JP2005110579A - PHOTOSENSITIVE GENE Hd5 FOR PLANT AND USE OF THE GENE - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new photosensitive gene for plant, to provide a method for modifying plant photosensitivity using the gene, and to provide a method for modifying plant heading date. <P>SOLUTION: The photosensitive gene Hd5 for Oryza sativa is successfully isolated by map base cloning. It is found that plant photosensitivity can be modified by transferring the gene or controlling its expression. Furthermore, it is found that plant photosensitivity can be evaluated by detecting the presence/absence of the functional gene. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a gene involved in plant photosensitivity and to modification of plant photosensitivity using the gene. The modification of plant photosensitivity is useful in fields such as plant breeding improvement.

  The heading time of rice is mainly determined by photosensitivity that depends on day length and other factors (basic nutrient growth or temperature sensitivity). Genetic analysis of this heading stage has been carried out for a long time, and so far Se1 locus (chromosome 6; Non-patent document 1), E1 locus (chromosome 7; Non-patent documents 2 and 3), E2 locus (unknown), E3 locus (Chromosome 3; Non-Patent Document 4) or Ef1 locus (Chromosome 10: Non-Patent Document 5) and other heading-related genes have been found by mutations and mutations inherent in varieties (Non-Patent Document 6).

  In rice, heading is generally promoted on a short day, while heading is delayed on a long day. Among Japanese cultivars, cultivars in Kyushu and southern Honshu generally have strong photosensitivity, while varieties in Tohoku and Hokkaido are not sensitive or very weak. When rice loses its photosensitivity, the heading time does not change due to changes in day length, and it shows the characteristic of heading after a certain growth period. As described above, the adaptability of rice in terms of the cultivation area and the cultivation time varies greatly depending on the presence or absence of photosensitivity. Therefore, modification of rice photosensitivity has become an important issue in improving rice varieties.

  Conventionally, the modification of heading time in rice varieties improvement has been carried out by (1) selection of early and late lines by crossing and (2) mutagenesis by radiation and chemicals. However, these operations require a long time, and there are many problems such as the inability to predict the degree and direction of mutation.

  By the way, in the field of rice genetics, genes that enhance rice photosensitivity are collectively called “photosensitive genes”. In recent years, DNA markers have been used for genetic analysis of rice, and genetic analysis of traits that follow complex inheritance such as heading time (quantitative trait locus (QTL) mapping) has progressed. Based on this background, genetic identification of genes involved in rice photosensitivity has been promoted (Non-Patent Documents 7 to 14). Among these, four types of QTLs, Hd1, Hd3a, Hd6 and Ehd1 have been isolated and identified at the molecular level (Non-patent Documents 15 to 17). However, the molecular level of the Hd5 gene, which plays an important role in the early / late nature of Japanese rice varieties, has not been elucidated.

  Once rice photosensitivity genes have been isolated, they can be introduced into any cultivar by transformation to modify the photosensitivity of those lines and thereby control the heading time of rice. it is conceivable that. For this reason, it can be said that the breed improvement using the gene is extremely advantageous in comparison with the conventional method in terms of simplicity and certainty.

Prior art document information related to the invention of the present application is shown below.
WO01 / 032880 WO01 / 032881 Application Publication 2002-153283 Yokoo and Fujimaki (1971) Japan. J. Breed. 21: 35-39 Tsai, KH (1976) Jpn. J. Genet. 51: 115-128 Okumoto, Y. et al. (1992) Jpn. J. Breed. 42: 415-429 Okumoto et al., Japanese Breeding Society 91st Lecture 47 (1): 31 Sato et al. (1988) Jpn. J. Breed. 38: 385-396 Yamagata et al. (1986) In Rice Genetics, International Rice Research Institute, Manilla, pp351-359 Yano et al. Theoretical and Applied Genetics (TAG) 95: 1025-1032, 1997 Yamamoto et al. TAG 97: 37-44, 1998 Yamamoto et al. Genetics 154: 885-891, 2000 Lin et al. TAG 101: 1021-1028,2000 Monna et al. TAG 104: 772-778, 2002 Doi et al. Breeding Science 48: 395-399, 1998 Lin et al. Breeding Science 52: 35-41, 2002 Lin et al. Breeding Science 53: 51-59, 2003 Yano et al., Plant Cell 12: 2473-2484, 2000 Takahashi et al., PNAS 98: 7922-7927, 2001 Kojima et al., Plant Cell Physiol. 43: 1096-1105, 2002 Nishida et al. Annl. Bot. 88: 527-536, 2001 Ichitani et al. Plant Breed. 117: 543-547, 1998 Ichitani et al. Breed. Sci. 48: 51-57, 1998 Yamamoto et al. Breeding Research Vol.5 (Attachment 1) p.50 (2003) Abstracts of the 103rd Annual Meeting of the Breeding Society of Japan Nonoue et al. Breeding Studies Vol. 2 (Attachment 1) p.13 (2000) Proceedings of the 97th Annual Meeting of the Breeding Society of Japan Nonoue et al. Breeding Studies Vol.5 (Attachment 1) p.71 (2003) Proceedings of the 103th Annual Meeting of the Breeding Society of Japan

  This invention is made | formed in view of such a condition, The objective is to provide the photosensitive gene of a novel plant. Another object of the present invention is to modify the photosensitivity of a plant using the gene, thereby altering the flowering time of the plant. Another object of the present invention is to provide a method for determining the photosensitivity of a plant targeting the gene.

  The inventors of the present invention have paid particular attention to rice for which development of a simple method for modifying the heading time is desired among plants, and conducted earnest research to isolate genes involved in the photosensitivity.

  In rice, Hd5, one of the heading-related quantitative trait loci (QTL) detected using the progeny of the Japanese cultivar “Nipponbare” and the Indian cultivar “Kasalath”, is located on chromosome 8. Is known to sit on (Fig. 1) (Yano et al., Theoretical Applied Genetics 95: 1025-1032, 1997). In addition, an analysis using a near-isogenic line [NIL (Hd5)] with a genetic background of “Nipponbare” and replacing the Hd5 region with the allelic region of “Kasalath” revealed that the Hd5 locus is involved in photoperiod responsiveness. However, it has been clarified that it has the effect of delaying heading under long day conditions (Lin et al., Breeding Science 53: 51-59, 2003). Furthermore, it was also found that another photosensitive gene Hd1 is required for its delayed action (Lin et al., Breeding Science 53: 51-59, 2003).

  In order to confirm the function of the photosensitive gene Hd5, the present inventors first cultivated near-isogenic lines [NIL (Hd5)] and Nipponbare under different day length conditions, and investigated the number of days to reach them. From these results, it was found that the Hd5 gene has a function of delaying heading, and the heading delaying action is observed only under long-day conditions and natural conditions (FIG. 2).

Next, in order to isolate the photosensitive gene Hd5, whose presence itself has been confirmed, but not yet identified, linkage analysis and alignment of the Hd5 gene region with artificial chromosome (PAC and BAC) clones Went.
Specifically, we performed a detailed linkage analysis of the Hd5 region using a large-scale segregation population essential for map-based cloning. As the group for linkage analysis, the back-cross generations of “Nippon Hare” and “Kasalath” were used. From the backcross progeny, individuals were selected in which the Hd5 region became heterozygous and most of the other genomic regions were replaced with “Nihonbare”. The genotype of the Hd5 locus was determined by a progeny test of the F3 generation. As a result of linkage analysis, Hd5 was positioned between the RFLP markers EH560 and R2976, and each of the markers and 14 individuals and 4 recombinant individuals could be identified (FIG. 3B).

  In order to further narrow down the candidate regions of the Hd5 gene, the present inventors performed alignment of the Hd5 gene region with artificial chromosome (PAC and BAC) clones. Specifically, the genomic base sequence of PAC clone P690F8 (Fig. 3C) containing the Hd5 gene found by the above analysis was analyzed, and using the obtained base sequence information, a novel CAPS marker and SNP marker were Created and further restricted the candidate genomic region. As a result, it became clear that the candidate region of Hd5 is about 4.3 kb sandwiched between SNP markers 14161 and 18485. When gene prediction and similarity search were performed on the base sequence of this candidate region using GENSCAN (http://genes.mit.edu/GENSCAN.html), one gene was predicted and a known CCAAT-box It showed high similarity to the subunit B gene (NF-YB gene) of the binding transcription factor NF-Y protein (Fig. 3E).

  As a result of the nucleotide sequence analysis of PAC clone P690F8, the present inventors succeeded in narrowing the region considered to contain the Hd5 candidate gene to about 4.3 kb. Furthermore, gene prediction and similarity search were performed on the genome base sequence of Hd5 region about 4.3 kb in rice cultivars “Kasalath”, “Nipponbare” and “Hayamasari”. Compared with “Kasalath” We found that there were 46 base substitutions and insertions / deletions in “Nipponbare” at 46 sites and “Hayamasari” (Figure 4). In addition, when the total length of the cDNA of “Kasalath” was determined and compared with the genomic base sequence, it was predicted that Hd5 consists of one exon and that the transcription region has a total length of 1060 bp and encodes a protein consisting of 298 amino acids. (Figure 4). Comparing the differences in the nucleotide sequence within the predicted transcription region with “Kasalath”, the “Nippon Hare” has 10 single-base substitutions, and the “Hayamasari” has 10 single-base substitutions in addition to “Nippon Haru”. Loss was confirmed. Also, comparing the difference in amino acid sequence with “Kasalath”, 8 amino acids were replaced in “Nippon Hare”, and the 19 bp deletion found in “Hayamasari” caused a frameshift, resulting in a 62 It was revealed that a stop codon was generated at the second amino acid site (FIG. 5).

