (CGG) are deleted, the base type at position 2188 is C To G, 2190th base type is G to C, 2191st base type is C to A, 2193rd base type is G to C, 2194th base type is G to T, 2195th base type is A To C, 2280-position base species is C to T, 2494-position base species is G to C, and 3092-position base species is C to T. It is determined.

As described above, according to the present invention, the region on the gene related to ear germination resistance has been clarified, so that detection of ear germination resistance of a test plant can be performed without imposing an excessive burden on those skilled in the art. Can do.
A person skilled in the art can determine the base species in the polymorphic site of the present invention by various methods. For example, it can be performed by directly determining the base sequence of DNA containing the polymorphic site of the present invention.

The “test plant” to be subjected to the detection method of the present invention is not particularly limited, but preferably includes rice, more preferably Japanese fine varieties of rice and Kasalath varieties.
In general, the test sample used in the detection method of the present invention is preferably a biological sample obtained in advance from a test plant. Examples of the biological sample include a DNA sample. The DNA sample in the present invention can be prepared based on, for example, chromosomal DNA extracted from tissues or cells of a test plant, or RNA.
That is, the present invention is a method in which a biological sample derived from a subject (a biological sample obtained in advance from a test plant) is used as a test sample.
A person skilled in the art can appropriately prepare a biological sample using a known technique. For example, a DNA sample can be prepared by PCR using a primer that hybridizes to DNA containing the polymorphic site of the present invention and chromosomal DNA or RNA as a template.

In this method, the base sequence of the isolated DNA is then determined. Those skilled in the art can easily determine the base sequence of the isolated DNA using a DNA sequencer or the like.
Various methods for determining the base type of a polymorphic site whose base variation has been clarified in advance are known. The method for determining the base species of the present invention is not particularly limited. For example, TaqMan PCR method, AcycloPrime method, MALDI-TOF / MS method and the like have been put to practical use as analysis methods applying the PCR method. Invader and RCA methods are known as methods for determining base types that do not depend on PCR. Furthermore, the base species can be determined using a DNA array. Any of the methods described herein can be applied to the determination of the base type of the polymorphic site in the present invention.

  All of these methods have been developed for genotyping a large amount of samples at high speed. With the exception of MALDI-TOF / MS, it is usually necessary to prepare a labeled probe or the like in any way for either method. On the other hand, a method for determining a base type that does not rely on a labeled probe has been performed for a long time. As one of such methods, for example, a method using restriction fragment length polymorphism (RFLP), a PCR-RFLP method and the like can be mentioned.

RFLP utilizes the fact that a restriction enzyme recognition site mutation or a base insertion or deletion in a DNA fragment caused by restriction enzyme treatment can be detected as a change in the size of the fragment produced after the restriction enzyme treatment. If there is a restriction enzyme that recognizes the base sequence containing the polymorphism to be detected, the base of the polymorphic site can be known by the principle of RFLP.
Alternatively, a CAPS (Cleaved Amplifeid Polymorphic Sequence) marker or a primer can be used to introduce a mutation and a dCAPS (derived CAPS) marker that creates a restriction enzyme site. The dCAPS marker is a technique of creating a restriction enzyme site on a PCR product by causing a mismatch between a PCR primer and DNA of a template (Japanese Patent Laid-Open No. 2003-259898).

  As a method that does not require a labeled probe, a method for detecting a difference in base using a change in the secondary structure of DNA as an index is also known. PCR-SSCP utilizes the fact that the secondary structure of single-stranded DNA reflects the difference in its nucleotide sequence (Cloning and polymerase chain reaction-single-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11. Genomics 1992 Jan 1; 12 (1): 139-146., Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene. 1991 Aug 1; 6 (8): 1313- 1318., Multiple fluorescence-based PCR-SSCP analysis with postlabeling., PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.). The PCR-SSCP method is performed by dissociating the PCR product into single-stranded DNA and separating it on a non-denaturing gel. Since the mobility on the gel varies depending on the secondary structure of the single-stranded DNA, if there is a difference in base at the polymorphic site, it can be detected as a difference in mobility.

