JP5042497B2 - Polypeptides involved in the biosynthesis of spiramycin, nucleotide sequences encoding these polypeptides, and uses thereof - Google Patents

Description

  The present invention relates to the isolation and identification of a novel gene in the biosynthetic pathway of spiramycin and to a novel polypeptide involved in this biosynthesis. The invention also relates to the use of these genes to increase the level of spiramycin production and the purity of the spiramycin produced.

  The invention also relates to the use of these genes to construct new antibiotics or to construct mutants that allow derivatized forms of spiramycin. The invention also relates to molecules produced by the expression of these genes and, ultimately, pharmacologically active compositions of molecules produced by the expression of such genes.

  Streptomyces is a gram-positive soil filamentous fungus. Streptomyces plays an important role in the degradation and mineralization of organic substances by the wide variety of degrading enzymes they secrete. Streptomyces exhibits a morphological differentiation phenomenon unique to prokaryotes and involves metabolic differentiation characterized by the production of secondary metabolites with very diverse chemical structures and biological activities. These metabolites include spiramycin, which is naturally produced by the bacterium Streptomyces ambofaciens.

  Spiramycin is a macrolide antibiotic and can be used in both veterinary and human medicine. Macrolides are characterized by the presence of a lactone ring grafted with one or more sugars. Streptomyces ambofaciens naturally produces spiramycin I, II and III (see FIG. 1); however, the antibiotic activity of spiramycin I is more apparent than that of spiramycin II and III Strong (Liu et al., 1999). The spiramycin I molecule consists of a lactone-based macrocycle called platenolide and three sugars: folosamine, mycaminose and mycarose (see FIG. 1). The antibiotic activity of spiramycin is by inhibiting protein synthesis in prokaryotes by a mechanism involving the binding of antibiotics to bacterial ribosomes.

  Certain compounds that are macrolide members and have a lactone ring have been used outside the antibiotic field. Thus, the FK506 product has an immunosuppressive effect and provides a future perspective for therapeutic applications in the field of organ transplantation, rheumatoid arthritis, and more generally in the field of pathological conditions related to autoimmune reactions. . Other macrolides such as evermectin have insecticidal and anti-helminthic activities.

  To date, many biosynthetic pathways for antibiotics belonging to various classes, as well as other secondary metabolites (in general, K, Chater, 1990) have already been studied in Streptomy sheet. However, so far knowledge of the biosynthetic pathway for spiramycin is only partial.

Spiramycin biosynthesis is a complex process involving many steps and involving many enzymes (Omura et al., 1979a, Omura et al., 1979b). Spiramycin belongs to a large class of polyketides and contains complex molecules rich in microorganisms especially found in soil.
These molecules are grouped together by some kind of similarity in the process of their biosynthetic pathway, not structural similarity. In particular, polyketides are produced by a series of complex reactions that involve a series of reactions catalyzed by one or more enzymes called “polyketide synthases” (PKSs) in their biosynthetic pathways. It is common to happen. In Streptomyces ambofaciens, the biosynthesis of the lactone-based macrocycle of spiramycin (platenolide) is performed by a series of eight modules encoded by five PKS genes (S. Kuhstoss, 1996). , US Pat. No. 5,945,320). Spiramycin is obtained from this lactone ring. However, the various processes and enzymes involved in sugar synthesis and their attachment to the lactone ring, and the modification of this ring, such that spiramycin is obtained, are not yet known.

  US Pat. No. 5,514,544 describes the cloning of a sequence called srmR in Streptomyces ambofaciens. In this patent, the hypothesis is proposed that the srmR gene encodes a protein that regulates the transcription of genes involved in macrolide biosynthesis.

  In 1987, Richardson et al. (Richardson et al., 1987) Ambofaciens spiramycin resistance has been shown to be conferred by at least three genes, which are referred to as srmA, srmB and srmC. U.S. Pat. No. 4,886,757, more specifically, is described in US Pat. Figure 2 illustrates the characterization of a DNA fragment containing the smbC gene of Ambofaciens. However, the sequence of this gene is not disclosed. In 1990, Richardson et al. (Richardson et al., 1990) proposed the hypothesis that there are three genes close to srmB for spiramycin biosynthesis. US Pat. No. 5,098,837 reports the cloning of five genes that may be involved in spiramycin biosynthesis. These genes have been named srmD, srmE, srmF, srmG and srmH.

  One of the major difficulties in producing compounds such as spiramycin is that very large amounts of fermentation are required to produce relatively small amounts of product. It is therefore desirable to be able to increase the production efficiency of such molecules in order to reduce their production costs.

  The biosynthesis pathway of spiramycin is a complex process and it would be desirable to identify and eliminate parasitic reactions that may exist during this process. The purpose of such manipulation is to obtain a purer antibiotic and / or to improve productivity. In this regard, Streptomyces ambofaciens naturally produces spiramycin I, II and III (see FIG. 1); however, the antibiotic activity of spiramycin I is the activity of spiramycin II and III. Obviously stronger (Liu et al., 1999). Therefore, although it is possible to obtain a strain that produces only spiramycin I, it would be desirable.

  Due to the commercial value of macrolide antibiotics, the production of new derivatives, particularly the production of spiramycin analogues with particularly advantageous properties, is eagerly sought. In particular, for the purpose of producing a hybrid antibiotic derived from spiramycin, it would be desirable to be able to produce a sufficient amount of a biosynthetic intermediate in the biosynthetic pathway of spiramycin or a spiramycin derivative.

The present invention was obtained as a result of cloning a gene whose product is involved in spiramycin biosynthesis. The present invention firstly relates to a novel gene of the biosynthesis pathway of spiramycin and a novel polypeptide involved in this biosynthesis.

Biosynthetic pathway genes and associated coding sequences have been cloned and the respective DNA sequences have been determined. The cloned coding sequences are named as follows: orf1 ^* c, orf2 ^* c, orf3 ^* c, orf4 ^* c, orf5 ^* , orf6 ^* , orf7 ^* c, orf8 ^* c, orf9 ^* , orf10 ^* , Orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14, orf15c, orf16, orf17, orf18, orf19, orf20, orf21c, orf22c, orf22c, orf22c, orf22c , Orf26, orf27, orf28c, orf29, orf30c, orf31, orf32c, orf33, and orf34c. The functions of the proteins encoded by these sequences in the spiramycin biosynthetic pathway are developed in the following discussion, which are illustrated in FIGS.

1) The first object of the present invention relates to a polynucleotide encoding a polypeptide involved in spiramycin biosynthesis, and the sequence of the polynucleotide is as follows:
(A) SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149 Any one of
(B) any one of the sequences consisting of variants of sequence (a),
(C) One of the sequences obtained from sequences (a) and (b) due to the degeneracy of the genetic code.

  2) The object of the present invention is also a polynucleotide that hybridizes to at least one of the polynucleotides described in paragraph 1) above under highly stringent hybridization conditions.

  3) The present invention also provides at least 10, 12, 15, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200 of the polynucleotide described in paragraph 1) above. , 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450 At least 70%, 80%, 85%, 90%, 95% or 98% nucleotide identity with a polynucleotide comprising 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850 or 1900 contiguous nucleotides The present invention relates to a polynucleotide exhibiting sex.

  4) The present invention also relates to the polynucleotide according to paragraph 2) or 3) above, which is isolated from a bacterium of the genus Streptomyces.

  5) The present invention also relates to the polynucleotide according to paragraph 2), 3) or 4) above, which encodes a protein involved in macrolide biosynthesis.

  6) The invention is also described in paragraphs 2), 3) or 4) above, which encodes a hybridizing polynucleotide or a protein having activity similar to a protein encoded by a polynucleotide exhibiting identity. Of the polynucleotide.

  7) The present invention also relates to a polypeptide resulting from the expression of a polynucleotide according to paragraphs 1), 2), 3), 4), 5) or 6) above.

8) Another aspect of the present invention relates to a polypeptide involved in spiramycin biosynthesis, wherein the sequence of the polypeptide is as follows:
(A) SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 29, 31, 32, 33, 35, 37, 38, 39, 41, 42 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85 , 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150,
(B) any one of the sequences defined in (a), provided that one or more amino acids are substituted, inserted or deleted throughout the sequence without affecting their functional properties ),
(C) any one of the sequences consisting of variants of sequence (a) and (b).

  9) Another object of the present invention is at least 10, 15, 20, 30-40, 50, 60, 70, 80, 90, 100, 120, 140, 160 of the polypeptide described in paragraph 8) above. 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or 640 It relates to a polypeptide that shows at least 70%, 80%, 85%, 90%, 95% or 98% amino acid identity with a polypeptide comprising consecutive amino acids.

  10) Another aspect of the present invention relates to the polypeptide according to paragraph 9) above, which is isolated from a bacterium of the genus Streptomyces.

  11) Another aspect of the present invention relates to the polypeptide according to paragraph 9) or 10) above, which encodes a protein involved in macrolide biosynthesis.

  12) Another aspect of the invention relates to a polypeptide according to paragraph 9), 10) or 11) above, which has an activity similar to that of a polypeptide that shares identity.

  13) Another aspect of the present invention relates to a recombinant DNA comprising at least one of the polynucleotides according to any one of paragraphs 1), 2), 3), 4), 5) and 6) above. .

  14) Another aspect of the present invention relates to the recombinant DNA according to paragraph 13) above, wherein the recombinant DNA is contained in a vector.

  15) Another aspect of the present invention is the set according to paragraph 14) above, wherein the vector is selected from bacteriophage, plasmid, phagemid, integrateable vector, fosmid, cosmid, shuttle vector, BAC and PAC. Recombinant DNA.

  16) Other forms of the present invention include pOS49.1, pOS49.11, pOSC49.12, pOS49.14, pOS49.16, pOS49.28, pOS44.1, pOS44.2, pOS44.4, pSPM5, pSPM7, pOS49.67, pOS49.88, pOS49.106, pOS49.120, pOS49.107, pOS49.32, pOS49.43, pOS49.44, pOS49.50, pOS49.99, pSPM17, pSPM21, pSPM502, pSPM504, pSPM507, pSPM508, pSPM509, pSPM1, pBXL1111, pBXL1112, pBXL1113, pSPM520, pSPM521, pSPM522, pSPM523, pSPM524, pSPM525, pS M527, pSPM528, pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM41, pSPM42, pSPM43, pSPM44, pSPM45, pSPM47, pSPM48, pSPM50, pSPM51, pSPM51, SPM51, pSPM51 The recombinant DNA according to paragraph 15) above, which is selected from pSPM515, pSPM519, pSPM74, pSPM75, pSPM79, pSPM83, pSPM107, pSPM543, and pSPM106.

  17) Another aspect of the present invention relates to an expression vector comprising at least one nucleic acid sequence encoding the polypeptide according to paragraphs 7), 8), 9), 10), 11) or 12) above.

  18) The present invention also includes an expression comprising a suitable expression vector capable of expressing one or more of the polypeptides described in paragraphs 7), 8), 9), 10), 11) or 12) above. The system and the host cell.

  19) The present invention also relates to the expression system according to paragraph 18) above, which is selected from prokaryotic expression systems and eukaryotic expression systems.

  20) The present invention also relates to a bacterium E. coli. Paragraph 19) above selected from an expression system in E. coli, a baculovirus expression system capable of expression in insect cells, an expression system capable of expression in yeast cells, and an expression system capable of expression in mammalian cells. To the expression system described in.

  21) The present invention is also described in any one of paragraphs 1), 2), 3), 4), 5), 6), 13), 14), 15), 16) and 17) above. Relates to a host cell into which at least one polypeptide and / or at least one recombinant DNA and / or at least one expression vector has been introduced.

22) The present invention also relates to a method for producing the polypeptide according to paragraphs 7), 8), 9), 10), 11) or 12) above, which method comprises the following steps:
a) inserting at least one of the nucleic acids encoding said polypeptide into a suitable vector;
b) culturing the host cells previously transformed or transfected with the vector of step a) in a suitable medium;
c) recovering the conditioned medium or cell extract;
d) separating and purifying the polypeptide from the medium or from the cell extract obtained in step c);
e) optionally characterizing the produced recombinant polypeptide.

  23) Another aspect of the invention relates to a microorganism blocked in the process of at least one macrolide biosynthetic pathway.

  24) Another aspect of the present invention is described in paragraph 23) above, which is obtained by inactivating a function of at least one protein involved in biosynthesis of the macrolide in the macrolide-producing microorganism. Related to microorganisms.

25) Another aspect of the invention is that the inactivation of the protein is caused by mutagenesis in a gene encoding the protein or an antisense RNA complementary to a messenger RNA encoding one or more of the proteins The microorganism according to paragraph 24) above, which is carried out by expression of

  26) In another form of the invention, the inactivation of the protein is effected by mutagenesis by irradiation, the action of a mutagenic chemical agent, site-directed mutagenesis, or gene replacement as described above in paragraph 25) It relates to the microorganism described in 1.

  27) Another aspect of the invention is that the mutagenesis is performed in vitro or in situ, by repression, substitution, deletion and / or addition of one or more bases of the gene of interest or by gene inactivation. The microorganism according to paragraph 25) or 26) above, which is performed.

  28) Another aspect of the present invention relates to the microorganism according to paragraph 23), 24), 25), 26) or 27) above, wherein the microorganism is a bacterium belonging to the genus Streptomyces.

  29) Another aspect of the present invention relates to the microorganism according to paragraph 23), 24), 25), 26), 27) or 28) above, wherein the macrolide is spiramycin.

  30) In another aspect of the present invention, the microorganism is S. cerevisiae. The microorganism according to paragraph 23), 24), 25), 26), 27), 28) or 29), which is an ambofaciens strain.

  31) According to another aspect of the present invention, the mutagenesis is performed at least one of the genes comprising the sequence according to any one of paragraphs 1), 2), 3), 4), 5) and 6) above. It relates to the microorganism according to paragraph 23), 24), 25), 26), 27), 28), 29) or 30).

  32) According to another aspect of the present invention, the mutagenesis is performed in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40. 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120 , 141, 143, 145, 147 and 149, as described in paragraphs 25), 26), 27) above, performed on one or more of the genes comprising any one of the sequences corresponding to one or more of the sequences of 28), 29), 30) or 31).

  33) Another aspect of the present invention is the above paragraph 25), 26), 27), 28), wherein the mutagenesis comprises gene inactivation of a gene comprising a sequence corresponding to the sequence of SEQ ID NO: 13. 29), 30), 31) or 32).

  34) Another embodiment of the present invention is disclosed in Collection Nationale de Cultures de Microorganisms [National Collection of Cultures And Microorganisms] (CNCM) on July 10, 2002, registration numbers I-2909, I-1291, The present invention relates to a Streptomyces ambofaciens strain, which is a strain selected from any one of the strains deposited under I-2913, I-2914, I-2915, I-2916 or I-2917.

35) Another aspect of the present invention relates to a method for producing an intermediate for macrolide biosynthesis, which method comprises the following steps:
a) The microorganism according to any one of paragraphs 23), 24), 25), 26), 27), 28), 29), 30), 31), 32), 33) or 34) above Culturing in an appropriate medium,
b) recovering the conditioned medium or cell extract;
c) Separating and purifying the biosynthetic intermediate from the medium or from the extract obtained in step b).

  36) In another form of the invention, the biosynthetic intermediate is produced according to the method described in paragraph 35) above, and the intermediate thus produced is obtained from a modified macrolide. The present invention relates to a method for producing a molecule.

  37) Another aspect of the present invention is the method according to paragraph 36), wherein the intermediate is chemically, biochemically, enzymatically and / or microbiologically modified. About.

  38) Another aspect of the invention is the above paragraph 36), wherein one or more of the genes encoding proteins capable of modifying the intermediate by using the intermediate as a substrate are introduced into the microorganism. Or the manufacturing method as described in 37).

  39) Another embodiment of the present invention relates to the production method according to paragraph 36), 37) or 38) above, wherein the macrolide is spiramycin.

  40) In another aspect of the present invention, the microorganism used is S. cerevisiae. The production method according to paragraph 36), 37), 38) or 39), which is an ambofaciens strain.

  41) Another aspect of the invention relates to microorganisms that produce spiramycin I but not spiramycin II and III.

  42) Another aspect of the present invention includes all of the genes necessary for the biosynthesis of spiramycin I, but the gene comprising the sequence of SEQ ID NO: 13, or any one of its variants, or the gene code Any one of the sequences encoding the polypeptide of the sequence SEQ ID NO: 14, or any one of its variants, obtained therefrom due to the degeneracy of is not expressed or rendered inactive It relates to the microorganism according to paragraph 41) above.

  43) In another aspect of the invention, the inactivation is performed by mutagenesis in a gene encoding the protein or by expression of an antisense RNA complementary to a messenger RNA encoding the protein. Paragraph 42).

  44) Another aspect of the invention is that the mutagenesis is carried out in the promoter of this gene so that the encoded protein is inactivated or its expression or its translation from it is inhibited. Or the microorganism described in paragraph 43) above, which is carried out in a coding sequence or in a non-coding sequence.

  45) According to another aspect of the present invention, in the above paragraph 43) or 44), the mutagenesis is performed by irradiation, the action of a mutagenic chemical agent, site-directed mutagenesis, or gene replacement. It relates to microorganisms.

46) Another aspect of the invention is that the mutagenesis is performed in vitro or in situ, by suppression, substitution, deletion and / or addition of one or more bases of the gene of interest or by gene inactivation. The microorganism according to paragraph 43), 44) or 45) above, which is performed.

  47) In another aspect of the present invention, the microorganism is obtained by expressing a gene of the biosynthesis pathway of spiramycin, and these genes include a gene containing a sequence corresponding to SEQ ID NO: 13, or a variant thereof Or any one of the sequences encoding the polypeptide of the sequence of SEQ ID NO: 14 derived therefrom by degeneracy of the genetic code, or any one of its variants And the microorganism according to paragraph 41) or 42) above.

  48) Another aspect of the present invention relates to the microorganism according to paragraph 41), 42), 43), 44), 45), 46) or 47) above, wherein the microorganism is a bacterium belonging to the genus Streptomyces. .

  49) Another aspect of the present invention is that the microorganism is obtained from a starting strain that produces spiramycin I, II and III, paragraphs 41), 42), 43), 44), 45), 46) above. 47) or 48).

  50) Another aspect of the invention is obtained from the gene comprising the sequence corresponding to SEQ ID NO: 13, or any one of its variants having the same function, or the degeneracy of the genetic code, Paragraphs 41), 42), 43), 44) above, obtained by mutagenesis in any one of the sequences encoding the polypeptide of the sequence SEQ ID NO: 14 or any one of its variants 45), 46), 47), 48) or 49).

  51) In another aspect of the invention, the microorganism is an S. cerevisiae producing spiramycin I, II and III. A gene obtained from an ambofaciens strain, wherein a gene comprising any one of the sequence corresponding to SEQ ID NO: 13 or the sequence obtained therefrom due to degeneracy of the genetic code has been performed. And the above-mentioned paragraphs 41), 42), 43), 44), 45), 46), 47), 48), 49) or 50).

  52) Another aspect of the present invention is a strain of S. cerevisiae deposited at Collection Nationale de Cultures de Microorganisms (CNCM) on July 10, 2002, with registration number I-2910. Regarding Ambofaciens strains.

53) Another aspect of the present invention relates to a method for producing spiramycin I, which method comprises the following steps:
(A) The microorganism according to any one of paragraphs 41), 42), 43), 44), 45), 46), 47), 48), 49), 50), 51) and 52) above In a suitable medium,
(B) recovering the conditioned medium or cell extract;
(C) separating and purifying spiramycin I from the medium or from the cell extract obtained in step b).

  54) Another aspect of the present invention provides a polymer according to any one of paragraphs 1), 2), 3), 4), 5) and 6) above for improving microbial macrolide production. It relates to the use of nucleotides.

55) According to another aspect of the present invention, at least one of the genes comprising the sequence described in any one of the above paragraphs 1), 2), 3), 4), 5) or 6) is genetically modified. Suddenly producing a macrolide having and overexpressing at least one of the genes comprising a sequence according to any one of paragraphs 1), 2), 3), 4), 5) and 6) above It relates to mutant microorganisms.

  56) Another aspect of the invention is that the genetic modification is performed in the gene of interest for the purpose of expressing one or more of the proteins with higher activity or for the purpose of expressing the proteins at a higher level. The mutant microorganism according to paragraph 55) above, comprising suppression, substitution, deletion and / or addition of one or more bases.

  57) According to another aspect of the present invention, the overexpression of the gene of interest is obtained by increasing the copy number of the gene and / or by introducing a promoter more active than the wild type promoter. The mutant microorganism according to paragraph 55).

  58) In another embodiment of the present invention, the overexpression of the gene of interest is performed by transforming a microorganism producing a macrolide with the recombinant DNA construct according to paragraph 13, 14 or 17 above, The mutant microorganism according to paragraph 55) or 57) above, which is obtained by overexpression.

  59) According to another aspect of the present invention, the genetic modification is performed using SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40. 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120 , 141, 143, 145, 147 and 149, one of the sequences corresponding to one or more of the sequences, or any one of its variants, or derived from the degeneracy of the genetic code 59. The mutant microorganism of paragraph 55), 56), 57) or 58) above, performed on one or more of the genes comprising any one of the sequences.

  60) In another aspect of the present invention, the microorganism is SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, Any one of the sequences corresponding to one or more of the sequences 141, 143, 145, 147 and 149, or any one of its variants, or a sequence derived therefrom by degeneracy of the genetic code 60. The mutant microorganism of paragraph 55), 56), 57), 58) or 59) above, which overexpresses one or more of the genes comprising any one of

  61) Another aspect of the present invention relates to the mutant microorganism according to paragraph 55), 56), 57), 58), 59) or 60) above, wherein the microorganism is a bacterium of the genus Streptomyces.

  62) Another aspect of the present invention relates to the mutated microorganism according to paragraph 55), 56), 57), 58), 59), 60) or 61) above, wherein the macrolide is spiramycin.

  63) In another aspect of the present invention, the microorganism is S. cerevisiae. The mutant microorganism according to paragraph 55), 56), 57), 58), 59), 60), 61) or 62), which is an ambofaciens strain.

64) Another aspect of the present invention relates to a method for producing a macrolide, which method comprises the following steps:
(A) Paragraphs 55), 56), 57), 58), 59), 60), 61), 62) above
63) and culturing the microorganism according to any one of 64) in an appropriate medium,
(B) recovering the conditioned medium or cell extract;
(C) A step of separating and purifying the produced macrolide from the medium or from the cell extract obtained in step b).

  65) Another aspect of the present invention is the above paragraphs 1), 2), 3), 4), 5), 6), 7), 8), 9), 10) for producing a hybrid antibiotic. ), 11), 12), 13), 14), 15), 16) and 17). The use of sequences and / or recombinant DNA and / or vectors according to any one of the above.

  66) Another aspect of the present invention is the above paragraphs 1), 2), 3), 4), 5), 6), 7), 8), for carrying out one or more bioconversion reactions. 9), 10), 11), 12), 13), 14), 15), 16), 17) and / or 21) at least one polynucleotide and / or at least 1 It relates to the use of one recombinant DNA and / or at least one expression vector and / or at least one polypeptide and / or at least one host cell.

  67) Another aspect of the invention relates to a polynucleotide that is complementary to any one of the polynucleotides described in paragraphs 1), 2), 3), 4), 5) or 6) above.

68) Another aspect of the invention relates to a microorganism producing at least one spiramycin, said microorganism being:
-The following sequence primer pairs:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
And a gene obtainable by polymerase chain reaction (PCR) using cosmid pSPM36 or Streptomyces ambofaciens total DNA as a matrix, or
-Genes derived from them due to the degeneracy of the genetic code,
Is overexpressed.

  69) Another aspect of the present invention relates to the microorganism according to paragraph 68 or 90, which is a bacterium of the genus Streptomyces.

  70) Another aspect of the invention relates to the microorganism of paragraph 68, 69 or 90, which is a bacterium of the Streptomyces ambofaciens species.

  71) Another aspect of the invention relates to the microorganism of paragraph 68, 69, 70 or 90, wherein the overexpression of the gene is obtained by transformation with an expression vector of the microorganism.

72) Another aspect of the present invention is the Collection Nationale de Cultures de Microorganisms (CNCM) [National
Collection of Cultures And Microorganisms] Pasteur Institute, 25, ru du Ductor Roux 75724, Paris Ced 15, 15, PMC, OSC2p, deposited at registration number I-3101 on October 6, 2003, or OSC2p. The present invention relates to the Streptomyces ambofaciens strain, which is the pSPM75 (2) strain.

73) Another aspect of the invention relates to recombinant DNA, which comprises the following:
-The following sequence primer pairs:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
And a polynucleotide obtainable by polymerase chain reaction using cosmid pSPM36 or Streptomyces ambofaciens total DNA as matrix, or
-At least 10, 12, 15, 18, 20-25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, of this polynucleotide 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1460, 1470, 1480, 1490 or 1500 in succession Nucleotide fragment.

  74) Another aspect of the present invention relates to the recombinant DNA according to paragraph 73 or 91, which is a vector.

  75) Another aspect of the invention relates to a recombinant DNA according to paragraph 73, 74 or 91, which is an expression vector.

  76) Another aspect of the invention relates to a host cell into which at least one recombinant DNA according to any one of paragraphs 73, 74, 75 and 91 has been introduced.

77) Another aspect of the invention relates to a method for producing a polypeptide comprising the following steps:
a) transforming a host cell with at least one expression vector according to paragraph 75;
b) culturing the host cell in a suitable medium;
c) recovering the conditioned medium or cell extract;
d) separating and purifying the polypeptide from the medium or from the cell extract obtained in step c);
e) optionally characterizing the produced recombinant polypeptide.

  78) According to another aspect of the present invention, the gene inactivation is a gene comprising any one of a sequence corresponding to SEQ ID NO: 13 or a sequence obtained therefrom due to degeneracy of the gene code, 52. The microorganism of paragraph 51, which is made by a deletion within some phase.

79) Another aspect of the present invention relates to the microorganism described in any one of paragraphs 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, and 78, and the following genes are also excessive Express:
-The following sequence primer pairs:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
And a gene obtainable by polymerase chain reaction using cosmid pSPM36 or Streptomyces ambofaciens total DNA as matrix, or
-Genes obtained from them due to the degeneracy of the genetic code.

  80) According to another aspect of the present invention, a polynucleotide having the sequence of SEQ ID NO: 47 or a polynucleotide obtained by degeneracy of the genetic code is encoded by the polynucleotide in Streptomyces ambofaciens. The present invention relates to an expression vector which is placed under the control of a promoter capable of expressing the protein to be expressed.

  81) Another aspect of the invention relates to the expression vector according to paragraph 80, which is a plasmid pSPM524 or pSPM525.

  82) Another aspect of the present invention relates to a Streptomyces ambofaciens strain transformed with the vector according to paragraph 80 or 81.

  83) Paragraphs 41, 42, 43.44, wherein the other form of the invention also overexpresses the coding sequence SEQ ID NO: 47 or a gene having a coding sequence obtained therefrom due to the degeneracy of the genetic code, The microorganism according to any one of 45, 46, 47, 48, 49, 50, 51, 78, 79 and 92.

  84) Another form of the present invention is the Collection National de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, due du Doctour Roux 75724, Paris Cedex 15, France, dated Feb. 84. The microorganism of paragraph 83, which is the deposited SPM502 pSPM525 strain.

85) Another aspect of the present invention relates to a method for producing spiramycin comprising the following steps:
(A) culturing the microorganism according to any one of paragraphs 68, 69, 70, 71, 72, 78, 79, 82, 83, 84, 90 and 92 in an appropriate medium;
(B) recovering the conditioned medium or cell extract;
(C) separating and purifying spiramycin from the medium or from the cell extract obtained in step b).

  86) Another aspect of the invention relates to a polypeptide comprising the sequence of SEQ ID NO: 112 or SEQ ID NO: 142.

87) Another aspect of the invention relates to a polypeptide whose sequence corresponds to a sequence translated from the coding sequence of the following gene:
-The following sequence primer pairs:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
And a gene obtainable by chain reaction (PCR) using cosmid pSPM36 as a matrix or total DNA polymerase of Streptomyces ambofaciens, or
-Genes obtained from them due to the degeneracy of the genetic code.

  88) Another aspect of the present invention relates to an expression vector capable of expressing the polypeptide of Paragraph 86, 87 or 93 in Streptomyces ambofaciens.

  89) Another aspect of the invention relates to the expression vector according to paragraph 88, which is plasmid pSPM75.

  90) In another embodiment of the present invention, the gene obtainable by polymerase chain amplification is the gene of SEQ ID NO: 141, which is a coding sequence, or a gene obtained therefrom by degeneracy of the gene code, 68. The microorganism according to 68.

  91) Another aspect of the invention relates to the recombinant DNA of paragraph 73, wherein the polynucleotide obtainable by polymerase chain amplification is a polynucleotide of the sequence of SEQ ID NO: 141.

  92) In another aspect of the present invention, the gene obtainable by polymerase chain amplification is the gene of SEQ ID NO: 141, which is a coding sequence, or a gene obtained therefrom by degeneracy of the gene code, 79. The microorganism according to 79.

  93) Another aspect of the invention relates to a polypeptide whose sequence is SEQ ID NO: 142.

General Definitions For the purposes of the present invention, the term “isolated” means a biological material (nucleic acid or protein) that is separated from its original environment (naturally occurring environment).

  For example, a polynucleotide that is naturally present in a plant or animal has not been isolated. A polynucleotide is considered "isolated" if it is separated from adjacent nucleic acids that are naturally inserted into the plant or animal genome.

  Such polynucleotides may be included in the vector and / or such polynucleotides may be included in the composition, and the vector or composition is in its natural environment. Can still remain in an isolated state.

  The term “purified” does not require that the material be present in a completely pure state in which no other compound is present. This term is rather a relative definition.

  “Purified” polynucleotide refers to after the starting material or natural material has been purified on a scale of at least 1 digit, preferably 2 or 3 digits, optionally 4 or 5 digits.

  For the purposes of the present invention, the term ORF (open reading frame) is used in particular to mean the coding sequence of a gene.

  For the purposes of the present invention, the expression “nucleotide sequence” can be used to mean either a polynucleotide or a nucleic acid. The expression “nucleotide sequence” encompasses the genetic material itself and is therefore not limited to information about that sequence.

  The terms “nucleic acid”, “polynucleotide”, “oligonucleotide” or alternatively “nucleotide sequence” include RNA, DNA or cDNA sequences of two or more nucleotides, or RNA / DNA hybrid sequences, which are Either a chain type or a double-stranded type may be used.

The term “nucleotide” refers to a natural nucleotide (A, T, G, c) and at least one modification such as (1) purine analogs, (2) pyrimidine analogs, or (3) sugar analogs. And examples of such modified nucleotides are described, for example, in PCT application number WO 95/04064.

  For purposes of the present invention, a first polynucleotide is “complementary to a second polynucleotide when each base of the first polynucleotide pairs with a complementary base of the second polynucleotide in the reverse direction. It is considered to be “target”. Complementary bases are A and T (or A and U) or C and G.

  The term “spiramycin biosynthetic pathway genes” also includes regulatory genes and genes that confer resistance to the producing microorganism.

  According to the present invention, the term “fragment” of a related nucleic acid is intended to mean a nucleotide sequence that is shorter than the related nucleic acid and that contains the same nucleotide sequence in the common part as the related nucleic acid.

  According to the present invention, such nucleic acid “fragments” may optionally be included in larger polynucleotides, the fragments being a component thereof.

  Such fragments are 8, 10, 12, 15, 18, 20-25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200 of the nucleic acid according to the invention. , 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450 It comprises or consists of a polynucleotide in the range of 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850 or 1900 contiguous nucleotides.

  According to the present invention, the term “fragment” of a polypeptide refers to a polypeptide whose amino acid sequence is shorter than the amino acid sequence sequence of the related polypeptides and that contains the same amino acid sequence throughout the portion common to these related polypeptides. Shall mean.

  Such a fragment may be included in a larger polypeptide, if necessary, and the fragment becomes a part.

  Such a polypeptide fragment according to the present invention has a length of 10, 15, 20, 30 to 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200. 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or 640 amino acids. is there.

  For the purposes of the present invention, the expression “high stringency hybridization conditions” shall mean hybridization conditions that are undesirable for the hybridization of heterologous nucleic acid strands. For example, highly stringent hybridization conditions can be described as hybridization conditions at a temperature of 55 ° C. to 65 ° C. in a buffer described by Church and Gilbert (Church and Gilbert, 1984). The hybridization temperature is preferably 55 ° C., even more preferably 60 ° C., and most preferably 65 ° C .; followed by 2 × SSC buffer (1 × SSC buffer is 0.15 M NaCl, Is equivalent to an aqueous solution of 15 mM sodium citrate) at a temperature of 55 ° C. to 65 ° C., one or more washings are performed, this temperature is preferably 55 ° C., even more preferably 60 ° C. Preferably 65 ° C; followed by 0.5 × SSC buffer, temperature 55 ° C.-6 At ° C., 1 or more washes are carried out, the temperature is preferably 55 ° C., and even more preferably 60 ° C., and most preferably 65 ° C..

  Of course, the hybridization conditions described above can be adjusted depending on the length of the nucleic acid for which hybridization is sought, or the function of the label type selected according to techniques known to those skilled in the art. For example, suitable hybridization conditions include F.I. Adjustments can be made according to a book by Ausubel et al. (2002).

  The term “variant” of a nucleic acid according to the present invention is intended to mean a nucleic acid that differs in one or more bases compared to the relevant polynucleotide. Mutant nucleic acids may be of natural origin, such as naturally occurring mutants, or non-naturally occurring mutants obtained, for example, by mutagenesis techniques.

  In general, the difference between a related nucleic acid and a mutant nucleic acid is so small that the nucleotide sequences of the related nucleic acid and the mutant nucleic acid are very close and the same in many regions. Nucleotide modifications present in the mutant nucleic acid may be silent, meaning that they do not modify the amino acid sequence encoded by the mutant nucleic acid.

  However, nucleotide changes in the mutated nucleic acid may result in substitutions, additions and / or deletions in the polypeptide encoded by the mutated nucleic acid as compared to the peptide encoded by the related nucleic acid. In addition, nucleotide modifications in the coding region may result in conservative or non-conservative substitutions in the amino acid sequence.

  Preferably, a variant nucleic acid according to the present invention is a polypeptide that preserves substantially the same function or biological activity as the polypeptide of the related nucleic acid, or the ability to be recognized by an antibody to a polypeptide encoded by the original nucleic acid. Code.

  Thus, some mutated nucleic acids may encode mutated forms of the polypeptide, which can be inferred from a systematic study of the structure and activity of the protein in question. Become.

  The term “variant” of a polypeptide according to the present invention mainly refers to an amino acid sequence having one or more substitutions, additions or deletions of at least one amino acid residue as compared to the amino acid sequence of the related polypeptide. It is understood to mean a polypeptide comprising, and such amino acid substitutions are understood to be either conservative or non-conservative.

  Preferably, a variant polypeptide according to the invention preserves substantially the same function or biological activity as the related polypeptide, or the ability to be recognized by an antibody against the original polypeptide.

  For the purposes of the present invention, a polypeptide having a related polypeptide “similar activity” is related to the biological activity of the related polypeptide as measured by a biological assay suitable for measuring the biological activity of the related polypeptide. It shall mean a polypeptide having a close (but not necessarily identical) biological activity.

  For the purposes of the present invention, the term “hybrid antibiotic” shall mean a compound resulting from the construction of an artificial biosynthetic pathway using recombinant DNA technology.

DETAILED DESCRIPTION OF THE INVENTION The object of the present invention is more specifically the genes of the novel spiramycin biosynthetic pathway shown in the detailed description below and the novel polypeptides involved in this biosynthesis.

The biosynthetic pathway genes were cloned and the DNA sequences of these genes were determined. The resulting sequences were analyzed using the FramePlot program (J. Ishikawa and K. Hotta, 1999). Among the open reading frames, those that showed the use of codons typical for Streptomyces were identified. According to this analysis, this region contains the 44 ORFs located on either side of the 5 genes that encode the enzyme “polyketide synthase” (PKS) and indicate the use of codons typical of Streptomyces. It was shown that there is. On either side of these 5 genes encoding PKS, 10 and 34 ORFs were identified on the downstream and upstream sides, respectively (the downstream and upstream directions of the 5 PKS genes all facing the same direction) (See FIGS. 3 and 37). Thus, this type of 34 open reading frames occupying a region of about 41.7 kb (see below; SEQ ID NO: 1 representing the 31 kb first region containing 25 ORFs) and about 12.1 kb SEQ ID NO: 140 indicating the region, of which 1.4 kb overlaps with the preceding sequence (SEQ ID NO: 1), of which about 10.7 kb corresponds to the subsequent sequence, and the latter about 10.7 kb has an additional 9 Of ORFs (including one ORF of partial sequence); see also FIGS. 3 and 37 below), identified upstream of 5 genes encoding PKS, and a region of about 11.1 kb Ten open reading frames (SEQ ID NO: 2 and FIG. 3) occupying were identified downstream of the PKS gene. Thus, the 10 genes located downstream of the 5 PKS genes were named as follows: orf1 ^* c, orf2 ^* c, orf3 ^* c, orf4 ^* c, orf5 ^* , orf6 ^* , orf7 ^* c, orf8 ^* , orf9 ^* , and orf10 ^* (SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21). “C” appended to the name of the gene indicates that the coding sequence is reversed with respect to the ORF in question (the coding strand is therefore complementary to the sequence shown in SEQ ID NO: 2 for these genes) ). Using the same nomenclature, the 34 ORFs upstream of the PKS gene were named as follows: orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c , Orf14, orf15c, orf16, orf17, orf18, orf19, orf20, orf21c, orf22c, orf23c, orf24c, orf25c, orf26, orf27, orf28c, orf29, orf30c, orf31, orf32c, orf33c, and orf34c 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 10 , 109,111,113,115,118,120,141,143,145,147 and 149) (see Figure 3 and 37).

  Using various programs, the protein sequences deduced from these open reading frames were compared to protein sequences present in various databases: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD -Search, COG (Cluster of Orthologous Groups) (these three programs are especially available from the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA), FASTA ((WR Pearson and DJ Lipman, 1988) and (WR Pearson, 1990), BEA TY (K.C, Worley, etc., 1995)) (these two types of programs, in particular, INFOBIOGEN Resource Center (INFOBIOGEN resource center, Evry, France), is available from). These comparisons allowed us to compile hypotheses about the function of the products of these genes and identify those that might be involved in spiramycin biosynthesis.