  In order to confirm that this Hd5 candidate gene has a function of imparting photosensitivity to rice, “Kasalath”, which is presumed to have a stronger photosensitivity function than “Nippon Hare” type, in the “Nippon Hare” plant body. Transformation was performed to introduce a type of Hd5 candidate gene. Specifically, a HindIII-EagI 4.2 kb fragment (FIG. 3E) containing the candidate gene region was excised from BAC clone B179C8 of “Kasalath” that was found to contain the Hd5 candidate gene, and Ti-plasmid vector pPZP2H-lac (Fuse et al. Plant Biotechnology 18: 219-222, 2001) and introduced into “Nipponbare” via Agrobacterium. As a result, it was confirmed that the produced transformed plants were significantly delayed in heading under long day conditions (FIGS. 6A and B). In the individual into which the HindIII-EagI 4.2 kb fragment was introduced, transcription of the NF-YB-like candidate gene derived from “Kasalath” was observed (FIG. 7). As for “Hayamasari”, when the DNA fragment was introduced, it was confirmed that heading was significantly delayed (FIG. 8). From the above results, it was confirmed that the NF-YB-like gene has a function of delaying heading under long-day conditions and is Hd5.

  In addition, when the change in the daily expression level of the Hd5 gene was examined, it was found that the amount of mRNA accumulated in the Hd5 gene increased during the light period, decreased during the dark period, and reached the lowest level in the morning. (Fig. 9). Moreover, it was revealed that more mRNA was accumulated in the long-day condition where the heading delaying action of the Hd5 gene was clear (FIG. 9) than in the short-day condition. Some genes involved in photosensitivity have been shown to show diurnal variation in their expression (Kojima et al., Plant Cell Physiol. 43: 1096-1105, 2002). From these results, it is presumed that the change in the expression ratio caused by diurnal variation plays an important role in the development of photosensitivity, and diurnal variation in Hd5 gene expression is also due to the interaction of the photosensitive gene group. It was suggested to play a part.

  Furthermore, in order to clarify whether functional diagnosis of the Hd5 gene is possible, a primer pair capable of amplifying a genomic fragment containing a 19 bp deletion in the Hd5 gene found in “Hayamasari” PCR amplification was carried out using the genomic DNA of each of the 7 varieties cultivated in Japan or 7 cultivars that have been cultivated so far as templates (FIG. 10). From these results, it can be seen that there are some varieties with a functional Hd5 gene and varieties with a deficient gene in the very early cultivars cultivated in the Hokkaido region. It was shown that it can be used to diagnose the presence or absence of function.

  That is, the present inventors have succeeded in isolating a new gene involved in plant photosensitivity, and using this gene can modify plant photosensitivity and alter flowering time. In addition, the present inventors have found that it is possible to determine the intensity of photosensitivity of a plant using the gene, thereby completing the present invention.

The present invention more specifically,
[1] The DNA according to any one of (a) to (d) below, which encodes a plant-derived protein having a function of increasing plant photosensitivity.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(B) DNA containing the coding region of the base sequence described in any one of SEQ ID NOs: 1, 2, 4 or 5.
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1, 2, 4 or 5.
[2] The DNA according to [1], which is derived from rice.
[3] DNA encoding RNA complementary to the transcription product of DNA according to [1] or [2].
[4] A DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcription product of the DNA according to [1] or [2].
[5] DNA encoding an RNA that suppresses the expression of the DNA according to [1] or [2] due to a co-suppression effect during expression in plant cells.
[6] A vector comprising the DNA according to any one of [1] to [5].
[7] A host cell into which the vector according to [6] has been introduced.
[8] A plant cell into which the vector according to [6] has been introduced.
[9] A transformed plant comprising the plant cell according to [8].
[10] A transformed plant that is a descendant or clone of the transformed plant according to [9].
[11] A propagation material for the transformed plant according to [9] or [10].
[12] A method for producing a transformed plant comprising the step of introducing the DNA according to any one of [1] to [5] into a plant cell and regenerating the plant from the plant cell.
[13] A protein encoded by the DNA of [1] or [2].
[14] The method for producing a protein according to [13], comprising culturing the host cell according to [7] and recovering the recombinant protein from the cell or a culture supernatant thereof.
[15] An antibody that binds to the protein of [13].
[16] A polynucleotide comprising at least 15 consecutive bases complementary to the base sequence according to any one of SEQ ID NOs: 1, 2, 4 or 5, or a complementary sequence thereof.
[17] A method for increasing the photosensitivity of a plant, comprising a step of expressing the DNA according to [1] or [2] in a cell of a plant body.
[18] A method for reducing the photosensitivity of a plant, comprising a step of expressing the DNA according to any one of [3] to [5] in cells of the plant body.
[19] An agent for modifying the photosensitivity of a plant, comprising the DNA according to any one of [1] to [5] or the vector according to [6] as an active ingredient.
[20] An inspection method for determining the photosensitivity of a plant, comprising the following steps (a) to (c).
(A) A step of preparing a DNA sample from a test plant body and a propagation medium.
(B) A step of amplifying the DNA region described in [1] from the DNA sample.
(C) A step of comparing the molecular weight or base sequence of the DNA fragment obtained by amplifying the DNA region described in [1] from a plant variety / line and the DNA fragment amplified from the DNA sample.

  According to the present invention, a novel photosensitive gene is provided. The gene of the present invention has a function of imparting photosensitivity to a plant and thereby causing the plant to become late. In plants having ears such as rice, the heading time can be regulated by regulating the expression and function of this gene. For this reason, the gene of the present invention is particularly useful for breeding rice varieties adapted to the cultivation region and cultivation season. In addition, rice cultivar breeding using the gene of the present invention is more advantageous than conventional methods in that a target plant can be obtained with high certainty in a short period of time.

  The present invention also provides a genetic diagnosis method for determining plant photosensitivity. In the method of the present invention, photosensitivity can be determined by extracting genomic DNA of cultivars cultivated so far and new varieties by mating or genetic recombination, and analyzing them. If the photosensitivity can be determined, it becomes possible to predict the photosensitivity of an individual appearing in the progeny of a cross between varieties, which is useful information for selection and selection of a mating mother.

  The present invention provides a DNA encoding an Hd5 protein derived from rice. The base sequence of the genomic DNA of “Kasalath” is shown in SEQ ID NO: 1, the base sequence of the cDNA of “Kasalath” is shown in SEQ ID NO: 2, and the amino acid sequence of the protein encoded by the DNA is shown in SEQ ID NO: 3. Further, the base sequence of Hd5 genomic DNA of “Nippon Hare” is shown in SEQ ID NO: 4, the base sequence of cDNA of “Nippon Hare” is shown in SEQ ID NO: 5, and the amino acid sequence of the protein encoded by the DNA is shown in SEQ ID NO: 6. .

  The Hd5 gene is one of the quantitative trait loci (QTL) detected using the progeny of “Nipponbare” and “Kasalath”, and it has been shown that it sits on chromosome 8. In addition, analysis using a near-isogenic line in which the Hd5 region of “Kasalath” was replaced with the genetic background of “Nipponbare” revealed that the Hd5 locus is involved in day length reactivity and has the effect of delaying heading under long day conditions. (Lin et al., Breeding Science 53: 51-59, 2003). Furthermore, it was also found that another photosensitive gene Hd1 is required for its delayed action (Lin et al., Breeding Science 53: 51-59, 2003). In other words, the Hd5 gene of “Kasalath” enhances photosensitivity and has the effect of being late-grown when grown in the field (close to long-day conditions). Thus, the Hd5 gene has been known as a gene involved in plant photosensitivity, so far existing in one of the vast regions of rice chromosome 8, but for its identification and isolation. It was not reached. The present inventors have succeeded for the first time in elucidating the region of existence through complicated steps and isolating the gene as a single gene.

  Currently, in the improvement of rice varieties in Japan, the control of heading time is an important breeding target. The adjustment of heading time is important for avoiding cold damage, especially in cold regions, since the low temperature of autumn comes early. On the other hand, in the southwestern warm regions, to avoid the concentration of harvesting work in large-scale rice farming areas. Is expected to become early or late.