  Other examples of methods that do not require a labeled probe include denaturant gradient gel electrophoresis (DGGE method). The DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel having a concentration gradient of a denaturing agent, and the DNA fragments are separated depending on the instability of each. When a mismatched unstable DNA fragment migrates to a certain denaturant concentration in the gel, the DNA sequence around the mismatch is partially dissociated into single strands due to its instability. The mobility of a partially dissociated DNA fragment becomes very slow and can be separated from the mobility of a complete double-stranded DNA without a dissociated portion.

  In addition, the DNA species can be used to determine the base species (Cell engineering separate volume “DNA microarray and the latest PCR method”, Shujunsha, published 2000.4 / 20, pp97-103 “SNP analysis using oligo DNA chip”, Sabae. Shinichi). In the DNA array, sample DNA (or RNA) is hybridized to a large number of probes arranged on the same plane, and the hybridization to each probe is detected by scanning the plane. Since responses to many probes can be observed simultaneously, for example, a DNA array is useful for analyzing a large number of polymorphic sites simultaneously.

  In addition to the above method, an allele specific oligonucleotide (ASO) hybridization method can be used to detect a base at a specific site. An allyl-specific oligonucleotide (ASO) is composed of a base sequence that hybridizes to a region where a polymorphic site to be detected is present. When ASO is hybridized to sample DNA, the hybridization efficiency decreases if a mismatch occurs at the polymorphic site due to the polymorphism. Mismatches can be detected by Southern blotting or a method that uses the property of quenching by intercalating a special fluorescent reagent into the hybrid gap. Mismatches can also be detected by the ribonuclease A mismatch cleavage method.

  Among the above-mentioned oligonucleotides, positions 223, 297, 531, 1145, 1156-1157, 146-1157, 1411, 1624, 1945, 2027, 2182-2184 in the nucleotide sequence shown in SEQ ID NO: 2 , 2188 position, 2190 position, 2191 position, 2193 position, 2194 position, 2195 position, 2280 position, 2494 position, 3092 position at least one polymorphic site corresponding to at least one polymorphic site Oligonucleotides that hybridize to DNA containing the type site and have a chain length of at least 15 nucleotides can be used as reagents (test agents) for detecting panicle germination resistance. This is used for a test using gene expression as an index or a test using gene polymorphism as an index.

  The oligonucleotide specifically hybridizes to DNA containing any one of the polymorphic sites of the present invention. Here, “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, In the condition described in the second edition 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins. If the specific hybridization is possible, the oligonucleotide is added to a DNA base sequence encoding a plant-derived protein having a function of controlling seed dormancy of the plant in a gene to be detected or a DNA region in the vicinity of the gene. On the other hand, it need not be completely complementary.

  The oligonucleotide can be used as a probe or primer in the test method of the present invention. When the oligonucleotide is used as a primer, the length is usually 15 bp to 100 bp, preferably 17 bp to 30 bp. Primers are the positions 223, 297, 531, 1145, 1156-1157, 146-1157, 1411, 1624, 1945, 2027, 2182-2184 in the base sequence described in SEQ ID NO: 2 of the present invention. Position, 2188, 2190, 2191, 2193, 2194, 2194, 2195, 2280, 2494, 3092, any one of the polymorphic sites corresponding to at least one polymorphic site There is no particular limitation as long as it can amplify at least part of the DNA containing the polymorphic site.

  The present invention provides a primer for amplifying a region containing the polymorphic site of the present invention, and a probe that hybridizes to a DNA region containing the polymorphic site.

  In the present invention, the primer for amplifying a region containing a polymorphic site also includes a primer that can initiate complementary strand synthesis toward the polymorphic site using DNA containing the polymorphic site as a template. The primer can also be expressed as a primer for providing a replication origin on the 3 ′ side of the polymorphic site in DNA containing the polymorphic site. The interval between the region where the primer hybridizes and the polymorphic site is arbitrary. For the interval between the two, a suitable number of bases can be selected according to the analysis method of the base at the polymorphic site. For example, in the case of a primer for analysis using a DNA chip, the primer can be designed so as to obtain an amplification product having a length of 20 to 500, usually 50 to 200 bases, as a region containing a polymorphic site. A person skilled in the art can design a primer according to the analysis method based on the base sequence information about the surrounding DNA region including the polymorphic site. The base sequence constituting the primer of the present invention can be appropriately modified as well as a base sequence completely complementary to the genomic base sequence.