FIG. 3 shows a diagrammatic representation of the structure of the above-mentioned region of the gene located downstream of the gene encoding PKS . As demonstrated below, of the 10 genes identified downstream of the gene encoding PKS, 9 appear to be involved in spiramycin biosynthesis or resistance to spiramycin. They are the following nine genes: orf1 ^* c, orf2 ^* c, orf3 ^* c, orf4 ^* c, orf5 ^* , orf6 ^* , orf7 ^* c, orf8 ^* , and orf9 ^* .

Table 1 below provides a reference for the DNA and amino acid sequences of the 10 genes identified downstream of the 5 PKS genes.

  “C” appended to the name of the gene indicates that the coding sequence is in the reverse direction (the coding strand is therefore complementary to the sequence shown in SEQ ID NO: 2 for these genes).

  To determine the function of the identified polypeptide, three types of experiments were performed: comparison of the identified sequence with a known function, a gene inactivation experiment resulting in the construction of a mutant strain, And production of spiramycin and analysis of spiramycin biosynthetic intermediates by these mutants.

  First of all, using various programs, the protein sequences deduced from these open reading frames were compared with sequences present in the following various databases: BLAST (Altschul et al., 1990) (Altschul et al., 1997). Year), CD-search, COG (Cluster of Orthologous Groups), FASTA ((WR Pearson and DJ Lipman, 1988) and (WR Pearson, 1990), BEAUTY (K.C). Worley et al., 1995)). These comparisons allowed us to compile hypotheses about the function of the products of these genes and identify those that might be involved in spiramycin biosynthesis. Table 2 shows proteins that show strong similarity to the product of 10 genes located downstream of the 5 PKS genes.

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  In order to confirm these results, gene inactivation experiments were performed. The method used is to perform gene replacement. The target gene to be interrupted is replaced with a copy of this gene interrupted with a cassette conferring resistance to antibiotics (eg, apramycin, geneticin or hygromycin). The cassette used is adjacent to either end of the translation stop codon of all reading frames and to either end of a transcription terminator active in Streptomyces. Insertion of the cassette into the target gene may or may not be accompanied by this target gene deletion. The size of the region adjacent to the cassette can range from hundreds to thousands of base pairs. The second type of cassette can be used for gene inactivation, and such a cassette is termed a “cleavable cassette”. These cassettes are S.I. It has the advantage that it can be excised in Streptomyces by site-specific recombination events after being introduced into the genome of ambofaciens. The purpose is to inactivate certain genes in the Streptomyces strain without leaving a selectable marker or a large DNA sequence not belonging to that strain in the final strain. After excision, only a short sequence of about 30 base pairs (referred to as the “scar” site) remains in the genome of the strain (see FIG. 10). The use of this system is initially to replace the wild-type copy of the target gene with a construct that has a cassette that can be excised into the target gene (based on two homologous recombination events). , See FIG. This cassette insertion is accompanied by a deletion of the target gene (see FIG. 9). Second, excision of a cassette that can be excised from the genome of the strain occurs. The excisable cassette functions on the basis of a site-specific recombination system and has the advantage that it makes it possible to obtain Streptomyces mutants that do not have resistance genes at the ends. A possible polar effect on the expression of genes located downstream of the inactivated gene is also avoided (see FIG. 10). Strains constructed in this way were tested for their spiramycin production.

By sequence comparison experiments it can be determined that the orf1 ^* c, orf2 ^* c, orf3 ^* c and orf4 ^* c genes have a relatively high similarity to genes involved in the biosynthesis of relatively close antibiotics. As a result, orf1 ^* c, orf2 ^* c, orf3 ^* c and orf4 ^* c genes were not inactivated. Thus, the orf1 ^* c gene encodes a protein that shows 66% identity to the protein encoded by the tylMI gene encoding N-methyltransferase (determined using the BLAST program), where N -Methyltransferase is involved in the biosynthesis of tyrosine and is responsible for the production of mycaminos in Streptomyces fradiae (AR Gandecha et al., 1997; GenBank accession number: CAA57473; BLAST score: 287). In this case, it catalyzes 3-N-methylation. The similarity of this to the biosynthetic pathways for other antibiotics that are relatively close, and more particularly to the proteins involved in the biosynthesis of mycaminose, is that the orf1 ^* c gene is N-linked during forosamine or mycaminose biosynthesis. It suggests encoding an N-methyltransferase involved in methylation (see FIGS. 5 and 6). This hypothesis is supported by the fact that the protein encoded by the orf1 ^* c gene shows strong similarity to other proteins with similar functions in other organisms (see Table 3).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf2 ^* c gene encodes a protein with a relatively strong similarity to the protein encoded by the tylMIII gene encoding NDP hexose 3,4-isomerase involved in tyrosine biosynthesis in Streptomyces fradiae (35 % Identity) (AR Gandecha et al., 1997; GenBank accession number: CAA57471; BLAST score: 130). The similarity between this and other nearby antibiotic biosynthetic pathways, and more specifically the proteins involved in the biosynthesis of mycaminose, is that the orf ^* 2c gene is a sugar of spiramycin (sometimes mycaminose) It strongly suggests that it encodes an NDP hexose 3,4-isomerase involved in isomerization during biosynthesis of (see FIGS. 5 and 6).

The orf3 ^* c gene is a protein encoded by the tylMII gene that encodes a glycosyltransferase involved in tyrosine biosynthesis in Streptomyces fradiae (AR Gandech et al., 1997; GenBank accession number:
It encodes a protein that shows a relatively strong similarity to CAA 57472 (BLAST score: 448) (59% identity). The similarity between this and proteins involved in biosynthetic pathways for other nearby antibiotics strongly suggests that the orf3 ^* c gene encodes a glycosyltransferase. This hypothesis is supported by the fact that the protein encoded by the orf3 ^* c gene shows strong similarities to other proteins with similar functions in other organisms (see Table 4).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf4 ^* c gene encodes a protein with strong similarity to several crotonyl-CoA reductases. In particular, the protein encoded by orf4 ^* c has considerable similarity to crotonyl-CoA reductase from Streptomyces coelicolor (M. Redenbach et al., 1996; GenBank accession number: NP — 630556; BLAST Score: 772). This similarity to proteins involved in the biosynthetic pathway for other nearby antibiotics strongly suggests that the orf4 ^* c gene also encodes crotonyl-CoA reductase. This hypothesis is supported by the fact that the protein encoded by the orf4 ^* c gene shows strong similarities to other proteins with similar functions in other organisms (see Table 5).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf6 ^* gene is present in Streptomyces mycarofaciens, which produces macrolide antibiotics.
It shows some similarity to the dmB gene (Hara and Hutchinson, 1992; GenBank accession number: A42719; BLAST score: 489). In this producer, the gene is involved in acylation of the lactone ring. The orf6 ^* gene is therefore thought to encode an acyltransferase. This hypothesis is supported by the strong similarity of the protein encoded by the orf6 ^* gene to other proteins that have similar functions in other organisms (see Table 6).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

Inactivation of the orf6 ^* gene was caused by intraphase deletions / inversions, and the resulting strains did not produce spiramycin II and III but produced spiramycin I (see FIG. 1). reference). This confirms that the orf6 ^* gene is actually involved in the synthesis of spiramycin II and III. The enzyme encoded by this gene is involved in the formation of spiramycins II and III by adding an acetyl or butyryl group at the 3-position of the carbon. They are particularly advantageous because strains that no longer express the protein encoded by the orf6 ^* gene do not produce spiramycin II and III and produce only spiramycin I. As noted above, the antibiotic activity of spiramycin I is clearly higher than that of spiramycin II and III (Liu et al., 1999).

The orf5 ^* gene encodes a protein that exhibits a relatively strong similarity to several O-methyltransferases. In particular, the protein encoded by orf5 ^* has considerable similarity to the O-methyltransferase (EC 2.1.1.-) MdmC from Streptomyces mycalofaciens (Hara and Hutchinson, 1992; GenBank accession number: B42719; BLAST score: 355). The similarity between this and proteins involved in biosynthetic pathways for other antibiotics strongly suggests that the orf5 ^* gene also encodes O-methyltransferase. The orf5 ^* gene is thought to be involved in the formation of precursors incorporated into the lactone ring. In fact, according to sequence comparison, the product of the orf5 ^* gene is relatively close to FkbG, which is Wu et al., 2000; Hoffinester et al., 2000; GenBank accession number: AAP86386; BLAST score: 247 Is involved in the methylation of hydroxymalonyl-ACP (see FIG. 8). This hypothesis is supported by the fact that the protein encoded by the orf5 ^* gene shows strong similarities to other proteins with similar functions in other organisms (see Table 7).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

Because of the polar effect of insertion of the excised cassette into the orf6 ^* gene, it was possible to determine that the orf5 ^* gene is essential for the biosynthesis pathway of spiramycin. In particular, by inserting a cleavable cassette into the coding part of the orf6 ^* gene, spiramycin production is completely blocked. However, when the inserted cassette is excised (thus only when the orf6 ^* gene is inactivated, see Examples 14 and 15), production of spiramycin I is observed again. This indicates that the orf5 ^* gene is essential for the biosynthesis pathway of spiramycin because its inactivation completely blocks spiramycin production.

The orf5 ^* gene encodes a protein that exhibits a relatively strong similarity to several O-methyltransferases. The orf5 ^* gene is thought to be an O-methyltransferase that is directly involved in either platenolide synthesis or the synthesis of methylated precursors (methoxymalonyl, see FIG. 8) incorporated into platenolide by PKS. ing. In order to confirm this hypothesis, the S. genotype: orf6 ^* :: att1Ωhyg + LC / SM and NMR analysis experiments were performed on the ambofaciens strain. In this strain, the orf5 ^* gene is not expressed due to the polar effect of cassette insertion that includes a transcription terminator on the orf6 ^* gene (see Example 27). This strain showed a UV spectral state similar to that of spiramycin I, but the mass spectrum was shown to produce a molecule showing a molecular ion at 829. The 14 mass difference compared to the mass of spiramycin can be explained by the absence of methyl in the oxygen produced by the fourth carbon of the lactone ring (the structure of this compound is shown in FIG. 39). The results obtained by NMR are consistent with this hypothesis. The presence of the compound at 829 makes it possible to confirm the hypothesis of the role of orf5 ^* in spiramycin biosynthesis. In addition, the product corresponding to spiramycin that does not contain a methyl group, when tested in the microorganism Micrococcus luteus, exhibits very weak microbiological activity (10 times weaker) compared to unmodified spiramycin.

The orf7 ^* c gene encodes a protein that exhibits a relatively strong similarity to the protein encoded by Streptomyces mycarofaciens mdmA (encoding the protein responsible for midecamycin resistance in the producer enzyme) ( Hara et al., 1990; GenBank accession number: A60725; BLAST score: 380). The similarity between this and proteins involved in biosynthetic pathways for other antibiotics strongly suggests that the orf7 ^* c gene also encodes a protein involved in spiramycin resistance. More specifically, the enzyme encoded by the orf7 ^* c gene has methyltransferase activity in Streptomyces ambofaciens and is involved in spiramycin resistance. This gene has been demonstrated to confer resistance to MLS (type I), and this resistance is known to be due to monomethylation at position A2058 of 23S ribosomal RNA (Pernodet et al., 1996). This hypothesis is supported by the fact that the protein encoded by the orf7 ^* c gene shows strong similarities to other proteins with similar functions in other organisms (see Table 8).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf8 ^* gene encodes a protein that shows relatively strong similarity to the ABC transporter type protein in Streptomyces griseus (Campelo, 2002, GenBank accession number: CAC22119; BLAST score: 191). The similarity between this and the ABC transporter type protein strongly suggests that the orf8 ^* gene also encodes an ABC transporter type protein that may be involved in spiramycin resistance. This hypothesis is supported by the fact that the protein encoded by the orf8 ^* gene shows strong similarities to other proteins with similar functions in other organisms (see Table 9).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf9 ^* gene encodes a protein that shows relatively strong similarity to the ABC transporter type protein in Streptomyces griseus (Campelo, 2002, GenBank accession number: CAC22118; BLAST score: 269). The similarity between this and the ABC transporter type protein strongly suggests that the orf9 ^* gene also encodes an ABC transporter type protein that may be involved in spiramycin resistance. This hypothesis is supported by the fact that the protein encoded by the orf9 ^* gene shows strong similarities to other proteins with similar functions in other organisms (see Table 10).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf10 ^* gene encodes a protein that exhibits a relatively strong similarity to a protein of unknown function. However, genes similar to orf10 ^* are found in the middle of several gene groups involved in antibiotic biosynthesis. Therefore, genes close to orf10 ^* It has been found in Coericolor (Redenbach et al., 1996, GenBank deposit number: NP — 627432, BLAST score: 109). A close gene (CouY) is also described in S. cerevisiae. It has been found in Lyciliensis (Wang et al., 2000, GenBank accession number: AAG29779, BLAST score 97).

DNA sequence located upstream of the gene encoding PKS upstream of the gene encoding PKS (downstream and upstream are defined by the directions of five PKS genes all facing the same direction) (see FIG. 3 34) ORFs were identified (see above). Thus, 34 open reading frames of this type occupy a region of about 41.7 kb (see below; SEQ ID NO: 1 indicating the first 31 kb region containing 25 ORFs, and about 12.1 kb) SEQ ID NO: 140 indicating the region of the sequence, of which 1.4 kb overlaps with the preceding sequence (SEQ ID NO: 1), of which about 10.7 kb corresponds to the subsequent sequence, and the latter about 10.7 kb further includes 9 (See also FIGS. 3 and 37 below, including a single ORF, including a partial sequence of the ORF). A graphical representation of the structure of the region is shown in FIGS. The 34 genes identified were named as follows: orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14, orf15c, orf16, orf17, orf18, orf19, orf20, orf21c, orf22c, orf23c, orf24c, orf25c, orf26, orf27, orf28c, orf29, orf30c, orf31, orf32c, orf33c.

  References to the DNA and amino acid sequences of 34 genes identified upstream of the five PKS genes are shown in Table 11 below.

1； 遺伝子の名称に付記された「ｃ」は、コーディング配列が逆方向であること（それゆえに、これら遺伝子について、コーディング鎖は、配列番号１または配列番号１４０で示される配列に相補的な鎖）を示す。
2； １つのｏｒｆに数種のタンパク質配列が示されている場合、対応するタンパク質は、数種の可能な翻訳開始部位から得られる。

1; “c” appended to the name of the gene indicates that the coding sequence is in the reverse direction (therefore, for these genes, the coding strand is complementary to the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 140) ).
2; if several protein sequences are shown in one orf, the corresponding protein is derived from several possible translation start sites.

  Three types of experiments were performed to determine the function of the polypeptides identified in Table 11 above: comparison of identity between identified sequences and sequences of known function, gene inactivation experiments And analysis of spiramycin production by these mutants.

  First of all, the following various programs were used to compare all protein sequences deduced from these open reading frames with protein sequences present in various databases: BLAST (Altschul et al., 1990) (Altschul et al. , 1997), CD-search, COG (Cluster of Orthologous Groups), FASTA ((WR Pearson and DJ Lipman, 1988) and (WR Pearson, 1990), BEAUTY (K). C. Worley et al., 1995)) (see above). These comparisons allowed us to compile hypotheses about the function of the products of these genes and identify those that might be involved in spiramycin biosynthesis. Table 12 shows proteins showing strong similarity to 34 genes located upstream of 5 PKF genes.

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  In order to confirm these results, gene inactivation experiments were performed. The method used is to perform gene replacement. The target gene to be interrupted is replaced with a copy of this gene interrupted with a cassette conferring resistance to antibiotics (eg, apramycin or hygromycin). The cassette used is adjacent to either of the translation stop codons in all reading frames and to either end of a transcription terminator active in Streptomyces. Insertion of the cassette into the target gene may or may not be accompanied by this target gene deletion. The size of the region adjacent to the cassette can range from hundreds to thousands of base pairs. The second type of cassette can be used for gene inactivation and such cassettes are termed “cleavable cassettes” (see above). Strains constructed in this way were tested for their spiramycin production.

  The orf1 gene encodes a protein that exhibits a relatively strong similarity to several cytochrome P450s. In particular, the protein encoded by orf1 has considerable similarity to the protein encoded by the tylI gene involved in tyrosine biosynthesis in Streptomyces fradiae (LA Merson-Davies et al., 1994; GenBank deposit number: S49051; BLAST score: 530). The similarity between this and proteins involved in biosynthetic pathways for other nearby antibiotics strongly suggests that the orf1 gene also encodes cytochrome P450. This hypothesis is supported by the fact that the protein encoded by the orf1 gene shows strong similarity to other proteins that have similar functions in other organisms (see Table 13).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf2 gene encodes a protein that exhibits a relatively strong similarity to dTDP-6-deoxy-3,4-ketohexulose isomerase from Aneurinibacillus thermoaerophilus (Pfoesti, A. et al. , 2003, GenBank accession number: AA006351; BLAST score: 118). This similarity is that the orf2 gene encodes an isomerase involved in the isomerization reaction required for the biosynthesis of any one of the sugars present in the spiramycin molecule, which in some cases is mycarose. (See FIG. 5). The inf2 gene was inactivated. The resulting strain could be shown not to produce spiramycin. This confirms that the orf2 gene is actually involved in spiramycin biosynthesis.

  The orf3 gene encodes a protein that exhibits a relatively strong similarity to several aminotransferases. In particular, the protein encoded by orf3 has considerable similarity to the aminotransferase of Streptomyces antibiotics involved in oleandomycin biosynthesis (G. Draeger et al., 1999; GenBank). Deposit number: AAF59939; BLAST score: 431). The similarity between this and proteins involved in biosynthetic pathways for other nearby antibiotics is that the orf3 gene is involved in the transamination reaction required for the biosynthesis of any one of the amino sugars of spiramycin. It strongly suggests that it encodes an aminotransferase (see FIG. 5). This hypothesis is supported by the strong similarity of the protein encoded by the orf3 gene to other proteins that have similar functions in other organisms (see Table 15).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf3 gene was inactivated. Thereby, the obtained strain could be shown not to produce spiramycin. This confirms that the orf3 gene is actually involved in spiramycin biosynthesis. Therefore, the enzyme encoded by this gene is clearly involved in the biotransformation reaction steps essential for spiramycin biosynthesis. Spiramycin production is produced by S. cerevisiae. It can be supplemented by expression of the Fradiae TylB protein (see Example 23). This demonstrates that the orf3 gene encodes a 3-aminotransferase involved in the transamination reaction required for mycaminose biosynthesis (see FIG. 5). Since mycaminose is the first sugar attached to platenolide, the orf3 knockout strain (OS49.67) is expected to accumulate platenolide.

  Biosynthetic intermediates of strains in which the orf3 gene was knocked out were studied (see Example 20). These experiments made it possible to demonstrate that this strain produces two types of platenolide: platenolide A and platenolide B (the inferred structures of these two molecules are shown in FIG. 36). This strain also produces platenolide A + mycarose and platenolide B + mycarose (see Example 20 and FIG. 40). These compounds contain sugar but do not contain any mycaminose. In addition, when they are compared to spiramycin (see FIG. 1), these compounds contain micalose instead of micaminose. These results are consistent with the orf3 gene product that is involved in mycaminose biosynthesis and has a role as a 3-aminotransferase involved in the transamination reaction required for mycaminose biosynthesis (see FIG. 5). It can be said that the specificity of glycosylation does not appear to be complete, since molecules with mycarose bound to the position normally occupied by mycaminose have been discovered (see FIG. 40).

  The orf4 gene encodes a protein that exhibits a relatively strong similarity to several NDP-glucose synthetases. In particular, the protein encoded by orf4 has considerable similarity to Streptomyces venezuela's α-D-glucose-1-phosphate thymidylyltransferase (Y. Xue et al .: 1998; GenBank). Deposit number: AAC68682; BLAST score: 404). The similarity of this to the proteins involved in the biosynthetic pathway for other nearby antibiotics is that the orf4 gene synthesizes NDP-glucose required for biosynthesis of three typical sugars incorporated into the spiramycin molecule. It strongly suggests encoding NDP-glucose synthetase involved in (see FIGS. 4, 5 and 6). This hypothesis is supported by the fact that the protein encoded by the orf4 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 16).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf5 gene encodes a protein that exhibits a relatively strong similarity to several glucose dehydratases. In particular, the protein encoded by orf5 has considerable similarity to dTDP-glucose 4,6-dehydratase from Streptomyces tenebralius (TB Li et al., 2001; GenBank accession number) : AAG18457, BLAST score: 476). The similarity between this and the proteins involved in the biosynthetic pathway for other nearby antibiotics is that the orf5 gene contains NDP-glucose dehydratase required for biosynthesis of three typical sugars incorporated into the spiramycin molecule. It strongly suggests coding (see FIGS. 4, 5 and 6). This hypothesis is supported by the fact that the protein encoded by the orf5 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 17).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf6 gene encodes a protein that exhibits a relatively strong similarity to several thioesterases. In particular, the protein encoded by orf6 has considerable similarity to the thioesterase of Streptomyces avermitilis (S. Omura et al., 2001; GenBank accession number: BAB69315; BLAST score: 234). The similarity between this and proteins involved in the biosynthetic pathway for other nearby antibiotics strongly suggests that the orf6 gene encodes a thioesterase. This hypothesis is supported by the fact that the protein encoded by the orf6 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 18).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf7 gene encodes a protein that exhibits a relatively strong similarity to several hexose dehydratases. In particular, the protein encoded by orf7 has considerable similarity to the Streptomyces fradiae dNTP-hexose 2,3-dehydratase (encoded by the TylCVI gene) involved in tyrosine biosynthesis (LA. Merson-Davies et al., 1994; GenBank accession number: AAF29379; BLAST score: 461). The similarity between this and the proteins involved in the biosynthetic pathway for other nearby antibiotics is that the orf7 gene is a hexose 2-3-3 required for biosynthesis of two typical sugars incorporated into the spiramycin molecule. It strongly suggests that it also encodes dehydratase (see FIGS. 4 and 6). This hypothesis is supported by the fact that the protein encoded by the orf7 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 19).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf8 gene encodes a protein that exhibits a relatively strong similarity to several aminotransferases. In particular, the protein encoded by orf8 has considerable similarity to aminotransferases that may be involved in forosamine biosynthesis in Saccharopolyspora spinosa (C. Waldron et al., 2001; GenBank; Deposit number: AAG23279; BLAST score: 465). The similarity between this and proteins involved in biosynthetic pathways for other nearby antibiotics strongly suggests that the orf8 gene encodes a 4-aminotransferase involved in the transamination reaction required for forosamine biosynthesis. (See FIG. 6). This hypothesis is supported by the fact that the protein encoded by the orf8 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 20).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf8 gene was inactivated. Thereby, the obtained strain could be shown not to produce spiramycin. This confirms that the orf8 gene is actually involved in spiramycin biosynthesis. Therefore, the enzyme encoded by this gene is clearly involved in the biotransformation reaction steps essential for spiramycin biosynthesis. Confirmation of the hypothesis of the role of the orf8 gene product in forosamine biosynthesis confirms that the orf8 gene is inactivated to produce forocidin, and therefore this mutant is blocked at the forosidine step and any neospira is Also provided by not producing mycin (see FIG. 7 and Example 25). These results are consistent with the orf8 gene product involved in forosamine biosynthesis (see FIG. 6).

The orf9c gene has already been identified in Streptomyces ambofaciens and has been named srmX by Geistrich et al. (M. Geistrich et al., 1992). The similarity between the protein encoded by this gene and several methyltransferases involved in the biosynthetic pathway for other nearby antibiotics is
The r9c gene strongly suggests that it encodes a methyltransferase involved in the methylation reaction required for mycaminose or forosamine biosynthesis (see FIGS. 5 and 6). This hypothesis is supported by the fact that the protein encoded by the orf9c gene shows strong similarities to other proteins with similar functions in other organisms (see Table 21).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf10 gene has already been identified in Streptomyces ambofaciens and has been named srmR by Geistrich et al. (M. Geistrich et al., 1992). The protein encoded by this gene is involved in the regulation of the biosynthesis pathway of spiramycin in Streptomyces ambofaciens. The orf10 gene was inactivated. Thereby, the obtained strain could be shown not to produce spiramycin. This confirms that the orf10 gene is actually involved in spiramycin biosynthesis. Therefore, the protein encoded by this gene is clearly essential for spiramycin biosynthesis.

  In addition, the translation initiation point of orf10 could be determined and showed that overexpression of this gene resulted in an improvement in spiramycin production. The translation initiation site corresponds to ATG located upstream of ATG, which was proposed by Geistrich et al. (M. Geistrich et al., 1992). It has also been demonstrated that this 5 'end is essential for the function of orf10 since the 5' truncated messenger is inactive (see Example 17). Therefore, in order to obtain the desired effect on spiramycin production, it is essential to enable overexpression of orf10, while orf10 5 'does not express a truncated messenger.

  The orf11c gene has already been identified in Streptomyces ambofaciens and is named srmB by Geistrich et al. (M. Geistrich et al., 1992) and Schoner et al. (B. Schoner et al., 1992). The protein encoded by this gene is involved in spiramycin resistance in Streptomyces ambofaciens and is an ABC-type transporter.

The orf12 gene encodes a protein that exhibits a relatively strong similarity to several hexose dehydratases. In particular, the protein encoded by orf12 has considerable similarity to the NDP-hexose 3,4-dehydratase encoded by the Streptomyces fradiae UrdQ gene and is involved in urudamycin biosynthesis (D. Hoffineister). Et al., 2000; GenBank accession number: AAF72550; BLAST score: 634). The similarity between this and proteins involved in the biosynthetic pathway for other nearby antibiotics strongly suggests that the orf12 gene encodes 3,4-dehydratase involved in the dehydration required for forosamine biosynthesis. (See FIG. 6). This hypothesis is supported by the fact that the protein encoded by the orf12 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 22).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf12 gene was inactivated. The resulting strain could be shown not to produce spiramycin. This confirms that the orf12 gene is actually involved in spiramycin biosynthesis. Therefore, the enzyme encoded by this gene is clearly involved in the biotransformation reaction steps essential for spiramycin biosynthesis. Confirmation of the hypothesis of the role of orf12 plays in forosamine biosynthesis is provided by the fact that mutants inactivated with respect to the orf12 gene no longer produce forosamine. However, this mutant produces a small amount of forocidin. Therefore, this mutant is blocked at the forosidine stage and does not produce any neospiramycin (see FIG. 7 and Example 26). This mutant also produces a compound having the structure shown in FIG. The latter compound contains two sugars, mycaminose and mycarose, but does not contain any forosamine. In addition, when comparing this compound with the structure of spiramycin (see FIG. 1), this compound contains the sugar micalose at the expected forosamine position. These results are consistent with the orf12 gene product being involved in forosamine biosynthesis (see FIG. 6). The molecule is usually not fully glycosylated due to the observation of molecules bound to micalose at positions normally occupied by forosamine (see FIG. 38).

The orf13c gene encodes a protein having a relatively strong similarity with a protein of unknown function in Streptomyces coelicolor. This protein was named SC4H2.17 (GeneBank accession number: T35116; BLAST score: 619). The protein encoded by the orf13c gene also shows strong similarities to other proteins from other organisms (see Table 23).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  There was no correct function due to a protein close to the protein encoded by orf13c. In Streptomyces ambofaciens, the orf13c gene was inactivated to study the function of this gene in the spiramycin biosynthetic pathway. It was possible to show that the resulting strain produced spiramycin. This indicates that the orf13c gene is not essential for spiramycin biosynthesis and is not essential for bacterial survival. Therefore, the enzyme encoded by this gene does not participate in the biotransformation reaction steps essential for spiramycin biosynthesis.

  The orf14 gene encodes a protein that exhibits a relatively strong similarity to the putative reductase (M. Redenbach et al., 1996; Bentley et al., 2002; GenBank accession number: CAB90862; BLAST score: 147).

  The orf14 gene was inactivated. Thereby, the obtained strain could be shown not to produce spiramycin. This confirms that the orf14 gene is actually involved in spiramycin biosynthesis. Therefore, the enzyme encoded by this gene is clearly involved in the biotransformation reaction steps essential for spiramycin biosynthesis. Biosynthetic intermediates of strains in which the orf14 gene was knocked out were studied (see Example 20). These experiments made it possible to demonstrate that this strain produces platenolide A but not platenolide B (see FIG. 36).

  The orf15c gene encodes a protein that exhibits a relatively strong similarity to several ketoreductases. In particular, the protein encoded by orf15c has considerable similarity to 3-ketoreductase in Streptomyces antibiotics (GenBank accession number: T51102, BLAST score: 285). This similarity strongly suggests that the orf15c gene encodes 3-ketoreductase involved in the reductive reaction required for forosamine biosynthesis (see FIG. 6). This hypothesis is supported by the strong similarity of the protein encoded by the orf15c gene with other proteins that have similar functions in other organisms (see Table 24).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf16 gene encodes a protein that exhibits a relatively strong similarity to several isomerases. In particular, the protein encoded by orf16 has considerable similarity to NDP-hexose 3,4-isomerase in Streptomyces fradiae (Gandecha et al., 1997; GenBank accession number: CAA57471, BLAST score: 209). This similarity strongly suggests that the orf16 gene encodes a protein involved in the biosynthesis of any one of the spiramycin sugars (see FIGS. 5 and 6). This hypothesis is supported by the fact that the protein encoded by the orf16 gene shows strong similarity to other proteins that have similar functions in other organisms (see Table 25).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf17 gene encodes a protein that exhibits a relatively strong similarity to several glycosyltransferases. In particular, the protein encoded by orf17 has considerable similarity to the Streptomyces venezuela glycosyltransferase (Y. Xue et al., 1998; GenBank accession number: AAC68677; BLAST score: 400). The similarity between the protein encoded by the orf17 gene and several glycosyltransferases involved in the biosynthetic pathway for other nearby antibiotics strongly suggests that this gene also encodes a glycosyltransferase. This hypothesis is supported by the fact that the protein encoded by the orf17 gene shows some similarity to other proteins that have similar functions in other organisms (see Table 26).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf18 gene encodes a protein that exhibits a relatively strong similarity to several glycosyltransferases. In particular, the protein encoded by orf18 has considerable similarity to the glycosyltransferase of Streptomyces lyciliensis (Wang et al., 2000; GenBank accession number: AAG29785; BLAST score: 185). The similarity between the protein encoded by the orf18 gene and several glycosyltransferases involved in the biosynthetic pathway for other nearby antibiotics strongly suggests that this gene also encodes a glycosyltransferase. This hypothesis is supported by the fact that the protein encoded by the orf18 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 27).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf19 gene encodes a protein that exhibits a relatively strong similarity to several ketoreductases. In particular, the protein encoded by orf19 has considerable similarity to the NDP-hexose 4-ketoreductase of Streptomyces fradiae (T
ylCIV) (Bate et al., 2000; GenBank accession number: AAD41822; BLAST score: 266). The similarity between the protein encoded by the orf19 gene and this ketoreductase involved in the biosynthetic pathway for nearby antibiotics is that this gene is also a 4-ketoreductase involved in the reduction reaction required for mycarose biosynthesis. It strongly suggests coding (see FIG. 4). This hypothesis is supported by the fact that the protein encoded by the orf19 gene shows strong similarities to other proteins that have similar functions in other organisms (see Table 28).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf20 gene encodes a protein that exhibits a relatively strong similarity to several hexose reductases. In particular, the protein encoded by orf20 has considerable similarity to Saccharopolyspora erythrae EryBII, which encodes dTDP-4-keto-L-6-deoxyhexose 2,3-reductase ( RG Summers et al., 1997), GenBank accession number: AAB84068; BLAST score: 491). The similarity between the protein encoded by the orf20 gene and several hexose reductases involved in the biosynthetic pathway for other nearby antibiotics indicates that this gene is involved in the reduction required for mycarose biosynthesis 2,3 -Strongly suggests encoding a reductase (see Figure 4). This hypothesis is supported by the fact that the protein encoded by the orf20 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 29).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf21c gene encodes a protein that exhibits a relatively strong similarity to several hexose methyltransferases. In particular, the protein encoded by orf21c has considerable similarity to the TylCIII gene of Streptomyces fradiae encoding NDP-hexose 3-C-methyltransferase (N. Bate et al., 2000; GenBank accession number: AAD41823; BLAST score: 669): Similarity between the protein encoded by the orf21c gene and several hexose methyltransferases involved in biosynthetic pathways for other nearby antibiotics It strongly suggests that it encodes a hexose methyltransferase involved in the required methylation reaction (see FIG. 4). This hypothesis is supported by the strong similarity of the protein encoded by the orf21c gene with other proteins that have similar functions in other organisms (see Table 30).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf22c gene is Streptomyces hygroscopicus ver., which encodes an enzyme involved in methoxymalonyl biosynthesis. Encodes a protein that exhibits relatively strong similarity to the protein encoded by the fkbH gene of Streptomyces hygroscopicus var. Ascomyceticus (K. Wu et al., 2000; GenBank accession number: AAF86387; BLAST score: 463 ). The similarity between the protein encoded by the orf22c gene and this protein involved in the biosynthetic pathway for other close macrolides is that this gene is also an enzyme involved in methoxymalonyl biosynthesis in Streptomyces ambofaciens. It strongly suggests coding (see FIG. 8).

  The orf23c gene is a Streptomyces hygroscopicus ver. that encodes an acyl-CoA dehydrogenase involved in methoxymalonyl. It encodes a protein that shows relatively strong similarity to the protein encoded by the Ascomiceticus fkbI gene (K. Wu, et al., 2000; GenBank accession number: AAF86388; BLAST score: 387). The similarity between the protein encoded by the orf23c gene and several acyl-CoA dehydrogenases involved in biosynthetic pathways for other nearby antibiotics, suggests that this gene is responsible for the acyl-CoA dehydrogenase involved in methoxymalonyl biosynthesis. It strongly suggests coding (see FIG. 8). This hypothesis is supported by the strong similarity of the protein encoded by the orf23c gene with other proteins that have similar functions in other organisms (see Table 31).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf24c gene is a Streptomyces hygroscopicus ver., which is believed to encode an acyl carrier protein (ACP) involved in methoxymalonyl biosynthesis. It encodes a protein that exhibits a relatively strong similarity to the protein encoded by the fkbJ gene of Ascomiceticus (K. Wu et al., 2000; GenBank accession number: AAF86389; BLAST score: 87). The similarity between the protein encoded by the orf24c gene and this protein involved in the biosynthetic pathway for other nearby macrolides indicates that this gene represents a protein involved in methoxymalonyl biosynthesis in Streptomyces ambofaciens. It strongly suggests coding (see FIG. 8).

  The orf25c gene is a Streptomyces hygroscopicus ver., encoding acyl-CoA dehydrogenase involved in methoxymalonyl biosynthesis. It encodes a protein that exhibits a relatively strong similarity to the protein encoded by the Ascomiceticus fkbK gene (K. Wu et al., 2000; GenBank accession number: AAF86390; BLAST score: 268). The similarity between the protein encoded by the orf25c gene and several acyl-CoA dehydrogenases involved in biosynthetic pathways for other nearby antibiotics, suggests that this gene allows acyl-CoA dehydrogenases involved in methoxymalonyl biosynthesis. It strongly suggests coding (see FIG. 8). This hypothesis is supported by the fact that the protein encoded by the orf25c gene shows strong similarities to other proteins with similar functions in other organisms (see Table 32).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  The orf26 gene is a protein that shows 65% identity (determined using the BLAST program) with the protein encoded by the tylCV gene that encodes the mycanosyltransferase involved in tyrosine biosynthesis in Streptomyces fradiae. Code (N. Bate, et al., 2000; GenBank accession number: AAD41824, BLAST score: 471). More specifically, TylCV is a glycosyltransferase that binds to a micalose molecule during tyrosine synthesis. The similarity of this to the biosynthetic pathways for other relatively close antibiotics, and more specifically to proteins involved in micalose migration, suggest that the orf26 gene is a glycosyltransferase. This hypothesis is supported by the fact that the protein encoded by the orf26 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 33).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf27 gene is 70% identical to the protein encoded by the tylCVII gene encoding NDP-hexose 3,5- (or 5-) epimerase involved in tyrosine biosynthesis in Streptomyces fradiae (using the BLAST program (N. Bate et al., 2000; GenBank accession number: AAD41825, BLAST score: 243). More specifically, TylCVII is a hexose 3,5- (or 5-) epimerase involved in mycarose biosynthesis. The similarity of this to the biosynthetic pathway for other relatively close antibiotics, more specifically to proteins involved in mycarose biosynthesis, suggests that the orf27 gene encodes epimerase. This hypothesis is supported by the fact that the protein encoded by the orf27 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 34). Analysis of the close sequence obtained using the BLAST program strongly suggests that the orf27 gene encodes a 5-epimerase involved in the isomerization reaction required for mycarose biosynthesis (see FIG. 4). .

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

Since only the sequence of the region of about 450 base pairs was determined after the rearrangement analysis, the orf28c sequence was first partially determined (this region is represented by the symbol “N” in the incomplete sequence of SEQ ID NO: 106). ). Nevertheless, this partial sequence of the ORF (SEQ ID NO: 111 ) was used for analysis with the various computer programs described above. Thus, the orf28c gene spans the determined sequence (SEQ ID NO: 112, which is a partial sequence of the Orf28c protein), a regulatory protein involved in carbomycin biosynthesis in Streptomyces thermotolerans. Can be determined to encode a protein that shows 64% identity with the protein encoded by the acyB2 gene (A. Arisawa et al., 1993; GenBank accession number: JC2032, BLAST score: 329). (Determined using the BLAST program). The similarity between this and proteins involved in the biosynthetic pathway for relatively close antibiotics indicates that the orf28c gene encodes a regulatory protein involved in spiramycin biosynthesis. This hypothesis is supported by the fact that the protein encoded by the orf28c gene also shows strong similarity to the TylR protein, a regulatory protein involved in tyrosine biosynthesis in Streptomyces fradiae (N. Bate et al., 1999). Year; GenBank accession number: AAF29380, BLAST score: 167).

  It was possible to amplify the orf28c gene with an oligonucleotide located at either end of the undetermined sequence and subclone it into an expression vector. In this way, it was possible to demonstrate that overexpression of the orf28c gene significantly increased spiramycin production in the OSC2 strain (see Example 24). This demonstrates that overexpression of orf28c increases spiramycin production and confirms its role as a regulator of the biosynthesis pathway of spiramycin.