  Since Hd5 protein has the effect of enhancing the photosensitivity of plants, it is possible to cause late planting (delaying of flowering time) by transforming plants with DNA encoding the protein. It is. On the other hand, by controlling the expression of the DNA using an antisense method or a ribozyme method, it is possible to reduce photosensitivity and advance the flowering time of plants. For example, by transforming this gene with a sense strand into a variety in which the function of the Hd5 gene has disappeared, such as “Hayamasari”, it is possible to delay heading in the long day or the natural day length in summer. On the other hand, heading can be promoted by introducing the Hd5 gene in the antisense direction into cultivars that retain the function of the Hd5 gene, such as “Nipponbare” or “Kasalath”. The long day condition is similar to the natural day length condition of the rice cultivation period in summer in Japan, so it is effective in adjusting the heading period under actual cultivation conditions. The period required for transformation is extremely short compared to gene transfer by mating, and the heading time can be modified without changing other traits. By using the isolated heading delay gene Hd5, it is possible to easily change the heading time of rice and contribute to the breeding of rice varieties adapted to different regions.

  The DNA encoding the Hd5 protein of the present invention includes genomic DNA, cDNA, and chemically synthesized DNA. Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. Genomic DNA is extracted from rice varieties (for example, “Kasalath” and “Nippon Hare”) that have photosensitivity genes, and genomic libraries (vectors include plasmids, phages, cosmids, BACs, PACs, etc.). By developing colony hybridization or plaque hybridization using a probe prepared on the basis of DNA encoding the protein of the present invention (for example, SEQ ID NO: 2, 5). It is possible to prepare. It is also possible to prepare a primer specific for DNA encoding the protein of the present invention (for example, SEQ ID NOs: 2, 5) and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from rice varieties having a photosensitivity gene (eg, “Kasalath”, “Nippon Hare”), and inserted into a vector such as λZAP to obtain a cDNA library. It is possible to prepare by developing and developing colony hybridization or plaque hybridization in the same manner as described above, or by performing PCR.

  The present invention includes a DNA encoding a protein functionally equivalent to the Hd5 protein (“Kasalath”, “Nippon Hare”) described in SEQ ID NO: 3 or 6. Here, “having the same function as Hd5 protein” means that the target protein has a function of increasing the photosensitivity of plants. Such DNA is preferably derived from a monocotyledonous plant, more preferably from a gramineous plant, and most preferably from rice.

  Such a DNA includes, for example, a mutant encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added and / or inserted in the amino acid sequence set forth in SEQ ID NO: 3 or 6. Derivatives, alleles, variants and homologs are included.

  Methods well known to those skilled in the art for preparing DNA encoding proteins with altered amino acid sequences include, for example, the site-directed mutagenesis method (Kramer, W. & Fritz, H.-J. (1987) Oligonucleotide-directed construction of mutagenesis via gapped duplex DNA. Methods in Enzymology, 154: 350-367). In addition, the amino acid sequence of the encoded protein may be mutated in nature due to the mutation of the base sequence. Thus, even if the DNA encodes a protein having an amino acid sequence in which one or more amino acids are substituted, deleted or added in the amino acid sequence encoding the natural Hd5 protein, the natural Hd5 protein (SEQ ID NO: As long as it encodes a protein having a function equivalent to 3 or 6), it is included in the DNA of the present invention. Moreover, even if the base sequence is mutated, it may not be accompanied by amino acid mutation in the protein (degenerate mutation), and such a degenerate mutant is also included in the DNA of the present invention.

  Whether or not a certain DNA encodes a protein that increases plant photosensitivity can be evaluated as follows. The most common method is a method for cultivating and examining a plant into which the DNA has been introduced in a growth chamber in which the day length can be changed. That is, cultivate under short-day (generally 9-10 hours) and long-day (14-16 hours) conditions, and the number of days required from sowing to flowering (from rice sowing to earing) It is a method of comparison. If the number of days does not change between the long days and the short days or is almost the same, it is determined that there is no photosensitivity. When there is photosensitivity, the number of days until flowering in a long day is greater than that in a short day, and the magnitude of the difference can be regarded as the degree of photosensitivity. When the growth chamber is not available, it can be verified by a cultivation test in a natural day length field or greenhouse. That is, sowing every 20 days in a greenhouse, keeping the temperature and cultivating under natural day length, and measuring each flowering date. In rice, in general, when sown in August-February, heading of highly sensitive varieties is promoted, and conversely, it is delayed from April to July. On the other hand, in varieties with small photosensitivity, the number of days reached reaches little without being affected by the movement of the sowing period.

  Other methods well known to those skilled in the art for preparing DNA encoding a protein functionally equivalent to the Hd5 protein described in SEQ ID NO: 3 or 6 include hybridization techniques (Southern, EM (1975 ) Journal of Molecular Biology, 98, 503) and polymerase chain reaction (PCR) technology (Saiki, RK et al. (1985) Science, 230, 1350-1354, Saiki, RK et al. (1988) Science, 239, 487 -491). That is, for those skilled in the art, the nucleotide sequence of the Hd5 gene (SEQ ID NO: 2 or 5) or a part thereof is used as a probe, and an oligonucleotide that specifically hybridizes to the Hd5 gene (SEQ ID NO: 2 or 5) is used as a primer. Thus, it is usually possible to isolate DNA having high homology with the Hd5 gene from rice and other plants. Thus, DNA encoding a protein having a function equivalent to the Hd5 protein that can be isolated by a hybridization technique or a PCR technique is also included in the DNA of the present invention.

  In order to isolate such DNA, the hybridization reaction is preferably carried out under stringent conditions. In the present invention, stringent hybridization conditions refer to hybridization conditions of 6M urea, 0.4% SDS, 0.5xSSC or equivalent stringency. Isolation of DNA with higher homology can be expected by using conditions with higher stringency, for example, conditions of 6M urea, 0.4% SDS, 0.1 × SSC. The isolated DNA is considered to have high homology with the amino acid sequence of the Hd5 protein (SEQ ID NO: 3 or 6) at the amino acid level. High homology means a sequence of at least 50% or more, more preferably 70% or more, more preferably 90% or more (for example, 95%, 96%, 97%, 98%, 99% or more) in the entire amino acid sequence. Refers to the identity of The identity of amino acid sequences and nucleotide sequences is determined using the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc Natl Acad Sci USA 90: 5873, 1993) by Carlin and Arthur. it can. Programs called BLASTN and BLASTX based on the BLAST algorithm have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When analyzing a base sequence using BLASTN, parameters are set to, for example, score = 100 and wordlength = 12. In addition, when an amino acid sequence is analyzed using BLASTX, the parameters are, for example, score = 50 and wordlength = 3. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods of these analysis methods are known.

  The DNA of the present invention can be used, for example, for the preparation of recombinant proteins and the production of transformed plants with altered photosensitivity.

  When preparing a recombinant protein, usually, a DNA encoding the protein of the present invention is inserted into an appropriate expression vector, the vector is introduced into an appropriate cell, and the transformed cell is cultured and expressed. Purify. The recombinant protein can be expressed as a fusion protein with another protein for the purpose of facilitating purification or the like. For example, a method for preparing a fusion protein with maltose binding protein using E. coli as a host (vector pMAL series released by New England BioLabs, USA), a method for preparing a fusion protein with glutathione-S-transferase (GST) (Amersham Pharmacia Biotech Vector pGEX series released by the company), a method of preparing by adding a histidine tag (pET series from Novagen), etc. can be used. The host cell is not particularly limited as long as it is a cell suitable for the expression of a recombinant protein. For example, yeast, various animal and plant cells, insect cells and the like can be used in addition to the above-mentioned E. coli. Various methods known to those skilled in the art can be used to introduce a vector into a host cell. For example, for introduction into E. coli, introduction methods using calcium ions (Mandel, M. & Higa, A. (1970) Journal of Molecular Biology, 53, 158-162, Hanahan, D. (1983) Journal of Molecular Biology, 166, 557-580) can be used. The recombinant protein expressed in the host cell can be purified and recovered from the host cell or its culture supernatant by methods known to those skilled in the art. When the recombinant protein is expressed as a fusion protein with the maltose binding protein or the like, affinity purification can be easily performed. It is also possible to prepare a transformed plant into which the DNA of the present invention has been introduced by the method described later and prepare the protein of the present invention from the plant. Therefore, the transformed plant of the present invention contains not only the plant into which the DNA of the present invention has been introduced in order to modify photosensitivity, which will be described later, but also the DNA of the present invention for the preparation of the protein of the present invention. Introduced plants are also included.

  If the obtained recombinant protein is used, an antibody that binds to the protein can be prepared. For example, a polyclonal antibody can be prepared by immunizing an immunized animal such as a rabbit with the purified protein of the present invention or a partial peptide thereof, collecting blood after a certain period, and removing the blood clot. is there. In addition, the monoclonal antibody is obtained by fusing an antibody-producing cell of an animal immunized with the protein or peptide and a bone tumor cell, and isolating a single clone cell (hybridoma) that produces the target antibody. Can be prepared. The antibody thus obtained can be used for purification and detection of the protein of the present invention. The present invention includes antibodies that bind to the proteins of the present invention. By using these antibodies, it is possible to determine the expression site of the photosensitive protein in the plant body or to determine whether the plant species expresses the photosensitive protein. For example, an antibody that specifically recognizes the amino acid sequence on the carboxyl-terminal side of “Kasalath” or “Nippon Hare” does not bind to proteins expressed in varieties such as “Hayamasari” that do not have photosensitivity. Can be used to determine whether or not the protein expresses a photosensitive protein.