In addition to the base sequence complementary to the genomic base sequence, an arbitrary base sequence can be added to the primer of the present invention. For example, in a primer for a polymorphism analysis method using a type IIs restriction enzyme, a primer to which a recognition sequence for a type IIs restriction enzyme is added is used. Such a primer with a modified base sequence is included in the primer of the present invention. Furthermore, the primer of the present invention can be modified. For example, a fluorescent substance or a primer labeled with a binding affinity substance such as biotin or digoxin is used in various genotyping methods. Primers having these modifications are also included in the present invention.
Specific examples of the primer of the present invention include the primer set forth in SEQ ID NO: 11 or 12, but the primer of the present invention is not limited thereto.
The present invention also provides a test agent or kit for the polymorphic site of the present invention, which contains the above primer as an active ingredient.

  On the other hand, in the present invention, a probe that hybridizes to a region containing a polymorphic site refers to a probe that can hybridize to a polynucleotide having a base sequence of a region containing a polymorphic site. More specifically, a probe containing a polymorphic site in the base sequence of the probe is preferable as the probe of the present invention. Alternatively, depending on the base analysis method at the polymorphic site, the probe may be designed so that the end of the probe corresponds to a base adjacent to the polymorphic site. Therefore, although the polymorphic site is not included in the base sequence of the probe itself, a probe including a base sequence complementary to the region adjacent to the polymorphic site can also be shown as a desirable probe in the present invention.

  In other words, a probe capable of hybridizing to the polymorphic site of the present invention on genomic DNA or a site adjacent to the polymorphic site is preferred as the probe of the present invention. In the probe of the present invention, modification of the base sequence, addition of the base sequence, or modification is allowed in the same manner as the primer. For example, a probe used for the Invader method is added with a base sequence unrelated to the genome constituting the flap. Such a probe is also included in the probe of the present invention as long as it hybridizes to a region containing a polymorphic site. The base sequence constituting the probe of the present invention can be designed according to the analysis method based on the base sequence of the DNA region surrounding the polymorphic site of the present invention in the genome.

  The primer or probe of the present invention can be synthesized by any method based on the base sequence constituting it. The length of the base sequence complementary to the genomic DNA of the primer or probe of the present invention is usually 15 to 100, generally 15 to 50, usually 15 to 30. A technique for synthesizing an oligonucleotide having the base sequence based on the given base sequence is known. Furthermore, in the synthesis of the oligonucleotide, any modification can be introduced into the oligonucleotide using a nucleotide derivative modified with a fluorescent dye or biotin. Alternatively, a method of binding a fluorescent dye or the like to a synthesized oligonucleotide is also known.

  As specific examples of the probe of the present invention, the base species at position 223 is G to A, the base species at position 297 is A to G, and the position between positions 530 and 531 in the base sequence shown in SEQ ID NO: 2, respectively. 1 base (A) insertion, 1145 position base species from A to G, 1156-1157 position 2 base deletion, 1411 position 4 base (ACCC) insertion, 1624 position base type from C G, 1945 position base species G to T, 2027 position base species A to G, 2182-2184 position 3 bases (CGG) deletion, 2188 position base species C to G, 2190 position base Species is G to C, 2191th base type is C to A, 2193rd base type is G to C, 2194th base type is G to T, 2195th base type is A to C, 2280th base A probe that hybridizes to a region containing a polymorphic site corresponding to any of the polymorphic sites of species C to T, base species 2494 at the position G to C, and base 3030 at the position C to T. And probes having a chain length of at least 15 nucleotides. .

  The present invention also provides a reagent (test agent) for use in the method of detecting panicle germination resistance of the present invention. The reagent of the present invention includes the primer and / or probe of the present invention. In the detection of panicle germination resistance, a primer and / or probe for amplifying DNA containing the polymorphic site described in any of the polymorphic sites of the present invention is used.

Various reagents, enzyme substrates, buffers and the like can be combined with the reagent of the present invention depending on the method for determining the base species. As the enzyme, enzymes necessary for various analysis methods exemplified as the above-mentioned base species determination method such as DNA polymerase, DNA ligase, or IIs restriction enzyme can be shown. As the buffer solution, a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected. Furthermore, as the enzyme substrate, for example, a substrate for complementary strand synthesis is used.
Furthermore, another aspect of the reagent in the present invention is a reagent for detecting panicle germination resistance comprising a solid phase on which a nucleotide probe that hybridizes with the DNA containing the polymorphic site of the present invention is immobilized.
These are used for examinations using the polymorphic site of the present invention as an index. These preparation methods can be carried out by methods known to those skilled in the art.