Subsequently, a partial sequence of orf28c was completed, and a region in which about 450 base pairs were lost was determined (see SEQ ID NO: 140 and SEQ ID NO: 141). The complete sequence of this ORF (SEQ ID NO: 141) was used for analysis with the various computer programs described above. In this way, the orf28c gene encodes a regulatory protein involved in carbomycin biosynthesis in Streptomyces thermotolerance across the determined sequence (SEQ ID NO: 142, which is the complete sequence of the Orf28c protein). A protein showing 69% identity (determined using the BLAST program) with the protein encoded by the acyB2 gene (Arisawa, A., et al., 1993; GenBank accession number: JC2032, BLAST score: 451) I was able to decide to code. The similarity between this and a protein involved in the regulation of relatively close antibiotic biosynthesis indicates that the orf28c gene encodes a regulatory protein involved in spiramycin biosynthesis. This hypothesis indicates that the protein encoded by the orf28c gene also shows strong similarity to the TylR protein (a regulatory protein involved in the regulation of tyrosine biosynthesis in Streptomyces fradiae) (Bate, N et al., 1999). Year; GenBank deposit number: AAF29380, BLAST score: 224). The result of overexpression of this gene (see Example 24) confirms its role as a regulator of the spiramycin biosynthetic pathway.

  The orf28c gene was inactivated. Thereby, the obtained strain could be shown not to produce spiramycin. This confirms that the orf28c gene is clearly involved in spiramycin biosynthesis and is essential for spiramycin biosynthesis. These results, together with the results of overexpression of this gene (see Example 24), are consistent with the role of Orf28c as an activator essential for spiramycin biosynthesis.

  The orf29 gene is a possible glycosyl hydrolase (J. Ligon et al., 2002; GenBank accession number) located in the gene group involved in soraphen A (polyketide class antifungal) biosynthesis in Sorangium cellulosum. : AAK 19890, BLAST score: 139) and encodes a protein showing 31% identity (determined using the BLAST program). This similarity to proteins involved in biosynthetic pathways for relatively close molecules indicates that the orf29 gene encodes a protein with glycosyl hydrolase activity. This hypothesis is supported by the fact that the protein encoded by the orf29 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 35). Sequence analysis of the protein encoded by orf29 in the CD-search program (see above) also shows that the orf29 gene encodes a glycosyl hydrolase.

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  Analysis of the protein sequence inferred from orf29 using the SignalP program (http://www.cbs.dtu.dk/services/SignalP/) (Nielsen, H. et al., 1997) And C-terminal signal sequence with the expected cleavage site (QSA / QA) between positions 31 and 31. This protein is expected to be extracellular. This protein is thought to have a role as a glycosyl hydrolase in the reactivation of spiramycin inactivated by glycosylation by glycosyltransferases GimA and / or GimB (Gounnelen et al., 1998).

  The orf30c gene has 31% identity (determined using the BLAST program) with the nucleoside-phosphate phosphate epimerase (GenBank accession number: NP_600590, BLAST score: 89) in Corynebacterium glutamicum. Encodes the indicated protein. This similarity indicates that the orf30c gene encodes epimerase. This hypothesis is supported by sequence analysis in the CD-search program (see above) also showing that the orf30c gene encodes epimerase.

  orf30c shows two possible start codons (see SEQ ID NO: 115) which yields two possible proteins (SEQ ID NO: 116 and 117) consisting of 345 and 282 amino acids, respectively . However, this codon usage is characteristic for Streptomyces only from the second ATG; in addition, the deduced protein sequence of the sequence between the first ATG and the second ATG has been identified. While not aligned with the close sequence, the shortest protein sequence (from the second ATG: SEQ ID NO: 144) is aligned correctly at the beginning of these proteins. Therefore, from now on, the second ATG is the correct start codon, and therefore this orf sequence is the sequence shown in SEQ ID NO: 143. It can be guessed that it corresponds.

  The orf31 gene encodes a protein that exhibits 52% identity (determined using the BLAST program) with oxidoreductase (GenBank accession number: NP — 631148, BLAST score: 261) in Streptomyces coelicolor. This similarity indicates that the orf31 gene encodes a reductase. This hypothesis is supported by analysis of the sequence using a CD-search program (see above) also showing that the orf31 gene encodes a reductase. This hypothesis is also supported by the fact that the protein encoded by the orf31 gene shows strong similarities to other proteins with similar functions in other organisms (see Table 36).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等
，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

The orf31 gene was inactivated. Thereby, the obtained strain could be shown not to produce spiramycin. This confirms that the orf31 gene is actually involved in spiramycin biosynthesis. Therefore, the enzyme encoded by this gene is clearly involved in the biotransformation reaction steps essential for spiramycin biosynthesis.

  Since only the coding sequence at position 5 'was determined in the second step, first the sequence of orf32c was partially determined (see Example 19). However, this orf partial sequence (SEQ ID NO: 120) was used for analysis with the various computer programs described above. Thus, the orf32c gene spanned the determined sequence (SEQ ID NO: 121, which is a partial sequence of the ORF32c protein), a GntR family regulatory protein in Streptomyces coelicolor (GenBank accession number: NP — 625576, BLAST). Could be determined to encode a protein showing a score of 229) and 47% identity (determined using the BLAST program). This similarity indicates that the orf32c gene encodes a transcriptional regulator of the GntR family. This hypothesis is supported by the fact that the protein encoded by the orf32c gene shows strong similarities to other proteins that have similar functions in other organisms.

  Subsequently, the partial sequence of orf32c was completed and the missing region was determined (see SEQ ID NO: 140 and SEQ ID NO: 145). The complete sequence of this orf is a protein that exhibits 44% identity (determined using the BLAST program) with the GntR family of regulatory proteins (GenBank accession number: NP_824604, BLAST score: 282) in Streptomyces avermitilis Code. This similarity indicates that the orf32c gene encodes a transcriptional regulator of the GntR family. This hypothesis is supported by the fact that the protein encoded by the orf32c gene shows strong similarities to other proteins with similar functions in other organisms (see Table 37).

*；配列類似性の大きさは、ＢＬＡＳＴスコアの高さに関連する（Ａｌｔｓｃｈｕｌ等，１９９０年）。

*; The magnitude of sequence similarity is related to the high BLAST score (Altschul et al., 1990).

  In order to study the function of this gene in the spiramycin biosynthetic pathway in Streptomyces ambofaciens, the orf32c gene was inactivated. The resulting strain could be shown to produce spiramycin. This indicates that the orf32c gene is not essential for spiramycin biosynthesis and is not essential for bacterial survival.

  The orf33 gene encodes a protein showing 49% identity (determined using the BLAST program) with the hypothetical protein of Xanthomonas campestris (GenBank accession number: NP — 635564, BLAST score: 54).

  The sequence of orf34c is partial. In fact, the comparison made between the product of this orf and the database shows that the C-terminal part of the protein is not in the product deduced from the nucleotide sequence, so Indicates that it has been continuous beyond that longer. However, this partial sequence of ORF was used for analysis with the various computer programs described above. The orf34c gene spans the determined sequence (SEQ ID NO: 150, which is a partial sequence of the ORF34c protein), an arabinofuranosidase from Streptomyces coelicolor (Bentley et al., 2002; GenBank accession number: NP_630049, BLAST) Could be determined to encode a protein showing a score of 654) and 91% identity (determined using the BLAST program). S. In Coericolor, the gene encoding this arabinofuranosidase does not appear to be involved in the biosynthesis of secondary metabolites. Therefore, S.H. In ambofaciens, this gene does not appear to be involved in spiramycin biosynthesis.

  It is also an object of the present invention to provide SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36 under highly stringent hybridization conditions. , 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118 , 120, 141, 143, 145, 147 and 149, any one of the variants thereof, or any one of the sequences obtained therefrom due to the degeneracy of the genetic code Polynucleotide that hybridizes with each other. Optionally, said polynucleotides are isolated from Streptomyces bacteria, more selectively these polynucleotides encode proteins involved in macrolide biosynthesis, and even more selectively. These polynucleotides encode proteins that have similar activity to the protein encoded by the polynucleotide to which they hybridize. Highly stringent hybridization conditions can be defined as hybridization conditions that are undesirable for hybridization of heterologous nucleic acid strands. For example, highly stringent hybridization conditions can be described as hybridization conditions at temperatures between 55 ° C. and 65 ° C. in buffer, as described by Church and Gilbert (church and Gilbert, 1984), The hybridization temperature is preferably 55 ° C., even more preferably 60 ° C., most preferably 65 ° C., followed by one or more washes with 2 × SSC buffer at a temperature of 55 ° C. to 65 ° C. This temperature is preferably 55 ° C., even more preferably 60 ° C., most preferably 65 ° C., followed by 0.5 × SSC buffer at a temperature of 55 ° C. to 65 ° C. one or more times. This temperature is preferably 55 ° C, even more preferably 60 ° C, most preferably 65 ° C. It is. The hybridization conditions described above can be adjusted depending on the length of the nucleic acid for which hybridization is sought, or the label type selected according to techniques known to those skilled in the art. Suitable hybridization conditions are described in, for example, F.I. Adjustments can be made according to a book by Ausubel et al. (2002).

  The present invention also includes SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53. , 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149 A polynucleotide selected from the group consisting of the nucleotide sequences of: or any one of its variants, or any one of the sequences derived therefrom due to the degeneracy of the genetic code, or the polynucleotide of the complementary sequence Of at least 10, 12, 15, 18, 20-25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 50, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, A polynucleotide comprising 1700, 1750, 1800, 1850 or 1900 contiguous nucleotides and at least 70%, more preferably 80%, more preferably 85%, even more preferably 90%, even more preferably 95%, And most preferably relates to a polynucleotide having 98% nucleotide identity. Optionally, said polynucleotides are isolated from Streptomyces bacteria, more selectively these polynucleotides encode proteins involved in macrolide biosynthesis, and even more selectively. These polynucleotides encode proteins that have activities similar to those encoded by the polynucleotides they exhibit identity with. Most preferably, the polynucleotide according to the present invention has SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, It is selected from the group consisting of nucleotide sequences 143, 145, 147 and 149, or is a complementary sequence polynucleotide.

  Optimal alignment of the sequences for comparison can be done on a computer using known algorithms, such as the algorithm of the FASTA package (WR Pearson and DJ Lipman, 1988). And WR Pearson, 1990), especially available from the INFOBIOGEN Resource Center (Evry, France). As an example, percentage sequence identity may be determined using LFASTA (K.-M. Chao et al., 1992) or LALIGN (X. Huang and W. Miller, 1991) software. The LFASTA and LALIGN programs are part of the FASTA package. LALIGN provides optimal local alignment; this program is more precise but slower than LFASTA.

  Another aspect of the invention relates to a polypeptide resulting from the expression of a nucleic acid sequence as defined above. Optionally, the polypeptide according to the invention is SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 29, 31, 32, 33, 35. , 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150, or any of these sequences One (but one or more amino acids throughout the sequence have been substituted, inserted or deleted without affecting their functional properties), or any one of variants of these sequences, At least 10, 15, 20, 30-40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or a polypeptide comprising 640 consecutive amino acids and at least 70%, more preferably 80%, more preferably Shows amino acid identity with 85%, even more preferably 90%, even more preferably 95%, and most preferably 98%. Alternatively, the polypeptides according to the invention are expressed in the natural state by Streptomyces bacteria, more selectively, these polypeptides are involved in macrolide biosynthesis and are even more selective. In some cases, these polypeptides have an activity similar to that of the polypeptides with which they are identical. Preferably, the polypeptide according to the present invention is SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 29, 31, 32, 33, 35, 37. , 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150 polypeptide sequences, or these Any one of the sequences, provided that one or more amino acids have been substituted, inserted or deleted throughout the sequence without affecting their functional properties, or mutations in these sequences It is any one of. Most preferably, the polypeptide according to the invention is SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 29, 31, 32, 33, 35, 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150 polypeptide sequences.

  Optimal alignment of sequences for comparison can be done in a computer using known algorithms, for example, such algorithms include those of the PASTA package (WR Pearson and DJ Lipman, 1988 and WR Pearson, 1990), especially available from the INFOBIOGEN Resource Center (Evry, France). By way of example, percentage sequence identity is determined by the INFOBIOGEN Resource Center (Evry, France) using LFASTA (K.-M. Chao et al., 1992) or LALIGN (X. Huang and W. Miller, 1991) software. It may be determined using defined default parameters. The LFASTA and LALIGN programs are part of the FASTA package. LALIGN provides optimal local alignment; this program is more precise but slower than LFASTA.

Another aspect of the present invention relates to the above-described recombinant DNA polynucleotide. Optionally, the recombinant DNA is a vector. Even more selectively, the vector is selected from bacteriophages, plasmids, phagemids, integrateable vectors, fosmids, cosmids, shuttle vectors, BACs (bacterial artificial chromosomes) and PACs (P1-derived artificial chromosomes). By way of example, lambda phage and M13 phage can be described as bacteriophages. Plasmids include E. coli. Plasmids that replicate in E. coli, such as pBR322 and its derivatives, pUC18 and its derivatives, pUC19 and its derivatives, pGB2 and its derivatives (G. Churchward et al., 1984), pACYC177 (GenBank accession number: X06402) and its derivatives, and PACYC184 (GenBank accession number: X06403) and its derivatives. Also included are plasmids that replicate in Streptomyces, such as pU101 and its derivatives, pSG5 and its derivatives, SLP1 and its derivatives, and SCP2 ^* and its derivatives (Kieser et al., 2000). Phagemids include, for example, pBluescript II and its derivatives (particularly marketed by Stratagene (La Jolla, Calif., USA)), pGEM-T and its derivatives (Promega, Madison, Wis.) , USA)), [omitted] IS117 integration system (Kieser et al., 2000). Examples of fosmids include fosmid pFOSI (commercially available from New England Biolabs Inc. Beverly, Mass., USA) and derivatives thereof. Examples of cosmids include cosmid SuperCos and derivatives thereof (particularly marketed by Stratagene (La Jolla, Calif., USA)), and cosmid pWED15 (Wahl et al., 1987) and derivatives thereof. Examples of shuttle vectors include E.I. E. coli / Streptomyces shuttle plasmids such as pU903 and its derivatives, a series of plasmids pUWL, pCA0106, pWHM3, and pOJ446 and their derivatives (Kieser et al., 2000); Coli / Streptomyces shuttle BAC, such as those described in patent application WO 01/40497. Examples of BAC (bacterial artificial chromosome) include BACpBeloBAC11 (GenBank accession number: U51113). Examples of PACs (P1-derived artificial chromosome) include the vector pCYPAC6 (GenBank accession number: AF133437). Most preferably, the vector according to the present invention is pOS49.1, pOS49.11, pOSC49.12, pOS49.14, pOS49.16, pOS49.28, pOS44.1, pOS44.2, pOS44.4, pSPM5, pSPM7 POS49.67, pOS49.88, pOS49.106, pOS49.120, pOS49.107, pOS49.32, pOS49.43, pOS49.44, pOS49.50, pOS49.99, pSPM17, pSPM21, pSPM502, pSPM504, pSPM507 , PSPM508, pSPM509, pSPM1, pBXL1111, pBXL1112, pBXL1113, pSPM520, pSPM521, pSPM522, pSPM523, pSPM524, pSP 525, pSPM527, pSPM528, pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM41, pSPM42, pSPM43, pSPM44, pSPM45, pSPM47, pSPM48, PSPM50, pSPM51, pSPM50, pSPM51 It is selected from pSPM73, pSPM515, pSPM519, pSPM74, pSPM75, pSPM79, pSPM83, pSPM107, pSPM543, and pSPM106.

  Another aspect of the invention relates to an expression system comprising a suitable expression vector and a host cell capable of expressing one or more of the aforementioned polypeptides in a biological system. The expression vector according to the present invention comprises a nucleic acid sequence encoding one or more of the above-mentioned polypeptides, and causes expression of various polypeptides according to the present invention in various host cells well known to those skilled in the art. Can do. For example, prokaryotic expression systems such as bacteria E. coli. Expression systems in E. coli and eukaryotic expression systems, such as baculovirus expression systems capable of expression in insect cells, expression systems capable of expression in yeast cells, or expression in cells in mammals Expression systems, particularly human cells, can be mentioned. Expression vectors that can be used in such systems are well known to those of skill in the art; E. coli expression vectors such as pET (commercially available from Stratagene (La Jolla, Calif., USA)), GATEWAY family of vectors (Invitrogen (Carlsbad, Calif., USA)) PBAD family vectors (commercially available from Invitrogen (Carlsbad, Calif., USA)), pMAL family vectors (marketed by New England Biolabs (Beverly, Massachusetts, USA)), and B. Include the rhamnose-inducible expression vectors and derivatives thereof described in Wilms et al., 2001; and further, expression vectors in Streptomyces such as vectors pU4123, pU6021, pPM927, pANT849, pANT850, pANT851, pANT1200, pANT1201, and PANT1202 and their derivatives (Kieser et al., 2000). Examples of yeast cells include vector pESC (commercially available from Stratagene (La Jolla, Calif., USA)). Regarding a baculovirus expression system capable of expression in insect cells, see, for example, the vector BacPAK. 6 (commercially available from BD Biosciences Clontech, Palo Alto, Calif., USA). For mammalian cells, for example, a vector containing a CMV (cytomegalovirus) immediate early gene promoter (eg, the vector pCMV and its derivatives marketed by Stratagene (La Jolla, Calif., USA)), or bacul Examples include the SV40 early promoter of vacuating simian virus (for example, the vector pSG5 marketed by Stratagene (La Jolla, Calif., USA)).

The present invention also relates to a method for producing the above polypeptide, said method comprising the following steps:
a) inserting a nucleic acid encoding the polypeptide into an appropriate vector;
b) culturing the host cells previously transformed or transfected with the vector of step a) in a suitable medium;
c) recovering the conditioned medium or cell extract, for example by sonication or osmotic shock;
d) separating and purifying the polypeptide from the medium or from the cell extract obtained in step c);
e) optionally characterizing the produced recombinant polypeptide.

  Recombinant polypeptides according to the invention can be purified by passage through a suitable series of chromatography columns according to methods known to those skilled in the art, e.g. Ausubel et al. (2002). An example is the “histidine tag” technique, which consists in adding a short polyhistidine sequence to the polypeptide to be produced, so that the polypeptide can be purified on a nickel column. The polypeptide according to the present invention can also be produced by in vitro synthesis techniques. As an example of such a technique, a polypeptide according to the present invention is, in particular, Roche Diagnostics, France S. A. (Roche Diagnostics France SA, Meran, France) and may be manufactured using a “Rapid Translation System (RTS)”.

  Another aspect of the invention relates to a host cell into which at least one polynucleotide according to the invention and / or at least one recombinant DNA and / or at least one expression vector has been introduced.

  Another aspect of the invention relates to a microorganism that is blocked in a step of the biosynthetic pathway of at least one macrolide. The advantages are firstly to study the function of the mutein and secondly to produce microorganisms that produce biosynthetic intermediates. These intermediates, in this way, suddenly encode proteins that can be modified after separation by adding certain components to the production medium or using the intermediate as a substrate. It may be modified by introducing other mutated genes into the microorganism. In this way, these intermediates can be chemically, biochemically, enzymatically and / or microbiologically modified. The microorganism blocked in the process of the biosynthetic pathway for the macrolide is a function of one or more proteins involved in the biosynthesis of this (or these) macrolides in the microorganism that produces this (or these) macrolides Can be obtained by inactivation. Depending on the inactivated protein, microorganisms blocked in various steps of the biosynthetic pathway for this (or these) macrolides can be obtained in this way. This (or these) protein inactivation can be done by any method known to those skilled in the art, for example by mutagenesis in the gene encoding the protein or complementary to the messenger RNA encoding the protein. Or by expression of one or more antisense RNAs. For example, mutagenesis can be performed by irradiation, the action of mutagenic chemical agents, solid-directed mutagenesis, gene replacement, or any other method known to those skilled in the art. For example, conditions suitable for such mutagenesis are described in T.W. Adjustments can be made according to the teachings described in the work by Kieser et al. (2000) and Ausubel et al. (2002). Mutagenesis can be performed in vitro or in situ by suppression, substitution, deletion and / or addition of one or more bases of the gene of interest, or gene inactivation. This mutagenesis can be performed on a gene comprising the above-described sequence. Alternatively, the microorganism blocked in the process of the biosynthetic pathway for macrolides is a Streptomyces bacterium. More selectively, the inactivation of the function of one or more proteins involved in the macrolide biosynthesis in question is performed by mutagenesis. Even more preferentially, the macrolide in question is spiramycin and the microorganism to be mutagenized is S. cerevisiae. Ambofaciens strain. More selectively, mutagenesis is performed in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, Performed on one or more of the genes comprising any one of the sequences corresponding to one or more of the sequences of 145, 147 and 149. Preferably, mutagenesis is performed by gene inactivation. Most preferably, mutagenesis consists of gene inactivation of a gene comprising a sequence corresponding to the sequence of SEQ ID NO: 13.

For example, examples of such microorganisms include the following microorganisms: OS49.16 (orf3 :: Ωhyg, see Example 2), OS49.67 (deletion in orf3 phase, see Example 6) ), OS49.107 (orf8 :: Ωhyg, see Example 7), OS49.50 (orf10 :: Ωhyg, see Example 8), SPM21 (orf2 :: att3Ωaac−, see Example 10), SPM22 (Deletion within the phase of orf :: att3, see Example 10), SPM501 (orf6 ^* :: att1Ωhyg +, cf; example 14), SPM502 (orf6 ^* :: deletion within the phase of att1, example 14), SPM507 (orf12 :: att3Ωaac−, see Example 11), SPM508 (orf13c: att3Ωaac−, see Example 12), and SPM509 (orf14 :: att3Ωaac−, see Example 13), SPM107 (orf28c :: att3aac +, see Example 29), SPM543 (orf31 :: att3aac +, Example) 30), SPM 106 (orf32c :: att3aac +, see Example 31).

  The other form of this invention is related with the manufacturing method of the intermediate body of a macrolide biosynthesis using the microorganisms blocked by the biosynthetic pathway process regarding the above-mentioned macrolide. The method comprises culturing a microorganism blocked in a biosynthetic pathway step for the macrolide described above in a suitable medium, eg, recovering conditioned medium or cell extract by sonication or osmotic shock, and The biosynthetic intermediate is to be separated and purified from the medium or from the cell extract obtained in the previous step. Conditions for culturing such microorganisms may be determined according to techniques well known to those skilled in the art. As such a medium, for example, MP5 medium or SL11 medium can be used for Streptomyces, particularly Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may refer in particular to the book by Kieser et al. (2000) regarding the culture of Streptomyces. The intermediate produced can be recovered by any technique known to those skilled in the art. For example, one skilled in the art may refer to the technique taught in US Pat. No. 3,000,785, and more particularly to the method of extracting spiramycin described in that patent.

  Another object of the present invention relates to a method for producing a molecule obtained from a macrolide, using a microorganism blocked in the biosynthetic pathway process relating to the macrolide described above. The method consists in obtaining the biosynthetic intermediate according to the method described above and optionally modifying the intermediate thus produced after separation from the culture medium. Conditions for culturing such microorganisms may be determined according to techniques well known to those skilled in the art. As such a medium, for example, MP5 medium or SL11 medium can be used for Streptomyces, particularly Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may refer to a book by Kieser et al. (2000) in particular regarding Streptomyces culture. The intermediate produced may optionally contain other genes encoding proteins that can be modified after addition by adding appropriate components to the production medium or using the intermediate as a substrate. It may be modified either by introduction into a microorganism. Accordingly, these intermediates can be chemically, biochemically, enzymatically and / or microbiologically modified. More selectively, the macrolide in question is spiramycin, and the microorganism to be mutagenized is S. cerevisiae. Ambofaciens strain.

The invention also relates to microorganisms that produce spiramycin I but not spiramycin II and III. This microorganism contains all the genes necessary for the biosynthesis of spiramycin I, but then either the gene containing the sequence corresponding to SEQ ID NO: 13 or any one of its variants, or due to the degeneracy of the genetic code. Since any one of the resulting sequences encoding the polypeptide of the sequence of SEQ ID NO: 14 or any one of its variants is not expressed or rendered inactive, Mycins II and III are not produced. This inactivation of the protein can be performed by any method known to those skilled in the art, for example by mutagenesis in the gene encoding the protein or of an antisense RNA complementary to the messenger RNA encoding the protein. Of course, if orf5 ^* expression is affected by this manipulation, other modifications will need to be made so that the orf5 ^* gene is expressed correctly. Mutagenesis can be performed on coding or non-coding sequences such that the encoded proteins are inactivated or their expression or translation from them is inhibited. Mutagenesis may be performed by site-directed mutagenesis, gene replacement or any other method known to those skilled in the art. For example, conditions suitable for such mutagenesis are described in T.W. Adjustments may be made according to the teachings described in the work by Kieser et al. (2000) and Ausubel et al. (2002). Mutagenesis may be performed in vitro or in situ, by repression, substitution, deletion and / or addition of one or more bases of the gene of interest or by gene inactivation. Such a microorganism may be obtained by expressing a gene of the biosynthetic pathway of spiramycin, provided that the gene comprising the sequence of SEQ ID NO: 13, or any one of its variants, or the gene It does not include any one of the sequences encoding the polypeptide of the sequence of SEQ ID NO: 14 obtained therefrom due to the degeneracy of the code, or any one of its variants. Optionally, such microorganisms are Streptomyces bacteria. More selectively, microorganisms that produce spiramycin I but not spiramycin II and III are obtained from starting microorganisms that produce spiramycin I, II and III. Even more selectively, such a microorganism is obtained from the gene comprising the sequence corresponding to SEQ ID NO: 13, or any one of its variants having the same function, or from the degeneracy of the genetic code. Obtained by mutagenesis in any one of the sequences encoding the polypeptide of the sequence SEQ ID NO: 14, or any one of its variants. Even more selectively, this mutagenesis is performed by gene inactivation. Preferably, such a microorganism is a spiramycin in which gene inactivation of any one of the gene comprising the sequence corresponding to SEQ ID NO: 13 or the sequence obtained therefrom due to degeneracy of the genetic code has been performed. S. producing I, II and III Obtained from Ambofaciens strains. Most preferably, the gene inactivation is a gene comprising a sequence corresponding to SEQ ID NO: 13, or a part of a gene comprising a sequence corresponding to SEQ ID NO: 13, or a sequence obtained therefrom by degeneracy of the gene code By deletion within any one of the phases. For example, a strain SPM502 (orf6 ^* :: att1, see Example 14) is given as a microorganism that produces spiramycin I but does not produce spiramycin II and III.

The present invention also relates to a microorganism that produces the aforementioned spiramycin I but does not produce spiramycin II and III, which is also overexpressed:
-Primer pairs of the following sequences: 5 'AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3' (SEQ ID NO: 138) and 5 'GGATCCCGCGACGGACACGACCGCCGCGCA3' (SEQ ID NO: 139) and cosmid pSPM36 or Streptomyces amphithmus More preferably, a gene obtainable by polymerase chain reaction using the coding sequence SEQ ID NO: 141 gene),
Or a gene obtained from them due to the degeneracy of the genetic code.

An example of the sequence of such a gene is shown in SEQ ID NO: 111 (DNA); however, this sequence is partial because it does not include the 3 'portion of the corresponding coding sequence. Translation of this portion of the coding sequence into the protein is shown in SEQ ID NO: 112. Those skilled in the art can easily complete it, especially using the teachings described in Example 24. The sequence not determined in SEQ ID NO: 111 was determined in the second step, and the complete sequence of this orf (orf28c) is shown in SEQ ID NO: 141. Translation of this coding sequence into protein is shown in SEQ ID NO: 142. Example 24 shows a method for cloning the orf28c gene and a method for producing an expression vector capable of expressing orf28c. This example also shows that overexpression of the orf28c gene in OSC2 strain results in improved spiramycin production in this strain. Overexpression of the orf28c gene can be obtained by increasing the copy number of this gene and / or by introducing a promoter that is more active than the wild type promoter. Preferably, the overexpression of the gene is obtained by introducing a recombinant DNA construct capable of overexpression of the gene into a microorganism. Preferably, this recombinant DNA construct increases the copy number of the gene and makes it possible to obtain overexpression of the gene. In this recombinant DNA construct, the coding sequence of the gene can be placed under the control of a promoter more active than the wild type promoter. Examples include the ptrc promoter active in Streptomyces ambofaciens (E. Amann et al., 1988) and the ermE ^* promoter. Thus, preferably, as with the construct pSPM75, the introduced copy of the orf28c gene is placed under the control of the ermE ^* promoter (see Example 24).

  The present invention also produces the aforementioned spiramycin I, which overexpresses the gene having the coding sequence SEQ ID NO: 47, or the gene having the coding sequence obtained therefrom due to the degeneracy of the gene code, It relates to microorganisms that do not produce mycins II and III. Preferentially, this microorganism is the strain SPM502 pSPM525, which is Collection Nationale de Cultures de Microorganisms [National Collection of Cultures And Microeste 24, Induction of Microorganisms (CNCM) Pasteur 25. On February 26, 2003, it was deposited with the registration number I-2777.

The present invention also relates to a method of producing spiramycin I; the method comprises culturing a microorganism that produces spiramycin I but not spiramycin II and III in a suitable medium, conditioned medium or cell extraction And to separate and purify spiramycin I from the medium or from the cell extract obtained in the previous step. Conditions for culturing such microorganisms may be determined according to techniques well known to those skilled in the art. As such a medium, for example, MP5 medium or SL11 medium can be used for Streptomyces, particularly Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may refer to the book by Kieser et al. (2000) in particular regarding the culture of Streptomyces. The spiramycin I produced can be recovered by techniques known to those skilled in the art. One skilled in the art may refer to, for example, the technique taught in US Pat. No. 3,000,785, and more particularly the method of extracting spiramycin described in that patent.

Another aspect of the invention relates to the use of a nucleotide sequence according to the invention for improving the macrolide production of microorganisms. Accordingly, the present invention provides a macrolide having a genetic modification in at least one of the genes comprising a sequence as defined above and / or overexpressing at least one of the genes comprising a sequence as defined above. It relates to mutant microorganisms to be produced. Such genetic modification may involve one or more in the gene of interest for the purpose of expressing one or more of the proteins having higher activity or for the purpose of expressing this (or these) proteins at a higher level. It can consist of suppression, substitution, deletion and / or addition of the above bases. Overexpression of the gene of interest can be obtained by increasing the copy number of this gene and / or by introducing a promoter that is more active than the wild type promoter. Examples include the ptrc promoter active in Streptomyces ambofaciens (E. Amann et al., 1988), and the ermE ^* promoter (Bibb et al., 1985), (Bibb et al., 1994). Therefore, overexpression of the target gene can be obtained by introducing the recombinant DNA construct according to the present invention capable of overexpression of the gene into a microorganism that produces the target macrolide. In particular, certain macrolide biosynthesis processes are limited, and one or more proteins are expressed that are more active than wild-type proteins involved in these limited processes or at higher expression levels than wild-type proteins. The production of the associated macrolides can be improved. Increases in tyrosine production rates are realized, for example, in Streptomyces fradiae by replication of genes encoding a limited methyltransferase (which converts macrocine to tyrosine) (R. Baltz, 1997). . Production of the expression of more active protein can be obtained in particular by mutagenesis; Reference may be made to a book by Ausubel et al. (2002). Optionally, these mutant microorganisms improved with respect to their macrolide production are bacteria of the genus Streptomyces. More selectively, the macrolide in question is spiramycin, and the microorganism to be mutagenized is S. cerevisiae. Ambofaciens strain. More selectively, the genetic modification is SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, Any one of the sequences corresponding to one or more of the sequences of 145, 147 and 149, or any one of its variants, or any one of the sequences obtained therefrom due to the degeneracy of the genetic code Performed on one or more of the genes comprising one. Preferably, such a microorganism is SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47. 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145 Any one of the sequences corresponding to one or more of the sequences 147 and 149, or any one of its variants, or any one of the sequences derived therefrom due to the degeneracy of the genetic code Overexpress one or more of the genes comprising Preferably, such a microorganism comprises any one of the sequences corresponding to SEQ ID NO: 111 or 141, or any one of its variants, or the sequence obtained therefrom due to the degeneracy of the genetic code. Overexpress the gene. The sequence shown in SEQ ID NO: 111 is partial; however, one skilled in the art can easily complete it using the teachings described in Example 24 in particular. The sequence not determined in SEQ ID NO: 111 was determined in the second step, and the complete sequence of this orf (orf28c) is shown in SEQ ID NO: 141. Translation of this coding sequence into protein is shown in SEQ ID NO: 142. Example 24 shows a method for cloning the orf28c gene and a method for producing an expression vector capable of expressing orf28c. This example also shows that overexpression of the orf28c gene in OSC2 strain results in improved spiramycin production in this strain. Overexpression of the orf28c gene can be obtained by increasing the copy number of this gene and / or by introducing a promoter that is more active than the wild type promoter. Preferably, the overexpression of the gene is obtained by introducing a recombinant DNA construct capable of overexpression of the gene into a microorganism. Preferably, this recombinant DNA construct increases the copy number of the gene and makes it possible to obtain overexpression of the gene. In this recombinant DNA construct, the coding sequence of the gene can be placed under the control of a promoter more active than the wild type promoter. Examples include the ptrc promoter active in Streptomyces ambofaciens (E. Amann et al., 1988) and the ermE ^* promoter. Thus, preferably, the copy of the introduced orf28c gene is placed under the control of the ermE ^* promoter, as in the construct pSPM75 (see Example 24).

  Another embodiment of the present invention relates to a method for producing a macrolide using the microorganism described in the above paragraph. This method comprises culturing a microorganism as defined in the above paragraph in a suitable medium, recovering a conditioned medium or cell extract, and a cell extract obtained from said medium or in a previous step Is to separate and purify the macrolide produced from Conditions for culturing such microorganisms may be determined according to techniques well known to those skilled in the art. As such a medium, for example, MP5 medium or SL11 medium can be used for Streptomyces, particularly Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may refer to the book by Kieser et al. (2000) in particular regarding the culture of Streptomyces. The macrolide produced can be recovered by techniques known to those skilled in the art. One skilled in the art may refer to, for example, the technique taught in US Pat. No. 3,000,785, and more particularly the method of extracting spiramycin described in that patent. Optionally, the microorganism used in such a method is a Streptomyces bacterium. More selectively, the macrolide in question is spiramycin, and mutant microorganisms improved with respect to their spiramycin production are S. cerevisiae. Ambofaciens strain.

Another aspect of the invention relates to the use of the sequences and / or vectors according to the invention for producing a hybrid antibiotic. In particular, the polynucleotide according to the present invention may be used to obtain a microorganism that expresses one or more muteins that cause a change in substrate specificity, or for the purpose of producing a hybrid antibiotic, It may be expressed in microorganisms that produce many antibiotics. Therefore, the polynucleotide according to the present invention enables the production of hybrid antibiotics having advantageous pharmacological properties by gene transfer between producing microorganisms (Hopwood et al., 1985a, Hopwood et al., 1985b, Hutchinson et al., 1989). Year). First of all, the principle that hybrid antibiotics can be produced by genetic engineering was proposed by Hopwood (Hopwood, 1981). It suggests that enzymes involved in antibiotic biosynthesis often accept structurally related substrates, but their natural substrates are different. It is generally accepted that the substrate specificity of enzymes encoded by biosynthetic pathway genes for antibiotics is less stringent than those of primary metabolism (Hopwood, 1981, Hutchinson, 1988). Year, Robinson, 1988). It was thus possible to show that a large number of non-natural substrates are converted by microorganisms producing antibiotics, their mutants, or purified enzymes of the biosynthetic pathway for these antibiotics (Hutchinson, 1988). Using this teaching, one of ordinary skill in the art can construct a microorganism that expresses one or more muteins that cause a change in substrate specificity in order to produce a hybrid antibiotic.

  The present invention also provides at least one polynucleotide according to the present invention and / or at least one recombinant DNA and / or at least one expression vector for performing one or more bioconversion reactions, and / Or relates to the use of at least one polypeptide and / or at least one host cell. The present invention thus makes it possible to construct bacterial or fungal strains in which one or more proteins according to the invention are expressed under the control of appropriate expression signals. Such strains can be used to perform one or more bioconversion reactions. These bioconversion reactions may be performed either using whole cells or using cell extracts of the cells. These bioconversion reactions allow the molecule to be converted to a derivatized form using enzymes in the biosynthetic pathway. For example, Carreras et al. Describe the use of Saccharopolyspora erythraea and Streptomyces coelicolor strains to produce novel erythromycin derivatives (Carreras et al., 2002). Describe the use of Streptomyces P450 monooxygenase for the bioconversion reaction of desacetyladriamycin (anthracycline analog) to a novel anthracycline (Walczak et al., 2001). . Olonao et al. Describe the use of a modified Streptomyces lividans strain for the bioconversion reaction of ε-rhodomycinone to rhodomycin D (Olonaocines). Et al., 1999). One skilled in the art may apply this principle to any biosynthetic intermediate.

The invention also relates to recombinant DNA comprising:
A primer pair of the following sequence:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 'GGATCCCGCCGACGGACACACCGCCGCGCA3' (SEQ ID NO: 139)
And a polynucleotide obtainable by polymerase chain reaction using cosmid pSPM36 as a matrix or total DNA of Streptomyces ambofaciens, more preferably a polynucleotide of the sequence of SEQ ID NO: 141, or
-At least 10, 12, 15, 18, 20-25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 of said polynucleotide. 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1460, 1470, 1480, 1490 or 1500 Contiguous nucleotide fragment.