  When producing a transformed plant with increased photosensitivity using the DNA of the present invention, the DNA encoding the protein of the present invention is inserted into an appropriate vector, which is introduced into a plant cell, The transformed plant cell obtained by the above is regenerated. The photosensitive gene isolated by the present inventors has the effect of enhancing the photosensitivity of rice and, as a result, has the effect of delaying the heading period, but this Hd5 gene can be introduced into any variety and expressed. It is possible to adjust the heading time of these lines. The period required for this transformation is extremely short as compared with conventional gene transfer by crossing, and is advantageous in that it does not involve any other changes in traits.

  On the other hand, when producing a transformed plant body with reduced photosensitivity, a DNA for suppressing the expression of the DNA encoding the protein of the present invention is inserted into an appropriate vector and introduced into a plant cell. Then, the transformed plant cell thus obtained is regenerated. “Suppressing the expression of DNA encoding the protein of the present invention” includes suppression of gene transcription and suppression of protein translation. Also included is a decrease in expression as well as complete cessation of DNA expression.

  Suppression of the expression of a specific endogenous gene in a plant can be performed using, for example, DNA encoding RNA complementary to a transcription product of DNA encoding the protein of the present invention.

  One embodiment of “DNA encoding RNA complementary to the transcription product of DNA encoding the protein of the present invention” is DNA encoding antisense RNA complementary to the transcription product of DNA encoding the protein of the present invention. It is. The antisense effect in plant cells was demonstrated for the first time when antisense RNA introduced by electroporation exerted an antisense effect in plants using a transient gene expression method (JREckerand RWDavis, ( 1986) Proc. Natl. Acad. USA. 83: 5372). Subsequently, tobacco and petunia have also been reported to decrease the expression of target genes by expressing antisense RNA (ARvan der Krol et al. (1988) Nature 333: 866). Established as a means to suppress

  There are several factors as described below for the action of an antisense nucleic acid to suppress the expression of a target gene. That is, transcription initiation inhibition by triplex formation, transcription inhibition by hybridization with a site where an open loop structure is locally created by RNA polymerase, transcription inhibition by hybridization with RNA that is undergoing synthesis, intron and exon Of splicing by hybrid formation at the junction with the protein, suppression of splicing by hybridization with the spliceosome formation site, suppression of transition from the nucleus to the cytoplasm by hybridization with mRNA, hybridization with capping sites and poly (A) addition sites Splicing suppression by formation, translation initiation suppression by hybridization with the translation initiation factor binding site, translation suppression by hybridization with the ribosome binding site near the initiation codon, peptization by hybridization with the mRNA translation region and polysome binding site For example, inhibition of gene chain elongation is prevented, and hybridization between nucleic acid and protein interaction sites is performed. They inhibit transcription, splicing, or translation processes and suppress target gene expression (Hirashima and Inoue, "Neurochemistry Experiment Course 2, Nucleic Acid IV Gene Replication and Expression", edited by the Japanese Biochemical Society, Tokyo Kagaku Dojin , pp.319-347, 1993).

  The antisense sequence used in the present invention may suppress the expression of the target gene by any of the actions described above. In one embodiment, if an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the gene is designed, it will be effective for inhibiting translation of the gene. However, sequences complementary to the coding region or the 3 ′ untranslated region can also be used. As described above, a DNA containing an antisense sequence of a non-translated region as well as a translated region of a gene is also included in the antisense DNA used in the present invention. The antisense DNA to be used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side. The DNA thus prepared can be transformed into a desired plant by a known method. The sequence of the antisense DNA is preferably a sequence complementary to the endogenous gene or a part thereof possessed by the plant to be transformed, but may be not completely complementary as long as the gene expression can be effectively inhibited. Good. The transcribed RNA preferably has a complementarity of 90% or more, most preferably 95% or more, to the transcription product of the target gene. In order to effectively inhibit the expression of a target gene using an antisense sequence, the length of the antisense DNA is at least 15 bases or more, preferably 100 bases or more, more preferably 500 bases or more. is there. Usually, the length of the antisense DNA used is shorter than 5 kb, preferably shorter than 2.5 kb.

  Suppression of endogenous gene expression can also be performed using DNA encoding a ribozyme. A ribozyme refers to an RNA molecule having catalytic activity. Some ribozymes have a variety of activities. Among them, research on ribozymes as enzymes that cleave RNA has made it possible to design ribozymes for site-specific cleavage of RNA. Some ribozymes have a group I intron type or a size of 400 nucleotides or more like M1RNA contained in RNaseP, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type ( Makoto Koizumi and Eiko Otsuka, (1990) Protein Nucleic Acid Enzymes, 35: 2191).

  For example, the self-cleaving domain of hammerhead ribozyme cleaves 3 ′ of C15 of G13U14C15, but it is important for U14 to form a base pair with A at position 9, and the base at position 15 is In addition to C, it has been shown to be cleaved by A or U (M. Koizumi et al. (1988) FEBS Lett. 228: 225). If the ribozyme substrate binding site is designed to be complementary to the RNA sequence near the target site, it is possible to create a restriction enzyme-like RNA-cleaving ribozyme that recognizes the UC, UU, or UA sequence in the target RNA. (M. Koizumi et al. (1988) FEBS Lett. 239: 285, Makoto Koizumi and Eiko Otsuka, (1990) Protein Nucleic Acid Enzyme, 35: 2191, M. Koizumi et al. (1989) Nucleic Acids Res. 17 : 7059). For example, there are a plurality of target sites in the coding region of the Hd5 gene (SEQ ID NO: 2 or 4).

  Hairpin ribozymes are also useful for the purposes of the present invention. Hairpin ribozymes are found, for example, in the minus strand of tobacco ring spot virus satellite RNA (J. M. Buzayan Nature 323: 349, 1986). It has been shown that this ribozyme can also be designed to cause target-specific RNA cleavage (Y. Kikuchi and N. Sasaki (1992) Nucleic Acids Res. 19: 6751, Hiroshi Kikuchi, (1992) Chemistry and Biology 30 : 112).

  A ribozyme designed to cleave the target is linked to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence so that it is transcribed in plant cells. However, at that time, if an extra sequence is added to the 5 ′ end or 3 ′ end of the transcribed RNA, the ribozyme activity may be lost. In such a case, in order to accurately cut out only the ribozyme part from the RNA containing the transcribed ribozyme, another trimming ribozyme that acts in cis for trimming is placed on the 5 'side or 3' side of the ribozyme part. (K. Taira et al. (1990) Protein Eng. 3: 733, AMDzianottand JJ Bujarski (1989) Proc. Natl. Acad. Sci. USA. 86: 4823, CAGrosshansand RTCech (1991) Nucleic Acids Res. 19: 3875, K. Taira et al. (1991) Nucleic Acids Res. 19: 5125). In addition, such structural units can be arranged in tandem so that multiple sites in the target gene can be cleaved, thereby further enhancing the effect (N. Yuyama et al. Biochem. Biophys. Res. Commun. 186: 1271,1992). Such a ribozyme can be used to specifically cleave the transcription product of the target gene in the present invention, thereby suppressing the expression of the gene.

  Another embodiment of "DNA encoding RNA complementary to the transcription product of DNA encoding the protein of the present invention" is DNA encoding dsRNA complementary to the transcription product of DNA encoding the protein of the present invention. It is. RNAi is a phenomenon in which, when a double-stranded RNA (hereinafter referred to as dsRNA) having the same or similar sequence as a target gene sequence is introduced into a cell, the expression of the introduced foreign gene and target endogenous gene are both suppressed. When dsRNA of about 40 to several hundred base pairs is introduced into a cell, a RNaseIII-like nuclease called Dicer with a helicase domain is present in the presence of ATP, and dsRNA is about 21 to 23 base pairs from the 3 ′ end. Cut out and produce siRNA (short interference RNA). A protein specific to this siRNA binds to form a nuclease complex (RISC: RNA-induced silencing complex). This complex recognizes and binds to the same sequence as siRNA, and cleaves the mRNA of the target gene at the center of siRNA by RNaseIII-like enzyme activity. In addition to this pathway, the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RsRP) to synthesize dsRNA. There is also a possibility that this dsRNA becomes Dicer's substrate again to generate new siRNA and amplify the action.

  The RNAi was originally found in nematodes (Fire, A. et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811, (1998)), In addition to nematodes, it has been observed in various organisms such as plants, linear animals, Drosophila, protozoa (Fire, A. RNA-triggered gene silencing. Trends Genet. 15, 358-363 (1999), Sharp, PA RNA interference 2001. Genes Dev. 15, 485-490 (2001), Hammond, SM, Caudy, AA & Hannon, GJ Post-transcriptional gene silencing by double-stranded RNA.Nature Rev. Genet. 2, 110-1119 ( 2001), Zamore, PD RNA interference: listening to the sound of silence. Nat Struct Biol. 8, 746-750 (2001)). In these organisms, it has been confirmed that the expression of the target gene is suppressed by actually introducing dsRNA from a foreign body, and is also being used as a method for creating knockout individuals.