The present invention provides a method for selecting a plant having a function of controlling seed dormancy, comprising the steps described in the following (a) and (b).
(A) A step of producing a variety in which a plant having an ear germination resistance and a plant having an arbitrary function are crossed (b) The ear germination resistance of the plant produced in the step (a) is detected by the above-described method. Process By the said method, the plant which has high ear germination tolerance can be selected.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.
[Example 1] Sdr4 locus Sdr4 of the quantitative trait locus (QTL) was found in the vicinity of R1245, an RFLP marker, on chromosome 7 (Lin et al. TAG 96: 997-1003, 1998). Near-isogenic lines used as experimental materials for physiological experiments were prepared as follows. Nipponbare / Kasalath F1 backbred four times, and only one region of chromosome 73.0-94.5cM was heterozygous from the BC4F2 line that had self-bred (98F2-23- 140) was selected. Next, 99F2-50 (n = 50) of 98F2-23-140 self-propagating seeds were expanded, and an individual (99F2-50-14) in which only the region of chromosome 7 83.0-94.5cM was homozygous This was selected and used as a near-isogenic line [NIL (Sdr4)]. Comparison of changes in germination rates of near-isogenic lines [NIL (Sdr4)], Nipponbare, and Kasalath over time revealed that NIL (Sdr4) is from 5th to 8th week compared to Nipponbare or Kasalath. The effect which suppressed germination strongly and gave deep dormancy was recognized (FIG. 1).

[Example 2] High-accuracy linkage analysis The population for linkage analysis used the generation of backcross progenies of Nipponbare and Kasalath. From the backcross progeny, individuals were selected in which the Sdr4 region was heterozygous and most of the other genomic regions were replaced with Nipponbare. First, as a result of linkage analysis by 100 progeny progenies of the selected individuals (corresponding to F2 population) and progeny tests, Sdr4-IND3 (primer 5'-TTTGTTTTCCCCGTGAGGTT -3 '(SEQ ID NO: 13) and primer 5'-GTCATAATTAAGCAGCCTATGGGTC-3 '(SEQ ID NO: 14)) and Sdr4-IND8 (primer 5'-ACACACCATTGTTCCAAGCA-3' (SEQ ID NO: 15) and primer 5'-GGTCACAACTGATAGGCCAAC-3 '(SEQ ID NO :) 16)) (Fig. 2B). Next, linkage analysis of the Sdr4 region was performed using a large-scale segregation population essential for map-based cloning. From 2,515 individuals of Sdr4 segregated population (corresponding to F2 population), 60 individuals having recombinant chromosomes generated in the vicinity of Sdr4 were selected using RM3753 and RM6042 which are markers sandwiching Sdr4. In order to identify recombinant individuals within the candidate genomic region of Sdr4, the selected 60 individuals were typed with Sdr4-IND3 and Sdr4-IND8, further narrowing down to 28 individuals that could be used for mapping. These 28 progeny lines (corresponding to the F3 line) were developed in the field, and individuals with homologous recombinant chromosomes and non-recombinant chromosomes were selected. To narrow the gene region, compare the Nipponbare genome sequence with the base sequence of Indica 93-11 read by the whole genome shotgun method, and amplify the fragment that is expected to show polymorphism between Nipponbare / Kasalath Primers were synthesized and mapped. This produced 19 PCR markers between RM3753 and RM6042. As a result of cultivating these fixed lines (corresponding to F4 line) in the field and examining the degree of ear germination at 6 weeks after heading, the candidate region of Sdr4 is the Sdr4-SNP24 (primer) that is a CAPS (Cleaved Amplified Polymorphic Sequence) marker. 5′-GCCTTCTTAACCCCACCAC-3 ′ (SEQ ID NO: 17) and primer 5′-CTGAACCTCGCCATGATCTC-3 ′ (SEQ ID NO: 18), restriction enzyme AluI) and Sdr4-SNP28 (primer 5′-AACAAGCAACAGCTGACGTG-3 ′) (SEQ ID NO: 19) and primer 5'-TAATGCACCGCAACTATCCA-3 '(SEQ ID NO: 20), SNP primer 5'- GGAAATCATGCACAACCCTAAAAT-3' (SEQ ID NO: 21)). (FIG. 2C).