Optionally, the recombinant DNA is a vector. Even more selectively, the vector is selected from bacteriophages, plasmids, phagemids, integrateable vectors, fosmids, cosmids, shuttle vectors, BACs (bacterial artificial chromosomes) and PACs (artificial chromosomes derived from P1). By way of example, lambda phage and M13 phage can be described as bacteriophages. Plasmids include E. coli. Plasmids that replicate in E. coli, such as pBR322 and its derivatives, pUC18 and its derivatives, pUC19 and its derivatives, pGB2 and its derivatives (G. Churchward et al., 1984), pACYC177 (GenBank accession number: X06402) and its derivatives, and PACYC184 (GenBank accession number: X06403) and its derivatives. Also included are plasmids that replicate in Streptomyces, such as pU101 and its derivatives, pSG5 and its derivatives, SLP1 and its derivatives, and SCP2 ^* and its derivatives (Kieser et al., 2000). Examples of phagemids include pBluescript II and derivatives thereof (particularly marketed by Stratagene, La Jolla, Calif., USA), pGEM-T and derivatives thereof (Promega, Madison, Wisconsin, USA). And λZAPII and its derivatives (particularly marketed by Stratagene (La Jolla, Calif., USA)). Examples of vectors that can be integrated include vectors that integrate with Streptomyces, such as vectors derived from SLP1 (Kieser et al., 2000), vectors derived from pSAM2 (Kieser et al., 2000), PhiC31 phage integration system (Kieser). Et al., 2000) (for example, pSET152 (Bierman et al., 1992)) or a vector using the VWB integration system (L. van Melaert et al., 1998), and a vector using the IS117 integration system (Kieser et al., 2000) Is mentioned. Examples of the fosmid include fosmid pFOSI (commercially available from New England Biolabs (Beverly, Mass., USA)) and derivatives thereof. Examples of cosmids include cosmid SuperCos and derivatives thereof (particularly marketed by Stratagene (La Jolla, Calif., USA)), and cosmid pWED15 (Wahl et al., 1987) and derivatives thereof. Examples of shuttle vectors include E.I. E. coli / Streptomyces shuttle plasmids such as pU903 and derivatives thereof, a series of plasmids pUWL, pCA0106, pWHM3, and pOJ446 and their derivatives (Kieser et al., 2000); Coli / Streptomyces shuttle BAC, such as those described in patent application WO 01/40497. Examples of BAC (bacterial artificial chromosome) include BAG pBeloBAC11 (GenBank accession number: U51113). Examples of PAC (P1-derived artificial chromosome) include vector pCYPAC6 (GenBank accession number: AF133437). More selectively, the recombinant DNA is an expression vector. Expression vectors that can be used in such systems are well known to those of skill in the art; E. coli expression vectors such as pET (commercially available from Stratagene (La Jolla, Calif., USA)), GATEWAY family of vectors (commercially available from Invitrogen (Carlsbad, Calif., USA)), pBAD family vectors (commercially available from Invitrogen (Carlsbad, Calif., USA)), pMAL family vectors (commercially available from New England Biolabs (Beverly, Massachusetts, USA)), and literature B . Include the rhamnose-inducible expression vectors and derivatives thereof described in Wilms et al., 2001; and further, expression vectors in Streptomyces such as vectors pU4123, pU6021, pPM927, pANT849, pANT850, pANT851, pANT1200, pANT1201, and PANT1202 and their derivatives (Kieser et al., 2000). Examples of yeast cells include vector pESC (commercially available from Stratagene (La Jolla, Calif., USA)). Examples of baculovirus expression systems capable of expression in insect cells include the vector BacPAK6 (commercially available from BD Biosciences Clontech (Palo Alto, Calif., USA)). For mammalian cells, for example, a vector containing a CMV (cytomegalovirus) immediate early gene promoter (eg, vector pCMV and its derivatives (commercially available from Stratagene, La Jolla, Calif., USA)), or , SV40 early promoter of baculorating simian virus (eg, vector pSG5 (commercially available from Stratagene, La Jolla, Calif., USA)). Another aspect of the invention relates to a host cell into which at least one recombinant DNA described in this paragraph has been introduced.

Another aspect of the invention relates to a method for producing a polypeptide, said method comprising the following steps:
a) transforming a host cell with at least one expression vector described in the paragraph above;
b) culturing the host cell in a suitable medium;
c) recovering the conditioned medium or cell extract;
d) separating and purifying the polypeptide from the medium or from the cell extract obtained in step c);
e) optionally characterizing the produced recombinant polypeptide.

  Recombinant polypeptides thus produced can be obtained by methods known to those skilled in the art, for example, F.I. Purification can be accomplished by passing through a suitable series of chromatography columns according to the method described in Ausubel et al. (2002). An example is the “histidine tag” technique, which is to add a short polyhistidine sequence to the polypeptide to be produced, so that the polypeptide can be purified on a nickel column. This polypeptide can also be produced by in vitro synthetic techniques. As an example of such a technique, the polypeptide is in particular Roche Diagnostics, France S. A. (Rapid Translation System (RTS)) sold by (Melan, France).

Another aspect of the invention relates to a microorganism that produces at least one spiramycin and overexpresses:
A primer pair of the following sequence:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
Furthermore, a gene obtainable by polymerase chain reaction (PCR) using cosmid pSPM36 or total DNA of Streptomyces ambofaciens (more preferably, the gene of SEQ ID NO: 141 which is a coding sequence) as a matrix Or
Genes derived from them due to the degeneracy of the genetic code.

An example of the sequence of such a gene is shown in SEQ ID NO: 111 (DNA); however, this sequence is partial because it does not include the 3 'portion of the corresponding coding sequence. Translation of this portion of the coding sequence into the protein is shown in SEQ ID NO: 112. Those skilled in the art can easily complete it, especially using the teachings described in Example 24. Therefore, in this example, a method for cloning the orf28c gene and a method for producing an expression vector capable of expressing orf28c are shown. This example also shows that overexpression of the orf28c gene in OSC2 strain results in improved spiramycin production in this strain. Preferably,
A primer pair of the following sequence:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
Furthermore, a gene obtainable by polymerase chain reaction (PCR) using cosmid pSPM36 or total DNA of Streptomyces ambofaciens (more preferably, the gene of SEQ ID NO: 141 which is a coding sequence) as a matrix Or
-Genes derived from them due to the degeneracy of the genetic code,
The microorganism that overexpresses is a Streptomyces bacterium, and even more preferably a Streptomyces ambofaciens bacterium. Preferably, the overexpression of the gene is obtained by transformation with an expression vector of the microorganism; most preferably, the microorganism strain is the OSC2 / pSPM75 (1) strain or the OSC2 / pSPM75 (2) strain; These are listed in Collection National de Cultures de Microorganisms (CNCM) [National Collection of Cultures And Microorganisms] Paste Institute, 25, rudu du Doc 75 Deposited at

  Another embodiment of the present invention relates to a method for producing spiramycin using the microorganism described in the above paragraph. This method comprises culturing a microorganism as defined in the above paragraph in an appropriate medium, recovering a conditioned medium or cell extract, and a cell extract obtained from said medium or in a previous step Is to isolate and purify spiramycin produced from Conditions for culturing such microorganisms may be determined according to techniques well known to those skilled in the art. The medium can be, for example, MP5 medium or SL11 medium for Streptomyces, in particular Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may refer to the book by Kieser et al. (2000) in particular regarding the culture of Streptomyces. The spiramycin produced can be recovered using any technique known to those skilled in the art. One skilled in the art may refer to, for example, the technique taught in US Pat. No. 3,000,785, and more particularly the method of extracting spiramycin described in that patent. Optionally, the microorganism used in such a method is a Streptomyces bacterium. More selectively, such microorganisms are S. cerevisiae. Ambofaciens strain.

  In another aspect of the present invention, there is provided a protein in which a polynucleotide having the sequence of SEQ ID NO: 47 or a polynucleotide obtained by degeneracy of the genetic code is encoded by the polynucleotide in Streptomyces ambofaciens. The present invention relates to an expression vector placed under the control of a promoter capable of expressing Examples of expression vectors that can be used in Streptomyces are as indicated above. Optionally, such an expression vector is the plasmid pSPM524 or pSPM525.

  Another aspect of the invention relates to a Streptomyces ambofaciens strain transformed with the vector defined in the paragraph above.

Another aspect of the invention relates to a polypeptide comprising the sequence of SEQ ID NO: 112. The present invention also provides the sequence:
A primer pair of the following sequence:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
In addition, a gene obtainable by polymerase chain reaction (PCR) using cosmid pSPM36 or total DNA of Streptomyces ambofaciens (more preferably, the gene of SEQ ID NO: 141 which is a coding sequence) as a matrix Coding sequence or
The coding sequence of the gene obtained from it due to the degeneracy of the genetic code,
Relates to a polypeptide corresponding to a sequence translated from. Alternatively, these polypeptides are naturally expressed by Streptomyces bacteria, and more selectively, these polypeptides are involved in spiramycin biosynthesis.

  Another aspect of the present invention relates to an expression vector capable of expressing a polypeptide defined in the above paragraph in Streptomyces ambofaciens. Examples of expression vectors that can be used in Streptomyces are as indicated above. Optionally, the expression vector in question is the plasmid pSPM75.

In the attached drawings;
FIG. 1 is the chemical structure of spiramycin I, II and III.
FIG. 2 is a cosmid used to sequence the region.
FIG. 3 shows the composition of genes involved in the biosynthesis pathway of spiramycin.
FIG. 4 is a biosynthetic pathway that is said to be related to mycarose.
FIG. 5 is a biosynthetic pathway that is said to be related to mycaminose.
FIG. 6 is a biosynthetic pathway that is said to be related to forosamine.
FIG. 7 is a preferred sequence of addition of sugars to spiramycin molecules and intermediates.
FIG. It is a biosynthetic pathway that is said to be related to methoxymalonyl in ambofaciens. This route is similar to Streptomyces hygroscopicus ver. Proposed by analogy to methoxymalonyl biosynthesis in Ascomiceticus (K. Wu et al., 2000).

FIG. 9 is a process that causes gene inactivation:
A) E.E. Cloning of the target gene into a vector that replicates in E. coli but not in Streptomyces;
B) Insertion of resistance cassette into the target gene (by cloning or recombination between short identical sequences);
C) Introduction of the plasmid into Streptomyces ambofaciens (by transformation or conjugation with E. coli) and selection of the clone with integrated cassette, followed by vector replacement to include gene replacement Screening for clones with missing parts;
D) A chromosomal region of the mutant strain in which the target gene is inactivated by gene replacement.

FIG. 10 is a step as necessary after gene inactivation by the method described in FIG. 9, and this step may be performed when the excisable cassette is used to interrupt the target gene. ;
E) Introduction of a plasmid pOSV508 carrying a pSAM2 xis and int gene into a mutant strain, the product of which can be efficiently excised by site-specific recombination between attL and the attR sequence flanking the cassette. it can;
F) Production of clones that are sensitive to antibiotics for which the excisable cassette has been lost and for which resistance has been provided by the cassette;
G) After growth and sporulation on solid medium without antibiotics, plasmid pOSV508 is frequently lost. In this way, a clone that is sensitive to thiostrepton can be obtained, in which the target gene contains a deletion within the phase. The sequence of the deleted target gene can be verified by PCR amplification and sequence analysis of the PCR product.

  FIG. 11 is an amplification of a cleavable cassette for use in homologous recombination experiments. The technique of homologous recombination with short homologous sequences has been described by Chaveroche et al. (2000). The 39 or 40 deoxynucleotides located at the 5 ′ end of these oligonucleotides contain sequences corresponding to the sequences of the genes to be inactivated, and the 20 deoxynucleotides located at the extreme 3 ′ positions are: It corresponds to any one of the ends of the cassette that can be cut out.

FIG. 12 is the production of a construct for inactivating a target gene using the technique described by Chaveroche et al., 2000.
FIG. 13 shows plasmid pWHM3. Strepto ori: A map of Streptomyces origin of replication.
FIG. 14 is a map of plasmid pOSV508.
FIG. 15 shows an example of a cassette structure that can be cut out. This is composed of an Ωhyg cassette in which the attR and attL sites are adjacent (Blondelet-Rouault et al., 1997) (Raynal et al., 1998). The cassette can be cut out.
FIG. 16 is a map of plasmid pBXL1111.
FIG. 17 is a map of plasmid pBXL1112.

FIG. 18 is a microbiological test for spiramycin production based on the susceptibility of Micrococcus luteus strains to spiramycin. The Micrococcus luteus strain used is a strain that is naturally sensitive to spiramycin but resistant to congocidine. The various Streptomyces strains to be tested are cultured in 500 ml Aallen-Meyer flasks containing 70 ml of MP5 medium, seeded at an initial concentration of 2.5 × 10 ⁶ spores / ml, shaken at 27 ° C. and rotated at 250 rpm. While growing. After culturing for 48, 72 and 96 hours, a sample of the culture was taken and centrifuged. A 10-fold dilution of these supernatants in sterile medium is used for testing. A Micrococcus luteus indicator strain (Gourmelen et al., 1998) that is resistant to congosin but sensitive to spiramycin was cultured in a 12 x 12 cm square culture dish. A disk of Whatman AA paper was immersed in a 10-fold dilution (70 l) of each supernatant and placed on the surface of the culture dish. Discs (2-4-8 g / ml in MP5 medium) soaked in various concentrations of spiramycin solution were diluted as the standard range. Culture dishes were incubated at 37 ° C. for 24-48 hours. If the disc contains spiramycin, it will diffuse into the agar and inhibit the growth of the Micrococcus luteus indicator strain. This inhibition forms a “ring” around the disk, which indicates the area where the Micrococcus luteus strain did not grow. The presence of this ring is therefore an indicator of the presence of spiramycin and The ambofaciens strain makes it possible to determine whether it is a spiramycin producer or not. By comparing the diameters of inhibition obtained in the standard range, it is possible to obtain an indication of the amount of spiramycin produced by this strain.

FIG. 19 is an HPLC chromatogram of the filtered medium supernatant of OSC2 strain.
FIG. 20 is an HPLC chromatogram of the filtered medium supernatant of SPM501 strain.
FIG. 21 is an HPLC chromatogram of the filtered medium supernatant of SPM502 strain.
FIG. 22 is an HPLC chromatogram of the filtered medium supernatant of SPM507 strain.
FIG. 23 is an HPLC chromatogram of the filtered medium supernatant of SPM508 strain.
FIG. 24 is an HPLC chromatogram of the filtered medium supernatant of SPM509 strain.
FIG. 25 shows ORF3 protein (SEQ ID NO: 29) obtained using the FASTA program and Alignment with the Fradiae TylB protein (SEQ ID NO: 87).
FIG. 26 shows the S. cerevisiae obtained using the FASTA program. It is alignment with the MdmA protein (sequence number 88) of mycalofaciens, and SrmD protein (sequence number 16).

FIG. 27 shows an example of a remaining part sequence after a cassette that can be cut out is cut out. The minimal att26 site defined by Raynal et al. (1998) is shown in bold. The 33 nucleotide phase 1 sequence (att1) is shown in SEQ ID NO: 104, the 34 nucleotide phase 2 sequence (att2) is shown in SEQ ID NO: 105, and the 35 nucleotide phase 3 sequence. (Att3) is shown in SEQ ID NO: 95.
FIG. 28 is a diagrammatic representation of the orf10 gene, the location of the PCR primers used, and the constructs obtained using each primer pair.
FIG. 29 shows the construction of the cassette pac-oritT.
FIG. 30 is a map of cosmid pWED2.

31 shows a group of genes involved in the biosynthesis pathway of spiramycin; FIG. 3 is a diagrammatic representation of the position of the three probes used to isolate the cosmid of the genomic DNA library of Streptomyces ambofaciens OSC2 strain in E. coli (see Example 19).
FIG. FIG. 4 is the position of the cosmid insert isolated from the genomic DNA library of Streptomyces ambofaciens strain OCS2 in E. coli (see Example 19). New cosmid DNA library.
FIG. 33 shows subcloning of the PstI-PstI fragment of cosmid pSPM36 (insert of plasmid pSPM58), subcloning of the StuI-StuI fragment of cosmid pSPM36 (insert of plasmid pSPM72), and subcloning of EcoRI-StuI (insert of plasmid pSPM73). is there.

FIG. 34 is the position of the open reading frame identified in the PstI-PstI insert of plasmid pSPM58 and the EcoRI-StuI insert of plasmid pSPM73.
FIG. 35 shows juxtaposition of HPLC chromatograms of filtered media supernatants of OS49.67 strain obtained at 238 nm and 280 nm (top) and UV spectra of molecules eluted at 33.4 and 44.8 min ( Bottom).

FIG. 36 shows the molecular structure of platenolide A and platenolide B molecules.
FIG. 37 shows the composition of genes involved in the biosynthesis pathway of spiramycin.
FIG. 38 is the molecular structure of the biosynthetic intermediate produced by SPM507 strain.
FIG. 39 shows the S. cerevisiae of genotype orf6 ^* :: att1Ωhyg + obtained from a strain overproducing spiramycin. It is the structure of a biosynthetic intermediate produced by an ambofaciens strain. Insertion of cassette att1Ωhyg + into orf6 ^* affects the polarity effect, thereby inhibiting the expression of orf5 ^* .

FIG. 40 is the molecular structure of platenolide A + mycarose and platenolide B + mycarose molecules produced by the OS49.67 strain.
FIG. 41 is the subcloning of the PstI-PstI fragment of cosmid pSPM36 (insert of plasmid (pSPM79)), the position of the open reading frame identified in the PstI-PstI insert of plasmid pSPM79, and the position of the sequence of SEQ ID NO: 140. .

  The present invention is illustrated using the following examples, which are to be regarded as non-limiting illustrations.

  In summary, genes for the spiramycin biosynthetic pathway were isolated from a Streptomyces ambofaciens genomic DNA library. This library was obtained by partial digestion of Streptomyces ambofaciens genomic DNA with BamHI restriction enzyme. An average 35-45 kb large DNA fragment was cloned into cosmid pWED1 obtained from cosmid pWED15 (Wahl et al., 1987) (Gourmelen et al., 1998). These cosmids were transformed into E. coli using phage particles. Introduced in Kori. The library thus obtained and A probe (sequence of SEQ ID NO: 86) corresponding to a portion of the Fradiae tylB gene (Merson-Davies and Cundlife, 1994, GenBank accession number: U08223) was hybridized. More specifically, after hybridization, one cosmid was selected from the four cosmids hybridized with the probe. Next, this cosmid was named pOS49.1, subsequently digested with SacI, and a 3.3 kb fragment containing the region hybridized with the probe was subcloned into the vector pUC19 and sequenced. Four open reading frames were identified, one of which was S. cerevisiae. It encodes a protein (SEQ ID NO: 29) that exhibits strong sequence similarity to the Fradiae TylB protein (SEQ ID NO: 87) (see FIG. 25). This gene was named orf3 (SEQ ID NO: 28) and S. cerevisiae. Inactivated in ambofaciens. It was possible to demonstrate that the clone in which the orf3 gene was inactivated does not produce spiramycin. This indicates the involvement of the orf3 gene or a gene located downstream in spiramycin biosynthesis.

  Once this was confirmed, the larger region of cosmid pOS49.1 was sequenced and either end of the SacI fragment was studied in advance. Thus, from cosmid pOS49.1, the sequence of the region containing the entire seven open reading frames and the other two incomplete open reading frames located at either end of these seven open reading frames. Could get. By searching the database, it was possible to show that one of the incomplete open reading frames corresponds to the srmG locus (region encoding the enzyme (PKS) called “polyketide synthase”). The corresponding gene is Have been subcloned by Burgett et al. (1996) (US Pat. No. 5,945,320). In addition, the entire seven ORFs of the other open reading frames, orf1, orf2, orf3, orf4, orf5, orf6, and orf7 (SEQ ID NOs: 23, 25, 28, 30, 34, 36, 40), and orf8 The beginning of the 8th ORF (sequence of SEQ ID NO: 43) was not found in the database.

Subsequently, S. in this same region for the purpose of cloning other genes involved in spiramycin biosynthesis. Other cosmids containing fragments of the ambofaciens genome were isolated. For this purpose, a further series of hybridizations was performed on the colonies using three probes. The first probe corresponds to a 3.7 kb DNA fragment containing the start of orf1, orf2, and orf3 subcloned from pOS49.1. The second probe corresponds to a 2 kb DNA fragment containing the orf7 and orf8 parts subcloned from pOS49.1. A third probe was also used. This latter probe corresponds to a 1.8 kb DNA fragment containing the srmD gene. The srmD gene is capable of conferring spiramycin resistance. It is a gene isolated from ambofaciens. In particular, in previous studies, S. Cloning several resistance determinants of ambofaciens It is possible to confer resistance to spiramycin to a S. grieseofuscus strain (a spiramycin sensitive strain) (Pernodet et al., 1993) (Per
nodeet et al., 1999). In order to isolate the resistance gene, cosmid pKC505 was transformed into S. cerevisiae. A cosmid library of genomic DNA of the ambofaciens strain was produced (Richardson MA et al., 1987). This pool of cosmids is naturally associated with S. cerevisiae that is sensitive to spiramycin. It was introduced into Griseo offuscus. In this way, S.I. Five cosmids were obtained that could confer apramycin resistance and spiramycin resistance in Griseocuscus. Among these five cosmids, the cosmid of pOS44.1 contains a srmD gene in its insert, which is encoded by the mdmA gene of Streptomyces mycalofaciens and is resistant to midecamycin resistance in this producing organism. It encodes a protein that shows some similarity to the protein involved (Hara et al., 1990, GenBank accession number: A60725) (FIG. 26). The third probe used to confirm the location of the spiramycin biosynthetic gene was an approximately 1.8 kb insert containing the srmD gene.

  Use these three probes to hybridize the genomic DNA library described above and select the two cosmids (pSPM7 and pSPM5) that tend to contain the longest inserts and do not have a common band Made possible. Cosmid pSMP5 was hybridized with the first and second probes, but not with the third probe, while cosmid pSPM7 was hybridized only with the third probe. These two cosmids were completely sequenced using the “shotgun sequence analysis” technique. Since the sequences of the inserts of these two cosmids: pSPM7 and pSPM5 do not overlap, but each insert contains a known sequence at one of its ends, the sequences of these inserts could be assembled. In particular, each of these inserts contained a fragment of any one sequence of a gene encoding an enzyme called “polyketide synthase” (PKS). These five genes are designated S. It was cloned by Burgett et al. (1996) (US Pat. No. 5,945,320) (see FIG. 2). Thus, a single S.P. The genomic DNA sequence of ambofaciens could be determined. The sequence of 30943 nucleotides ranging from the EcoRI site located in the first PKS gene at the 5 'position to the BamHI site at the 3' position is shown in SEQ ID NO: 1. This sequence corresponds to the region upstream of the PKS gene (see FIGS. 2 and 3). A second region of 11171 nucleotides ranging from the PstI site at position 5 'to the BstEII site at position 3' located in the fifth PKS gene is shown in SEQ ID NO: 2. This region is the downstream region of the PKS gene (downstream and upstream are defined in the direction of the five PKS genes or face the same direction) (see FIGS. 2 and 3).

  Next, in order to clone other genes involved in spiramycin biosynthesis, S. Other cosmids containing fragments of the ambofaciens genome were isolated (see Examples 18 and 19).

Example 1 Construction of genomic DNA library of Streptomyces ambofaciens strain ATCC 23877 in E. coli
1.1. Extraction of genomic DNA of Streptomyces ambofaciens strain ATCC 23877 Obtained from Streptomyces ambofaciens strain ATCC 23877 (particularly American Type Culture Collection, ATCC (Manassas, VA, USA), number 23877 Possible) was cultured in YEME (yeast extract-malt extract) (Kieser, T, et al .; 2000), the genomic DNA of this strain was extracted and purified according to standard techniques of lysis and precipitation (Kieser T Etc., 2000).

1.2. Construction of genomic DNA library Partially digested genomic DNA of Streptomyces ambofaciens strain ATCC 23877 isolated above with BamHI restriction enzyme so as to obtain a DNA fragment having a size of about 35 to 45 kb. did. These fragments were cloned into cosmid pWED1 (Gounnelen et al., 1998) previously digested with BamHI. Cosmid pWED1 was obtained from cosmid pWE15 (Wahl et al., 1987) by deleting a 4.1 kb HpaI-HpaI fragment (Gounnelen et al., 1998) containing an expression module active in mammals. Then, by using according to the manufacturer's instructions to "Packagene ^(R) lambda DNA packaging system" marketed by Promega were encapsidated lambda phage particles The ligation mixture in vitro. The obtained phage particles were treated with E. coli. It was used to infect the SURE® strain of E. coli ⁽ commercially available from Stratagene (La Jolla, Calif., USA)). Since cosmid pWED1 confers ampicillin resistance, clones were selected with LB medium + ampicillin (50 μg / ml).

Example 2: Isolation and characterization of genes involved in spiramycin biosynthesis in Streptomyces ambofaciens
2.1. The genomic library of Streptomyces ambofaciens ATCC 23877 Colony hybridization of E. coli clones About 2,000 E. coli libraries obtained above. Coli clones were transferred to colony hybridization filters. The probe used for hybridization is a NaeI-NaeI DNA fragment (SEQ ID NO: 86) containing a portion of the tylB gene of Streptomyces fradiae. This fragment is the A. Merson-Davies and E.I. It corresponds to nucleotides 2663-3702 of the DNA fragment described by Cundlife (LA Merson-Davies and E. Cundlife, 1994, GenBank accession number: U08223), in which the coding sequence of the tylB gene is nucleotide 2677 Corresponds to ~ 3843.

A NaeI-NaeI DNA fragment having a portion of the Stylomyces fradiae tylB gene (SEQ ID NO: 86) was labeled with ³² P using random priming technology (a kit marketed by Roche). As a probe, 2000 clones of the library were hybridized and transferred to a filter. The membrane used is a Hybond N nylon membrane marketed by Amersham (Amersham Biosciences, Orsay, France), hybridization at 55 ° C., Church and Gilbert (Church And in the buffer described by Gilbert, 1984). Washing was performed in 2 × SSC at 55 ° C. for 15 minutes, followed by washing twice in 0.5 × SSC at 55 ° C. for 15 minutes each. Under these hybridization and washing conditions, 4 out of 2000 hybridized clones showed strong hybridization signals. These four clones were cultured in LB medium + ampicillin (50 μg / ml) and the corresponding four cosmids were extracted by standard alkaline lysis (Sambrook et al., 1989). Next, it was confirmed that the hybridization was actually due to DNA fragments present in the inserts of these four cosmids. For this, cosmids were digested independently with several enzymes (BamHI, PstI and SacI). Digested products were separated on an agarose gel, transferred onto a nylon membrane, and hybridized with the NaeI-NaeI DNA fragment containing the Stylomyces fradiae tylB gene (see above) under the same conditions as described above. Four cosmids could be identified, more specifically, one of these cosmids was selected and named pOS49.1.

2.2. Confirmation of the involvement of the identified region and sequence analysis of the insert of cosmid pOS49.1 Several fragments of the insert of cosmid pOS49.1 were subcloned and their sequences determined. Cosmid pOS49.1 was digested with the SacI enzyme and Southern blotting under the conditions described above showed that the 3.3 kb fragment contained a region that hybridized with the tylB probe. This 3.3 kb fragment was isolated by electroelution from a 0.8% agarose gel and subsequently cloned into the vector pUC19 (GenBank accession number: M77789) and sequenced. The plasmid thus obtained was named pOS49.11. Four open reading frames showing codon usage typical of Streptomyces could be identified in this fragment using the FramePlot program (J. Ishikawa and K. Hotta, 1999) (two complete And two truncated open reading frames). By sequence comparison using the FASTA program (see WR Pearson and D. J Lipman, 1988 and WR Pearson, 1990, in particular, available from the INFOBIOGEN resource center (Evry, France)) Proteins inferred from one of these four open reading frames are S. cerevisiae. It could be shown to show strong sequence similarity with the Fradiae TylB protein (SEQ ID NO: 87; GenBank accession number: U08223) (see FIG. 25). This protein was named orf3 (SEQ ID NO: 29).

  In order to test whether the corresponding gene (orf3 gene (SEQ ID NO: 28)) is involved in spiramycin biosynthesis, this gene was transformed into the Ωhgy cassette (MH Blinderet-Rouault et al., 1997, GenBank). It was interrupted with the deposit number: X99315). To this end, plasmid pOS49.11 is digested with XhoI enzyme and contains four open reading frames (two complete and two truncated open reading frames, including orf3 in their entirety). The fragment was subcloned into the XhoI site of the vector pBC SK + (commercially available from Stratagene (La Jolla, Calif., USA)). The plasmid thus obtained was named pOS49.12. In order to inactivate orf3, the PmlI-BstEII fragment in orf3 was replaced with an Ωhyg cassette by blunt ended cloning into the latter plasmid. For this purpose, plasmid pOS49.12 was digested with PmlI and BstEII enzymes (the unique site for which is in the coding sequence of the orf3 gene). The end of the fragment corresponding to this vector was blunt-ended by treatment with Klenow enzyme (DNA polymerase I large fragment). The plasmid pHP45Ωhyg (Blondelet-Rouault et al., 1997, GenBank accession number: X99315) was digested with BamHI enzyme to obtain an Ωhyg cassette. The fragment corresponding to the Ωhyg cassette was recovered on an agarose gel, and the ends were blunted by treatment with Klenow enzyme. The two blunt-ended fragments thus obtained (Ωhyg cassette and plasmid pOS49.12) were ligated and E. coli was used with the ligation product. E. coli bacteria were transformed. The plasmid thus obtained is named pOS49.14, which contains the orf3 gene interrupted with the Ωhyg cassette.

  The insert of plasmid pOS49.14 in XhoI-XhoI fragment form (ends made non-adhesive by treatment with Klenow enzyme) was cloned into the EcoRV site of plasmid pOJ260 (plasmid pOJ260 replicated in E. coli). A conjugative plasmid that can, but cannot replicate in S. ambofaciens (M. Bierman et al., 1992. This plasmid confers apramycin resistance to E. coli and Streptomyces). The resulting plasmid (the insert of plasmid pOS49.14 was cloned into plasmid pOJ260) was named pOS49.16. The latter was joined to the joined E. coli described by Mazodier et al. By S. coli strain S17-1 (Mazodier et al., 1989). Transferred to ambofaciens strain ATCC 23877. E. E. coli strain S17-1 is a strain of E. coli. From strain E. coli 294 (Simon et al., 1983) (Simon et al., 1986). It was possible to obtain a complete zygote clone having a hygromycin resistance marker contained in the Ωhyg cassette and having lost the apramycin resistance marker vector contained in pOJ260. For this purpose, after conjugation, clones were selected for their hygromycin resistance. Next, the hygromycin resistant clones were subcultured in a hygromycin (antibiotic B) -containing medium and an apramycin (antibiotic A) -containing medium, respectively (see FIG. 9). A clone that is resistant to hygromycin (HygR) and a clone that is sensitive to apramycin (ApraS), in principle, have an orf3 interrupted with the Ωhyg cassette due to a double recombination event. A clone having a gene. Replacement of the wild-type copy of orf3 with the interrupted copy was confirmed by two consecutive hybridizations. Therefore, in order to confirm that the cassette is present in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with various enzymes, separated on an agarose gel, transferred onto a membrane, Hybridized with a probe corresponding to the Ωhyg cassette (see above). Using XhoI-XhoI of plasmid pOS49.11 containing 4 open reading frames (2 complete open reading frames and 2 truncated open reading frames, including orf3 in its entirety) as a probe Second hybridization was performed. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products. One of the orf3 :: Ωhyg clones obtained in this way and whose genotype was confirmed was selected and named OS49.16.

  The spiramycin production of the OS49.16 clone thus obtained was tested using the production test described below (see Example 15). In this way, it was possible to demonstrate that this strain no longer produces spiramycin, confirming the involvement of orf3 and / or downstream genes (eg orf4) in spiramycin biosynthesis.

  Once this was confirmed, a larger region of cosmid pOS49.1 was sequenced at either end of the previously studied SacI fragment. Thus, from cosmid pOS49.1, obtain the sequence of the region containing the entire seven open reading frames and the other two incomplete open reading frames located at either end of these seven open reading frames. I was able to. A database search indicated that one of the incomplete open reading frames corresponds to the srmG locus (region encoding the enzyme (PKS) called “polyketide synthase”). The corresponding gene is designated S. It was cloned by Burgett et al. (1996) (US Pat. No. 5,945,320). In addition, the other open reading frame: the entire seven ORFs (named orf1, orf2, orf3, orf4, orf5, orf6, and orf7 (SEQ ID NOs: 23, 25, 28, 30, 34, 36 and 40)), and The start of the 8th ORF, orf8 (the complete sequence of this orf is shown in SEQ ID NO: 43) was not found in the database.

Example 3: Isolation and characterization of other genes involved in spiramycin biosynthesis in Streptomyces ambofaciens Secondly, for the purpose of cloning other genes involved in spiramycin biosynthesis S. in the region. Other cosmids containing fragments of the ambofaciens genome were isolated. To this end, a further series of colony hybridizations were performed using 3 probes.

  The first probe used was a fragment of the PKS gene (the gene corresponding to PKS was cloned by S. Burgett et al. (1996) (US Pat. No. 5,945,320)), orf1, orf2 And a 3.7 kb BamHI-PstI DNA fragment containing the start of orf3, which is subcloned from pOS49.1 and 1300 upstream of the EcoRI site designated position 1 of SEQ ID NO: 1. This range is from the BamHI site located at the base pair to the PstI site located at position 2472 (SEQ ID NO: 1). This BamHI-PstI fragment was subcloned from pOS49.1 into plasmid pBCSK +, resulting in plasmid pOS49.28.

  The second probe used corresponds to an approximately 2 kb PstI-BamHI DNA fragment containing the fragments of orf7 and orf8, which is subcloned from pOS49.1 and located at position 6693 of SEQ ID NO: 1 The range is from the PstI site to the BamHI site located at position 8714 of SEQ ID NO: 1. This PstI-BamHI fragment was subcloned from pOS49.1 into plasmid pBCSK +, resulting in plasmid pOS49.76.

  -A third probe was also used. This corresponds to a 1.8 kb EcoRI-HindIII DNA fragment containing the srmD gene. The srmD gene is capable of conferring spiramycin resistance. It is a gene isolated from ambofaciens. In particular, due to previous studies, S. Cloning several resistance determinants of ambofaciens; It is possible to confer resistance to spiramycin (Pernodet et al., 1999) on a Griseo offus strain (Spiramycin sensitive strain) (Pernodet et al., 1993). In order to isolate the resistance gene, the A genomic DNA cosmid library of the ambofaciens strain ATCC 23877 was produced with cosmid pKC505 (MA Richardson et al., 1987). For this purpose, S. cerevisiae is obtained so that fragments of about 30-40 kb are obtained. The genomic DNA of ambofaciens strain ATCC 23877 was partially digested with Sau3AI. The digested genomic DNA (3 μg) was ligated with pKC505 (1 μg) (Pernodet et al., 1999) previously digested with BamHI enzyme. This ligation mixture was then encapsidated into phage particles in vitro. Using the obtained phage particles, E. coli was used. E. coli strain HB101 was infected (particularly available under the number 33694 from American Type Culture Collection (ATCC) (Manassas, VA, USA)). About 20000 apramycin resistant E. coli Coli clones were pooled and the cosmids of these clones were extracted. This pool of cosmids is naturally associated with S. cerevisiae that is sensitive to spiramycin. Glyceofus sp. Strain DSM10191 (KL Cox and RH Baltz, 1984) (RN Rao et al., 1987, this strain is notably German Collection of Microorganisms and Cell Cultures (Deutsche Sammulv). und zeilkulturen GmbH, DSMZ) (available from Braunschweig, Germany) under the number DSM10191). Transformants were selected on medium containing apramycin. 1300 clones growing on medium containing apramycin were transferred onto medium containing 5 μg / m spiramycin. Several apramycin resistant clones were also grown in medium containing spiramycin and the cosmids of these colonies were extracted. Coli and S. Used to transform Griseocuscus (Pernodet et al., 1999). In this way, E.I. Apramycin resistant to S. coli, and S. cerevisiae Five cosmids capable of conferring co-resistance to apramycin and spiramycin were obtained on Griseocuscus. Among these five cosmids, a cosmid of pOS44.1 has a protein (sequence which shows a certain degree of similarity to the protein encoded by the mdmA gene of Streptomyces mycarofaciens (SEQ ID NO: 88) in its insert. Was determined to contain the gene (SEQ ID NO: 15) encoding this and was named srmD (see the alignment shown in FIG. 26, which is the PASTA program (WR Pearson and DJ. See, Lipman, 1988, and WR Pearson, 1990, especially using the INFOBIOGEN resource center (Evry, France).

  In order to isolate the resistance determinants contained in plasmid pOS44.1, the latter was partially digested with Sau3AI restriction enzyme to obtain a fragment of about 1.5-3 kb in size, and these fragments were digested with BamHI enzyme. Was ligated into the vector pU486 linearized with (Ward et al., 1986). The plasmid was naturally transformed into S. pneumoniae that is sensitive to spiramycin. It was selected for its ability to confer resistance to spiramycin in Griseocus sp. Strain DSM10191 (see above) (RN Rao et al., 1987). For this purpose, a pool of plasmids (see above) corresponding to the Sau3AI fragment of pOS44.1 ligated into the vector pU486 was introduced by protoplast transformation into the DSM10191 strain, and the transformants were resistant to their thiostrepton resistance. Selected for (depending on the tsr gene of pU486). Clones growing on thiostrepton containing medium were transferred to medium containing spiramycin. In addition, several thiostrepton resistant clones grew on a medium containing spiramycin, and plasmids of these colonies were extracted. A plasmid conferring resistance and containing an approximately 1.8 kb insert was selected and designated pOS44.2. This 1.8 kb insert can be easily excised by the HindIII and EcoRI sites present at either end of the insert in the vector. The 1.8 kb HindIII-EcoRI insert was sequenced and the resistance gene containing it was named srmD. In this way, the fragment containing the srmD gene can be easily subcloned into the vector pUC19 (GenBank accession number: M77789) opened with EcoRI-HindIII, and the resulting plasmid is called pOS44.4. Named. The position of the spiramycin biosynthetic gene was confirmed using the 1.8 kb HindIII-EcoRI insert containing the srmD gene of this plasmid as a probe (see below).

A sample of Escherichia coli DH5a strain containing plasmid pOS44.4 can be obtained from Collection Nationale de Cultures de Microorganisms [National Collection of Cultures.
And Microorganisms] (CNCM) Pasture Institute, 25, ru du Ducteur Roux 75724, Paris Cedex 15, France, deposited on July 10, 2002, with registration number I-2918.

  Approximately 2000 clones of the library obtained above (see Example 1) were transferred onto colony hybridization filters according to the prior art (Sambrook et al., 1989).

The above three probes are labeled with ³² P using random priming technology (a kit marketed by Roche), which is used to hybridize 2000 clones of the library and transfer them onto the filter. did. Hybridization was performed at 65 ° C. in a buffer described by Church and Gilbert (Church and Gilbert, 1984). Washing was performed in 2 × SSC at 65 ° C. for 15 minutes, followed by two consecutive washes in 0.5 × SSC at 65 ° C. for 15 minutes each. Under these hybridization and washing conditions, 16 out of 2000 hybridized clones showed strong hybridization signals with at least one probe. However, no cosmid hybridized with the three probes. Sixteen cosmids were extracted and digested with BamHI restriction enzyme. By comparing the restriction profiles of each of these various cosmids with each other, two cosmids that could contain the longest region insert and did not have a common band were selected. Thus, two cosmids were selected, one named pSPM5 and the other named pSPM7. Cosmid pSPM5 was hybridized with probes orf1-orf4 and probe orf8, but not hybridized with probe srmD. pSPM7 was hybridized only with the probe srmD but not with the other two probes.