  At the beginning of RNAi, dsRNA was thought to be effective unless it was longer than a certain length (40 bases), but US Rockefeller University Tuschl et al. Used single-stranded dsRNA (siRNA) around 21 base pairs in cells. Introduced in, we report that RNAi is effective in mammalian cells without causing antiviral reaction by PKR (Tuschl, Nature, 411, 494-498 (2001)). It has attracted a lot of attention as a technology that can be applied to mammalian cells.

  The DNA of the present invention comprises an antisense code DNA that encodes an antisense RNA for any region of the target gene mRNA, and a sense code DNA that encodes a sense RNA for any region of the target gene mRNA. The antisense RNA and the sense RNA can be expressed from the sense code DNA and the sense code DNA. Moreover, dsRNA can also be produced from these antisense RNA and sense RNA.

  When the dsRNA expression system of the present invention is retained in a vector or the like, the antisense RNA and sense RNA are expressed from the same vector, and the antisense RNA and sense RNA are expressed from different vectors, respectively. There is. For example, antisense RNA and sense RNA can be expressed from the same vector as antisense RNA in which an antisense coding DNA and a promoter capable of expressing a short RNA such as polIII are linked upstream of the sense coding DNA. It can be constructed by constructing an expression cassette and a sense RNA expression cassette, respectively, and inserting these cassettes into the vector in the same direction or in the opposite direction. It is also possible to construct an expression system in which the antisense code DNA and the sense code DNA are arranged in opposite directions so as to face each other on different strands. In this configuration, one double-stranded DNA (siRNA-encoding DNA) in which an antisense RNA coding strand and a sense RNA coding strand are paired is provided, and antisense RNA and sense RNA from each strand are provided on both sides thereof. A promoter is provided oppositely so that it can be expressed. In this case, in order to avoid adding extra sequences downstream of the sense RNA and antisense RNA, a terminator is added to the 3 ′ end of each strand (antisense RNA coding strand, sense RNA coding strand). It is preferable to provide. As this terminator, a sequence in which four or more A (adenine) bases are continued can be used. Further, in this palindromic style expression system, it is preferable that the two promoters are of different types.

  In addition, as a configuration for expressing antisense RNA and sense RNA from different vectors, for example, antisense coding DNA and an antisense in which a promoter capable of expressing a short RNA such as polIII is linked upstream of the sense coding DNA. An RNA expression cassette and a sense RNA expression cassette can be constructed, and these cassettes can be held in different vectors.

  In the RNAi of the present invention, siRNA may be used as dsRNA. “SiRNA” means a double-stranded RNA consisting of short strands in a range that does not show toxicity in cells, and is not limited to the total length of 21 to 23 base pairs reported by Tuschl et al. The length is not particularly limited as long as the length is not shown. For example, the length can be 15 to 49 base pairs, preferably 15 to 35 base pairs, and more preferably 21 to 30 base pairs. Alternatively, the siRNA to be expressed is transcribed and the length of the final double-stranded RNA portion is, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, more preferably 21 to 30 base pairs. be able to.

  As the DNA of the present invention, an appropriate sequence (preferably an intron sequence) is inserted between inverted repeats of a target sequence to produce a double-stranded RNA having a hairpin structure (self-complementary 'hairpin' RNA (hpRNA)). (Smith, NA et al. Nature, 407: 319, 2000, Wesley, SV et al. Plant J. 27: 581, 2001, Piccin, A. et al. Nucleic Acids Res. 29: E55, 2001) Can also be used.

  The DNA used for RNAi need not be completely identical to the target gene, but has at least 70%, preferably 80%, more preferably 90%, most preferably 95% or more sequence identity. . The sequence identity can be determined by the method described above.

  The part of the double-stranded RNA in which the RNAs in dsRNA are paired is not limited to a perfect pair, but mismatch (corresponding base is not complementary), bulge (no base corresponding to one strand) ) Or the like may include an unpaired portion. In the present invention, both bulges and mismatches may be included in the double-stranded RNA region where RNAs in dsRNA pair with each other.

  Suppression of endogenous gene expression can also be achieved by co-suppression caused by transformation of DNA having a sequence identical or similar to the target gene sequence. “Co-suppression” refers to a phenomenon in which the expression of both a foreign gene and a target endogenous gene to be introduced is suppressed when a gene having the same or similar sequence as that of the target endogenous gene is introduced into a plant by transformation. Say. The details of the mechanism of co-suppression are not clear, but are often observed in plants (Curr. Biol. 7: R793, 1997, Curr. Biol. 6: 810, 1996). For example, in order to obtain a plant body in which the Hd5 gene is co-suppressed, a vector DNA prepared so that the Hd5 gene or a DNA having a similar sequence can be expressed is transformed into the target plant, and the resulting plant is obtained. A plant having an Hd5 mutant trait, that is, a plant with reduced photosensitivity may be selected. The gene used for co-suppression need not be completely identical to the target gene, but is at least 70% or more, preferably 80% or more, more preferably 90% or more (eg, 95%, 96%, 97%, 98 %, 99% or more).

  Furthermore, suppression of the expression of the endogenous gene in the present invention can also be achieved by transforming a gene having a dominant negative trait of the target gene into a plant. A gene having a dominant negative trait refers to a gene having a function of eliminating or reducing the activity of an endogenous wild-type gene inherent in a plant by expressing the gene.

  The present invention also provides a vector into which the DNA of the present invention or a DNA that suppresses the expression of the DNA of the present invention is inserted. As the vector of the present invention, in addition to the above-mentioned vectors used for the production of recombinant proteins, the DNA of the present invention or the DNA that suppresses the expression of the DNA of the present invention is expressed in plant cells for the production of transformed plants. These vectors are also included. Such a vector is not particularly limited as long as it contains a promoter sequence that can be transcribed in plant cells and a terminator sequence including a polyadenylation site necessary for stabilization of the transcript. For example, plasmids `` pBI121 '', `` pBI221 "," pBI101 "(both manufactured by Clontech). The vector used for the transformation of plant cells is not particularly limited as long as the inserted gene can be expressed in the cells. For example, using a vector having a promoter (eg, cauliflower mosaic virus 35S promoter) for constitutive gene expression in plant cells or a vector having a promoter that is inducibly activated by external stimuli Is also possible. As used herein, “plant cells” include various forms of plant cells, such as suspension culture cells, protoplasts, leaf sections, and callus.

  The vector of the present invention may contain a promoter for constitutively or inducibly expressing the protein of the present invention. Examples of promoters for constant expression include cauliflower mosaic virus 35S promoter (Odell et al. 1985 Nature 313: 810), rice actin promoter (Zhang et al. 1991 Plant Cell 3: 1155), maize And ubiquitin promoter (Cornejo et al. 1993 Plant Mol. Biol. 23: 567).

  In addition, promoters for inducible expression are known to be expressed by external factors such as infection and invasion of filamentous fungi, bacteria and viruses, low temperature, high temperature, drying, UV irradiation, and spraying of specific compounds. Promoters and the like. Examples of such promoters include the rice chitinase gene promoter (Xu et al. 1996 Plant Mol. Biol. 30: 387) expressed by infection and invasion of filamentous fungi, bacteria, and viruses, and the promoter of tobacco PR protein gene. (Ohshima et al. 1990 Plant Cell 2:95), low temperature induced rice “lip19” gene promoter (Aguan et al. 1993 Mol. GenGenet. 240: 1), high temperature induced rice “hsp80” And the promoter of the "hsp72" gene (Van Breusegem et al. 1994 Planta 193: 57), the promoter of the Arabidopsis "rab16" gene induced by drought (Nundy et al. 1990 Proc. Natl. Acad. Sci. USA 87: 1406), the promoter of the parsley chalcone synthase gene induced by UV irradiation (Schulze-Lefert et al. 1989 EMBO J. 8: 651), corn alfa induced under anaerobic conditions Promoter of Lumpur dehydrogenase gene (Walker et al 1987 Proc.Natl.Acad.Sci.USA 84:. 6624), and the like. The rice chitinase gene promoter and tobacco PR protein gene promoter are also induced by specific compounds such as salicylic acid, and “rab16” is also induced by spraying the plant hormone abscisic acid.