[Example 3] Analysis of candidate gene region
A BAC containing the Sdr4 candidate region was screened by PCR from the Kasalath BAC library, and the NruI fragment 11.6 kbp containing the Sdr4 candidate region 8.7 kbp was cloned and the nucleotide sequence was determined. There were 72 single nucleotide polymorphisms between Nipponbare and Kasalath, and insertion deletions were found at 4 sites. As a result of analyzing the genomic base sequence containing this candidate region by RiceGAAS (http://ricegaas.dna.affrc.go.jp/), there were three predicted genes (FIG. 3A). As a result of analyzing the expression by Northern blot or RT-PCR for three candidate genes, candidate gene 1 (Sdr4C1) and candidate gene 2 (Sdr4C2) were expressed in ears (FIG. 4). In both candidate genes, single nucleotide polymorphisms with amino acid substitutions were observed between Nipponbare and Kasalath, but no nucleotide polymorphisms that could easily be predicted to lose function could not be found.

[Example 4] Complementary test for identification of Sdr4 gene
An Ndr fragment of 11.6 kbp derived from Kasalath including 8.7 kbp of Sdr4 candidate region and its surrounding region, and a fragment of 0.4 kbp region including the transcription start point of candidate gene 1 and the first exon were deleted from pPZP2H-lac (Fuse et al. Plant Biotechnology 18: 219-222, 2001) and introduced into Nipponbare via Agrobacterium. The progeny (T1) DNA of the transformant was extracted, and a fixed line having the transgene homozygous was selected by Southern hybridization. As a result of the germination test of the seeds of the fixed line, the germination rate decreased in the line into which the 11.6 kbp Kasalath fragment was introduced (FIG. 3B). In addition, the germination rate was reduced even in the lines into which the deletion mutant of candidate gene 1 was introduced. From this result, it was clarified that Sdr4 is present on the 11.6 kbp fragment but not candidate gene 1. Next, a complementation test was performed using a 3.3 kbp fragment derived from Kasalath having candidate gene 2. As a result of the germination test using the seed (T1) of the current generation (T0), the germination rate was reduced compared to the vector control (FIG. 3C). From this result, it was revealed that the main body of Sdr4 is candidate gene 2. Full-length cDNA was obtained by 5'RACE and 3'RACE by the oligo cap method. The amino acid sequence was the same as the predicted gene (FIG. 5).

[Example 5] Functional analysis by knockdown strain of Sdr4 gene In order to prove that candidate gene 2 is the main body of Sdr4 and to compare the functions of Sdr4 gene of Nipponbare and Kasalath, a knockdown strain of Sdr4 gene by RNAi was selected. Created. As a result of examining the germination rate of seeds grown in T1 individuals at 5 weeks after heading, the germination rate was higher than that of the vector control. This increase in germination rate was observed in both the Nipponbare knockdown line and the NIL (Sdr4) knockdown line, indicating that both the Nipponbare and Kasalath Sdr4 genes have germination-inhibiting functions (Fig. 6). Since NIL (Sdr4) having Sdr4 derived from Kasalath showed higher ear germination resistance than its recurrent parent, Nipponbare, it is speculated that Sdr4 derived from Kasalath has higher germination-inhibiting ability. The sequence of the siRNA used in this example is shown in SEQ ID NO: 10.

[Example 6] Isolation of Sdr4 mutant from easy-to-sproute germinating line The nucleotide sequence of the coding region of the Sdr4 gene was determined using as a template the DNA of 12 kinds of easy-to-sproute mutant lines selected from the mutant panel. As a result, the same 21-base deletion mutation was found on the Sdr4 gene in the three strains (FIG. 5, M25). Of the lines found, seeds that were born to individuals with heterozygous deletion mutations were cultivated in the field, and the germination rate of seeds 5 weeks after heading was examined. The germination rate of 2 to 5% was shown in the lines having the seeds, while the germination rate of seeds in the mutant lines having the deletion mutation in heterogeneity was 31 to 33% (FIG. 7). Furthermore, Nipponbare showed a germination rate of 1.9%, while the germination rate of the self-propagating seeds of the line having the isolated mutation was 100% for the M25 line and 99.3% for the M100 line. From these results, it was shown that the main body of Sdr4 is candidate gene 2 and that Sdr4 from Nipponbare also has the ability to suppress germination.