  These two cosmids were completely sequenced using the “shotgun sequence analysis” technique. The sequences of the inserts of these two cosmids: pSPM7 and pSPM5 are non-overlapping, but because each insert contains a known sequence at one of its ends, they could be assembled. In particular, each of these inserts contained a fragment of any one sequence of a gene encoding an enzyme called “polyketide synthase” (PKS). These five genes are designated S. It was cloned by Burgett et al. (1996) (US Pat. No. 5,945,320) (see FIG. 2). Thus, a single S.P. The genomic DNA sequence of ambofaciens could be determined. The sequence of 30943 nucleotides ranging from the EcoRI site located in the first PKS gene at position 5 'to the BamHI site at position 3' is shown in SEQ ID NO: 1. This sequence corresponds to the region upstream of the PKS gene (see FIGS. 2 and 3). The second region of 11171 nucleotides ranges from the PstI site at position 5 'to the Ncol site at position 3' located in the fifth PKS gene, which is shown in SEQ ID NO: 2. This second region is the downstream region of the PKS gene (downstream and upstream are defined by the directions of five PKS genes all pointing in the same direction) (see FIGS. 2 and 3).

Example 4: Analysis of nucleotide sequences of genes involved in spiramycin biosynthesis, determination of open reading frames, and characterization of the resulting sequences using the FramePlot program (J. Ishikawa and K. Hotta, 1999) And analyzed. As a result, among the open reading frames, it was possible to identify an open reading frame indicating the use of a codon typical for Streptomyces. This analysis allowed this region to be determined to contain 35 ORFs located at either end of the five genes encoding the enzyme “polyketide synthase” (PKS). 10 and 25 ORFs were identified downstream and upstream of these genes, respectively (downstream and upstream are defined by the orientation of five PKS genes all pointing in the same direction) (see FIG. 3). Thus, 25 open reading frames (SEQ ID NO: 1 and FIG. 3) occupying an approximately 31 kb region of this type were identified upstream of 5 PKS genes and 10 open reading frames occupying an approximately 11.1 kb region. (SEQ ID NO: 2 and FIG. 3) was identified downstream of the PKS gene. The upstream region genes were named as follows: orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14, orf15c, orf16, orf17, orf18, orf19 , Orf20, orf21c, orf22c, orf23c, orf24c, and orf25c (SEQ ID NOs: 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68 70, 72, 74, 76, 78, 80, 82, and 84). The genes in the downstream region were named as follows: orf1 ^* c, orf2 ^* c, orf3 ^* c, orf4 ^* c, orf5 ^* , orf6 ^* , orf7 ^* c, orf8 ^* , and orf9 ^* , orf10 ^* ( SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21). “C” appended to the name of the gene indicates that the coding sequence is reversed with respect to the ORF in question (and thus the coding strand is complementary to the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 for these genes) (See FIG. 3).

  Using various programs, the protein sequences deduced from these open reading frames were compared to protein sequences present in various databases: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search , COG (Cluster of Orthologous Groups) (these three programs are especially available from the National Center for Biotechnology Information (NCBI) (Bethesda, MD, USA)), FASTA (WR Pearson and DJ Lipman, 1988, and WR Pearson, 1990), BEAUTY (KC Worley et al., 1995)) (these two programs are in particular INFOBIOGE (Available from the Resource Center (Evry, France)); these comparisons can compile hypotheses about the function of the products of these genes and identify genes that may be involved in spiramycin biosynthesis It became possible.

Example 5: Gene inactivation: Construction principle of knocked out Streptomyces ambofaciens strain The method used was to perform gene replacement. The target gene to be interrupted is replaced with a copy of this gene interrupted with a cassette conferring resistance to antibiotics (eg, apramycin or hygromycin) (as explained in FIG. 9). The cassette used is adjacent to either end of the translation stop codon of all reading frames and to either end of a transcription terminator active in Streptomyces.

  Insertion of the cassette into the target gene may or may not be accompanied by this target gene deletion. The size of the region adjacent to the cassette can range from hundreds to thousands of base pairs.

  The constructs required for gene inactivation in the cassette are E. coli (reference organism for obtaining recombinant DNA construct). The interrupted gene is designated as E. coli. A plasmid was obtained that replicated in E. coli but not replicated in Streptomyces.

Next, S.M. This construct was subcloned into a vector to allow transformation and inactivation of the desired gene in ambofaciens. For this, two plasmids were used:
POJ260 (M. Bierman et al., 1992) (see Example 2) In Escherichia coli, it imparted resistance to apramycin and streptomyces, and was used when the target gene was interrupted with a cassette conferring resistance to hygromycin.

-POSK1205 (4726 bp). This plasmid is obtained from plasmid pBK-CMV (commercially available from Stratagene (La Jolla, Calif., USA)), in which the AvrII fragment containing the sequence encoding neomycin / kanamycin resistance is hygromycin. The PSV40 promoter is conserved while being replaced with a sequence encoding resistance. For this purpose, the plasmid pHP45-Ωhyg (Blondelet-Rouault et al., 1997) was digested with NotI and PflmI enzymes, and the fragment conferring hygromycin resistance was blunt-ended by treatment with Klenow enzyme at all ends. Subsequently, it was subcloned into the AvrII site of the vector pBK-CMV. In pOSK1205, the cassette conferring hygromycin resistance is placed in front of the pSV40 promoter. This plasmid is E. coli. Used to confer hygromycin resistance to E. coli and Streptomyces and the target gene was interrupted with a cassette conferring apramycin resistance.

  This cassette can be cloned either by cloning using restriction sites present in the target gene or by recombination between short identical sequences as described, for example, Chaveroche et al. (MK Chaveroche et al., 2000). , Introduced into the target gene.

  Next, a plasmid having a gene interrupted by the cassette is, for example, E. coli. It can be introduced into Streptomyces ambofaciens by joining Kori and Streptomyces (P. Mazodier et al., 1989). This technique was used when the underlying vector was vector pOJ260. Second technique: To increase the frequency of recombination, a protoplast transformation technique (T. Kieser et al .; 2000) after denaturation of DNA by alkaline treatment may be used, for example, Oh and Chater. (Oh and Chater, 1997). This technique was used when the underlying vector was pOJ260 or pOSK1205 (see below). Next, a transformant is selected using an antibiotic corresponding to the cassette present in the target gene (see FIG. 9, antibiotic B). In this way, a mixture of clones in which integration by one or two recombination events has occurred is selected. Next, clones that are sensitive to antibiotics (see Figure 9, antibiotic A) in which the resistance gene is present in the vector (outside the recombination cassette) are searched. In this way, it is possible to select a clone in which two recombination events have occurred in principle and substitution with a copy interrupted with a cassette of the wild type gene has occurred. These steps are illustrated in FIG.

  Several cassettes can be used to interrupt the target gene. For example, an Ωhyg cassette (Blondelet-Rouault et al., 1997, GenBank accession number: X99315) conferring hygromycin resistance can be used.

Example 6: Construction of a Streptomyces ambofaciens strain knocked out in phase in the orf3 gene When the Ωhyg cassette is interrupted in the orf3 gene (see Example 2.2), the orf3 :: Ωhyg strain becomes the Spira. It can be demonstrated that it does not produce mycin, thereby confirming that one or more genes in the cloned region are involved in spiramycin biosynthesis (see Example 2.2). For those orientations, co-transcription of ORFs 1-7 is considered (see FIG. 3), and the observed phenotype (non-producer of spiramycin) is the absence of one or more genes co-transcribed with orf3. It may be due to activation. In order to confirm the involvement of orf3 in spiramycin biosynthesis, further inactivation of the orf3 gene was performed, and the latter inactivation was performed within the phase. For this purpose, the DraIII fragment inside orf3 consisting of 504 base pairs was deleted. The DNA fragment obtained from pOS491 ranges from the EcoRI site located at position 1 (SEQ ID NO: 1) to the SacI site located at position 5274 (SEQ ID NO: 1). This DNA fragment was cloned into plasmid pOJ260 (M. Bierman et al., 1992), containing a deletion between the DraIII sites (504 nucleotides removed). The plasmid thus obtained was named pOS49.67.

Therefore, the insert of pOS49.67 contains an orf1 gene, an orf2 gene, an orf3 gene (including deletion within the phase), an orf4 gene, and an orf5 portion. It consists of DNA fragments of ambofaciens. The vector i into which this insert was subcloned was pOJ260, therefore plasmid pOS49.67 confers apramycin resistance and was introduced into strain OS49.16 by protoplast transformation (see Example 2). Since strain OS49.16 is hygromycin resistant, hygR and apraR transformants were obtained. After such clones were passaged twice in non-selective medium, clones sensitive to apramycin and hygromycin (apraS and hygS) were searched. In some of these clones, in fact, due to recombination events between homologous sequences, the Ωhyg cassette (included in the genome of the OS49.16 strain) is a copy of orf3 containing a deletion within the phase present in the vector. It is expected that replacement of the copy of orf3 interrupted at The clone resulting from this recombination is expected to be apraS and hygS after removing the vector sequence. The genotype of the strain thus obtained can be confirmed by hybridization or PCR and PCR product sequence analysis (for clones from which only one copy of orf3 deleted within the phase was obtained). To confirm that it exists in the genome). In this way, clones with only one copy of orf3 with intraphase deletions were obtained and their genotype was confirmed. A clone showing the desired characteristics was selected more specifically and named OS49.67.

The sample of OS49.67 strain is Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur.
Deposited at Institute, 25, ru du Document Roux 75724 Paris Cedex 15, France on July 10, 2002, with registration number I-2916.

Example 7: Construction of Streptomyces ambofaciens strain containing knockout in orf8 gene In order to inactivate the orf8 gene, a construct in which the Ωhyg cassette was introduced into the coding sequence of orf8 was obtained. For this purpose, firstly the plasmid pOS49.88 was constructed. Plasmid pOS49.88 is obtained by insertion of a 3.7 kb fragment (the PstI-EcoRI fragment obtained from cosmid pSPM5) containing the end of orf7, orf8, and the start of orf9 from plasmid pUC19 (GenBank accession number: M77789). This was cloned into the PstI-EcoRI site of pUC19. “Ωhyg cassette (form of BamHI fragment blunt-ended by treatment with Klenow enzyme), blunt-ended all ends by treatment with Klenow enzyme, and then cloned into pOS49.88 unique SalI site located in orf8 did.

  Due to the blunt end of the cloning, two types of plasmids were obtained depending on the insertion direction of the cassette: pOS49.106 (hyg and orf8 genes in the same direction) and pOS49.120 (hyg and orf8 genes in opposite directions) ). Next, the insert of plasmid pOS49.106 was subcloned into plasmid pOJ260, resulting in pOS49.107. To this end, plasmid pOS49.106 was digested with Asp718I enzyme and the ends were blunted by treatment with Klenow enzyme; the digested product was re-digested with PstI enzyme and the orf8 gene with the Ωhyg cassette inserted. The containing fragment was cloned into vector pOJ260 (see above). For this, the vector pOJ260 was digested with EcoRV and PstI enzymes and used for ligation. Therefore, by this operation, each of the two fragments was able to obtain an oriented ligation because one was blunt ended and the other was PstI. The resulting plasmid was named pOS49.107.

  Plasmid pOS49.107 was transformed into S. cerevisiae by protoplast transformation. Introduced into the ambofaciens strain ATCC 23877 (T. Kieser et al., 2000). After protoplast transformation, clones are selected for their hygromycin resistance. Next, the hygromycin resistant clones are subcultured in a medium containing hygromycin (antibiotic B) and a medium containing apramycin (antibiotic A), respectively (see FIG. 9). A clone resistant to hygromycin (HygR) and a clone sensitive to apramycin (ApraS), in principle, had a double crossover during the event and was interrupted with the Ωhyg cassette. A clone containing the orf8 gene. Replacement of the wild-type copy of orf8 with a copy interrupted by the Ωhyg cassette was confirmed by Southern blotting. Therefore, in order to confirm that the cassette is present in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several kinds of enzymes, separated on an agarose gel, transferred onto a membrane, Hybridized with a probe corresponding to the Ωhyg cassette. As a probe, a second hybridization was performed using a PstI-EcoRI insert having a size of about 3.7 kb including the end of orf7, the orf8, and the start of orf9 in plasmid pOS49.88. Genotype confirmation can be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

  The orf8 :: Ωhyg clone was selected and named OS49.107. A sample of the OS49.107 strain was collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, true du Doctour Roux 75724 Paris Cedex 15, France, dated July 10, 2017, July 10, 29th. It was.

Example 8: Construction of Streptomyces ambofaciens strain containing knockout in orf10 gene A 1.5 kb DNA fragment in the orf10 gene was used as a matrix. Obtained by PCR using genomic DNA of ambofaciens and the following primers:
SRMR1: 5 ′ CTGCCAGTCCTCTCCCAGCAGTACG 3 ′ (SEQ ID NO: 89)
SRMR2: 5 ′ TGAAGCTGGACGTTCTCCTGTGCGG3 ′ (SEQ ID NO: 90).

  The DNA fragment obtained by this PCR was cloned into the vector pCR2.1 (commercially available from Invitrogen (Carlsbad, Calif., USA)). The plasmid thus obtained was named pOS49.32. The Ωhyg cassette (BamHI fragment form, see above) was cloned into a unique BstEII site inside the fragment of the orf10 gene after blunting all ends by treatment with Klenow enzyme. Due to the blunt end of the cloning, two types of plasmids were obtained depending on the insertion direction of the cassette: pOS49.43 (hyg and orf10 genes in the same direction) and pOS49.44 (hyg and orf10 genes in opposite directions) ). The insert of plasmid pOS49.43 is transferred to the EcoRV site of plasmid pOJ260 (in the form of an Asp7181-XbaI fragment blunt-ended by treatment with Klenow enzyme), thereby obtaining plasmid pOS49.50. I was able to. Plasmid pOS49.50 containing a fragment of the orf10 gene interrupted with the Ωhyg cassette was introduced into Streptomyces ambofaciens strain ATCC 23877. After transformation, clones were selected for their hygromycin resistance. Next, the hygromycin resistant clones were subcultured in a hygromycin (antibiotic B) -containing medium and an apramycin (antibiotic A) -containing medium, respectively (see FIG. 9). A clone resistant to hygromycin (HygR) and a clone sensitive to apramycin (ApraS), in principle, had a double crossover during the event and was interrupted with the Ωhyg cassette. A clone containing the orf10 gene. In this way, a clone containing the hygromycin resistance marker contained in the cassette and having lost the apramycin resistance marker contained in the vector pOJ260 was obtained. An event consisting of replacement of the wild-type copy of orf10 with the orf10 :: Ωhyg interrupted copy was confirmed by Southern blotting. Therefore, in order to confirm that the cassette is present in the genomic DNA of the obtained clone, the total genomic DNA of the obtained clone is digested with several enzymes, separated on an agarose gel, and transferred onto a membrane. And hybridized with a probe corresponding to the Ωhyg cassette. Second hybridization was performed using a 1.5 kb PCR product in the orf10 gene as a probe (see above).

  A more specific clone showing the expected characteristics (orf10 :: Ωhyg) was selected and named OS49.50. Indeed, based on the two rounds of hybridization, the Ωhyg cassette is actually present in the genome of this clone, and the expected digestion profile is actually the Ωhyg cassette of the wild-type gene in the genome of this clone. It was possible to confirm that it was obtained in the case of a replacement with an interrupted copy followed by a double recombination event. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

Example 9: Gene inactivation: Construction principle of Streptomyces ambofaciens strain knocked out according to the “cleavable cassette” technique (see FIGS. 9 and 10) The second type of cassette is gene inactive Such a cassette can be used for quantification, and such a cassette is designated as a “cuttable cassette”. These cassettes are S.I. After introduction into the genome of ambofaciens, it has the advantage that it can be excised in Streptomyces by site-specific recombination events. The purpose is to inactivate certain genes in the Streptomyces strain without leaving a selectable marker or a large DNA sequence not belonging to that strain in the final strain. After excision, only about 30 short base sequence lengths (referred to as “scar” sites) remain in the strain's genome (see FIG. 10).

  First of all, the implementation of this system consists in replacing the wild-type copy of the target gene with a construct in which a cassette that can be excised in this target gene is inserted (based on two homologous recombination events). , See FIG. This cassette insertion is accompanied by a deletion of the target gene (see FIG. 9). Second, excision of a cassette that can be excised from the genome of the strain occurs. The excisable cassette functions on the basis of a site-specific recombination system and has the advantage that a Streptomyces mutant that does not have a resistance gene can finally be obtained. A possible polar effect on the expression of genes located downstream of the inactivated gene is also avoided (see FIG. 10).

  The use of excisable cassettes has been described, and many organisms such as mammalian cells and yeast cells; (Bayley et al., 1992; Brunelli and Pall, 1993; Camilli et al., 1994; Dale and Ow, 1991; Russell et al., 1992; Lakso et al., 1992). All of these excisable cassettes use a Cre site-specific recombinase that acts on the lox site. This recombinant system originates from the P1 bacteriophage.

  In order to construct a “cleavable cassette” type system in Streptomyces, a site-specific recombination system (Boccard et al., 1989a and 1989a and the Streptomyces ambofaciens mobile genetic element b) is used. First, the system is set up by constructing a recombinant vector containing the gene to be interrupted and inserting a cleavable cassette into it. Insertion of the excisable cassette into the target gene is accompanied by deletion of the target gene. This can be done by cloning using restriction sites present in the target gene or by recombination between short identical sequences as described, for example, in Chaveroche et al. (Chaveroche MK et al., 2000). The cassette that can be cut out can be constructed using, for example, an Ωhyg cassette (Blondelet Ronault et al., 1997). This cassette was adjacent to the attR and attL sequences (usually at the end of the integrated copy of pSAM2) (see FIG. 15). The attL and attR sequences contain all the sites necessary for site-specific recombination that can excise pSAM2 or any DNA fragment located between these two regions (Sezonov et al., 1997, Raynal et al., 1998). Year). The construction of such cassettes is naturally not limited to the use of Ωhyg cassettes, and other resistance cassettes may be used as a basis for constructing this cassette (eg, Ωaac or Ωvph cassettes (Blondelet Rouault et al., 1997)). ).

  After obtaining this construct, the Streptomyces strain is transformed with the recombinant plasmid. Next, transformants are selected using antibiotics corresponding to the cassette present in the target gene (see FIG. 9, antibiotic B, for example, if a excisable cassette is obtained from the Ωhyg cassette, Including selection with hygromycin). In this way, a mixture of clones in which integration by one or two recombination events has occurred is selected. Subsequently, clones (see FIG. 9, antibiotic A) that are sensitive to antibiotics (its resistance gene is present in the vector (outside the recombination cassette)) are searched. In this way, it is possible to select a clone in which two recombination events have occurred in principle and the wild-type gene has been replaced with a cassette interrupted copy. These steps are illustrated in FIG. 9; the clones obtained in this way were confirmed by Southern blotting to show the desired characteristics (replacement of the wild-type gene with a copy interrupted with a excisable cassette). Select.

  The strain selected above is then transformed with a plasmid capable of expressing the xis and int genes, both of which are required for site-specific recombination between the attR and attL sites. Is done. This recombination results in withdrawal of the excisable cassette from the genome of the strain based on the recombination phenomenon (see FIG. 10) (Raynal et al., 1998). From vectors that are relatively stable in Streptomyces (eg, obtained from the Streptomyces vector pWHM3 (Vara et al., 1989)), it is advantageous to select a vector having the xis and int genes, thereby After several sporulation cycles in the absence of selection pressure, the latter vector makes it possible to obtain a strain in which it has been lost.

In order to excise the cassette, for example, the plasmid pOSV508 (see FIG. 14) can be used, which is a S. coli containing gene interrupted with the excisable cassette. Introduced by protoplast transformation into an ambofaciens strain. The plasmid pOSV508 is obtained by adding the pSAM2 xis and int genes (F. Boccard et al., 1989b) to the plasmid pWHM3 (J. Vara et al., 1989) (see FIG. 13), and the ptrc promoter (E. Ammann et al., 1988). Obtained by being placed under the control of year). The xis and int genes placed under the control of the ptrc promoter were subcloned from the plasmid pOSint3 (Raynal et al., 1998) into the plasmid pWHM3 (see FIG. 14). Introduction of the plasmid pOSV508 carrying the pSAM2 xis and int genes into the mutant strain is an efficient excision by site-specific recombination of the excisable cassette between the attL and attR sites present at the end of this cassette. (A. Raynal et al., 1998) (FIG. 10). Among the transformants selected for their thiostrepton resistance by the tsr gene contained in pOSV508, those selected to be sensitive to antibiotics to which resistance is conferred due to the presence of the cassette. (See FIG. 10). The excision was effective and it was observed that over 90% of the transformants were of this type. After one or more growth and sporulation cycles in thiostrepton-free solid medium, clones are obtained in which plasmid pOSV508 has been lost. These clones can be detected by their sensitivity to thiostrepton. The sequence of the deleted target gene can be confirmed by PCR and sequence analysis of the PCR product.

  Ultimately, the resulting strain is an inactivated gene (eg, an internal deletion) that corresponds to the minimal attB site obtained by recombination between the attR and attL sites. It has an att site (Raynal et al., 1998). This residual minimal attB site is similar to sites naturally present in the Streptomyces strain Ambofaciens, Streptomyces pristinaesspiralis and Streptomyces lividans. (Sezonov et al., 1997).

  Genes that are desired to be inactivated can be co-transcribed with other genes located downstream. In order to avoid inactivation of any one of the genes that have a polar effect on the expression of downstream genes in the operon, it is important to obtain an intra-phase deletion after excision of the cassette. Such requirements can be met by the cassette system that can be cut out. One skilled in the art can easily construct three different excisable cassettes in practice, which can be read in any reading frame without any stop codons after excision. Or a sequence of 35 nucleotides can be left. If the sequence of the target gene and the size of the deletion associated with the insertion of the cassette are known, it is possible to select these three excisable cassettes so that excision produces a deletion within the phase. Of the added 33, 34 or 35 nucleotides, 26 correspond to the minimal attB sequence (see FIG. 27).

  In the case of the present invention, two types of cassettes that can be cut out were used. These two cassettes are as follows: att1Ωhyg + (SEQ ID NO: 91) and att3Ωaac− (SEQ ID NO: 92); these cassettes leave 33 and 35 nucleotides, respectively, after excision. They comprise Ωhyg cassette or Ωaac cassette, respectively, and the + and − symbols correspond to the direction of the resistance cassette. These two cassettes were constructed and cloned into the EcoRV site of the vector pBCSK + from which the HindIII site had previously been deleted. The obtained plasmids were named patt1Ωhyg + and patt3Ωaac−, respectively. The excisable cassette can be easily removed by digesting the plasmid with EcoRV.

Example 10: Construction of a Streptomyces ambofaciens strain having a knockout in the orf2 gene The inactivation of the orf2 gene was performed using a cassette technique (see above) that can be excised. The starting strain used is Streptomyces ambofaciens OSC2 strain obtained from ATCC 23877 strain. However, the OSC2 strain differs from the ATCC 23877 strain in that the mobile genetic element pSAM2 is lost (Boccard et al., 1
989a and b). This mobilizable element is deleted spontaneously during protoplastization of ATCC 23877 strain (the action of lysozyme that digests the bacterial wall and degrades mycelium (Kieser et al., 2000)) and during protoplast regeneration. can do. In order to select clones in which the pSAM2 element was lost, screening was set up (G. Sezonov et al., 2000) based on pr gene repression by the KorSA transcriptional repressor (Sezonov et al., 1995). For this purpose, a DNA fragment containing the promoter of the pr gene located upstream of the aph gene (confers kanamycin resistance and lacks its own promoter) was cloned into the unstable vector pWHM3Hyg, It is obtained from the plasmid pWHM3 substituted with the hyg gene (confers hygromycin resistance) (Vara et al., 1989). The plasmid thus obtained was named pOSV510. The ATCC 23877 strain was transformed with plasmid pOSV510 after protoplastization. The Pra promoter is a promoter repressed by the KorSA repressor, and the gene encoding the latter is located within the mobile pSAM2 element (Sezonov G. et al., 2000). After transformation with plasmid pOSV510, transformed bacteria are selected for their kanamycin resistance (by the aph gene contained in pOSV510). Clones that have lost the integratable element of pSAM2 lack the KorSA repressor, the Pra promoter is not repressed, and the aph kanamycin resistance gene can be expressed. Therefore, by selecting with kanamycin after transformation with plasmid pOSV510, it is possible to select clones that lack the integrable elements of pSAM2 (and therefore KorSA) and clones that contain plasmid pOSV510. it can. Since plasmid pOSV510 is unstable, after several sporulation cycles without antibiotics, the isolated clones are subcultured in medium containing kanamycin, medium containing hygromycin, and medium containing no antibiotics. Incubate. Clones sensitive to kanamycin and hygromycin are missing pOSV510. The loss of the pSAM2 element was confirmed by hybridization and PCR. A clone showing the desired characteristics was selected and named OSC2.

  Samples of the OSC2 strain were collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, rue du Doctour Roux 75724 Paris Cedex 15, France, dated July 10, 2002, 8th July 90th.

  The orf2 gene was inactivated using the excisable cassette technology (see above and FIG. 10). For this purpose, a 4.5 kb insert, the sequence from the EcoRI site located at position 1 to the BamHI site located at position 4521 (SEQ ID NO: 1) is subcloned into the EcoRI and BamHI sites of plasmid pUC19 from cosmid pSPM5. (GenBank accession number: M77789). The plasmid thus obtained was named pOS49.99.

  This plasmid is an E. coli strain that already contains the plasmid pKOBEG (Chaveroche et al., 2000). It was introduced into E. coli strain KS272 (see FIG. 12).

In parallel, an att3Ωaac-cleavable cassette (SEQ ID NO: 92, see above) was amplified by PCR using plasmid pOSK1102 as a matrix and the following primers (plasmid pOSK1102 is vector pGP704Not (Chaveroche et al., 2000). (VL Miller and JJ Mekalanos, 1988), in which the att3Ω aac-cassette is cloned as an EcoRV fragment into the unique EcoRV site of pGP704Not) :

  The 40 deoxynucleotides located at the 5 ′ end of these oligonucleotides contain the sequence corresponding to the sequence in the target gene (in this case orf2) and 20 deoxynucleotides located at the extreme 3 ′ position ( (Shown in bold above) corresponds to any one sequence at the end of the att3Ωaac-cleavable cassette (see FIG. 11).

  Using the PCR product thus obtained, E. coli containing plasmids pKOBEG and pOS49.99. E. coli strains (described in Chaveroche et al., 2000) were transformed (see FIG. 12). Bacteria were therefore transformed by electroporation and selected for their apramycin resistance. The resulting clone's plasmid was extracted and digested with several restriction enzymes, and the resulting digestion profile was obtained when insertion of the cassette (att3Ωaac−) into the target gene (orf2) occurred, ie actually It was confirmed that it corresponds to the expected profile when homologous recombination between the end of the PCR product and the target gene occurs (Caveroche et al., 2000). Confirmation of the construct can also be carried out by any method known to those skilled in the art, in particular by PCR using suitable oligonucleotides and by sequence analysis of PCR products. A clone was selected for which the plasmid had the expected profile and the corresponding plasmid was named pSPM17. This plasmid is derived from pOS49.99 in which orf2 is interrupted with an apramycin cassette (see FIG. 12).

  Insertion of the cassette involves a deletion at nucleotides 211 to 492 of the coding portion of orf2, in orf2. Plasmid pSPM17 is digested with EcoRI enzyme, the ends are then blunted by treatment with Klenow enzyme, the digestion product is then digested with XbaI enzyme, and the insert containing the deleted orf2 gene is transformed into vector pOSK1205. (See above). For this, vector pOSK1205 was digested with BamHI enzyme and then the ends were blunted by treatment with Klenow enzyme; this product was then digested with XbaI enzyme and obtained from pSPM17 as described above. Used for ligation with the inserted insert. Therefore, by this operation, each of the two fragments can obtain a directed ligation because one is blunt ended and the other is XbaI. The plasmid thus obtained was named pSPM21; it has a hygromycin resistance gene (vector part) and an insert in which the deleted orf2 gene was replaced with the att3Ωaac-cassette.

  The vector pSPM21 was introduced into Streptomyces ambofaciens OSC2 strain (see above) by protoplast transformation (T. Kieser et al., 2000). After transformation, clones were selected for their apramycin resistance. Next, apramycin resistant clones were subcultured in apramycin (antibiotic B) -containing medium and hygromycin (antibiotic A) -containing medium (see FIG. 9), respectively. Clones that are resistant to apramycin (ApraR) and clones that are sensitive to hygromycin (HygS) are, in principle, double-crossed during the event and interrupted with the att3Ωaac-cassette. A clone containing the orf2 gene. These clones were selected to confirm replacement of the wild type copy of orf2 with a cassette interrupted copy. The presence of the att3Ωaac-cassette was confirmed by colony PCR. Hybridization was also performed. For this purpose, the total DNA of the obtained clones is digested with several enzymes, separated on an agarose gel, transferred onto a membrane and corresponds to the EcoRI-BamHI fragment of the insert of plasmid pOS49.99 (see above). Hybridized with a 3 kb probe. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

  A clone showing the expected characteristics was selected and named SPM21. Using PCR and hybridization, the att3Ωaac-cassette actually exists in the genome of this clone, and in this clone's genome, replacement of the wild-type gene with an interrupted copy of the att3Ωaac-cassette (two It was possible to confirm that the expected digestion profile was actually obtained in the case of (after heavy recombination events). This clone therefore has the genotype: orf2 :: att3Ωaac−.

  A sample of the SPM21 strain was Collection National de Cultures De Microorganisms (CNCM) Pasteur Institute, 25, rue du Doctour Roux 75724 Paris Cedex 15, France, dated July 10, 2002, number 14 July 29.

To cause cassette excision, SPM21 strain was transformed with vector pOSV508 by protoplast transformation (see FIG. 14). Plasmid pOSV508 is obtained from plasmid pWHM3 (see J. Vara et al., 1989) (see FIG. 13), in which the pSAM2 xis and int genes (F. Boccard et al., 1989b) are added to control the ptrc promoter. (E. Amann et al., 1988) (see FIG. 14). By introducing the plasmid pOSV508 having the xis and int genes of pSAM2 into the SPM21 strain, a cassette that can be excised between the attL site and the attR site at the end of the excisable cassette by site-specific recombination. Can be effectively cut out (A. Raynal et al., 1998) (FIG. 10). Among the transformants selected for their thiostrepton resistance by the tsr gene contained in pOSV508, it became sensitive to apramycin (the resistance gene is contained in the att3Ωaac-cassette) The body is selected; in fact, the excision results in a deletion of this resistance gene (see FIG. 10). Plasmid pOSV508 is unstable and, after two successive passages in antibiotic-free medium, the isolated clones were duplicated in thiostrepton-containing medium and thiostrepton-free medium. Next culture. Thiostrepton sensitive clones are missing pOSV508. Sequence analysis of the PCR and PCR product confirmed that this cassette excision actually resulted in an in-phase deletion in the orf2 gene; the cassette excision actually leaves a characteristic "scar" att3 sequence (This is similar to the origin's attB site after recombination between the attL and attR sites):
5 ′ ATCGCGCGCGCTTCGTTCGGGACGAAGAGTAGTAG3 ′ (SEQ ID NO: 95).

  The strain having the desired genotype (orf2 :: att3) thus obtained was named SPM22.

  A sample of the SPM22 strain was Collection National de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, rue du Doctour Roux 75724 Paris Cedex 15, France, dated July 10, 2002, number 29 Jul. 29.

Example 11: Construction of a Streptomyces ambofaciens strain with knockout in the orf12 gene For inactivation of orf12, orf13c, and orf14, the same starting plasmid (pSPM504) can be “cut out” at various positions. Used to introduce a "cassette" type cassette. This plasmid contains a 15.1 kb insert corresponding to the region from orf7 to orf17. To construct this plasmid, a 15.1 kb BglII fragment (see above) obtained by digestion of cosmid pSPM7 was cloned into BamHI digested plasmid pMBL18 (Nakano et al .; 1995). Since the BamHI and BglII ends are compatible, the plasmid pSPM502 is obtained after ligation. The entire insert of pSPM502 could then be subcloned into plasmid pOSK1205 (digested with HindIII / NheI) (in the form of a HindIII / NheI fragment), thereby obtaining plasmid pSPM504.

  This plasmid was transformed into E. coli already containing plasmid pKOBEG. Introduced into E. coli strain KS272 (Caveroche et al., 2000) (see FIG. 12).

In parallel, an att3Ωaac-cleavable cassette was amplified by PCR using plasmid pOSK1102 as a matrix (plasmid pOSK1102 is a plasmid obtained from the vector pGP704Not (Caveroche et al., 2000) (VL Miller). And JJ Mekalanos, 1988), in which the att3Ωaac-cassette has been cloned as an EcoRV fragment into the unique EcoRV site of pGP704Not); the primers used are:

  The 40 (only 39 for EDR8) deoxynucleotides located at the 5 ′ end of these oligonucleotides contain sequences corresponding to sequences in the target gene (in this case orf12) and are located at the extreme 3 ′ position. The 20 deoxynucleotides located (shown in bold above) correspond to the sequence of any one of the ends of the att3Ωaac-cleavable cassette (see FIG. 11).

  Using the PCR product thus obtained, the E. coli containing plasmids pKOBEG and pSPM504 (see above) as described by Chaveroche et al. (Chaveroche et al., 2000). E. coli strain KS272 was transformed (see FIG. 12 for principle, plasmid pOS49.99 should be replaced by plasmid pSPM504 and the resulting plasmid is not pSPM17 but becomes pSPM507). Bacteria were therefore transformed with this PCR product by electroporation and clones were selected for their apramycin resistance. The resulting clone's plasmid was extracted and digested with several restriction enzymes, and the resulting digestion profile was obtained when insertion of the cassette (att3Ωaac−) into the target gene (orf12) occurred, ie actually It was confirmed that this corresponds to the expected profile when homologous recombination between the end of the PCR product and the target gene occurred (Caveroche et al .; 2000). Confirmation of the construct can also be carried out by any method known to those skilled in the art, in particular by PCR using suitable oligonucleotides and by sequence analysis of PCR products. A clone was selected whose plasmid had the expected profile and the corresponding plasmid was named pSPM507. This plasmid is derived from pSPM504 in which orf12 is interrupted with the att3Ωaac-cassette (see FIG. 12). The insertion of the cassette is accompanied by a deletion in the orf12 gene, and the interrupt begins at the 30th codon of orf12. The last 46 codons of orf12 remain after the cassette.

  The vector pSPM507 was introduced into the Streptomyces ambofaciens OSC2 strain by protoplast transformation (T. Kieser et al., 2000) (see above). After transformation, clones were selected for their apramycin resistance. Next, apramycin resistant clones were subcultured in apramycin (antibiotic B) -containing medium and hygromycin (antibiotic A) -containing medium (see FIG. 9), respectively. Clones that are resistant to apramycin (ApraR) and clones that are sensitive to hygromycin (HygS) are, in principle, double-crossed during the event and interrupted with the att3Ωaac-cassette. A clone containing the orf12 gene. These clones were selected more specifically and the replacement of the wild type copy of orf12 with a cassette interrupted copy was confirmed by hybridization. Therefore, the total DNA of the obtained clone is digested with several kinds of enzymes, separated on an agarose gel, transferred onto a membrane, hybridized with a probe corresponding to the att3Ωaac-cassette, The presence of the cassette was confirmed. As a probe, a second hybridization was performed using a DNA fragment obtained by PCR and corresponding to a very large portion of the coding sequence of the orf12 gene.

  Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

  A more specific clone showing the expected characteristics (orf12 :: att3Ωaac−) was selected and designated SPM507. In fact, based on two hybridizations, the att3Ωaac-cassette is actually present in the genome of this clone, and in the clone's genome, in the interrupted copy of the wild-type gene with the att3Ωaac-cassette. It was possible to confirm that the expected digestion profile was actually obtained in the case of replacement (after double recombination events). Therefore, this clone had the genotype: orf12 :: att3Ωaac− and was named SPM507. If the gene orientation is known (see Figure 3), it is not necessary to excise the cassette to study the effect of orf12 inactivation. In particular, orf13c is oriented in the opposite direction to orf12, indicating that these genes are not co-transcribed. On the other hand, the use of a cassette that can be excised makes it possible to remove the selectable marker at any time, in particular by transformation of plasmid pOSV508. A sample of the SPM507 strain was collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, rue du Doctour Rox 75724 Paris Cedex 15, France, dated July 10, 2000, 29th July, 29th.

Example 12: Construction of a Streptomyces ambofaciens strain having a knockout in the orf13c gene An att3Ωaac-cleavable cassette was amplified by PCR using plasmid pOSK1102 as matrix and the following primers (see above): :

  The 40 deoxynucleotides located at the 5 ′ end of these oligonucleotides contain the sequence corresponding to the sequence in the target gene (in this case, orf13c) and 20 deoxynucleotides located at the extreme 3 ′ position (above Corresponds to any one sequence at the end of the att3Ωaac-cleavable cassette (see FIG. 11).

  Using the PCR product thus obtained, the plasmid pKOBEG and the E. coli containing pSPM504 as described by Chaveroche et al. (Chaveroche et al., 2000). E. coli strain KS272 (see above) was transformed (see FIG. 12 for principle, plasmid pOS49.99 should be replaced by plasmid pSPM504 and the resulting plasmid is not pSPM17 but becomes pSPM508) . Bacteria were therefore transformed with this PCR product by electroporation and clones were selected for their apramycin resistance. The resulting clone's plasmid was extracted and digested with several restriction enzymes, and the resulting digestion profile resulted in insertion of the cassette (att3Ωaac−) into the target gene (orf13c), ie, in fact, PCR It was confirmed that this corresponds to the expected profile when homologous recombination occurs between the end of the product and the target gene (Chaveroche et al., 2000). Confirmation of the construct can also be carried out by any method known to those skilled in the art, in particular by PCR using suitable oligonucleotides and by sequence analysis of PCR products. A clone was selected for which the plasmid had the expected profile and the corresponding plasmid was named pSPM508. This plasmid was obtained from pSPM504 in which orf13c was interrupted with an apramycin cassette (see FIG. 12). The insertion of the cassette is accompanied by a deletion in the orf13c gene, and the interrupt begins at the sixth codon of orf13c. The last three codons of orf13c remain after the cassette.