  The present invention also provides a transformed cell into which the vector of the present invention has been introduced. The cells into which the vector of the present invention is introduced include plant cells for the production of transformed plants in addition to the cells used for the production of recombinant proteins. There is no restriction | limiting in particular as a plant cell, For example, cells, such as Arabidopsis thaliana, rice, corn, potato, and tobacco, are mentioned. The plant cells of the present invention include cultured cells as well as cells in the plant body. Also included are protoplasts, shoot primordia, multi-buds, and hairy roots. For introduction of a vector into a plant cell, various methods known to those skilled in the art such as polyethylene glycol method, electroporation (electroporation), Agrobacterium-mediated method, and particle gun method can be used. Regeneration of the plant body from the transformed plant cell can be performed by a method known to those skilled in the art depending on the type of plant cell (see Toki et al. (1995) Plant Physiol. 100: 1503-1507). . For example, in rice, a method for producing a transformed plant is a method of regenerating a plant (indian rice varieties are suitable) by introducing a gene into protoplasts using polyethylene glycol (Datta, SK (1995) In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) Pp66-74), Gene transfer to protoplasts by electric pulses to regenerate plants (Japanese rice varieties are suitable) (Toki et al. (1992) Plant Physiol. 100, 1503-1507), a method of directly introducing a gene into a cell by the particle gun method to regenerate a plant body (Christou et al. (1991) Bio / technology, 9: 957-962.) And Agrobacterium Some technologies have already been established, such as a method for introducing a gene via a um and regenerating a plant (Hiei et al. (1994) Plant J. 6: 271-282.). Widely used. In the present invention, these methods can be suitably used.

  Transformed plant cells can regenerate plant bodies by redifferentiation. The method of redifferentiation varies depending on the type of plant cell. For example, for rice, the method of Fujimura et al. (Plant Tissue Culture Lett. 2:74 (1995)) can be mentioned, and for corn, Shillito et al. (Bio / Technology). 7: 581 (1989)) and Gorden-Kamm et al. (Plant Cell 2: 603 (1990)). For potatoes, Visser et al. (Theor. Appl. Genet 78: 594 (1989)) In the case of tobacco, the method of Nagata and Takebe (Planta 99:12 (1971)) is mentioned. In the case of Arabidopsis, the method of Akama et al. (Plant Cell Reports 12: 7-11 (1992)) is mentioned, and eucalyptus Then, the method of Toi et al. (Japanese Patent Laid-Open No. 8-89113) can be mentioned.

  Once a transformed plant into which the DNA of the present invention or the DNA that suppresses the expression of the DNA of the present invention is introduced in the genome is obtained, progeny can be obtained from the plant by sexual reproduction or asexual reproduction. Is possible. It is also possible to obtain a propagation material (for example, seeds, fruits, cuttings, tubers, tuberous roots, strains, callus, protoplasts, etc.) from the plant body, its descendants or clones, and mass-produce the plant body based on them. Is possible. The present invention includes a plant cell into which the DNA of the present invention has been introduced, a plant containing the cell, progeny and clones of the plant, and propagation material of the plant, its progeny and clones.

  Plants with altered photosensitivity produced in this way have changed flowering times compared to wild-type plants. For example, a plant into which DNA encoding Hd5 protein has been introduced has a delayed flowering time under field conditions due to increased photosensitivity, while expression of DNA encoding Hd5 protein by introduction of antisense DNA, etc. Plants with suppressed sensation have earlier flowering times due to their reduced photosensitivity. By controlling the expression of the Hd5 gene in this way, the flowering time of the plant can be regulated. By using the method of the present invention, it is possible to adjust the heading time of rice, which is a useful crop, and it is very beneficial in growing rice varieties adapted to the growth environment.

  The present invention also provides a polynucleotide comprising at least 15 consecutive bases complementary to the base sequence described in any of SEQ ID NOs: 1, 2, 4 or 5 or a complementary sequence thereof. Here, the “complementary sequence” refers to the sequence of the other strand with respect to the sequence of one strand of the double-stranded DNA comprising A: T and G: C base pairs. Further, the term “complementary” is not limited to a case where the sequence is completely complementary in at least 15 consecutive nucleotide regions, and is at least 70%, preferably at least 80%, more preferably 90%, even more preferably 95%. What is necessary is just to have the identity of the above base sequence. Such DNA is useful as a probe for detecting and isolating the DNA of the present invention and as a primer for performing amplification.

  Furthermore, the present invention provides a genetic diagnosis method for determining photosensitivity of plants. The photosensitivity of plants is closely related to the heading time of plants, and judging the photosensitivity of plants is very important in the cultivation of rice varieties adapted to the cultivation area and cultivation season.

  In the present invention, “determination of photosensitivity of plants” includes not only determination of photosensitivity in cultivars cultivated so far, but also determination of photosensitivity in new varieties by crossing or gene recombination techniques.

  The method for evaluating the photosensitivity of a plant of the present invention is characterized by detecting whether or not the plant holds DNA encoding a functional Hd5 protein. Whether or not a plant holds a DNA encoding a functional Hd5 protein can be evaluated by detecting the difference in molecular weight or nucleotide sequence in the region corresponding to Hd5 in genomic DNA. .

  One embodiment is a method of comparing the molecular weight of the DNA region corresponding to the Hd5 gene in the test plant body and propagation medium with the DNA region of the Hd5 gene in the photosensitive variety. “Photosensitive varieties” refers to varieties that maintain photosensitivity, including cultivars such as “Nihonbare” and “Koshihikari” cultivated in the Honshu region of Japan.

  First, a DNA sample is prepared from a test plant body and a propagation medium. Next, a DNA region corresponding to the Hd5 gene is amplified from the DNA sample. In addition, the molecular weight of the DNA fragment amplified from the DNA region of the Hd5 gene in the photosensitive cultivar is compared with the DNA fragment amplified from the DNA sample. If the molecular weight is significantly lower than the photosensitive cultivar, the photosensitivity of the test plant Is diagnosed as falling.

  Specifically, first, the DNA region of the Hd5 gene of the present invention is amplified by a PCR method or the like. The “DNA region of the Hd5 gene” in the present invention is a portion corresponding to the genomic DNA region of the Hd5 gene, and the amplified range may be the full length of the genomic DNA or a part of the genomic DNA. Good. A region containing a 19 bp deletion found in “Hayamasari” is preferred. Those skilled in the art can perform PCR by appropriately selecting reaction conditions and the like. In PCR, the amplified DNA product can be labeled by using a primer labeled with an isotope such as 32P, a fluorescent dye, or biotin. Alternatively, the amplified DNA product can be labeled by performing PCR by adding a substrate base labeled with an isotope such as 32P, a fluorescent dye, or biotin to the PCR reaction solution. Furthermore, labeling can also be performed by adding a substrate base labeled with an isotope such as 32P, a fluorescent dye, or biotin to the amplified DNA fragment using Klenow enzyme or the like after the PCR reaction.

  The labeled DNA fragment thus obtained is denatured by applying heat or the like, and electrophoresed on a polyacrylamide gel containing a denaturing agent such as urea or SDS. SDS-PAGE using SDS as a denaturing agent is an advantageous separation technique in the present invention, and SDS-PAGE can be performed according to the Laemmli method (Laemmli (1970) Nature 227, 680-685). After electrophoresis, the mobility of the DNA fragments is detected and analyzed by autoradiography using an X-ray film, a scanner that detects fluorescence, or the like. Even when the labeled DNA is not used, the band can be detected by staining the gel after electrophoresis with ethidium bromide or silver staining. For example, as described in Example 7, DNA fragments are amplified from photosensitive varieties (Nippon Hare, Koshihikari) and test plants using the polynucleotides of SEQ ID NOs: 29 and 30 of the present invention as primers, and the molecular weight The photosensitivity can be determined by comparing. In this case, 300 bp DNA fragments are amplified in photosensitive varieties, whereas 280 bp DNA fragments are amplified in varieties with low photosensitivity, such as DNA fragments with lower molecular weight than photosensitive varieties. Is done.

  Moreover, the photosensitivity of a plant can also be determined by directly determining the base sequence of the DNA region of the test plant corresponding to the DNA of the present invention and comparing it with the base sequence of the photosensitive variety.

  For example, if a mutation that causes loss of Hd5 function, such as the 19 bp deletion described above, is found in the DNA of the test plant, the test plant is diagnosed as having reduced photosensitivity.

  Evaluation of the photosensitivity of plants by the method of the present invention has advantages in the case of breed improvement by crossing plants, for example. For example, when it is not desired to introduce a photosensitive trait, it is possible to avoid mating with a cultivar having photosensitivity, and conversely, when mating with a photosensitive trait is desired, It can be performed. It is also effective when selecting desirable individuals from the progeny individuals of the cross. Since it is simple and reliable to judge the presence or absence of photosensitivity of a plant at the gene level as compared with judgment of its phenotype, the photosensitivity evaluation method of the present invention is greatly used in plant variety improvement. It can be said that it can contribute.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.