[Example 7] Analysis of Arabidopsis homozygous gene
As a result of searching for similar genes in Arabidopsis using the amino acid sequence of Sdr4 as a query, seven similar genes were found (FIG. 8A). Since the most similar gene name was not described, it was named AtSdr4L1 (FIG. 8B). We obtained the AtSdr4L1 T-DNA tag line, selected the lines with heterozygous insertion mutations and lines with homozygous mutations by PCR, and examined the germination rate for each genotype. The germination rate was reduced to 14% in the strain in which AtSdr4L1 was destroyed by T-DNA insertion. In addition, the line heterozygously showed a germination rate of 80% (FIG. 8C). Rice Sdr4 suppressed germination, but the most similar gene in Arabidopsis, AtSdr4L1, was shown to have the opposite function.

[Example 8] Marker for discriminating Nipponbare type Sdr4 and Kasalath type Sdr4 The 2280th cytosine (C) of Nipponbare type Sdr4 (SEQ ID NO: 2) has a single nucleotide polymorphism that becomes thymine (T) in Kasalath type. . When the 2280th base is T, the region containing the site is a restriction enzyme recognition site (CTGCAG) of PstI (FIG. 9). Therefore, the region was amplified by PCR using primers 2229F: 5 ′ CCACGTCGAGTCAGTCCAC 3 ′ (SEQ ID NO: 11) and 2622R: 5 ′ CGAAGACGTAGTCCCTCGAC 3 ′ (SEQ ID NO: 12), and then treated with PstI.
As a result, the PCR-amplified fragment of rice with Kasaras-type Sdr4 was cleaved with PstI to 360 bp, but rice with Nipponbare-type Sdr4 was not cleaved, and a 413 bp PCR product was detected (FIG. 9). ). From the above, it has been clarified that the 2280th cytosine of Nipponbare-type Sdr4 (SEQ ID NO: 2) can be used as a marker for discriminating between Nipponbare-type Sdr4 and Kasalath-type Sdr4.