The vector pSPM508 was obtained by protoplast transformation (T. Kieser et al.,
2000), introduced into the Streptomyces ambofaciens OSC2 strain (see above). After transformation, clones were selected for their apramycin resistance. Next, the apramycin resistant clones were subcultured in an apramycin (antibiotic B) -containing medium and a hygromycin (antibiotic A) -containing medium (see FIG. 9), respectively. Clones that are resistant to apramycin (ApraR) and clones that are sensitive to hygromycin (HygS) are, in principle, double-crossed during the event and interrupted with the att3Ωaac-cassette. A clone containing the orf13c gene. These clones were selected more specifically and the replacement of the wild type copy of orf13c with the cassette interrupted copy was confirmed by hybridization. Therefore, in order to confirm that the cassette is present in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several kinds of enzymes, separated on an agarose gel, transferred onto a membrane, Hybridized with the probe corresponding to the att3Ωaac-cassette. A second hybridization was performed using a PCR product corresponding to a sequence spanning about 100 base pairs upstream and downstream of the coding sequence of orf13c as a probe. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

  A clone (orf13c :: att3Ωaac−) exhibiting the expected characteristics was selected more specifically and named SPM508. In fact, based on two hybridizations, the att3Ωaac-cassette is actually present in the genome of this clone, and in the clone's genome, in the interrupted copy of the wild-type gene with the att3Ωaac-cassette. It was possible to confirm that the expected digestion profile was actually obtained in the case of replacement (after double recombination events). Therefore, this clone had the genotype: orf13c :: att3Ωaac− and was named SPM508. If the orientation of the gene is known (see Figure 3), it is not necessary to excise the cassette to study the effect of orf13c inactivation. The orientation of orf14 in the opposite direction to orf13c indicates that these genes are not cotranscribed. On the other hand, by using a cassette that can be cut out, the selection marker can be removed at any time. Samples of the SPM508 strain were collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, ru du Ducteur Roux 75724 Paris Cedex 15, France, dated July 12, 2000, number 29 July 2002.

Example 13: Construction of Streptomyces ambofaciens strain with knockout in orf14 gene attSΩaac-cleaveable cassette was amplified by PCR using plasmid pOSK1102 as matrix and the following primers (see above) :

  The 40 deoxynucleotides located at the 5 ′ end of these oligonucleotides contain the sequence corresponding to the sequence in the target gene (in this case, orf14) and 20 deoxynucleotides located at the extreme 3 ′ position ( (Shown in bold above) corresponds to the sequence of either end of att3Ωaac-cleavable cassette (see FIG. 11).

  Using the PCR product thus obtained, the plasmid pKOBEG and the E. coli containing pSPM504 as described by Chaveroche et al. (Chaveroche et al., 2000). E. coli strain KS272 (see above) was transformed (see FIG. 12 for principle, plasmid pOS49.99 should be replaced by plasmid pSPM504 and the resulting plasmid is not pSPM17 but becomes pSPM509) . Bacteria were therefore transformed with this PCR product by electroporation and clones were selected for their apramycin resistance. The resulting clone's plasmid was extracted and digested with several restriction enzymes and the resulting digestion profile was obtained when insertion of the cassette (att3Ωaac−) into the target gene (orf14) occurred, ie It was confirmed that this corresponds to the expected profile when homologous recombination between the end of the PCR product and the target gene occurred (Caveroche et al., 2000). Confirmation of the construct can also be carried out by any method known to those skilled in the art, in particular by PCR using suitable oligonucleotides and by sequence analysis of PCR products. A clone was selected in which the plasmid had the expected profile and the corresponding plasmid was named pSPM509. This plasmid is derived from pSPM504 in which orf14 is interrupted with an apramycin cassette (see FIG. 12). The insertion of the cassette is accompanied by a deletion in the orf14 gene, and the interrupt begins with the fourth codon of orf14. The last codon of orf14 remains after the cassette.

The vector pSPM509 was introduced into the Streptomyces ambofaciens OSC2 strain by protoplast transformation (T. Kieser et al., 2000) (see above). After transformation, clones were selected for their apramycin resistance. Next, the apramycin resistant clones were subcultured in an apramycin (antibiotic B) -containing medium and a hygromycin (antibiotic A) -containing medium (see FIG. 9), respectively. Clones that are resistant to apramycin (ApraR) and clones that are sensitive to hygromycin (HygS) are, in principle, double-crossed during the event and interrupted with the att3Ωaac-cassette. A clone containing the orf14 gene. These clones were selected more specifically and the replacement of the wild type copy of orf14 with the cassette interrupted copy was confirmed by hybridization. Therefore, in order to confirm the presence of the cassette in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several enzymes, separated on an agarose gel, and transferred onto a membrane. , And hybridized with the probe corresponding to the att3Ωaac-cassette. A second hybridization was performed using as a probe a PCR product corresponding to a sequence spanning about 100 base pairs upstream and downstream of the coding sequence of orf14. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

  A clone (orf14 :: att3Ωaac−) showing the expected characteristics was selected more specifically and named SPM509. In fact, based on two hybridizations, the att3Ωaac-cassette is actually present in the genome of this clone, and in the clone's genome, in the interrupted copy of the wild-type gene with the att3Ωaac-cassette. It was possible to confirm that the expected digestion profile was actually obtained in the case of replacement (after double recombination events). Therefore, this clone had the genotype: orf14 :: att3Ωaac− and was named SPM509. Given the gene orientation (see FIG. 3), it is not necessary to excise the cassette to study the effect of orf14 inactivation. The orientation of orf15c in the opposite direction to orf14 indicates that these genes are not cotranscribed. On the other hand, by using a cassette that can be cut out, the selection marker can be removed at any time. Samples of the SPM509 strain were collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, ru du Ductor Roux 75724 Paris Cedex 15, France, dated July 10, 2017, number 29 July 10, 2017.

Example 14: The orf6 ^* Construction of Streptomyces ambofaciens strains with knock-out in the gene orf6 ^* gene inactivation was performed using excisable cassette technique (see above and Figure 10). For this purpose, using the cosmid pSPM7 as a matrix, the following oligonucleotides were used to amplify the fragment of the orf6 ^* gene:

The 20 deoxynucleotides located at the 3 ′ end of these oligonucleotides correspond to the sequence (SEQ ID NO: 13) located in the coding part of the orf6 ^* gene, and the 6 deoxynucleotides located at the 5 ′ position of the extreme end. Corresponds to the sequence of the PstI site that facilitates subsequent cloning. The size of the amplified DNA fragment is about 1.11 kb. This PCR product was cloned into the vector pGEM-T Easy (commercially available from pGEM-T Easy, Promega (Madison, Wis., USA)), resulting in the plasmid pBXL1111 (FIG. 16).

Next, an att1Ωhyg + cleavable cassette was introduced into the coding sequence of the orf6 ^* gene. To this end, plasmid pBXL1111 was digested with SmaI and Asp718I restriction enzymes and the digested product was treated with Klenow enzyme. By this operation, or
A 120 bp internal deletion in the coding sequence of the f6 ^* gene could be produced (see FIG. 15). In addition, 511 bp and 485 bp of the orf6 ^* sequence remain at either end of the restriction site, thereby allowing homologous recombination for inactivation of the orf6 ^* gene. The att1Ωhyg + excisable cassette was prepared from the plasmid patt1Ωhyg + by digesting this plasmid with EcoRV (see above). The latter was then subcloned into the vector pBXL1111 previously prepared as described above (digestion with SmaI and Asp718I followed by treatment with Klenow enzyme). The resulting plasmid was named pBXL1112 (see FIG. 17). In this construct, the orf6 ^* gene contains a 120 bp deletion and is interrupted with the att1Ωhyg + cassette.

The plasmid pBXL1112 was then digested with the PstI enzyme (the site adjacent to the cassette because it is present in the PCR oligonucleotide), and then a 3.7 kb PstI insert containing the portion of orf6 ^* interrupted with the att1Ωhyg + cassette. It was cloned into the PstI site of plasmid pOJ260 (see above). The plasmid thus obtained was named pBXL1113.

Vector pBXL1113 was introduced into the Streptomyces ambofaciens OSC2 strain by protoplast transformation (T. Kieser et al., 2000) (see above). After transformation, clones were selected for their hygromycin resistance. Next, the hygromycin resistant clones were subcultured in a hygromycin (antibiotic B) -containing medium and an apramycin (antibiotic A) -containing medium, respectively (see FIG. 9). A clone resistant to hygromycin (HygR) and a clone sensitive to apramycin (ApraS), in principle, had a double crossover during the event and was interrupted with the att1Ωhyg + cassette. A clone containing the orf6 ^* gene. These clones were selected more specifically and the replacement of the wild type copy of orf6 ^* with a cassette interrupted copy was confirmed by Southern blotting techniques. Therefore, in order to confirm that the cassette is present in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several kinds of enzymes, separated on an agarose gel, transferred onto a membrane, Hybridized with a probe corresponding to the hyg gene (obtained by PCR). A second hybridization was performed using a PstI-PstI insert (see above and FIG. 16) that contained the orf6 ^* gene, was about 1.1 kb in size, and was obtained from plasmid pBXL1111. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

A clone (orf6 ^* :: att1Ωhyg +) showing the expected characteristics was selected more specifically and named SPM501. In fact, using two rounds of hybridization, the att1 Ωhgy + cassette is actually present in the genome of this clone, and in the genome of this clone, the replacement of the wild-type gene with a copy interrupted with the att1Ωhyg + cassette It was possible to confirm that the expected digestion profile was actually obtained in the case of (after double recombination events). Therefore, this clone had the genotype: orf6 ^* :: att1Ωhyg + and was named SPM501. A sample of the SPM501 strain was collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, due du Doctour Rox 75724 Paris Cedex 15, France, dated July 10, 1990, July 10, 1990, No. 90-10.

SPM501 strain was transformed with vector pOSV508 by protoplast transformation to cause cassette excision (see FIG. 14). Plasmid pOSV508 was supplemented with plasmid pWHM3 (see FIG. 14) with the addition of the pSAM2 xis and int genes (F. Boccard et al., 1989b) placed under the control of the ptrc promoter (E. Amann et al., 1988). J. Vara et al., 1989) (see FIG. 13). A cassette that can be excised between the attL site and the attR site at the end of the cassette that can be excised by site-specific recombination by introducing the plasmid pOSV508 having the xis and int genes of pSAM2 into the SPM501 strain. Can be effectively cut out (A. Raynal et al., 1998) (FIG. 10). Among the transformants selected for their thiostrepton resistance by the tsr gene contained in pOSV508, the transformants become sensitive to hygromycin (the resistance gene is contained in the att1Ωhyg + cassette). In fact, excision results in the deletion of this resistance gene (see FIG. 10). Plasmid pOSV508 is unstable and, after two successive passages in antibiotic-free medium, the isolated clones were duplicated in thiostrepton-containing medium and thiostrepton-free medium. Next culture. Thiostrepton sensitive clones are missing pOSV508. It was confirmed by PCR and sequence analysis of the PCR product that cassette excision in the orf6 ^* gene actually occurred within the phase. The interrupt begins at the 158th codon, 40 codons are deleted (120 bp), and excision of the cassette leaves a 33 bp characteristic “scar” att1 sequence:
5 ′ ATCGCGCGCTTCGTTCGGGACGAAGAGGGTAGAT3 ′ (SEQ ID NO: 104).

The strain having the desired genotype (orf6 ^* :: att1) thus obtained was named SPM502.

  A sample of the SPM502 strain was collected at Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, rue du Doctour Roux 75724 Paris Cedex 15, France, dated July 10, 2002, number 10 July 29.

Example 15: Analysis of Streptomyces strains / Ambofaciens with knockout in orf2, orf3, orf8, orf10, orf12, orf13c, orf14 or orf6 ^* genes To test the spiramycin production of the various strains obtained A microbiological test based on the susceptibility of Micrococcus luteus strains was performed (see A. Gourmelen et al., 1998). The Micrococcus luteus strain used is a strain derived from the strain DSM1790 that is naturally sensitive to spiramycin (this strain is especially the German Collection of Microorganisms and Cell Cultures (Deutsche Sammulung von Gunkulmungulmungen von Mikulungen , DSMZ) (available from Braunschweig, Germany) under the number DSM1790); the strain used in this study differs from the DSM1790 strain in that it is resistant to congosinidine. This strain is a spontaneous mutant obtained by selection on media containing increased amounts of congosinidine. Such strains were selected by streptomyces ambofaciens producing both spiramycin and congocidin. Since the aim is to analyze spiramycin production of various strains obtained using microbiological tests based on the susceptibility of Micrococcus luteus strains, it is necessary to have a congocidine resistant strain.

Various Streptomyces strains to be tested were cultured in 500 ml Erlenmeyer flasks with 70 ml of MP5 medium (Pernodet et al., 1993) containing baffles (Erlenmeyer with baffles). Various S.P. The ambofaciens strain was planted in Erlenmeyer with baffles at an initial concentration of 2.5 × 10 ⁶ spores / ml and grown at 27 ° C. with shaking at 250 rpm. After 48, 72 and 96 hours of culture, 2 ml samples of the suspension were taken and centrifuged. The various supernatants were then frozen at -20 ° C. A 10-fold dilution of these supernatants in sterile medium is used for testing (see FIG. 18).

  A Micrococcus luteus indicator strain that is resistant to congocidine but sensitive to spiramycin was cultured for 48 hours at 37 ° C. in 2TY medium containing 5 μg / ml of congocidine (Sambrook et al., 1989). The optical density (OD) of the culture solution is measured, and this culture solution is diluted to adjust the optical density to 4. 0.4 ml of this preculture was diluted with 40 ml of DAM5 medium (Difco antibiotic medium 5, marketed by Difco) whose temperature was about 45 ° C. in advance. The medium was then poured into a 12 × 12 cm square culture dish and left at ambient temperature.

  Once the medium was cooled and solidified, a 12 mm diameter Whatman AA paper disk (see A. Gounnelen et al., 1998) was immersed in 70 μl of a 10-fold dilution of each supernatant and placed on the surface of the culture dish. Discs soaked in various concentrations of spiramycin solution (2-4-8 μg / ml in MP5 medium) are used as standard ranges. The culture dish was left at 4 ° C. for 2 hours to allow the antibiotics to diffuse into the agar and then incubated at 37 ° C. for 24-48 hours.

  If the disc contains spiramycin, it will diffuse into the agar and inhibit the growth of the Micrococcus luteus indicator strain. This inhibition forms a “ring” around the disk, which indicates the area where the Micrococcus luteus strain did not grow. Hence, the presence of this ring is an indicator of the presence of spiramycin and corresponds to the S. cerevisiae corresponding to the disc in question. Ambofaciens makes it possible to determine whether it is a spiramycin producer or not. By comparing the diameters of inhibition obtained in the standard range, it is possible to obtain an indication of the amount of spiramycin produced by this strain.

  In order to detect their spiramycin production, various strains described in the previous examples were used in this test. The results obtained are grouped in Table 38.

  These results allow us to draw certain conclusions regarding the functions of various genes involved in spiramycin biosynthesis. Thus, the orf3 gene is essential for spiramycin biosynthesis. In particular, inactivation of this gene within the phase results in a strain that fails to produce spiramycin (OS 49.67, see Example 6). Inactivation within the phase makes it possible to eliminate the hypothesis of possible effects of the introduced cassette on the expression of genes located downstream of orf3.

  Similarly, since the OS49.107 and OS49.50 strains have non-productive phenotypes, the orf8 and orf10 genes encode proteins essential for spiramycin biosynthesis. In addition, in these latter two strains, this is clearly this non-productive, since the introduced construct cannot have a polar effect, given the various orf orientations (see FIG. 3). Inactivation of the corresponding gene involved in the body phenotype.

  Studies of strains with excisable cassettes can also draw certain conclusions regarding the function of the interrupted gene. SPM507 strain has the genotype: orf12 :: att3Ωaac−. Given the gene orientation (see FIG. 3), it is not necessary to excise the cassette to study the effect of orf12 inactivation. The orientation of orf13c in the opposite direction to orf12 indicates that these genes are not co-transcribed. On the other hand, by using a cassette that can be cut out, the selection marker can be removed at any time. The phenotype of the SPM507 strain is a non-producer; It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens.

  SPM508 strain has the genotype: orf13c :: att3Ωaac−. Considering the gene orientation (see Figure 3), it is not necessary to excise the cassette to study the effect of orf13c inactivation. The orientation of orf14 in the opposite direction to orf13c indicates that these genes are not co-transcribed. On the other hand, by using a cassette that can be cut out, the selection marker can be removed at any time. The phenotype of strain SPM508 is the producer; therefore, from now on, the orf13c gene is It can be concluded that in ambofaciens it is not an essential gene for spiramycin biosynthesis.

  SPM509 strain has genotype: orf14 :: att3Ωaac−. Given the orientation of the gene (see Figure 3), it is not necessary to excise the cassette to study the effect of orf14 inactivation; orf15c is oriented in the opposite direction to orf14. Indicates not co-transcribed. On the other hand, by using a cassette that can be cut out, the selection marker can be removed at any time. The phenotype of the SPM509 strain is a non-producer; It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens.

  SPM21 strain has the genotype: orf2 :: att3Ωaac−. This strain has a spiramycin non-producer phenotype. However, the orientation of the orf1 gene to the orf8 gene (see FIG. 3) means that these genes are co-transcribed. Thus, the observed phenotype may be due to the polar effect of the cassette introduced into orf2 on the expression of genes located downstream in the operon. SPM22 strain has genotype: orf2 :: att3 and was obtained after excision of the introduced cassette within the phase. Cutting out the cassette left only a characteristic “scar” sequence (see Example 10). Since the SPM22 strain also has a nonproductive phenotype, the orf1 gene is It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens. Here, only the effect of orf2 inactivation is observed.

SPM501 strain has genotype: orf6 ^* :: att1Ωhgy +. This strain has a non-spiramycin phenotype. However, orf5 ^* gene and orf6 ^* gene (see Figure 3) is because they have the same direction, the observed phenotype, the cassette introduced into orf6 ^*, may be due to polar effects on the expression of orf5 ^* is there. The arrangement of these genes means that they can be co-transcribed. To respond to this question, the SPM502 strain was obtained after excision of the introduced cassette within the phase. In this strain only the inactivation effect of orf6 ^* is observed. This strain has the genotype: orf6 ^* :: att1 (see Example 14). Cutting out the cassette leaves only the “scar” sequence in the phase (see Example 14). SPM502 has a producer phenotype (however, this strain produces only spiramycin I (see Example 16)). Therefore, the orf5 ^* gene is expressed in S. 501 because their inactivation in the SPM501 strain results in a non-productive phenotype. It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens. On the other hand, the orf6 ^* gene is It is not an essential gene for biosynthesis of spiramycin I in ambofaciens (while it is essential for the production of spiramycin II and III (see Example 16)).

Example 16: Analysis of spiramycin I, II and III production in the resulting mutant strains The various strains tested were each cultured in Erlenmeyer with 500 ml baffles containing 70 ml of 7 MP5 medium. (Pernodet et al., 1993). In Erlenmeyer, 2.5 × 10 ⁶ spores / ml of various S.P. An ambofaciens strain was planted and grown at 27 ° C. for 72 hours with shaking at 250 rpm. Culture fluids corresponding to the same clones were pooled and optionally filtered through a fluted filter and centrifuged at 7000 rpm for 15 minutes. The various supernatants were then stored at -30 ° C.

Analysis was performed by ion pair high performance liquid chromatography (HPLC). HPLC analysis of the medium makes it possible to accurately determine the concentration of the three forms of spiramycin. The column used (Macheley-Nagel) is packed with a silica phase grafted with octyl of Nucleosil. The particle size is 5 μm and the pore size is 100 mm. The column inner diameter is 4.6 mm and the length is 25 cm. Mobile phase is a 70/30 (v / v) mixture of H3PO4 buffer containing NaClO ₄ perchlorate 6.25 g / L and (pH 2.2) and acetonitrile. The analysis is performed in a homogeneous system with the flow rate fixed at 1 ml / min. The column is temperature controlled at 23 ° C. Detection is by UV spectrophotometry at 238 nm. Samples were cooled at + 10 ° C. and quantified from the peak area (with external correction). Under these conditions, the retention times for spiramycin I, II and III are about 17, 21 and 30 minutes, respectively, as can be confirmed using a commercial sample containing three forms of spiramycin.

  The OSC2 strain has a spiramycin producer phenotype. This is the parental strain that was used to obtain a strain with an excisable cassette (see Example 15). This strain was therefore used as a positive control for the production of three forms of spiramycin. This strain clearly produces three forms of spiramycin, as confirmed by HPLC (see Figure 19).

  Studies of strains with excisable cassettes can draw certain conclusions regarding the function of the interrupted gene. SPM507 strain has the genotype: orf12 :: att3Ωaac−. The phenotype of strain SPM507 is a non-producer (see Example 15); therefore, the orf12 gene is It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens. This strain does not produce spiramycin as confirmed by HPLC (see FIG. 22). This result confirms the essential nature of the orf12 gene in spiramycin biosynthesis.

  SPM508 strain has the genotype: orf13c :: att3Ωaac−. SPM508 strain has a spiramycin producer phenotype (see Example 15); therefore, the orf13c gene is It can be concluded that in ambofaciens it is not an essential gene for spiramycin biosynthesis. This strain produces spiramycin I, II and III as confirmed by HPLC (see FIG. 23). This result indicates that the orf13c gene is It is confirmed that it is not an essential gene for biosynthesis of spiramycin I, II and III in ambofaciens.

  SPM509 strain has genotype: orf14 :: att3Ωaac−. The phenotype of the SPM509 strain is a non-producer; It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens. This strain does not produce spiramycin as confirmed by HPLC (see FIG. 24). This result confirms the essential nature of the orf14 gene in spiramycin biosynthesis.

SPM501 strain has genotype: orf6 ^* :: att1Ωhyg +. This strain has a non-spiramycin phenotype. This strain does not produce spiramycin as confirmed by HPLC (see FIG. 20). However, orf5 ^*, and, orf6 ^* gene (see Figure 3) is to have the same direction, the observed phenotype, the operon, a cassette introduced into orf6 ^*, with a polar effect on the expression of orf5 ^* there is a possibility. This means that these genes are co-transcribed. To respond to this question, the SPM502 strain, obtained by excision of the introduced cassettes, to prepare a deletion in phases OR6 ^* gene, restored the expression of orf5 ^*. This strain has the genotype: orf6 ^* :: att1 (see Examples 14 and 15). By cutting out the cassette, only the “scar” att sequence in the phase remains (see Example 14). SPM502 strain has a spiramycin producer phenotype. However, as demonstrated by HPLC, this strain produces only spiramycin I and not spiramycin II and III (see FIG. 21). Therefore, these results indicate that their inactivation in the SPM501 strain results in a spiramycin non-producer phenotype (see FIG. 20), so the orf5 ^* gene is It can be concluded that it is an essential gene for spiramycin biosynthesis in ambofaciens. On the other hand, inactivation of this gene results in the spiramycin I producer phenotype, so the orf6 ^* gene is It is not an essential gene for the biosynthesis of spiramycin I in ambofaciens (see FIG. 21). However, orf6 ^* is essential for the production of spiramycin II and III (see Example 16)). Therefore, the orf6 ^* gene apparently encodes an acyltransferase that is involved in the modification of the platenolide at position 3 (see FIG. 1).

Example 17: Determination of the translation start of orf10 and improvement of spiramycin production
17.1. Construction of plasmids pSPM523, pSPM524, and pSPM525:
The orf10 gene was identified in Streptomyces ambofaciens and named srmR by Geistrich et al. (M. Geistrich et al., 1992). The inf10 gene was inactivated (see Example 8). Thereby, the obtained strain could be shown not to produce spiramycin (see Example 15). This confirms that the orf10 gene is clearly involved in spiramycin biosynthesis. Therefore, the protein encoded by this gene is essential for the apparently essential spiramycin biosynthesis. However, sequence analysis shows that two ATG codons present in the same reading frame can be used to translate orf10 (see FIG. 28). One of the two possible codons (the most upstream codon) starts at position 10656 of the sequence shown in SEQ ID NO: 1, while the other possible codon located further downstream starts at position 10809 (sequence See number 1). Before testing the possible effect of overexpression of srmR on spiramycin production, it is important to first determine the translation initiation point.

  In order to determine the translation start site, three constructs containing three forms of orf10 were produced. These forms were obtained by PCR using oligonucleotides containing either a HindIII restriction site or a BamHI restriction site.

The first pair used for amplification corresponds to the following oligonucleotides:

  Primer pair EDR39-EDR42 allows amplification of an orf10 fragment containing the ATG located at the extreme 3 'position (position 10809 of the sequence shown in SEQ ID NO: 1) (see Figure 28). The resulting fragment is approximately 2 kb in size and is subsequently referred to as “short orf10”; it does not contain the orf10 promoter. This 2 kb fragment was cloned into the vector pGEM-T Easy to obtain plasmid pSPM520.

The second pair used for amplification corresponds to the following oligonucleotides:

  Primer pair EDR40-EDR42 allows amplification of a fragment of orf10 containing the ATG located at the extreme 5 'position (position 10656 of the sequence shown in SEQ ID NO: 1) (see Figure 28). Subsequently, this 2.2 kb fragment, referred to as “long orf10”, was cloned into the vector pGEM-T easy to obtain plasmid pSPM521; this plasmid does not contain the orf10 promoter.

The third pair used for amplification corresponds to the following oligonucleotides:

  Primer pair EDR41-EDR42 allows amplification of the orf10 gene with two ATGs, plus its own promoter (see FIG. 28). Subsequently, this 2.8 kb fragment called “pro-orf10” was cloned into the vector pGEM-T easy to obtain the plasmid pSPM522.

  The “pro orf10” fragment was obtained using chromosomal DNA of OSC2 strain as a matrix. The “short orf10” and “long orf10” fragments themselves were obtained using the DNA of the pre-purified “proorf10” fragment as a matrix.

Next, the plasmid pSPM520, pSPM521, and the HindIII-BamHI insert of pSPM522 are plasmids obtained from the vector pUWL201 (plasmid pUWL199 (UF Wehmeier, 1995), pre-digested with the HindIII-BamHI enzyme, and the promoter (ErmE ^* promoter) A KpnI-BamHI fragment of the ermE promoter region with a mutation that increases strength (Bibb et al., 1985, especially see FIG. 2) (Bibb et al., 1994) has been introduced (Doumith et al., (See 2000)). Thus, three plasmids were obtained: pSPM523 (obtained from pUWL201 containing the “short orf10” type as an insert), pSPM524 (obtained from pUWL201 containing the “longorf10” type as an insert), and pSPM525 ( (Obtained from pUWL201 containing "pro orf10" type) (Figure 28).

17.2. Transformation of OS49.50 strain with constructs pSPM523, pSPM524, and pSPM525:
The strain OS49.50 (strain having a knockout in the orf10 gene, see Example 8) was independently transformed with each of plasmids pSPM523, pSPM524, and pSPM525 by protoplast transformation (T. Kieser et al., 2000). Transformed. A negative control was also produced by transforming strain OS49.50 with plasmid pUWL201 without insert. After protoplast transformation, clones were selected for their thiostrepton resistance. The transformation of clones with each plasmid was confirmed by extraction of these plasmids. Thus, four new strains were obtained: OSC49.50 pUWL201 strain was obtained from transformation with plasmid pUWL201 without insert; OSC49.50 pSPM523 strain was obtained from transformation with plasmid pSPM523. OSC49.50 pSPM524 was obtained from transformation with plasmid pSPM524; and finally, OS49.50 pSPM525 was obtained from transformation with plasmid pSPM525.

Each of four strains of spiramycin production was tested by HPLC. In this regard, the various Streptomyces strains to be tested were cultured in 500 ml Erlenmeyer (Erlenmeyer with baffle) with baffles containing 70 ml of MP5 medium (Pernodet et al., 1993). If the strain contains plasmid pUWL201 or any one of its derivatives, 5 μg / ml thiostrepton is added. Erlenmeyer with baffles was prepared with various S. cerevisiae at an initial concentration of 2.5 × 10 ⁶ spores / ml. The ambofaciens strain was planted and the culture was incubated for 96 hours with rotation at 27 ° C. and shaking at 250 rpm. Cells were separated from the medium by centrifugation and the supernatant was analyzed by HPLC (see Example 16) to determine the amount of spiramycin produced. Based on measurements of standard samples and peak areas, the amount of each spiramycin produced by these strains could be determined. The results of this analysis are shown in Table 39, and the data are shown in mg / liter supernatant. This result corresponds to the total production of spiramycin (obtained by adding production of spiramycin I, II and III).

  As shown by the results shown in Table 39, the negative control (OS49.50 strain transformed with plasmid pUWL201) does not produce spiramycin. When plasmid pSPM523 (including "short orf10" type) is introduced into OS49.50 strain, no spiramycin production is observed. On the other hand, when plasmid pSPM524 (including “long orf10” type) and plasmid pSPM525 (including “proorf10” type) are present, spiramycin production is restored in host OS49.50 strain. Thus, only the orf10 fragment containing the most upstream ATG can restore spiramycin synthesis.

  In order to confirm these results, plasmid pSPM521 (plasmid pGEM-T Easy containing “long orf10” type) was digested with the XhoI restriction enzyme (this enzyme is located in this plasmid between two ATGs). (See FIG. 28)). Next, the XhoI end was blunted by treatment with Klenow enzyme. Next, the plasmid was closed by the action of T4 DNA ligase to obtain plasmid pSPM527. When the most upstream ATG (position 10656 of the sequence shown in SEQ ID NO: 1) is actually used as the translation start site, this treatment causes a shift at the XhoI site in the reading frame, indicating activated activity. Has the effect of producing no protein. On the other hand, if translation initiation occurs in the most downstream ATG (position 10809 of the sequence shown in SEQ ID NO: 1), this treatment has little effect on the expression of orf10 (giving the position of the transcription start point), Or it should not work and the protein produced should have no effect.

  Next, the BamHI-HindIII insert of pSPM527 was subcloned into vector pUWL201, resulting in plasmid pSPM528. This plasmid was introduced into the OS49.50 strain, and a clone having the desired plasmid was selected more specifically. The resulting strains were then tested for spiramycin production by HPLC (see Example 16 and above). Unlike that observed with plasmid pSPM524 (see Table 39), the presence of plasmid pSPM528 in the OS49.50 strain does not reconstruct spiramycin production. This confirms that the translation start of the orf10 gene is the ATG located at the most downstream position (ATG1, see FIG. 28).

17.3. S. Improvement of spiramycin production of Ambofaciens OSC2 strain :
To test the effect of overexpression of the orf10 gene on spiramycin production, plasmids pSPM523, pSPM524, pSPM525, and pSPM528 were introduced into the OSC2 strain. For this purpose, protoplasts of the OSC2 strain were independently transformed with the respective plasmids pSPM523, pSPM524, pSPM525, and pSPM528 (T. Kieser et al., 2000). A negative control was also produced by transforming OSC2 strain with plasmid pUWL201 containing no insert. After protoplast transformation, clones were selected for their thiostrepton resistance. In this way, five new strains were obtained: OSC2 pUWL201 strain was obtained from transformation with plasmid pUWL201 without insert and OSC2 pSPM523 strain was obtained from transformation with plasmid pSPM523; OSC2 The pSPM524 strain was obtained from transformation with plasmid pSPM524; the OSC2 pSPM525 strain was obtained from transformation with plasmid pSPM525; and, finally, the OSC2 pSPM528 strain was obtained from transformation with plasmid pSPM528. It was. Next, the spiramycin production of these strains was analyzed by HPLC (in the same way as Example 17.2). Analysis of spiramycin production of OSC2 strain was also performed in parallel for comparison. The results of this analysis are shown in Table 40, and the data are shown in mg / liter supernatant. The results correspond to the total production of spiramycin (obtained by adding the production of spiramycin I, II and III).

  Thus, it is observed that the presence of plasmid pSPM524 or plasmid pSPM525 significantly increases the spiramycin production of the OSC2 strain. This clearly indicates that overexpression of orf10 has a positive effect on spiramycin production. On the other hand, plasmid pSPM528 has no effect on spiramycin production.

  Similarly, plasmids pSPM525 and pUWL201 were introduced into SPM502 strain (see Example 14). Thus, two new strains were obtained: SPM502 pUWL201 strain was obtained from transformation with plasmid pUWL201 without insert; and SPM502 pSPM525 strain was obtained from transformation with plasmid pSPM525.

  A sample of the SPM502 pSPM525 strain (this strain contains the plasmid pSPM525, see above) can be found in Collection Nationale de Cultures de Microorganisms (CNCM) Pasteur Institute, 25, rudu Duc ce ce p On the 26th, it was deposited under the registration number I-2777.

  Spiramycin production of SPM502 pUWL201 strain and SPM502 pSPM525 strain was analyzed by HPLC (in the same manner as in Example 17.2). Analysis of spiramycin production of SPM502 strain was also performed in parallel for comparison. The results of this analysis are shown in Table 41 and the data are shown in mg / liter supernatant. The result corresponds to the production of spiramycin I. In fact, these strains do not produce spiramycin II and III.

  Thus, it was observed that overexpression of the orf10 gene in the SPM502 strain significantly increased spiramycin I production.

Example 18: E. coli in cosmid pWED2. Construction of genomic DNA library of Streptomyces ambofaciens OSC2 strain in E. coli
18.1. Construction of cosmid pWED2:
In order to facilitate gene inactivation in Streptomyces, it has the oriT sequence of plasmid RK2 (allowing introduction from a suitable E. coli strain to Streptomyces by conjugation), and Streptomyces A cosmid with a gene for antibiotic resistance conferring a detectable phenotype in was constructed. Such a cosmid containing a large insert of Streptomyces ambofaciens genomic DNA can be used for gene inactivation experiments.

であり、ＥｃｏＲＶ制限部位は下線で示され、太字の２０個のヌクレオチド配列は、ｐａｃ遺伝子のプロモーター上流の領域に相当し、および、第二のプライマーは、プライマーＢ（その配列は、

であり、これは、その５’末端に、ｏｒｉＴ配列の開始部に相当する１２個のヌクレオチド配列（二重下線で示される）、および、ｐａｃ遺伝子の末端に相当する２０個のヌクレオチド配列（太字で）を含む（図２９の第一のＰＣＲを参照）。 To construct this vector, the pac-oriT cassette (EcoRV fragment) was introduced into the HpaI site unique to cosmid pWED1 obtained from cosmid pWED15 (Wahl et al., 1987) (Gourmelen et al., 1998). The pac-oriT cassette was obtained by PCR. To this end, the pac gene was amplified from plasmid pVF10.4 (Vara et al., 1985; Lacalle et al., 1989) by PCR using the following primers; where the first primer is primer A , The array is

The EcoRV restriction site is underlined, the 20 nucleotide sequence in bold represents the region upstream of the promoter of the pac gene, and the second primer is primer B (its sequence is

Which is, at its 5 ′ end, a 12 nucleotide sequence corresponding to the beginning of the oriT sequence (indicated by double underlining) and a 20 nucleotide sequence corresponding to the end of the pac gene (bold (See the first PCR in FIG. 29).

であり、これは、その５’末端に、ｐａｃ遺伝子のコーディング配列の下流の配列に相当する１２個のヌクレオチド配列（太字で）、ｏｒｉＴ配列の開始部に相当する２０個のヌ
クレオチド配列を含み、第二のプライマーは、プライマーＤであり、その配列は、

であり、これは、ＥｃｏＲＶ制限部位（一本下線で示される）、および、ｏｒｉＴ配列の末端に相当する２０個のヌクレオチド配列（二重下線で示される）を含む（図２９，第二のＰＣＲを参照）。 For the oriT gene, the plasmid pPM803 (P. Mazodier et al., 1989) was amplified by PCR using the following primers; where the first primer is primer C and its sequence is

Which comprises, at its 5 ′ end, a 12 nucleotide sequence (in bold) corresponding to the sequence downstream of the coding sequence of the pac gene, a 20 nucleotide sequence corresponding to the start of the oriT sequence, The second primer is primer D, whose sequence is

This includes an EcoRV restriction site (indicated by a single underline) and a 20 nucleotide sequence (indicated by a double underline) corresponding to the end of the oriT sequence (FIG. 29, second PCR). See).

  The amplification products obtained with primers A and B and the amplification products obtained with primers C and D have a consensus sequence consisting of 24 nucleotides at one of their ends. The third PCR was performed by previously mixing the two obtained amplification products and using primers A and D as primers (see FIG. 29, third PCR). As a result, an amplification product corresponding to the combination pac + oriT could be obtained. This pac-oriT fragment was then cloned into the vector pGEM-T Easy (commercially available from Promega (Madison, Wisconsin, USA)), which resulted in the expression of “plasmid pGEM-T-pac-oriT”. Could get to get. The insert of this plasmid was then subcloned into cosmid pWED1. For this, the plasmid pGEM-pac-oriT was digested with the EcoRV enzyme and the EcoRV insert containing the combination pac + oriT was inserted into the cosmid pWED1 previously opened with the HpaI enzyme. The cosmid thus obtained was named pWED2 (see FIG. 30).

  This cosmid can facilitate gene inactivation in Streptomyces. In particular, this cosmid has an oriT sequence (which can be introduced by conjugation from an appropriate E. coli strain to Streptomyces) and further relates to resistance to antibiotics that confer a detectable phenotype in Streptomyces. Have a gene. Such a cosmid containing a large insert of Streptomyces ambofaciens genomic DNA can be used for gene inactivation experiments.

  Thus, the cosmid obtained from pWED2 containing the target gene is, for example, an E. coli containing plasmid pKOBEG. It can also be introduced into the E. coli strain KS272 (see Chaveroche et al., 2000) and the cassette is introduced into the target gene according to the technique described by Chaveroche et al. (2000). Next, a cosmid obtained by this technique (a cosmid in which the target gene is inactivated) is an E. coli strain such as S17.1 strain. It can also be introduced into E. coli strains or any other strain that can be transferred to Streptomyces by conjugation with a plasmid containing the oriT sequence.

  E. After conjugation of E. coli and Streptomyces, a Streptomyces clone (where the wild-type copy of the target gene has been replaced with an interrupted copy) can be obtained as described in Example 2.

  The resistance gene expressed in Streptomyces present in this novel cosmid is the pac gene of Streptomyces alboniger (J. Vara et al., 1985; Lacalle et al., 1989), Encodes puromycin N-acetyltransferase and confers puromycin resistance. In a gene inactivation experiment, a clone in which a double recombination phenomenon has occurred is searched. These clones have the cosmid pWED2 removed and are therefore again sensitive to puromycin.