[Example 1]
The quantitative trait locus (QTL) Hd5 is found on chromosome 8 (Figure 1) (Yano et al. TAG 95: 1025-1032, 1997) and is located between the RFLP markers C166 and R902, and R2976 and Were found to co-segregate (FIG. 3A) (Lin et al., Breeding Science 53: 51-59, 2003). However, with this linkage analysis accuracy, it has been difficult to isolate and identify genes by map-based cloning. In addition, it has been clarified that the Hd5 gene of “Kasalath” with heading delaying action acts dominantly on the allele of “Nihonbare”. We cultivated near-isogenic lines [NIL (Hd5)] in which the Hd5 gene of “Kasalath” was substituted on the genetic background of “Nipponbare” and Nipponbare under different day length conditions, and investigated the number of days to reach them. [NIL (Hd5)] was delayed by 14.2 days under natural conditions and 14.8 days under long-day conditions compared to Nipponbare, but almost the same as Nipponbare under short-day conditions (Fig. 2). From these results, the Hd5 gene has a function of delaying heading, and the head delaying effect was observed only under long-day conditions and natural conditions (FIG. 2). Furthermore, from the results of genetic analysis of the cultivars “Hayamasari” and “Kasalath” that are adapted to Hokkaido, it is possible that the extremely early growth of “Hayamasari” may be caused by a functional deficiency or significant functional decline in the Hd5 gene. Suggested (Nonoue et al. Breeding Research Vol. 2 (Ap. 1) p.13 (2000) The 97th Annual Meeting of the Breeding Society of Japan, Nonoue et al. Breeding Studies Vol. 5 (Ap. 1) p.71 (2003) Proceedings of the 103rd Annual Meeting of the Japan Breeding Society).

[Example 2] High-precision linkage analysis Detailed linkage analysis of the Hd5 region was performed using a large-scale segregation population indispensable for map-based cloning. As the group for linkage analysis, the backcross generations of “Nippon Hare” and “Kasalath” were used. From the backcross progeny, individuals were selected in which the Hd5 region became heterozygous and most of the other genomic regions were replaced with “Nihonbare”. CAPS (Cleaved Amplified Polymorphic Sequence) marker S21656 (primer 5'- CTGGTGAAGGAGAGGTCGTC -3 '/ SEQ ID NO: 10 and 5'- GGTGAAGCAGCAGCATCCAT -3' / sandwiching Hd5 from 2308 self-breeding progeny of the selected individuals (corresponding to F2 population) SEQ ID NO: 11, restriction enzyme KpnI) and R902 (primer 5′-TCACGAAAGAACACATTAAACTTTATCC -3 ′ / SEQ ID NO: 12 and 5′-TTCCTTCAATTATGTAGATGCCATTC-3 ′ / SEQ ID NO: 13, restriction enzyme Eco81I) Individuals with recombinant chromosomes were selected. The genotype of the Hd5 locus was determined by a progeny test of the F3 generation. That is, 24 individual progeny progenies of the selected individuals (F2) were cultivated in an experimental field in Tsukuba City, and the genotype of Hd5 was determined from the segregation status of the arrival days within each line. As a result of linkage analysis, Hd5 was positioned between the RFLP markers EH560 and R2976, and each of the markers and 14 individuals and 4 recombinant individuals could be identified (FIG. 3B).

[Example 3] Hd5 gene region alignment by artificial chromosome (PAC and BAC) clones
The genomic nucleotide sequence of PAC clone P690F8 (Fig. 3C) containing the Hd5 locus was analyzed. Using the obtained nucleotide sequence information, new CAPS markers and SNP markers were created to further limit candidate genome regions. As a result, the Hd5 locus was identified as SNP marker 14161 (primer 5'-TCATCCAGCGTGTCCTCATT-3 '/ SEQ ID NO: 14 and 5'-TTTTATGGGCTCTATGATTTG-3' / SEQ ID NO: 15) and 18485 (primer 5'-ATCAAGACAGGGGAAACCAG-3 '/ SEQ ID NO: 16: and 5′-CGAGCACAACAGAGGAAATG-3 ′ / SEQ ID NO: 17) and one recombination were detected respectively, and CAPS marker 106Ga (primer 5′-CACTTGGAGACCTTGGATGG-3 ′ / SEQ ID NO: 18 and 5′-CCACCTTTCCCTCATTGTCG -3 ′ / SEQ ID NO: 19, restriction enzyme NlaIII) and SNP marker 18169 (primers are the same as SNP marker 18485) (FIG. 3D). Therefore, it was revealed that the candidate region of Hd5 is about 4.3 kb sandwiched between SNP markers 14161 and 18485. When gene prediction and similarity search were performed on the base sequence of this candidate region using GENSCAN (http://genes.mit.edu/GENSCAN.html), one gene was predicted and a known CCAAT-box It showed high similarity to the subunit B gene (NF-YB gene) of the binding transcription factor NF-Y protein (Fig. 3E). This predicted gene was used as a candidate for Hd5, and the subsequent analysis was performed.

[Example 4] Identification of candidate gene region by base sequence analysis of Hd5 gene The genome base sequence of Hd5 region of about 4.3 kb was analyzed for rice cultivars "Kasalath", "Nippon Hare" and "Hayamasari". In this region, 46 base substitutions and 47 insertions and deletions were found in “Nipponbare” and “Hayamasari” compared to “Kasalath” (FIG. 4). In addition, when the total length of the cDNA of “Kasalath” was determined and compared with the genomic base sequence, it was predicted that Hd5 consists of one exon and that the transcription region has a total length of 1060 bp and encodes a protein consisting of 298 amino acids. (Figure 4). Comparing the differences in the nucleotide sequence within the predicted transcription region with “Kasalath”, the “Nippon Hare” has 10 single-base substitutions, and the “Hayamasari” has 10 single-base substitutions in addition to “Nippon Haru”. Loss was found. Also, comparing the difference in amino acid sequence with “Kasalath”, “Nippon Hare” had 8 amino acid substitutions. In addition, it was revealed that the 19 bp deletion found in “Hayamasari” caused a frameshift, resulting in a stop codon at the 62nd amino acid site (FIG. 5). From this, it was estimated that the Hd5 gene of “Hayamasari” had lost its function due to this 19 bp deletion.

[Example 5] Proof of function of candidate Hd5 gene For transformation, a genomic DNA fragment derived from the Indian variety "Kasalath" presumed to have a functional Hd5 allele was used. That is, for the BAC library (Baba et al., Bulletin of the NIAR 14: 41-49, 2000) created from the genomic DNA of “Kasalath”, a primer pair P690F8T (5 '-ACTTCTCAGCGTCTTGTTCC-3' / SEQ ID NO: 20 and 5'- GATTTACCTCGTCATTGCCA-3 '/ SEQ ID NO: 21) and P700F2S (5'-AGGTCAGAGGAACATCATTG-3' / SEQ ID NO: 22 and 5'- GGTTTGGAAGGTGGTATTGT-3 '/ sequence No. 23) was screened and BAC clones B179C8 and B196F2 covering the Hd5 candidate gene were selected (FIG. 3C). Subsequent detailed linkage analysis revealed a HindIII-EagI 4.2 kb fragment (FIG. 3E) containing the candidate gene region from BAC clone B179C8, which was found to contain the Hd5 candidate gene, and Ti-plasmid vector pPZP2H-lac (Fuse et al. Plant Biotechnology 18: 219-222, 2001) and introduced into “Nipponbare” via Agrobacterium. Redifferentiated plants were quickly transferred to a growth chamber under long-day conditions (14.5 hours light) and grown, and the number of days required for heading was investigated. In the transformation generation (T0), most of the individuals into which the HindIII-EagI 4.2kb fragment was introduced (1-7 copies introduced, 19 individuals) emerged later than the vector alone (1-3 copies introduced, 7 individuals) (Fig. 6A). This suggests that the HindIII-EagI 4.2 kb fragment has the action of the Hd5 gene that significantly delays heading under long day conditions. Furthermore, in order to confirm the delayed heading action of the transgene, we selected individuals with one copy introduced from the transformation generations where heading was delayed, and cultivated their progeny progeny on long days (14.5 hours) The number of days reached was investigated. Individuals with only the vector headed from 93 to 108 days and were almost the same as “Nippon Hare”, whereas individuals with the HindIII-EagI 4.2 kb fragment were 125 to 175 days late. Was almost the same as the near-isogenic line [NIL (Hd5)] (FIG. 6B).

  For the individual into which the HindIII-EagI 4.2 kb fragment was introduced, the expression of the NF-YB-like candidate gene derived from “Kasalath” was expressed by a gene-specific marker (primer 5′-TCACATGAAGAGTAGGAAGAGCT-3 ′ / SEQ ID NO: 24 and 5′-TGATGAACTCCGACACGCACAC). -3 ′ / SEQ ID NO: 25, restriction enzyme TaqI) was confirmed by RT-PCR. As a result, transcription of NF-YB-like candidate genes derived from “Kasalath” was observed in all individuals (FIG. 7).

An experiment of transformation of NF-YB-like gene into “Hayamasari” was performed. In the transformation generation (T0), the number of days after redifferentiation of the individuals (25 individuals) into which the HindIII-EagI 4.2 kb fragment was introduced was 49 to 74 days, and normally “Hayamasari” was around 50 days after sowing. It was thought that heading was late compared with heading. When two kinds of late-bred individuals were cultivated in the same long-day condition (T1), early-born individuals (50-55 days) and late-born individuals (60-74 days) were separated in the progeny population ( Figure 8). All late-stage individuals retained the NF-YB-like gene derived from the introduced “Kasalath”. On the other hand, the number of days of arrival of “Hayamasari” was about 52 days, similar to that of early-growing individuals (FIG. 8).
These results demonstrated that the NF-YB-like gene has a function of delaying heading under long-day conditions and is Hd5.