It is a figure which shows the germination rate from the 4th to 8th week after heading of Nipponbare, Kasalath, and near-isogenic line NIL (Sdr4). The seeds from 4th to 8th week after heading of Nipponbare, Kasalath and NIL (Sdr4) were sampled and a germination test was performed. NIL (Sdr4), in which the chromosome was replaced by Kasalath-derived Sdr4, showed a reduced germination rate and strong seed dormancy. Fig. 4 is a mapping diagram of Sdr4 and a photograph of rice germination sensitivity and resistant rice. A) As a result of QTL analysis by Lin et al., It was shown that Sdr4 exists in R1245. B) As a result of newly creating a marker between both markers and typing a recombinant line, the candidate region could be narrowed to 108 kbp between Sdr4-SNP11 and Sdr4-SNP8. Figure 3 is a continuation of the figure and photograph of Figure 2AB. C) High-precision linkage analysis using a large-scale population (n = 2515) was performed. As a result of investigating the germination rate of 28 lines recombined between Sdr4-IND3 and Sdr4-IND8, Sdr4 was located between RM1365 and Sdr4-IND5. As a result of creating and typing a new marker in the candidate region, it was shown that the candidate region of Sdr4 was 8.7 kbp between Sdr4-SNP24 and Sdr4-SNP28. It is a figure which shows the result of a complementary test with the candidate gene of Sdr4. A) As a result of gene prediction by RiceGAAS, ORFs of three predicted genes were present in the candidate region. The bar represents the position of InDel or SNP. Binary vector of Kasalath genomic NruI fragment (11.6kbp) containing candidate region 8.7kbp, mutant lacking exon 1 of predicted gene 1 (Sdr4C1), and 3.3kbp NruI-AlaI fragment containing only candidate gene 2 (Sdr4C2) Was inserted into pPZP2H-Lac, and Nipponbare was transformed. It is a figure which shows the result of a complementary test with the candidate gene of Sdr4. B) The germination rate of Nipponbare was reduced for both the wild-type NruI fragment and the NruI fragment having a deletion mutation. As a result, it was shown that Sdr4 is present on the NruI fragment but not Sdr4C1. C) Further, as a result of using the NruI-AlaI fragment, a reduction in germination rate was observed. From these results, it was shown that Sdr4C2 is Sdr4. It is a photograph which shows the result of the expression analysis of a Sdr4 candidate gene. A) Expression of candidate gene 1 (Sdr4C1) was analyzed by Northern blotting. Adult leaves 0, 3, 7, 14, 28, 42 days after heading (upper stage) and 0, 0.3, 1, 3, 9, 24, 48, 72 hours after water absorption 6 weeks after heading RNA was extracted and analyzed from seeds (bottom) to which ABA and GA3 were added during seed absorption. B) Expression of candidate gene 2 (Sdr4C2) was analyzed by RT-PCR. The Ubq2 gene was used as a control. It is a figure which shows the comparison of the amino acid sequence of Sdr4 protein. The amino acid sequences derived from Kasalath (Kas) and Nipponbare (M25) are shown. The amino acid residues that differ from the Sdr4 amino acid sequence derived from Nipponbare are boxed. It is the figure and photograph which show the analysis result of a knockdown system | strain. A) An RNAi construct having a part of the glucuronidase gene (GUS) as a loop was prepared. It is the figure and photograph which show the analysis result of a knockdown system | strain. B) Transformation was performed with Agrobacterium introduced with Nipponbare and NIL (Sdr4) with vector control (pPZP2H2) and RNAi construct. A fixed line was selected from the progeny progeny by Southern blotting, and a germination test was carried out using seeds derived from the ears obtained from 3 individuals at 5 weeks after heading. C) The result of the germination test was graphed. It is a figure which shows the analysis result of the Sdr4 mutation system discovered from the mutant panel. A) A mutant strain of the Sdr4 gene was obtained by decoding the nucleotide sequence of the Sdr4 gene of the sprouting mutant strain. The germination rate for each line (upper) and each genotype were examined. W indicates wild-type Sdr4 and H indicates heterozygous mutant Sdr4 (lower panel). B) The germination rate for each gene was graphed. It is a figure which shows the analysis result of the analog of Arabidopsis thaliana. A) The amino acid sequence of Sdr4 was used as a query to examine analogs existing in the Arabidopsis genome. As a result, seven analogs were found. These relationships were displayed by the NJ method. The ORF most similar to Sdr4 has no gene name and was named AtSdr4L-1. B) Genotype of AtSdr4L-1 T-DNA tag line (SALK_022729) was analyzed by PCR, and germination of isolated wild type (+ / +), heterozygous (+/-), and homozygous (-/-) The rate was analyzed. The seeds for 1 week after ripening were absorbed, and the germination rate after 1 week was counted. It is a figure which shows the analysis result of the analog of Arabidopsis thaliana. C) The amino acid sequences of Sdr4 and AtSdr4L-1 were compared. It is the figure and photograph which show an example of the marker which discriminate | determines Nipponbare type | mold Sdr4 and Kasalath type | mold Sdr4.

Claims (13)