18.2. E. coli with cosmid pWED2. Streptomyces ambov in Koli
Construction of genomic DNA library of Vasiens OSC2 strain The genomic DNA of Streptomyces ambofaciens OSC2 strain was partially digested with BamHI restriction enzyme so as to obtain a DNA fragment having a size of about 35 to 45 kb. These fragments were then cloned into cosmid pWED2, previously digested with BamHI, followed by treatment with alkaline phosphatase. Then, Promega by commercially available "Packagene ^(R) lambda DNA packaging system" (Madison, WI, USA) used in accordance with the manufacturer's instructions, were encapsidated lambda phage particles The ligation mixture in vitro . Using the obtained phage particles, E. coli was used. E. coli strain SURE® ⁽ commercially available from Stratagene (La Jolla, Calif., USA)) was infected. Clones were selected with LB medium + ampicillin (50 μg / ml) (cosmid pWED2 confers ampicillin resistance).

Example 19: Isolation of a novel library cosmid covering a region of the biosynthesis pathway of spiramycin. Subcloning and sequence analysis of these cosmid fragments
19.1. Hybridization of Streptomyces ambofaciens OSC2 genomic library on colonies:
Orf1 ^{* to} orf10 ^* , or part or all of orf1 to orf25c, or a cosmid of a new library of Streptomyces ambofaciens OSC2 (see Example 18) covering the region upstream of orf25c Released. For this, the E. coli obtained according to Example 18 was used. Sequential hybridization on E. coli colonies was performed using the following three probes (see FIG. 31):
The first probe used corresponds to a cosmid pSPM5 as matrix and an approximately 0.8 kb DNA fragment amplified by PCR using the following primers:
ORF23c: 5'-ACGTGCCGCGTGGAGTTCGCCGTTGC-3 '(SEQ ID NO: 130), and
ORF25c: 5'-CTGAACGAGCCCCATCGCGGGTGGC-3 '(SEQ ID NO: 131).

  The PCR product thus obtained contains the start of orf23c, orf24c (whole), and a fragment at the end of orf25c (see FIG. 31, probe I).

The second probe used is S. cerevisiae as matrix. It corresponds to the total DNA of the ambofaciens strain ATCC 23877 and a DNA fragment of approximately 0.7 kb amplified by PCR using the following primers:
ORF1 ^* c: 5′-GACCACCTCGAACCGTCCGGCGCA-3 ′ (SEQ ID NO: 132), and
ORF2 ^* c: 5′-GGCCCGGTCCAGCGTGCCGAAGC-3 ′ (SEQ ID NO: 133).

The PCR product thus obtained contains an orf1 ^* c terminus and a fragment at the start of orf2 ^* c (see FIG. 31, probe II).

  The third probe used contains orf1, orf2 and orf3 and corresponds to the approximately 3 kb EcoRI-BamHI fragment obtained by digestion of the plasmid pOS49.99 (see FIG. 31, probe III).

  Approximately 2000 clones of the library obtained in Example 18.2 were transferred to colony hybridization filters according to conventional techniques (Sambrook et al., 1989).

The first probe (see FIG. 31, probe I) is labeled with ³² P by random priming technology (a kit marketed by Roche) and after transfer to the filter, 2000 clones of the library Used for hybridization at. Hybridization was performed at 65 ° C. in a buffer described by Church and Gilbert (Church and Gilbert, 1984). Two washes were performed at 65 ° C. in 2 × SSC (0.1% SDS) for the first 10 minutes and the second 20 minutes, and then the third wash at 65 ° C. For 30 minutes in 0.2 × SSC (0.1% SDS). Under these hybridization and washing conditions, 20 clones out of 2000 hybridized showed strong hybridization signals with the first probe. These 20 clones were cultured in LB medium + ampicillin (50 μg / ml) and the corresponding 20 cosmids were extracted by alkaline lysis (Sambrook et al., 1989) and then digested with BamHI restriction enzyme. The digested products were then separated on an agarose gel, transferred onto a nylon membrane, and hybridized with the first probe under the same conditions as above (see above: PCR product ORF23c-ORF25c, probe I). Twelve cosmids contained a BamHI fragment that hybridized strongly with the probe used. These 12 types of cosmids were named pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM41, pSPM42, pSPM43, pSPM44, and pSPM45. The profiles of these 12 cosmids after digestion with BamHI were compared to each other and to the profile of cosmid pSPM5. In addition, PCR amplification experiments with different primers corresponding to different genes already identified in the region of orf1 to orf25c can position several inserts of these cosmids relative to each other, The position in the known region of orf1 to orf25c could be determined (see FIG. 32). Cosmid pSPM36 was selected more specifically because it may contain a large region upstream of orf25c (see FIGS. 31 and 32).

Next, using the same conditions as described above, 2000 clones of the Streptomyces ambofaciens OSC2 library were hybridized with a second probe corresponding to the PCR product: ORF1 ^* c- ORF2 ^* c (see FIG. 31, probe II). This hybridization was possible that the insert is isolated cosmids located in the region of the orf1 ^* c~orf10 ^* c. Under the hybridization conditions used, 16 of the 2000 hybridized clones showed strong hybridization signals with this second probe. These 16 clones were cultured in LB medium + ampicillin (50 μg / ml) and the corresponding 16 cosmids were extracted by alkaline lysis (Sambrook et al., 1989) and then digested with BamHI restriction enzyme. . The digestion profiles of these 16 cosmids (after digestion with BamHI) were compared to each other and to the profile of cosmid pSPM7. By PCR amplification experiments using the primers ORF1 ^* c and ORF2 ^* c, clearly orf1 ^* c, and includes a orf2 ^* c gene, the profile has a common band selecting two cosmids band Yes different I was able to. In addition, other PCR amplification experiments with different primers corresponding to different genes already identified in the regions orf1 ^* c to orf10 ^* c can position these cosmid inserts relative to each other, and already The position of these inserts in the known regions orf1 ^* c to orf10 ^* c could also be determined (see FIG. 32). Two more specifically selected cosmids were named pSPM47 and pSPM48 (see FIG. 32).

Using the same conditions as described above, the 2000 clones of the Streptomyces ambofaciens OSC2 library were also used for EcoRI-B of plasmid pOS49.99.
Hybridization with a third probe corresponding to the amHI DNA fragment (see FIG. 31, probe III). By this hybridization, isolating a cosmid containing the region of orf1-orf3 and possibly containing either a large part of the PKS gene or a large part of the gene orf1-orf25c of the biosynthesis pathway of spiramycin I was able to. Under these hybridization conditions, 35 clones out of 2000 hybridized showed strong hybridization signals with the third probe. These 35 clones were cultured in LB medium + ampicillin (50 μg / ml) and the corresponding 35 cosmids were extracted by alkaline lysis (Sambrook et al., 1989) and then digested with BamHI restriction enzyme. . The profiles after digesting these 35 cosmids with BamHI were compared to each other and to the profile of cosmid pSPM5. In addition, PCR amplification experiments using various primers corresponding to various genes already identified in regions orf1 to orf25c confirmed that these cosmids clearly contain the inserts obtained from regions orf1 to orf25c. And the inserts of these cosmids could be positioned relative to each other and to the already known regions orf1 to orf25c (see FIG. 32). Five cosmids were selected more specifically and were named pSPM50, pSPM51, pSPM53, pSPM55, and pSPM56 (see FIG. 32).

19.2. Subcloning and sequence analysis of insert part of cosmid pSPM36 About 0.8 kb probe obtained by PCR using primers ORF23c and ORF25c (see above and FIG. 31, probe I) was also digested with PstI enzyme. It was used for Southern blotting experiments on the total DNA of Ambofaciens OSC2. Under the hybridization conditions described above, this probe was used to digest S. coli digested with the PstI enzyme. Hybridization with total DNA of ambofaciens OSC2 revealed a single PstI fragment of about 6 kb. The PstI site is present in the region of orf23c (see SEQ ID NO: 80), but no other PstI site exists up to the end of the known sequence (BamHI site) (see SEQ ID NO: 1). This PstI-BamHI fragment is approximately 1.4 kb in size. The 6 kb PstI fragment was digested with the PstI enzyme. It hybridizes with the total DNA of ambofaciens and therefore it contains an approximately 4.6 kb region located upstream of orf25c. This region may contain other genes whose products are involved in the biosynthesis pathway of spiramycin. Digestion confirmed that cosmid pSPM36 actually contained this 6 kb PstI fragment. This fragment was isolated from pSPM36 to determine the sequence further upstream of orf25c. For this, cosmid pSPM36 was digested with PstI restriction enzyme. A PstI-PstI fragment (size approximately 6 kb) was isolated by electroelution from a 0.8% agarose gel and then by the vector pBK-CMV (4512 bp) (Stratagene, La Jolla, Calif., USA) (Commercially available). The plasmid thus obtained was named pSPM58 (see FIG. 33) and the sequence of the insert was determined. The sequence of this insert is shown in SEQ ID NO: 134. However, the determined sequence was not all, but a cap consisting of about 450 nucleotides remained, and the portion of the sequence that was not determined was indicated by a consecutive “N” in the corresponding sequence.

19.3. Analysis of novel nucleotide sequences, determination of open reading frames, and characterization of genes involved in spiramycin biosynthesis The sequence of the insert of the resulting cosmid pSPM58 was determined using the FlamePlot program (J. Ishikawa and K. Hotta, 1999). ). Thereby, the open reading frame which shows the use of the codon typical for Streptomyces was able to be identified from among the open reading frames. With this analysis,
This insert could be determined to contain four new ORFs upstream of orf25c (see FIG. 34). In the sequence analysis of the inserts of orf26 (SEQ ID NO: 107), orf27 (SEQ ID NO: 109), orf28c (SEQ ID NO: 111, pSPM58), a gap consisting of about 450 nucleotides remains. Not fully determined, these 450 nucleotides are shown in consecutive “N” form in the sequence of SEQ ID NO: 111) and orf29 (the sequence of the latter orf is incomplete in this insert) ). “C” appended to the name of the gene means that the coding sequence is reversed for the ORF in question (see FIG. 34).

  Using various programs, the protein sequences deduced from these open reading frames were compared to protein sequences present in various databases: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search (These two programs are in particular available from the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA), FASTA (WR Pearson and DJ Lipman, 1988). And WR Pearson, 1990) (This program is especially available from the INFOBIOGEN Resource Center (Evry, France)). These comparisons allowed us to compile hypotheses about the function of the products of these genes and identify those that might be involved in spiramycin biosynthesis.

19.4. Subcloning and sequencing of the other part of the insert of cosmid pSPM36 The approximately 0.8 kb probe obtained by PCR using primers ORF23c and ORF25c (see above and FIG. 31, probe I) was also digested with StuI enzyme. It was used for Southern blotting experiments with the total DNA of the strain. Under the hybridization conditions for this probe described above, this probe revealed a single StuI fragment of about 10 kb when hybridized with the total DNA of OSC2 strain digested with StuI enzyme. Given the presence of the StuI site in orf23c (see SEQ ID NO: 80) and its position relative to the PstI site, this 10 kb fragment contains all the PstI fragments studied so far (inserts of pSPM58). An area of about 4 kb that has not yet been studied was available (see FIG. 33). Digestion confirmed that cosmid pSPM36 actually contains this 10 kb StuI fragment. This fragment was isolated from cosmid pSPM36 to determine the sequence of the end of orf29 and other genes further upstream of orf29. For this, cosmid pSPM36 was digested with StuI restriction enzyme. A StuI-StuI fragment of about 10 kb in size was isolated by electroelution from a 0.8% agarose gel and then marketed by the vector pBK-CMV (4512 bp) (Stratagene, La Jolla, Calif., USA) Has been cloned). The plasmid thus obtained was named pSPM72 (see FIG. 33). The latter was then digested with EcoRI (the EcoRI site in the insert of pSPM58) and HindIII (the HindIII site of the vector's multicloning site, immediately after the StuI site at the end of the insert) (see FIG. 33). The EcoRI-HindIII DNA fragment thus obtained corresponds to a fragment of the insert of plasmid pSPM72 (see FIG. 33), which is converted into the vector pBC-SK + (Stratagene (previously digested with EcoRI and HindIII). Commercially available from La Jolla, California, USA). The plasmid thus obtained was named pSPM73 and the sequence of the insert was determined. The sequence of this insert is shown in SEQ ID NO: 135.

  The assembly of the pSPM58 and pSPM73 insert sequences is shown in SEQ ID NO: 106. This sequence begins with a PstI site in orf23c (see SEQ ID NO: 80) and continues to a StuI site in orf32c (see FIG. 34). Since the sequence of orf28c (SEQ ID NO: 111) is not complete (see Example 19.3), a region of about 450 nucleotides has not been sequenced and these 450 nucleotides are It is shown in the form of a continuous “N” in the sequence.

19.5. Analysis of novel nucleotide sequences, determination of open reading frames, and characterization of genes involved in spiramycin biosynthesis. The resulting partial sequence of the insert of cosmid pSPM73 was obtained from the FramePlot program (J. Ishikawa and K. Hotta, 1999). Year). Thereby, the open reading frame which shows the use of the codon typical for Streptomyces was able to be identified from among the open reading frames. By this analysis, it was possible to determine that this insert contains four ORFs, one incomplete and three complete (see FIG. 34). The incomplete ORF corresponds to the 3 ′ portion of the coding sequence of orf29, which is based on this same orf subsequence obtained during sequence analysis of the insert of plasmid pSPM58 (Example 19.2 and (See 19.3), the sequence of this gene could be completed; in this way, the complete sequence of orf29 could be obtained by the combination of the two sequences. In this way, the four genes were named orf29 (SEQ ID NO: 113), orf30c (SEQ ID NO: 115), orf31 (SEQ ID NO: 118), and orf32c (SEQ ID NO: 120). The “c” appended to the name of the gene means that the coding sequence is reversed for the ORF in question (see FIG. 34).

  Protein sequences inferred from these open reading frames (SEQ ID NO: 114 for orf29, SEQ ID NOS: 116 and 117 for orf30c, SEQ ID NO: 119 for orf31, and SEQ ID NO: 121 for orf32c) Was used to compare to sequences present in various databases: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search (these two programs are in particular the National Center for Biotechnology Information (NCBI) (Available from Bethesda, Maryland, USA), PASTA (WR Pearson and DJ Lipman, 1988, and WR Pearson, 1990) (this pro The ram, in particular, is available from INFOBIOGEN Resource Center (Evry, France)). These comparisons allowed us to compile hypotheses about the function of the products of these genes and identify those that might be involved in spiramycin biosynthesis.

19.6. Subcloning and sequence analysis of the third part of the insert of cosmid pSPM36 The probe corresponding to the sequence in orf32c (DNA fragment of 0.8 kb) was used as a matrix for the total DNA of the Streptomyces ambofaciens strain, and Obtained by PCR with primers:
KF36: 5′-TTGCCGTAGCCGAGGACCAGCG-3 ′ (SEQ ID NO: 151), and
KF37: 5′-CACATGGCCCTGGAGGACCCTG-3 ′ (SEQ ID NO: 152).

The PCR product thus obtained shows the internal sequence of orf32c. This probe was used for Southern blotting experiments with chromosomal DNA of OSC2 strain and DNA of cosmid pSPM36 digested with PstI enzyme. Using the same hybridization conditions as described above (see Example 19.1), this probe hybridized to total DNA of OSC2 strain and DNA of cosmid pSPM36 digested with PstI enzyme, about 3 Two PstI fragments of .4 kb and 2.5 kb were revealed. Considering the presence of the PstI site in the probe used, these results can be explained. The first DNA fragment with a size of about 3.4 kb is a fragment whose sequence is already fully known. The sequence of the 2.5 kb fragment is only partially known over the 700 bp region. This fragment was isolated from cosmid pSPM36 to determine the sequence of the end of orf32c and other genes upstream of the latter. For this, cosmid pSPM36 was digested with PstI restriction enzyme. A PstI-PstI fragment of about 2.5 kb in size was isolated by purification from a 0.8% agarose gel and then marketed by the vector pBK-CMV (4518 bp) (Stratagene, La Jolla, Calif., USA) Has been cloned). The plasmid thus obtained was named pSPM79 (see FIG. 41) and the sequence of the insert was determined.

  The sequence of orf28c (SEQ ID NO: 111) was not complete (see Example 19.3). In particular, a region of about 450 nucleotides cannot be determined, and these 450 nucleotides are shown in consecutive “N” form in the sequence of SEQ ID NO: 106. The sequence of the entire lost region was determined by resequencing this region. Therefore, the entire sequence of pSPM58 and pSPM73 inserts was determined. The complete sequence of the coding portion of orf28c is shown in SEQ ID NO: 141, and the protein deduced from this sequence is shown in SEQ ID NO: 142. The sequence of the insert of plasmid pSPM79 is shown in SEQ ID NO: 161.

  The assembly of the insert sequence of pSPM58, pSPM73, and pSPM79 is shown in SEQ ID NO: 140 (see FIG. 41). This sequence begins with the PstI site in orf23c (see SEQ ID NO: 80) and continues to the PstI site in orf34c (see FIG. 41).

19.7. Analysis of novel nucleotide sequences, determination of open reading frames, and characterization of genes that may be involved in spiramycin biosynthesis. The sequence of the resulting plasmid pSPM79 insert was obtained from the FramePlot program (Ishikawa J and Hotta K.). 1999). Thereby, the open reading frame which shows the use of the codon typical for Streptomyces was able to be identified from among the open reading frames. By this analysis, it was possible to determine that this insert contains 3 ORFs, 2 are incomplete (orf32c and orf34c), and 1 is complete (orf33) (FIG. 41). See).

  The first incomplete ORF corresponds to the 5 'portion of the coding sequence of orf32c. This allows the sequence of this gene to be completed (see Examples 19.4 and 19.5) based on this same partial sequence of orf obtained during sequence analysis of the insert of plasmid pSPM73, Thus, the complete sequence of orf32c could be obtained by the combination of the two sequences (SEQ ID NO: 145). “C” appended to the name of the gene means that the coding sequence is reversed for the ORF in question (see FIG. 41). The complete orf was named orf33 (SEQ ID NO: 147). The third ORF was named orf34c (SEQ ID NO: 149). “C” appended to the name of the gene means that the coding sequence is reversed for the ORF in question (see FIG. 37). By comparison between the product of this orf and the data bank, the C-terminal part of the protein is not a product deduced from its nucleotide sequence, and therefore the orf was longer and sequenced. It is shown to continue beyond the area.

  Using various programs, the protein sequences deduced from these open reading frames were compared to protein sequences present in various databases: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search (These two programs are in particular available from the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA), FASTA (Pearson WR and DJ Lipman, 1988). And Pearson WR, 1990) (This program is especially available from the INFOBIOGEN Resource Center (Evry, France)). These comparisons made it possible to compile hypotheses about the function of the products of these genes and to identify genes that might be involved in spiramycin biosynthesis.

Example 20: Analysis of intermediate production of spiramycin biosynthesis :
20.1. Sample manufacture :
The various strains to be tested were each cultured in Erlenmeyer with 500 ml baffles containing 70 ml of 7 MP5 media (Pernodet et al., 1993). In Erlenmeyer, 2.5 × 10 ⁶ spores / ml of various S.P. An ambofaciens strain was planted and grown at 27 ° C. for 96 hours with shaking at 250 rpm. Culture fluids corresponding to the same clones were pooled and optionally filtered through a fluted filter and centrifuged at 7000 rpm for 15 minutes.

  Next, the pH of the culture solution was adjusted to 9 with sodium hydroxide, and the supernatant was extracted with methyl isobutyryl ketone (MIBK). The organic phase (MIBK) was then collected and evaporated. The dry extract was then absorbed into 1 ml of acetonitrile and then diluted 1/10 (100 μl aliquot to 1 ml with water) before being used for liquid chromatography / mass spectrometry (LC / MS) analysis.

20.2. Sample analysis by LC / MS:
Samples were analyzed by LC / MS to determine the mass of the various products synthesized by the strain to be tested.

The high performance liquid chromatography column used is a Kromasil C8 150 ^* 4.6 mm, 5 mm, 100Å column.

  The mobile phase is a concentration gradient consisting of a mixture of acetonitrile and 0.05% aqueous trifluoroacetic acid, and the flow rate is fixed at 1 ml / min. The temperature of the column oven is maintained at 30 ° C.

  UV detection at the column outlet was performed at two different wavelengths: 238 nm and 280 nm.

  The mass spectrometer connected to the chromatography column is a single quadrupole device (cone voltages 30V and 70V) marketed by Agilent.

20.3. Analysis of biosynthetic intermediates produced by OS49.67 strain:
The OS49.67 strain in which the orf3 gene was inactivated by intraphase deletion does not produce spiramycin (see Examples 6 and 15).

  Samples were prepared according to the method described above (see paragraph 20.1) and analyzed by LC / MS as described above (see paragraph 20.2).

  More specifically, chromatographic analysis shows that as a mobile phase, time T = 0-5 minutes is increased to 20% acetonitrile, then linearly to 30% at T = 35 minutes, followed by T = 50 minutes. Up to a plateau until the solvent gradient.

  Under these conditions, more specifically two products are observed: absorption at 238 mn (retention time 33.4 minutes) and absorption at 280 nm (retention time 44.8 minutes) (see FIG. 35). It was done. FIG. 35 shows the juxtaposition of the HPLC chromatograms produced at 238 and 280 nm (top), as well as the UV spectra (bottom) of molecules eluting at 33.4 and 44.8 minutes.

The coupled mass spectrometry analysis conditions were as follows: Scanning was performed in scan mode covering a mass range of 100-1000 Da. The gain of the electromultiplier was set to 1V. For the electrospray source, the atomizing gas pressure was 35 psig, the drying gas flow rate was 12.0 l / min, the drying gas temperature was 350 ° C., and the capillary voltage was +/− 3000V. These experiments allowed the masses of the two separated products to be determined. These masses are respectively 370 g / mol for the first eluted product (major product of [M−H ₂ O] ⁺ = 353) and 368 g / mol for the second product ([M−H ₂ O ] ⁺ = 351 major products).

  To obtain the structure, the above product was isolated and purified under the following conditions: The mobile phase is a 70/30 (v / v) mixture of 0.05% aqueous trifluoroacetic acid and acetonitrile. Chromatography is performed in a homogeneous system at a fixed flow rate of 1 ml / min. Under these conditions, the retention times of the two products are 8 and 13.3 minutes, respectively. In addition, in this case, the prepared sample (see paragraph 20.1) is injected without dilution with water.

  The two products are collected at the outlet of the chromatogram column and isolated under the following conditions: Oasis HLB 1 cc 30 mg cartridge (Waters) is 1 ml acetonitrile, then water / acetonitrile. Continuously adjusted with 1 ml of (20 v / 80 v) and 1 ml of 80/20 water / acetonitrile. The sample is then introduced and the cartridge washed sequentially with 1 ml of water / acetonitrile (95/5) and 1 ml of water / deuterated acetonitrile (95/5), then 40/60 water / acetate. Elute with 600 μl of deuterated acetonitrile. Next, the collected solution is directly analyzed by NMR.

The NMR spectra obtained for these two compounds are as follows:
-Eluted first product: platenolide A: (spectrum 9646V), 1H spectrum (chemical shift; ppm) in CD3CN: 0.90 (3H, t, J = 6Hz), 0.93 (3H, d, J = 5Hz), 1.27 (3H, d, J = 5Hz), 1.27-1.40 (3H, m), 1.51 (1H, m), 1.95 (1H, m), 2.12 (1H, m), 2.30 (1H, d, J = 12Hz) , 2.50 (1H, d, J = 11Hz), 2.58 (1H, dd, J = 9 and 12 Hz), 2.96 (1H, d, J = 7Hz), 3.43 (3H, s), 3.70 (1H, d, J = 9Hz), 3.86 (1H, d, J = 7Hz), 4.10 (1H, m), 5.08 (1H, m), 5.58 (1H, dt, J = 3 and 12Hz), 5.70 (1H, dd, J = 8 and 12 Hz), 6.05 (1H, dd, J = 9 and 12 Hz), 6.24 (1H, dd, J = 9 and 12 Hz).

  -Second product eluted: platenolide B: (spectrum 9647V), 1H spectrum (chemical shift; ppm) in CD3CN: 0.81 (3H, t, J = 6Hz), 0.89 (1H, m), 1.17 (3H, d , J = 5Hz), 1.30 (4H, m), 1.47 (2H, m), 1.61 (1H, t, J = 10Hz), 2.20 (1H, m), 2.38 (1H, d, J = 13Hz), 2.52 (1H, m), 2.58 (1H, m), 2.68 (1H, dd, J = 8 and 13Hz), 3.10 (1H, d, J = 7Hz), 3.50 (3H, s), 3.61 (1H, d, J = 8Hz), 3.82 (1H, d, J = 7Hz), 5.09 (1H, m), 6,20 (1H, m), 6.25 (1H, dd, J = 9 and 12 Hz), 6.58 (1H, d, J = 12 Hz), 7.19 (1H, dd, J = 9 and 12 Hz).

  Thus, these experiments allowed the structures of these two compounds to be determined. The first product eluted is platenolide A and the second product is platenolide B; the structure of these two molecules deduced is shown in FIG.

In addition, using LC / MS technology together with NMR under slightly different conditions than those described above (however, the setting is well known to those skilled in the art), the OS49.67 strain, in addition to platenolides A and B, It was also possible to produce and determine derivatives of these two compounds. They are platenolide A + micalose and platenolide B + mycarose (the structures of these two compounds are shown in FIG. 40). Table 42 shows the analysis results of the culture solution of OS49.67 strain.

20.4. Analysis of biosynthetic intermediates produced by SPM509 strain :
SPM509 strain (orf14 :: att3Ωaac−) in which the orf14 gene is inactivated does not produce spiramycin (see Examples 13, 15 and 16). Samples were prepared according to the method described above (see paragraph 20.1) and analyzed by LC / MS as described above (see paragraphs 20.2 and 20.3). By analysis of the biosynthetic intermediate present in the culture supernatant of the SPM509 strain cultured in MP5 medium, this strain produces only platenolide type B (see “Platenolide B”, see FIG. 36) and type A (“ Platenolide A "(see Figure 36) was shown not to be produced.

Example 21: The orf14 gene interrupt of the orf14 gene in a strain having a knockout in the orf3 gene (OS49.67) is essential for spiramycin biosynthesis (see Examples 13, 15 and 16: SPM509 strain, this gene Has been interrupted and no longer produces spiramycin). Analysis of the biosynthetic intermediate present in the culture supernatant of SPM509 strain cultured in MP5 medium showed that this strain produced only platenolide type B and not type A (Example 20). See). One hypothesis that can explain this observation is that the product of orf14 is involved in the conversion of the platenolide form B to form A by an enzymatic reduction process. To test this hypothesis, spiramycin was no longer produced, but the orf14 gene was inactivated with a mutant producing platenolide forms A and B. This is the case for the OS49.67 strain (Δorf3) in which the orf3 gene was inactivated by deletion within the phase (see Examples 6 and 20). In order to inactivate the orf14 gene in this strain, plasmid pSPM509 was introduced by protoplast transformation of OS49.67 strain (T. Kieser et al., 2000). The inactivation of the orf14 gene has already been explained in the case of the OSC2 strain (see Example 13), and the same procedure was performed on the OS49.67 strain for the inactivation of the orf14 gene. After transformation with plasmid pSPM509, clones were selected for their apramycin resistance. Next, the apramycin resistant clones were subcultured in an apramycin-containing medium and a hygromycin-containing medium, respectively. A clone resistant to apramycin (ApraR) and a clone sensitive to hygromycin (HygS), in principle, have undergone a double crossover during the event, and the orf14 gene is att3Ωaac− A clone replaced with a copy of orf14 interrupted with a cassette. These clones were selected more specifically and the replacement of the wild type copy of orf14 with the cassette interrupted copy was confirmed by hybridization. Therefore, the total DNA of the obtained clone was digested with several enzymes, separated on an agarose gel, transferred onto a membrane, hybridized with a probe corresponding to the att3Ωaac-cassette, and gene replacement actually occurred It was confirmed. Genotype confirmation can also be performed by any method known to those skilled in the art, and in particular by PCR using appropriate oligonucleotides and sequence analysis of PCR products.

  A clone (Δorf3, orf14 :: att3Ωaac−) exhibiting the expected characteristics was selected more specifically and named SPM510. In fact, based on two hybridizations, the att3Ωaac-cassette is actually present in the genome of this clone, and in the interrupted copy of the wild type orf14 gene in the genome of this clone with the att3Ωaac-cassette. It was possible to confirm that the expected digestion profile was actually obtained in the case of replacement (after double recombination events).

ならびに、マトリックスとして、ＯＳＣ２株の染色体ＤＮＡを用いたＰＣＲによって増幅した。オリゴヌクレオチドＥＤＲ３１およびＥＤＲ３７はそれぞれ、ＨｉｎｄＩＩＩおよびＸｂａＩ制限部位を有する（太字の配列）。このようにして得られた１．２ｋｂのフラグメントを、ベクターｐＧＥＭ−Ｔイージー（プロメガ社（マディソン，ウィスコンシン州，米国）により市販されている）にクローニングし、プラスミドｐＳＰＭ５１５を得た。次に、このプラスミドを、ＨｉｎｄＩＩＩおよびＸｂａＩ制限酵素で消化した。得られた１．２ｋｂのＨｉｎｄＩＩＩ／ＸｂａＩインサートを、同じ酵素で予めで消化されたベクターｐＵＷＬ２０１にクローニングした（実施例１７．１を参照）。このようにして得られたプラスミドを、ｐＳＰＭ５１９と命名した。 Example 22: Functional complementarity of orf14 gene interrupts :
22.1. Construction of plasmid pSPM519 :
The orf14 gene is converted into the following oligonucleotide pair:

And it amplified by PCR using the chromosomal DNA of OSC2 strain as a matrix. Oligonucleotides EDR31 and EDR37 have HindIII and XbaI restriction sites, respectively (bold sequence). The 1.2 kb fragment thus obtained was cloned into the vector pGEM-T Easy (commercially available from Promega (Madison, Wis., USA)) to obtain the plasmid pSPM515. This plasmid was then digested with HindIII and XbaI restriction enzymes. The resulting 1.2 kb HindIII / XbaI insert was cloned into the vector pUWL201 previously digested with the same enzymes (see Example 17.1). The plasmid thus obtained was named pSPM519.

22.1. Transformation of SPM509 and SPM510 strains with plasmid pSPM519 :
Plasmid pSPM519 was introduced into SPM509 strain (see Example 13) and SPM510 strain (see Example 17) by protoplast transformation (T. Kieser et al., 2000). After transformation, clones were selected for their thiostrepton resistance. Next, the clone was subcultured in a thiostrepton-containing medium.

  SPM509 strain is a non-spiramycin producer strain (see Examples 13, 15 and 16 and FIG. 24). Spiramycin production of the SPM509 strain transformed with the vector pSPM519 (strain called SPM509 pSPM519) was analyzed by culturing this strain in MP5 medium in the presence of thiostrepton. The culture supernatant was then analyzed by HPLC (see Examples 16 and 17). The results of this analysis are shown in Table 43, and the data are shown in mg / liter supernatant. The results correspond to the total production of spiramycin (obtained by adding the production of spiramycin I, II and III). It was observed that spiramycin production was restored by the presence of the vector pSPM519 in SPM509 strain (see Table 43).

  Strain SPM510 transformed with plasmid pSPM519 was named SPM510 pSPM509.

Example 23: S.I. Functional complementation of the orf3 gene interrupt by the Fradiae tylB gene
23.1. Construction of plasmid pOS49.52 :
Plasmid pOS49.52 is It corresponds to a plasmid capable of expressing TylB protein in ambofaciens. To build this, S. The coding sequence of the Fradiae tylB gene (Merson-Davies and Cundlife, 1994, GenBank accession number: U08223 (region sequence), SFU08223 (DNA sequence) and AAA21342 (protein sequence)) was introduced into the plasmid pKC1218 (Bierman et al. 1992, Kieser et al., 2000, E. coli strains containing this plasmid are available under the number B-14790, particularly from ARS (NRRL) Agricultural Research Service Collection (Peoria, Illinois, USA). ). In addition, the coding sequence was placed under the control of the ermE ^* promoter (see in particular Example 17.1, Bibb et al., 1985, Bibb et al., 1994).

23.1. Transformation of OS49.67 strain with plasmid pOS49.52 :
The OS49.67 strain in which the orf3 gene is inactivated by deletion within the phase does not produce spiramycin (see Examples 6 and 15). Plasmid pOS49.52 was introduced into OS49.67 strain by protoplast transformation (T. Kieser et al., 2000). After transformation, clones were selected for their apramycin resistance. Next, the clones were subcultured in a medium containing apramycin. A more specific clone was selected and named OS49.67 pOS49.52.

As demonstrated above, the OS49.67 strain does not produce spiramycin (see Examples 6 and 15). Spiramycin production of OS49.67 strain transformed with vector pOS49.52 was analyzed by the technique described in Example 15. In this way, it was possible to demonstrate that this strain has the phenotype of the spiramycin producer. Thus, TylB protein allows functional complementation of the orf1 gene interrupt.

Example 24: Improvement of spiramycin production by overexpression of the orf28c gene
24.1. Construction of plasmid pSPM75 :
The orf28c gene was amplified by PCR using an oligonucleotide pair containing a HindIII restriction site or a BamHI restriction site. These primers have the following sequences:

Primers KF30 and KF31 have HindIII and BamHI restriction sites (bold sequence), respectively. With the primer pair KF30 and KF31, a DNA fragment containing the orf28c gene having a size of about 1.5 kb can be amplified using cosmid pSPM36 (see above) as a matrix. The 1.5 kb fragment thus obtained was cloned into the vector pGEM-T Easy (commercially available from Promega (Madison, Wis., USA)) to obtain the plasmid pSPM74. Next, plasmid pSPM74 was digested with HindIII and BamHI restriction enzymes and the resulting approximately 1.5 kb HindIII / BamHI insert was subcloned into vector pUWL201 previously digested with the same enzymes (see Example 17.1). ). The plasmid thus obtained was named pSPM75; it contains all the coding sequences placed under the control of the orf28c ermE ^* promoter.

24.2. Transformation of OSC2 strain with plasmid pSPM75 :
Plasmid pSPM75 was introduced into OSC2 strain by protoplast transformation (T. Kieser et al., 2000). After protoplast transformation, clones were selected for their thiostrepton resistance. Next, the clones were subcultured in a thiostrepton-containing medium, and plasmid transformation was confirmed by plasmid extraction. Two clones were more specifically selected and named OSC2 / pSPM75 (1) and OSC2 / pSPM75 (2).

  Samples of the OSC2 / pSPM75 (2) strain were collected at Collection National de Cultures de Microorganisms (CNCM) [National Collection of Cultures 10th Annual Microorganisms] On the day, it was deposited with registration number I-3101.

To test the effect of overexpression of the orf28c gene on spiramycin production, the spiramycin production of OSC2 / pSPM75 (1) and OSC2 / pSPM75 (2) clones was tested with the technique described in Example 15. Analysis of spiramycin production of OSC2 strain was also performed in parallel for comparison. In this way, it could be observed that the presence of plasmid pSPM75 significantly increased the spiramycin production of the OSC2 strain.
This demonstrates that overexpression of orf28c results in an increase in spiramycin production, confirming its role as a regulator.

  The spiramycin production of OSC2 / pSPM75 (1) and OSC2 / pSPM75 (2) clones was also analyzed by HPLC (in the same way as Example 17.2). Analysis of spiramycin production of OSC2 strain was also performed in parallel for comparison. The results of this analysis are shown in Table 44, and the data are shown in mg / liter supernatant. The results correspond to the total production of spiramycin (obtained by adding the production of spiramycin I, II and III).

  Thus, it is observed that the presence of plasmid pSPM75 significantly increases the spiramycin production of the OSC2 strain. This clearly indicates that overexpression of orf28c has a positive effect on spiramycin production.

Example 25: Analysis of spiramycin biosynthetic intermediate production by strains inactivated in the orf8 gene :
The OS49.107 strain in which the orf8 gene is inactivated by insertion of the Ωhyg cassette does not produce spiramycin (see Examples 7 and 15). The orf8 gene encodes a protein that exhibits a relatively strong similarity to several aminotransferases, and the orf8 gene encodes a 4-aminotransferase that is involved in the transamination reaction required for forosamine biosynthesis (see FIG. 6). ) Strongly suggests. Therefore, spiramycin biosynthesis is expected to be blocked at the forosidine step (see FIG. 7). Therefore, OS49.107, a non-spiramycin producer, produces forosidine.

  Samples of the supernatant of OS49.107 strain were prepared according to the method described above (see Example 16 except for MIBK extraction) and analyzed by LC / MS as described above (paragraphs 20.2 and 20.3). See). In SIM mode, the mass 558 for forocidin molecular ion was selected and several peaks were detected. The presence of a compound with a mass of 558 is consistent with the hypothesis of orf8 that has a role in forosamine synthesis.

Example 26: Analysis of production of spiramycin biosynthetic intermediates by strains inactivated in the orf12 gene :
SPM507 strain in which the orf12 gene is inactivated does not produce spiramycin (see Examples 11 and 15). The orf12 gene is thought to encode 3,4-dehydratase involved in the dehydration reaction necessary for forosamine biosynthesis (see FIG. 6). Therefore, spiramycin biosynthesis is expected to be blocked at the forosidine step (see FIG. 7). SPM507, a non-spiramycin producing strain, should therefore produce forosidine.

A sample of the supernatant of SPM507 strain was prepared according to the method described above (see Example 16,
However, except for MIBK extraction), it was analyzed by LC / MS as described above (see paragraphs 20.2 and 20.3). Under these conditions, the retention time of forocidin is about 12.9 minutes. In SIM mode, the mass 558 for the molecular ion [M + H] ⁺ of forocidin was selected and a peak was detected. The presence of 558 compounds makes it possible to confirm the hypothesis that the product of orf12 has a role in spiramycin biosynthesis.

However, the amount of forosidin present is relatively small, and under these conditions the product that absorbs at 238 nm is more specifically observed (retention time 17.1 minutes). By LC / MS analysis, the mass of this compound could be determined as 744.3 g / mol ([M + H] ⁺ = 744.3, main product).

  To obtain the structure, the product described above was isolated and purified under the conditions described above (see paragraph 20.1). The organic phase (MIBK) was then collected and evaporated. The dried extract was absorbed into water and extracted with heptane. The aqueous solution is then extracted by binding to a 1 g cartridge of Oasis HLB (Waters SAS, St-Quentin en-Yvelines, France). The compound is recovered by elution with a 30/70 water / acetonitrile mixture. Next, this solution is injected into an analytical column (100 μl), and fractions are collected with an Oasis HLB 1 cc 30 mg cartridge (Waters). Prior to use, a 1 cc 30 mg cartridge (Waters) of Oasis HLB is continuously conditioned with acetonitrile followed by a water / acetonitrile mixture (20 v / 80 v) and an 80/20 water / acetonitrile mixture.