[Example 6] Expression analysis of Hd5 gene
Changes in the daily expression level of the Hd5 gene were examined. Nipponbare leaves grown for 1 month after sowing were collected every 3 hours in an artificial climate room under long-day conditions (14-hour light) and short-day conditions (9-hour light). Total RNA was extracted from these materials, and quantitative RT-PCR analysis was performed on the Hd5 gene (primer 5'-GATGCCCTCGAACTCCATCA-3 '/ SEQ ID NO: 26 and 5'-ACGGCGTTCTACGCGC-3' / SEQ ID NO: 27, probe) 5′-CCGCAGTACGCCTTGTTCCCTGA-3 ′ / SEQ ID NO: 28). As a result, it was found that the amount of Hd5 mRNA accumulated increased during the light period, decreased during the dark period, and reached the lowest level in the morning (FIG. 9). Moreover, it was revealed that more mRNA was accumulated in the long-day condition where the heading delaying action of the Hd5 gene was clear (FIG. 9) than in the short-day condition. Some genes involved in photosensitivity have been shown to show diurnal variation in their expression (Kojima et al., Plant Cell Physiol. 43: 1096-1105, 2002). From these results, it is presumed that the change in the expression ratio caused by diurnal variation plays an important role in the development of photosensitivity, and diurnal variation in Hd5 gene expression is also due to the interaction of the photosensitive gene group. It is considered to play a part.

[Example 7] Functional diagnosis of Hd5 gene
Primer pair (5'-TCACATGAAGAGTAGGAAGAGCT-3 which can amplify a genomic fragment containing 19bp deletion in Hd5 gene found in "Hayamasari" to clarify whether functional diagnosis of Hd5 gene is possible '/ SEQ ID NO: 29 and 5'-TGATGAACTCCGACACGCAC-3' / SEQ ID NO: 30) by PCR using the genomic DNA of each of the cultivars cultivated in Japan or the 7 cultivars cultivated so far as templates. Amplification was performed (Figure 10). The varieties “Nipponbare”, “Sasanishiki” and “Koshihikari” cultivated in the Honshu region amplify 300 bp genomic fragments, while the varieties “Hayamasari”, “Hayasei Toguni” and “Noryo 20” adapted to Hokkaido The “No.” amplified a 280 bp genomic fragment and the “Hoshinoyume” amplified a 300 bp genomic fragment (FIG. 10). From the results of genetic analysis of “Hoshi no Yume” and “Hayamasari”, “Hoshi no Yume” has a functional Hd5 gene, which causes “Hoshi no Yume” to cause late life about 10 days after “Haya Masari”. (Nonoue et al., Breeding Studies Vol.5 (Another 1) p.71 (2003) The 103rd Annual Meeting of the Breeding Society of Japan) These results indicate that there are some varieties with Hd5 gene function and varieties lacking in the very early cultivars cultivated in the Hokkaido region. It shows what you can do.

It is a figure which shows the position on the rice chromosome of Hd5 gene. It is a figure which shows the number of days to the earliest of the near isogenic line [NIL (Hd5)] of Hd5 gene of "Kasalath", and its repetitive parent (Nihonbare) under short and long days, and natural conditions. Natural conditions are cultivated in the field of the National Institute for Agrobiological Sciences (Tsukuba, Ibaraki Prefecture), and short- and long-day conditions are the growth chambers of the National Institute for Agrobiological Resources (photon 500 micromolar, day and night temperature 28 ° C (7: The plants were cultivated at 00-19: 00) and 24 ° C. (19: 00-7: 00) without transplanting. It is a figure which shows the high precision linkage map and candidate genome area | region of Hd5 area | region. Link et al. (Breeding Science 53: 51-59, 2003) Linkage map created using a segregated population of 2308 individuals and RFLP markers. The symbol on the map indicates the RFLP marker, and the numerical value below the map indicates the number of recombination detected between the markers. Genomic clone alignment and linkage map. P number indicates PAC clone (Nipponbare) and B number indicates BAC clone (Kasalath). Detailed linkage map with CAPS markers created based on nucleotide sequence information. ↓ indicates the position where recombination occurred. It is a figure which shows the structure of a Hd5 gene, and the base sequence polymorphism of a gene candidate area | region. It is a figure which shows the comparison of the amino acid sequence of Hd5 protein. The position of Hayamasari's frame shift is indicated by an arrow. It is a figure which shows the frequency distribution of the number of days to ear | spear on the long day conditions (14.5 hours day length) of the transformed plant which introduce | transduced HindIII-EagI 4.2kb fragment of "Kasalath" into "Nihonbare". A shows the result of the transformation day (long day condition, introduced in “Nippon Hare”: T0), and B shows the result of the next generation of transformation (long day condition, introduced in “Nippon Hare”, 1 copy: T1). It is a photograph showing the expression analysis of the “Kasalath” NF-YB-like gene in transgenic progeny individuals (T1) in which the HindIII-EagI 4.2 kb fragment of “Kasalath” was introduced into “Nipponbare”. CDNA was synthesized from the total RNA of the transgenic progeny (HindIII-EagI 4.2 kb with transgene and vector into which only the vector was introduced) and used as a template for RT-PCR. The obtained amplification product was digested with TaqI and then subjected to electrophoresis. 300 bp represents an amplification product derived from “Kasalath”, and 260 bp represents an amplification product derived from “Nipponbare”. 180bp is a ubiquitin amplification product of the control reaction. It is a figure which shows the frequency distribution of the number of days to the earliest in the long day conditions (14.5 hours day length) of the progeny (T1) of the transformation which introduce | transduced the HindIII-EagI 4.2kb fragment of "Kasalath" into "Hayamasari". A is the progeny of transformation (long day condition, introduced in “Hayamasari”, 1 copy: T1), B is the progeny of transformation (long day condition, introduced in “Hayamasari”, 1 copy: T1) Results are shown. It is a figure which shows the daily change of the accumulation amount of Hd5 mRNA. “Nippon Hare” leaves grown for 1 month under long-day conditions (7 am to 22:00, 14 hours light) and short-day conditions (7 am to 4 pm, 9 hours light) are collected every 3 hours for quantitative RT- It is a figure which shows the result of having performed PCR. PCR was performed 3 times for each 2 samples, and the average of 6 times in total was graphed. Standard deviation is indicated by an error bar. It is a figure which shows the identification of the Hd5 function deficient type | mold type | mold by a Hd5-specific marker. PCR amplification was performed using each kind of genomic DNA as a template using Hd5-specific primer pairs, and electrophoresis was performed on a 3% agarose gel.

Claims (20)

The DNA according to any one of (a) to (d) below, which encodes a plant-derived protein having a function of increasing plant photosensitivity.
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 or 6.
(B) DNA containing the coding region of the base sequence described in any one of SEQ ID NOs: 1, 2, 4 or 5.
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added and / or inserted in the amino acid sequence of SEQ ID NO: 3 or 6.
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence of SEQ ID NO: 1, 2, 4 or 5. The DNA according to claim 1, which is derived from rice. A DNA encoding an RNA complementary to the transcription product of the DNA according to claim 1 or 2. A DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcription product of the DNA according to claim 1 or 2. A DNA encoding an RNA that suppresses the expression of the DNA according to claim 1 or 2 due to a co-suppression effect during expression in a plant cell. A vector comprising the DNA according to any one of claims 1 to 5. A host cell into which the vector according to claim 6 has been introduced. A plant cell into which the vector according to claim 6 has been introduced. A transformed plant comprising the plant cell according to claim 8. A transformed plant that is a descendant or clone of the transformed plant according to claim 9. The propagation material of the transformed plant body of Claim 9 or 10. A method for producing a transformed plant comprising the steps of introducing the DNA according to any one of claims 1 to 5 into a plant cell and regenerating the plant from the plant cell. A protein encoded by the DNA according to claim 1 or 2. The method for producing a protein according to claim 13, comprising a step of culturing the host cell according to claim 7 and recovering the recombinant protein from the cell or a culture supernatant thereof. An antibody that binds to the protein of claim 13. A polynucleotide comprising at least 15 contiguous bases complementary to the base sequence described in any of SEQ ID NOs: 1, 2, 4 or 5 or a complementary sequence thereof. A method for increasing the photosensitivity of a plant, comprising the step of expressing the DNA according to claim 1 or 2 in a plant cell. A method for reducing the photosensitivity of a plant, comprising the step of expressing the DNA according to any one of claims 3 to 5 in a cell of the plant body. An agent for modifying the photosensitivity of a plant, comprising the DNA according to any one of claims 1 to 5 or the vector according to claim 6 as an active ingredient. The inspection method which determines the photosensitivity of a plant including the process of the following (a)-(c).
(A) A step of preparing a DNA sample from a test plant body and a propagation medium.
(B) A step of amplifying the DNA region according to claim 1 from the DNA sample.
(C) A step of comparing the molecular weight or base sequence of the DNA fragment obtained by amplifying the DNA region according to claim 1 from the variety / line of plant with the DNA fragment amplified from the DNA sample.