A step of introducing a DNA according to any one of the following (a) to (h), which encodes a plant-derived protein having a function of controlling plant seed dormancy, into a plant cell and regenerating the plant from the plant cell A method for producing a transformed plant body in which seed dormancy is controlled.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6
(B) Positions 69 to 1100 in the base sequence described in SEQ ID NO: 1 , positions 1675 to 2706 in the base sequence described in SEQ ID NO: 2, positions 69 to 1097 in the base sequence described in SEQ ID NO: 4 or SEQ ID NO: : DNA containing positions 1678 to 2706 in the 5 base sequence
(C) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6
(D) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5
(E) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 9
(F) DNA comprising positions 1930-2994 in the base sequence set forth in SEQ ID NO: 8
(G) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9
(H) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8   The production method according to claim 1, wherein the plant is a monocotyledonous plant or a dicotyledonous plant. A method for producing a transformed plant body in which seed dormancy is controlled, comprising a step of introducing the DNA according to the following (A) or (C) into a plant cell and regenerating the plant body from the plant cell.
(A) An antisense RNA having 15 bases or more complementary to a transcription product of DNA according to any one of (a) to (h) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy Encoding DNA;
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6
(B) Positions 69 to 1100 in the base sequence described in SEQ ID NO: 1, positions 1675 to 2706 in the base sequence described in SEQ ID NO: 2, positions 69 to 1097 in the base sequence described in SEQ ID NO: 4 or SEQ ID NO: : DNA containing positions 1678 to 2706 in the 5 base sequence
(C) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6
(D) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5
(E) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 9
(F) DNA comprising positions 1930-2994 in the base sequence set forth in SEQ ID NO: 8
(G) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9
(H) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8
(C) DNA shown in SEQ ID NO: 10   The method according to any one of claims 1 to 3, which is used for controlling seed dormancy of a plant. Including the step of introducing the DNA described in (a) or (b) below, which encodes a plant-derived protein lacking the function of controlling plant seed dormancy, into a plant cell, and regenerating the plant from the plant cell. A method for producing a transformed plant body.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 7
(B) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 7   The method according to claim 1, wherein the vector containing the DNA is introduced into a plant cell.   The method according to any one of claims 1 to 6, further comprising a step of obtaining a progeny or clone of the transformed plant body. A plant-derived protein encoding a plant-derived protein having a function of controlling plant seed dormancy, wherein the DNA according to any one of the following (a) to (d) is expressed in a plant cell: A method for inhibiting germination.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6
(B) Positions 69 to 1100 in the base sequence described in SEQ ID NO: 1 , positions 1675 to 2706 in the base sequence described in SEQ ID NO: 2, positions 69 to 1097 in the base sequence described in SEQ ID NO: 4 or SEQ ID NO: : DNA containing positions 1678 to 2706 in the 5 base sequence
(C) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6
(D) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5 Inhibiting the expression of DNA according to any one of the following (a) to (d), which encodes a plant-derived protein having a function of controlling plant seed dormancy in a plant cell A method for promoting germination of a plant.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6
(B) Positions 69 to 1100 in the base sequence described in SEQ ID NO: 1 , positions 1675 to 2706 in the base sequence described in SEQ ID NO: 2, positions 69 to 1097 in the base sequence described in SEQ ID NO: 4 or SEQ ID NO: : DNA containing positions 1678 to 2706 in the 5 base sequence
(C) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6
(D) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5 The method according to claim 9, wherein the DNA according to (A) or (C) below is introduced into a plant.
(A) An antisense RNA of 15 bases or more complementary to a transcription product of DNA according to any one of (a) to (d) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy Encoding DNA;
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6
(B) Positions 69 to 1100 in the base sequence described in SEQ ID NO: 1, positions 1675 to 2706 in the base sequence described in SEQ ID NO: 2, positions 69 to 1097 in the base sequence described in SEQ ID NO: 4 or SEQ ID NO: : DNA containing positions 1678 to 2706 in the 5 base sequence
(C) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 or 6
(D) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 4 or 5
(C) DNA shown in SEQ ID NO: 10 A plant-derived protein encoding a plant-derived protein having a function of controlling plant seed dormancy, wherein the DNA according to any one of (e) to (h) below is expressed in cells of the plant body: A method to promote germination.
(E) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 9
(F) DNA comprising positions 1930-2994 in the base sequence set forth in SEQ ID NO: 8
(G) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9
(H) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8 Inhibiting the expression of the DNA according to any one of (e) to (h) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy in a plant cell A method for suppressing germination of a plant.
(E) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 9
(F) DNA comprising positions 1930-2994 in the base sequence set forth in SEQ ID NO: 8
(G) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9
(H) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8 The method according to claim 12, wherein the DNA described in (A) below is introduced into a plant.
(A) An antisense RNA of 15 bases or more complementary to a transcription product of DNA according to any one of (e) to (h) below, which encodes a plant-derived protein having a function of controlling plant seed dormancy DNA encoding;
(E) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 9
(F) DNA comprising positions 1930-2994 in the base sequence set forth in SEQ ID NO: 8
(G) DNA encoding a protein comprising an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 9
(H) DNA having a sequence identity of 90% or more with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 8