  Next, a 1 cc 30 mg cartridge (Waters) of Oasis HLB was washed sequentially with 1 ml of water / acetonitrile (95/5) and 1 ml of water / deuterated acetonitrile (95/5), followed by 40 / Elute with 600 μl of 60 water / deuterated acetonitrile. Next, the collected solution is directly analyzed by NMR.

The NMR spectrum obtained for this compound is as follows (19312 V NMR spectrum):
1H spectrum (chemical shift; ppm) in CD3CN / D20: 0.92 (3H, d, J = 6Hz), 1.10 (1H, unresolved peak), 1.14 (3H, s), 1.17 (3H, d, J = 6Hz), 1.22 (3H, d, J = 6Hz), 1.25 (3H, d, J = 6Hz), 1.40 (1H, unresolved peak), 1.75 (1H, dd, J = 12 and 2Hz), 1.81 (1H, unresolved peak) , 1.90 (1H, d, J = 12Hz), 2.05 (1H, unresolved peak), 2.12 (3H, s), 2.15 (1H, unresolved peak), 2.35 (2H, unresolved peak), 2.45 (6H, broad s) , 2.53 (1H, unresolved peak), 2.64 (1H, dd, J = 12 and 9Hz), 2.80 (1H, dd, J = 9 and 16Hz), 2.95 (1H, d, J = 8Hz), 3.23 (2H, unresolved peak), 3.34 (1H, d, J = 7Hz), 3.45 (3H, s), 3.49 (1H, unresolved peak), 3.93 (1H, dd, J = 7 and 3Hz), 4.08 (1H, unresolved peak) , 4.37 (1H, d, J = 6Hz), 4.88 (1H, unresolved peak), 5.05 (2H, unresolved peak), 5.65 (2H, unresolved peak), 6.08 (1H, dd, J = 8 and 12Hz), 6.40 (1H, dd, J = 12 and 9Hz), 9.60 (1H, s).

  Thus, the structure of this compound can be determined by these experiments, and this structure is shown in FIG.

Example 27: Analysis of production of spiramycin biosynthetic intermediates by strains inactivated in the orf5 ^* gene :
SPM501 strain has the genotype: orf6 ^* :: att1 hyg +. orf6 ^* based on the polarity effect of insertion of att1 hyg + cassette into the gene, orf5 ^* gene could be determined that it is essential to spiramycin biosynthetic pathway. In particular, by insertion of excisable cassette into the coding portion of the orf6 ^* gene, based on the polar effect on the expression of orf5 ^* gene, results in complete inhibition of spiramycin production. However, once the inserted cassette is excised (and therefore only if the orf6 ^* gene is inactivated, see Examples 14 and 15), the production of spiramycin I is restored. This demonstrates that the orf5 ^* gene is essential for spiramycin biosynthesis because its inactivation completely blocks spiramycin production.

The orf5 ^* gene encodes a protein that exhibits a relatively strong similarity to several O-methyltransferases. The orf5 ^* gene is thought to be an O-methyltransferase involved in platenolide biosynthesis. To confirm this hypothesis, the genotype obtained from a strain overproducing spiramycin: orf6 ^* :: att1 hyg + S. cerevisiae. LC / MS and NMR analysis experiments were performed on the ambofaciens strain.

A sample of the supernatant of this strain was prepared according to the method described above (see Example 16, except for MIBK extraction) and analyzed by LC / MS as described above (see paragraphs 20.2 and 20.3). ). However, the column used was an X-Terra column (Waters SAS, St-Quentin-Yvelines, France) and the cone voltage of the spectrometer seems to give a fermentation of the compound to be analyzed. 380V. Under these conditions, a product with a retention time of about 13.1 minutes is observed. The mass spectrum of this compound shows characteristics similar to the mass spectrum of spiramycin I, but the molecular ion is 829. The 14 difference in mass compared to the mass of spiramycin can be explained by the absence of a methyl group in the oxygen produced by the fourth carbon of the lactone ring (the structure of this compound is shown in FIG. 39). The presence of the compound at 829 makes it possible to confirm the hypothesis that orf5 ^* has a role in spiramycin biosynthesis. M.M. Using microbiological tests performed on the susceptibility of the Luteus strain (see Example 15 and FIG. 18), an intermediate molecule produced by the orf6 ^* :: Ωatthyg + strain (spiramycin-methyl group, this structure (Shown in FIG. 39) was demonstrated to be significantly less active (about a factor of 10) than the source spiramycin having a methyl group at the 4-position.

Example 28: Construction of a new “cuttable cassette” :
A new excisable cassette was constructed. These cassettes are very similar to the cuttable cassettes already described in Example 9. The main difference between the previous cassette and the new cassette is that in the latter there is no sequence corresponding to the end of the Ω interposon (this sequence includes the transcription terminator obtained by T4 phage).

  In a cassette that does not contain a terminator, the gene that confers resistance to antibiotics has excisable attR and attL sequences at the ends. The resistance gene is the aac (3) IV gene encoding acetyltransferase that confers apramycin resistance. This gene is present in the Ωaac cassette (GenBank accession number: X99313, Blondelet-Rouault, MH et al., 1997), which serves as a matrix, plasmid pOSK-1102 (see above), and primer Amplified by PCR using oligonucleotides KF42 and KF43 (each containing a HindIII restriction site (in bold) (AAGCTT) at position 5 ').

  The resulting PCR product of approximately 1 kb was transformed into E. coli. The plasmid pSPM83 was produced by cloning into the coli vector pGEMT Easy.

  Vector pSPM83 was digested with HindIII restriction enzyme. Various possible excisables such that the HindIII-HindIII fragment of the insert is isolated by purification from a 0.8% agarose gel, replacing the HindIII fragment corresponding to acc with the HindIII fragment corresponding to the aac gene alone The plasmids were cloned into the HindIII site located between the attL and attR sequences of various plasmids (see Example 9 and FIG. 27) with the correct cassette. This made it possible to obtain att1aac, att1aac and att3aac cassettes (see Example 9 depending on the desired phase). Depending on the orientation of the aac gene relative to the attL sequence and the attR sequence, att1aac +, att1aac−, att2aac +, att1aac−, att3aac + and att3aac− are distinguished (following the same rules used in Example 9).

Example 29: S. cerevisiae having a knockout in the orf28c gene Construction of ambofaciens strains :
The orf28c gene was inactivated using excisable cassette technology. Using the excisable cassette att3aac + (see Example 28) as a matrix, plasmid pSPM101 (plasmid pSPM101 is a plasmid obtained from the vector pGP704Not (Chaveroche et al., 2000) (Miller VL and Mekalanos JJ, 1988) , In which the att3aac + cassette was cloned as an EcoRV fragment into the unique EcoRV site of pGP704Not) and amplified by PCR using the following primers:

  The 39 nucleotides located at the 5 ′ end of these oligonucleotides contain the sequence corresponding to the sequence in the orf28c gene, and the 26 nucleotides located at the extreme 3 ′ position (shown in bold and underlined above) Corresponds to any one of the ends of the cassette att3aac + which can be excised.

The PCR product thus obtained was used to overrecombine E. coli containing cosmid pSPM36. E. coli strain DY330 (Yu et al., 2000) (this strain contains the exo, bet and gam genes of lambda phage, which are integrated into the chromosome, which are expressed at 42 ° C. The KS272 strain (used instead of Chaveroche et al., 2000)) was transformed. Bacteria were therefore transformed with this PCR product by electroporation and clones were selected for their resistance to apramycin. The resulting digestion profile was expected when insertion of the cassette (att3aac +) into the orf28c gene occurred, ie when homologous recombination between the end of the PCR product and the target gene actually occurred In order to confirm that it corresponds to the profile, the cosmid of the obtained clone was extracted and digested with BamHI restriction enzyme. The construct can also be confirmed by any method known to those skilled in the art, and in particular by PCR using a suitable oligonucleotide and sequence analysis of the PCR product. A clone was selected that had a profile in which the cosmid was expected and the corresponding cosmid was named pSPM107. This cosmid is a pSPM36 derivative in which orf28c is interrupted with the att3aac + cassette. The insertion of the cassette is accompanied by a deletion in the orf28c gene, and the interrupt begins at the 28th codon of orf28c. After the cassette, the last 137 codons of orf28c remain.

  In the first step, cosmid pSPM107 It is introduced into the E. coli strain DH5α and subsequently introduced into the Streptomyces ambofaciens OSC2 strain by protoplast transformation. After transformation, clones were selected for their resistance to apramycin. Next, the apramycin resistant clones were subcultured in an apramycin (antibiotic B) -containing medium and a puromycin (antibiotic A) -containing medium, respectively (see FIG. 9). A clone that is resistant to apramycin (ApraR) and a clone that is sensitive to puromycin (PuroS) are, in principle, double-crossed during the event and orf28c interrupted with the att3aac + cassette. A clone having a gene. These clones were selected more specifically and the replacement of the wild-type copy of orf28c with the copy interrupted by the cassette was confirmed by hybridization. Therefore, in order to confirm the presence of the cassette at the expected locus in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several kinds of enzymes, separated by agarose gel, And hybridized with the probe corresponding to the att3aac + cassette. The genotype can also be confirmed by any method known to those skilled in the art, and in particular by PCR using a suitable oligonucleotide and sequence analysis of the PCR product.

  A clone (orf28c :: att3aac +) exhibiting the expected characteristics is more specifically selected and designated as SPM107. Therefore, this clone had the genotype: orf28c :: att3aac + and was named SPM107. Given the gene orientation (see FIG. 3), it is not necessary to excise the cassette to study the effect of orf28c inactivation. The orientation of orf29 in the opposite direction to orf28c indicates that these genes are not cotranscribed. On the other hand, the use of a cassette that can be excised makes it possible to remove the selection marker at any time, particularly by transformation with the plasmid pOSV508.

  To test the effect of orf28c gene inactivation on spiramycin production, spiramycin production of strain SPM107 was tested with the technique described in Example 15. In this way it was possible to demonstrate that this strain has a non-spiramycin producing phenotype. This is because the orf28c gene is S. cerevisiae. It has been demonstrated in Ambofaciens that it is an essential gene for spiramycin biosynthesis.

Example 30: S. cerevisiae having a knockout in the orf31 gene Construction of ambofaciens strains :
The orf31 gene was inactivated using a cassette technique capable of excision. The excisable cassette att3aac + was amplified by PCR using plasmid pSPM101 and oligonucleotides EDR71 and EDR72 as matrix.

  The 39 nucleotides located at the 5 ′ end of these oligonucleotides contain the sequence corresponding to the sequence in the orf31 gene, and the 26 nucleotides located at the extreme 3 ′ position (shown in bold and underlined above) Corresponds to any one of the ends of the cassette att3aac + which can be excised.

  Using the PCR product thus obtained, as described by Chaveroche et al. (Chaveroche et al., 2000) (see FIG. 12 for principle, plasmid pOS49.99 is replaced by cosmid pSPM36) And the resulting plasmid is not pSPM17 and becomes pSPM543), E. coli containing plasmids pKOBEG and cosmid pSPM36. E. coli strain KS272 was transformed. Bacteria were therefore transformed with this PCR product by electroporation and clones were selected for their resistance to apramycin. The resulting digestion profile is expected when insertion of the cassette (att3aac +) into the orf31 gene has occurred, ie, in fact, when homologous recombination has occurred between the end of the PCR product and the target gene. In order to confirm that it corresponds to the above profile, the cosmid of the obtained clone was extracted and digested with several restriction enzymes. The construct can also be confirmed by any method known to those skilled in the art, and in particular by PCR using a suitable oligonucleotide and sequence analysis of the PCR product. A clone was selected that had a profile in which the cosmid was expected and the corresponding cosmid was named pSPM543. This cosmid is a derivative of pSPM36 in which orf31 is interrupted with the att3aac + cassette (see FIG. 12). The insertion of the cassette is accompanied by a deletion in the orf31 gene, and the interrupt begins at the 36th codon of orf31. After the cassette, the last 33 codons of orf31 remain.

  Cosmid pSPM543 was introduced into Streptomyces ambofaciens OSC2 strain by protoplast transformation (Kieser, T et al., 2000) (see above). After transformation, clones were selected for their resistance to apramycin. Next, the apramycin resistant clones were subcultured in an apramycin-containing medium (antibiotic B) and a puromycin (antibiotic A) -containing medium (see FIG. 9), respectively. A clone that is resistant to apramycin (ApraR) and a clone that is sensitive to puromycin (PuroS), in principle, have a double crossover during the event and orf31 interrupted with the att3aac + cassette. A clone having a gene. These clones were selected more specifically and the replacement of the wild-type copy of orf31 with a copy interrupted by the cassette was confirmed by hybridization. Therefore, in order to confirm the presence of the cassette at the expected locus in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several kinds of enzymes, separated by agarose gel, And hybridized with the probe corresponding to the att3aac + cassette. Second hybridization was performed using a DNA fragment obtained by PCR as a probe and corresponding to a very large portion of the coding sequence of the orf31 gene.

  The genotype can also be confirmed by any method known to those skilled in the art, and in particular by PCR using a suitable oligonucleotide and sequence analysis of the PCR product.

  A clone (orf31 :: att3aac +) exhibiting the expected characteristics was selected more specifically and named SPM543. In fact, based on two hybridizations, the att3aac + cassette is actually present in the genome of this clone, and in the genome of this clone, replacement of the wild-type gene with an interrupted copy of the att3aac + cassette It was possible to confirm that the expected digestion profile in the case of (after the double recombination event) was actually obtained. Therefore, this clone had the genotype: orf31 :: att3aac + and was named SPM543. Given the gene orientation (see FIG. 3), it is not necessary to excise the cassette to study the effects of orf31 inactivation. The orientation of orf32c in the opposite direction to orf31 indicates that these genes are not co-transcribed. On the other hand, the use of a cassette that can be excised makes it possible to remove the selection marker at any time, particularly by transformation with the plasmid pOSV508.

  To test the effect of inf31 gene inactivation on spiramycin production, the spiramycin production of strain SPM543 was tested with the technique described in Example 15. In this way it was possible to demonstrate that this strain has a non-spiramycin producing phenotype. This is because the orf31 gene is S. cerevisiae. It has been demonstrated in Ambofaciens that it is an essential gene for spiramycin biosynthesis.

Example 31: S. cerevisiae having a knockout in the orf32c gene Ambofacien
Strain construction The inf orc32c gene was inactivated using a cassette technique capable of excision. The excisable cassette att3aac + was amplified by PCR using plasmid pSPM101 as a matrix and the following primers:

  The 40 nucleotides located at the 5 ′ end of these oligonucleotides contain the sequence corresponding to the sequence in the orf32c gene, and the 26 nucleotides located at the extreme 3 ′ position (shown in bold and underlined above) Corresponds to any one of the ends of the cassette att3aac + which can be excised.

  The PCR product thus obtained was used to overrecombine E. coli containing cosmid pSPM36. E. coli strain DY330 (Yu et al., 2000) was transformed. Bacteria were therefore transformed with this PCR product by electroporation and clones were selected for their resistance to apramycin. The resulting digestion profile was expected when insertion of the cassette (att3aac +) into the orf32c gene occurred, ie when homologous recombination actually occurred between the end of the PCR product and the target gene In order to confirm that it corresponds to the profile, the cosmid of the obtained clone was extracted and digested with BamHI restriction enzyme. The construct can also be confirmed by any method known to those skilled in the art, and in particular by PCR using a suitable oligonucleotide and sequence analysis of the PCR product. A clone was selected that had a profile in which the cosmid was expected and the corresponding cosmid was named pSPM106. This cosmid is a derivative of pSPM36 in which orf32c is interrupted with the att3aac + cassette. The insertion of the cassette is accompanied by a deletion in the orf32c gene, and the interrupt begins at the 112th codon of orf32c. After the cassette, the last 91 codons of orf32c remain.

  In the first step, cosmid pSPM106 It was introduced into the E. coli strain DH5α and subsequently introduced into the Streptomyces ambofaciens OSC2 strain by transformation. After transformation, clones are selected for their resistance to apramycin. Next, the apramycin resistant clones were subcultured in an apramycin (antibiotic B) -containing medium and a puromycin (antibiotic A) -containing medium (see FIG. 9), respectively. A clone that is resistant to apramycin (ApraR) and a clone that is sensitive to puromycin (PuroS) are, in principle, double-crossed during the event and orf32c interrupted with the att3aac + cassette. A clone having a gene. These clones were selected more specifically and the replacement of the wild type copy of orf32c with a copy interrupted by the cassette was confirmed by hybridization. Therefore, in order to confirm the presence of the cassette in the genomic DNA of the obtained clone, the total DNA of the obtained clone is digested with several enzymes, separated on an agarose gel, transferred onto a membrane, and the att3aac + cassette The probe was hybridized with the corresponding probe. The genotype can also be confirmed by any method known to those skilled in the art, and in particular by PCR using a suitable oligonucleotide and sequence analysis of the PCR product.

  A clone (orf32c :: att3aac +) exhibiting the expected characteristics was selected more specifically. Therefore, this clone had the genotype: orf32c :: att3aac + and was named SPM106. Given the gene orientation (see FIG. 3), it is not necessary to excise the cassette to study the effect of orf32c inactivation. The orientation of orf33 in the opposite direction to orf32c indicates that these genes are not cotranscribed. On the other hand, the use of a cassette that can be excised makes it possible to remove the selection marker at any time, particularly by transformation with the plasmid pOSV508.

  To test the effect of orf32c gene inactivation on spiramycin production, spiramycin production of strain SPM106 was tested with the technique described in Example 15. In this way, it was possible to demonstrate that this strain has a spiramycin production phenotype. This is because the orf32c gene is S. aureus. In Ambofaciens, it has been demonstrated that it is not an essential gene for spiramycin biosynthesis.

Deposit of biological material The following organisms are subject to the Collection Nationale de Cultures de Microorganisms [National Collection of Cultures And Micro genus 7 C, 15 Ru duc 75 Deposited on the 10th of the month.
-OSC2 strain (registration number I-2908)
-SPM501 strain (registration number I-2909)
-SPM502 strain (registration number I-2910)
-SPM507 strain (registration number I-2911)
-SPM508 strain (registration number I-2912)
-SPM509 strain (registration number I-2913)
-SPM21 strain (registration number I-2914)
-SPM22 strain (registration number I-2915)
-OS49.67 strain (registration number I-2916)
-OS49.107 strain (registration number I-2917)
-Escherichia coli strain DH5α (registration number I-2918) containing plasmid pOS44.4.

The following organisms were deposited on February 26, 2003 at Collection Nationale de Cultures de Microorganisms (CNCM), 25 true du Doctour Roux, 75724 Paris Cedex 15, France, in accordance with the provisions of the Budapest Treaty.
-SPM502 pSPM525 strain (registration number I-2777).

The following organisms were collected at the Collection Nationale de Cultures de Microorganisms (CNCM), Pasteur Institute, 25 ru du Doctour Rox, 75724 Paris Cedex 15, March 10th, France, March 10th, France 10th, March 10th, France.
-Strain OSC2 / pSPM75 (2) (registration number I-3101).

  All documents and patents cited are hereby incorporated by reference.

References :
-Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ.Basic local alignment search tool.J Mol Biol. (1990). 215 (3): 403-410.
-Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ.Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res. (1997). 25 (17) : 3389-402.
-Amann, E., Ochs, B. and Abel, KJ Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli Gene (1988) 69 (2), 301-315.
-Arisawa, A., Kawamura, N., Tsunekawa, H., Okamura, K., Tone, H. And Okamoto, R.Cloning and nucleotide sequences of two genes involved in the 4``-O-acylation of macrolide antibiotics from Streptomyces thermotolerans. Biosci. Biotechnol. Biochem. (1993). 57 (12): 2020-2025.
-Arisawa A, Kawamura N, Takeda K, Tsunekawa H, Okamura K, Okamoto R. Cloning of the macrolide antibiotic biosynthesis gene acyA, which encodes 3-O-acyltransferase, from Streptomyces thermotolerans and its use for direct fermentative production of a hybrid macrolide antibiotic. Appl Environ Microbiol. (1994). 60 (7): 2657-2660.
-August, PR, Tang, L., Yoon, YJ, Ning, Streptomyces, Mueller, R., Yu, TW, Taylor, M., Hoffmann, D., Kim, CG, Zhang, X., Hutchinson, CR and Floss, HG Biosynthesis of the ansamycin antibiotic rifamycin: deductions from the molecular analysis of the rif biosynthetic gene cluster of Amycolatopsis mediterranei S699. Chem. Biol. (1998) 5 (2), 69-79.
-Ausubel Fred M., Brent Roger, Kingston Robert E., Moore David D., Seidman JG, Smith John A., Struhl Kevin (Editeurs) .Current Protocols in Molecular Biology, published by John Wiley & Sons Inc. Current Protocols Customer Service, 605 Third Avenue, 9th Floor New York, NY 10158 USA (updated edition, March 2002).
-Baltz RH, McHenney MA, Cantwell CA, Queener SW, Solenberg PJ. Applications of transposition mutagenesis in antibiotic producing streptomycetes. Antonie Van Leeuwenhoek. (1997). 71 (1-2): 179-187.
-Bate N, Butler AR, Gandecha AR, Cundliffe E. Multiple regulatory genes in the tylosin biosynthetic cluster of Streptomyces fradiae. Chem Biol. (1999). 6 (9): 617-624.
-Bate, N., Butler, AR, Smith, IP and Cundliffe, E. The mycarose-biosynthetic genes of Streptomyces fradiae, producer of tylosin. Microbiology (2000). 146 (Pt
1), 139-146.
-Bayley C., Morgan, Dale EC, Ow DW Exchange of gene activity in transgenic plants catalysed by the Cre-lox site specific system.Plant Mol. Biol (1992). 18: 353-361.
-Bentley, SD, Chater, KF, Cerdeno-Tarraga, AM, Challis, GL, Thomson, NR,
James, KD, Harris, DE, Quail, MA, Kieser, H., Harper, D., Bateman, A., Brown, S., Chandra, G., Chen, CW, Collins, M., Cronin, A. , Fraser, A., Goble, A., Hidalgo, J., Hornsby, T., Howarth, S., Huang, CH, Kieser, T., Larke, L., Murphy, L., Oliver, K., O'Neil, S., Rabbinowitsch, E., Rajandream, MA, Rutherford, K., Rutter, S., Seeger, K., Saunders, D., Sharp, S., Squares, R., Squares, S. , Taylor, K., Warren, T., Wietzorrek, A., Woodward, J., Barrell, BG, Parkhill, J. and Hopwood, DA Complete genome sequence of the model actinomycete Streptomyces coelicolor A3 (2). Nature (2002 417 (6885), 141-147.
-Bibb MJ, Findlay PR, Johnson MW.The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences. Gene. (1984) 30 (1-3): 157- 166.
-Bibb MJ, Janssen GR, Ward JM.Cloning and analysis of the promoter region of
the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene. (1985). 38 (1-3): 215-26.
-Bibb MJ, White J, Ward JM, Janssen GR.The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site.Mol Microbiol. (1994) .14 ( 3): 533-45.
-Bierman M, Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. Plasmid cloning
vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 1992; 116 (1): 43-9.
-Blondelet-Rouault MH., Weiser J., Lebrihi A., Branny P. and Pernodet JL. Antibiotic resistance gene cassettes derived from the Ω interposon for use in E. coli and Streptomyces. Gene (1997) 190: 315-317.
-Boccard F., Smokvina T., J.-L., Pernodet Fridmann A., and Guerineau M., Structural analysis of loci involved in pSAM2 site-specific integration in Streptomyces. Plasmid, (1989a) .21: 59-70 .
-Boccard F., Smokvina T., J.-L., Pernodet Fridmann A., and Guerineau M..The integrated conjugative plasmid pSAM2 of Streptomyces ambofaciens is related to temperate bacteriophages.EMBO J. (1989b) 8: 973-980 .
-Brunelli JP, Pall ML, A series of Yeast / E. coli lambda expression vectors designed for directional cloning of cDNA and cre / lox mediated plasmid excision. Yeast. (1993) 9: 1309-1318.
-Camilli A., Beattie DT and Mekalanos JJ Use of genetic recombination as a reporter of gene expression.Proc. Natl. Acad. Sci. USA (1994) 91 (7), 2634-2638.
-Campelo, AB and Gil, JA The candicidin gene cluster from Streptomyces griseus IMRU 3570. Microbiology (2002) 148 (Pt 1), 51-59.
-Carreras C, Frykman S, Ou S, Cadapan L, Zavala S, Woo E, Leaf T, Carney J, Burlingame M, Patel S, Ashley G, Licari P. Saccharopolyspora erythraea-catalyzed bioconversion of 6-deoxyerythronolide B analogs for production of novel erythromycins. J Biotechnol. (2002). 92 (3): 217-28.
-Chao K.-M., Pearson WR, Miller W. Aligning two sequences within a specified diagonal band.Comput.Appl.Biosci. (1992) 8: 481-487.
-Chater KF The improving prospects for yield increase by genetic engineering in antibiotic-producing Streptomycetes. Biotechnology. (1990). 8 (2): 115-121.
-Chaveroche MK, Ghigo JM, d'Enfert C. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 2000; 28 (22): E97.
-Church GM, Gilbert W. Genomic sequencing.Proc Natl Acad Sci US A. (1984) 81 (7): 1991-5.
-Churchward G, Belin D, Nagamine Y. A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors. Gene. (1984) 31 (1-3): 165-71.
-Comstock, LE, Coyne, MJ, Tzianabos, AO and Kasper, DL Interstrain variation of the polysaccharide B biosynthesis locus of Bacteroides fragilis: characterization of the region from strain 638R J. Bacteriol. (1999). 181 (19): 6192- 6196.
-Cox KL, Baltz RH. Restriction of bacteriophage plaque formation in Streptomy
ces spp. J Bacteriol. (1984) 159 (2): 499-504.
-Dale EC, Ow DW, Gene transfer with subsequent removal of the selection gene from the host genome.Proc. Natl. Acad. Sci. USA (1991). 88: 10558-10562.
-Doumith M, Weingarten P, Wehmeier UF, Salah-Bey K, Benhamou B, Capdevila C, Michel JM, Piepersberg W, Raynal MC.Analysis of genes involved in 6-deoxyhexose
biosynthesis and transfer in Saccharopolyspora erythraea. Mol Gen Genet. (2000)
264 (4): 477-485.
-Draeger, G., Park, Streptomyces-HH and Floss, HG Mechanism of the 2-deoxygenation step in the biosynthesis of the deoxyhexose moieties of the antibiotics
granaticin and oleandomycin J. Am. Chem. Soc. (1999) 121: 2611-2612.
-Gandecha, AR, Large, SL and Cundliffe, E. Analysis of four tylosin biosynthetic genes from the tylLM region of the Streptomyces fradiae genome. Gene. (1997). 184 (2): 197-203.
-Geistlich, M., Losick, R., Turner, JR and Rao, RN Characterization of a novel regulatory gene governing the expression of a polyketide synthase gene in Streptomyces ambofaciens. Mol. Microbiol. (1992). 6 (14): 2019 -2029.
-Gourmelen A, Blondelet-Rouault MH, Pernodet JL. Characterization of a glycosyl transferase inactivating macrolides, encoded by gimA from Streptomyces ambofaciens. Antimicrob Agents Chemother. (1998). 42 (10): 2612-9.
-Huang X. and Miller W. A time-efficient, linear-space local similarity algorithm. Adv. Appl. Math. (1991). 12: 337-357.
-Hara O and Hutchinson CR. Cloning of midecamycin (MLS) -resistance genes from Streptomyces mycarofaciens, Streptomyces lividans and Streptomyces coelicolor A3 (2). J Antibiot (Tokyo). (1990). 43 (8): 977-991.
-Hara O and Hutchinson CR. A macrolide 3-O-acyltransferase gene from the midecamycin-producing species Streptomyces mycarofaciens. J Bacteriol. (1992). 174 (15): 5141-5144.
-Hoffmeister D, Ichinose K, Domann S, Faust B, Trefzer A, Drager G, Kirschning A, Fischer C, Kunzel E, Bearden D, Rohr J and Bechthold A. The NDP-sugar co-substrate concentration and the enzyme expression level influence the substrate specificity of glycosyltransferases: cloning and characterization of deoxysugar biosynthetic genes of the urdamycin biosynthetic gene cluster.Chem Biol. (2000). 7 (11): 821-831.
-Hopwood, DA Future possibilities for the diskovery of new antibiotics by genetic engineering.In Beta-lactam antibiotics.Edited by MRJ Salton and GD Shockman.New York: Academic Press. (1981) .585-598.
-Hopwood DA, Malpartida F., Kieser HM, Ikeda H., Duncan J., Fujii I., Rudd AM, Floss HG and Omura S. Production of 'hybrid' antibiotics by genetic engineering.Nature. (1985a) .314 ( 6012): 642-644.
-Hopwood DA, Malpartida F., Kieser HM, Ikeda H. and Omura S. (1985b) In
Microbiology (ed S. Silver). American Society for Microbiology, Washington DC, 409-413.
-Houben Weyl, 1974, in Methode der Organischen Chemie [Methods in Organic Chemistry], E. Wunsch Ed., Volume 15-I and 15-II,
-Hutchinson, CR Prospects for the diskovery of new (hybrid) antibiotics by genetic engineering of antibiotic-producing bacteria. Med Res Rev. (1988). 8 (4): 557-567.
-Hutchinson CR, Borell CW, Otten SL, Stutzman-Engwall KJ and Wang
Y. Drug diskovery and development through the genetic engineering of antibiotic-producing microorganisms J. Med. Chem. (1989) 32 (5): 929-937.
-Ishikawa J, Hotta K. FramePlot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G + C content.FEMS Microbiol Lett. (1999) 174 (2): 251-3.
-Kieser, T, Bibb, MJ, Buttner MJ, Chater KF, Hopwood DA.Practical Streptomyces Genetics. 2000.The John Innes Foundation, Norwich UK.
-Kuhstoss and al. Production of a novel polyketide through the construction of a hybrid polyketide synthase. Gene. (1996). 183 (1-2): 231-236.
-Lacalle RA, Pulido D, Vara J, Zalacain M, Jimenez A. Molecular analysis of the pac gene encoding a puromycin N-acetyl transferase from Streptomyces alboniger. Gene. (1989). 79 (2): 375-380.
-Lakso M, Sauer B, Mosinger B Jr, Lee EJ, Manning RW, Yu SH, Mulder KL, Westphal H. Targeted oncogene activation by site-specific recombination in transgenic mice.Proc Natl Acad Sci US A. (1992) 89 ( 14): 6232-6.
-Li, TB, Shang, GD, Xia, HZ and Wang, YG Cloning of the sugar related biosynthesis gene cluster from Streptomyces tenebrarius H6. Sheng Wu Gong Cheng Xue Bao (2001). 17 (3): 329-331.
-Ligon, J., Hill, S., Beck, J., Zirkle, R., Molnar, I., Zawodny, J., Money, S. And Schupp, T. Characterization of the biosynthetic gene cluster for the antifungal polyketide soraphen A from Sorangium cellulosum So ce26. Gene (2002). 285 (1-2), 257-267.
-Liu L, Saevels J, Louis P, Nelis H, Rico S, Dierick K, Guyomard S, Roets E, Hoogmartens J. Interlaboratory study comparing the microbiological potency of spiramycins I, II and III.J Pharm Biomed Anal. (1999) 20 (1-2): 217-24.
-Mazodier P, Petter R, Thompson C. Intergeneric conjugation between Escherichia coli and Streptomyces species. J Bacteriol. (1989). 171 (6): 3583-5.
-Merrifield RB, 1965a, Nature, 207 (996): 522-523.
-Merrifield RB., 1965b, Science, 150 (693): 178-185.
-Merson-Davies, LA and Cundliffe, E. Analysis of five tylosin biosynthetic genes from the tyllBA region of the Streptomyces fradiae genome, Molecular microbiology. (1994). 13 (2): 349-355.
-Miller VL, Mekalanos JJ.A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol. (1988) 170 (6): 2575-83.
-Nakano, Y., Yoshida, Y., Yamashita, Y. & Koga, T. Construction of a series of pACYC-derived plasmid vectors. Gene (1995). 162: 157-8.
-Nielsen H., Engelbrecht J., Brunak S. et von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.Protein Engineering. (1997). 10: 1-6.
-Oh SH, Chater KF. Denaturation of circular or linear DNA facilitates targeted integrative transformation of Streptomyces coelicolor A3 (2): possible relevance to other organisms. J Bacteriol. 1997; 179 (1): 122-7.
-Olano C, Lomovskaya N, Fonstein L, Roll JT, Hutchinson CR.A two-plasmid system for the glycosylation of polyketide antibiotics: bioconversion of epsilon-rhodomycinone to rhodomycin D. Chem Biol. (1999). 6 (12): 845 -55.
-Omura S, Kitao C, Hamada H, Ikeda H. Bioconversion and biosynthesis of 16-membered macrolide antibiotics.X. Final steps in the biosynthesis of spiramycin, using enzyme inhibitor: cerulenin.Chem Pharm Bull (Tokyo). (1979a). 27 (1): 176-82.
-Omura S, Ikeda H, Kitao C. Isolation and properties of spiramycin I 3-hydrox
yl acylase from Streptomyces and ambofaciens. J Biochem (Tokyo). (1979b). 86 (6):
1753-8.
-Omura, S., Ikeda, H., Ishikawa, J., Hanamoto, A., Takahashi, C., Shinose, M., Takahashi, Y., Horikawa, H., Nakazawa, H., Osonoe, T. , Kikuchi, H., Shiba, T., Sakaki, Y. and Hattori, M. Genome sequence of an industrial microorganism Streptomyces avermitilis: Deducing the ability of producing secondary metabolites. Proc. Natl. Acad. Sci. USA (2001). 98 (21), 12215-12220.
-Pearson WR and DJ Lipman. Improved Tools for Biological Sequence Analysis. Proc. Natl. Acad. Sci. USA 1988, 85: 2444-2448.
-Pearson WR Rapid and Sensitive Sequence Comparison with FASTP and FASTA.Methods in Enzymology. 1990, 183: 63-98.
-Pernodet JL, Simonet JM, Guerineau M. Plasmids in different strains of Streptomyces ambofaciens: free and integrated form of plasmid pSAM2. Mol Gen Genet. (1984); 198 (1): 35-41.
-Pernodet JL, Alegre MT, Blondelet-Rouault MH, Guerineau M. Resistance to spiramycin in Streptomyces ambofaciens, the producer organism, involves at least two different mechanisms.J Gen Microbiol. (1993); 139 (Pt 5): 1003-11 .
-Pernodet JL, Fish S, Blondelet-Rouault MH, Cundliffe E. The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using a specifically deleted, antibiotic-sensitive strain of Streptomyces lividans. Antimicrob Agents Chemother. (1996), 40 (3 ): 581-5.
-Pernodet JL, Gourmelen A, Blondelet-Rouault MH, Cundliffe E. Dispensable ribosomal resistance to spiramycin conferred by srmA in the spiramycin producer Streptomyces ambofaciens. Microbiology. (1999), 145 (Pt 9): 2355-64.
-Pfoestl, A., Hofinger, A., Kosma, P. and Messner, P. Biosynthesis of dTDP-3-acetamido-3,6-dideoxy-alpha-D-galactose in Aneurinibacillus thermoaerophilus L420-91T. J. Biol. Chem. (2003), 278 (29): 26410-26417.
-Rao RN, Richardson MA, Kuhstoss S. Cosmid shuttle vectors for cloning and analysis of Streptomyces DNA.Methods Enzymol. (1987); 153: 166-98.
-Raynal A, Tuphile K, Gerbaud C, Luther T, Guerineau M, and Pernodet JL..Structure of the chromosomal insertion site for pSAM2: functional analysis in Escherichia coli.Molecular Microbiology (1998) 28 (2) 333-342.
-Redenbach, M., Kieser, HM, Denapaite, D., Eichner, A., Cullum, J., Kinashi, H. And Hopwood, DA A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3 (2) chromosome Mol. Microbiol. (1996). 21 (1): 77-96.
-Richardson MA, Kuhstoss S, Solenberg P, Schaus NA, Rao RN.A new shuttle cosmid vector, pKC505, for streptomycetes: its use in the cloning of three different spiramycin-resistance genes from a Streptomyces ambofaciens library. Gene. (1987) ; 61 (3): 231-41.
-Robinson, JA Enzymes of Secondary Metabolism in Microorganisms. Chem Soc Rev. (1988). 17: 383-452.
-Russell SH, Hoopes JL, Odell JT. Directed excision of a transgene from the plant genome. Mol Gen Genet. (1992). 234 (1): 49-59.
-Sambrook J, Frisch EF, Maniatis T. Molecular Cloning: a laboratory manual 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York USA (1989).
-Schoner B, Geistlich M, Rosteck P Jr, Rao RN, Seno E, Reynolds P, Cox K, Burgett S and Hershberger C. Sequence similarity between macrolide-resistance determinants and ATP-binding transport proteins. Gene. (1992). 115 (1-2), 93-96.
-Sezonov G, Hagege J, Pernodet JL, Friedmann A and Guerineau M. Characterization of pra, a gene for replication control in pSAM2, the integrating element of Streptomyces ambofaciens. Mol Microbiol. (1995). 17 (3): 533-44 .
-Sezonov G., Blanc V., Bamas-Jacques N., Friedmann A., Pernodet JL and M. Guerineau, Complete conversion of antibiotic precursor to pristinamycin IIA by over expression of Streptomyces pristinaespiralis biosynthetic genes, Nature Biotechnology. (1997) 15 : 349-353.
-Sezonov G, Possoz C, Friedmann A, Pernodet JL, Guerineau M. KorSA from the Streptomyces integrative element pSAM2 is a central transcriptional repressor: target genes and binding sites.J Bacteriol. (2000). 182 (5): 1243-50 .
-Simon R., Priefer U and Puehler. A broad host range mobilisation system for in vivo genetic engeneering: transposon mutagenesis in gram negative bacteria. Bio / Technology (1983). 1: 784-791.
-Simon, and al., Plasmid vectors for the genetic analysis and manipulation of
rhizobia and other gram-negative bacteria, p. 640-659. In A. Weissbach, and H. Weissbach (eds.), Methods in enzymology, vol 118, Academic Press, Inc., Orlando,
1986.
-Summers, RG, Donadio, Streptomyces, Staver, MJ, Wendt-Pienkowski, E., Hutchinson, CR and Katz, L. Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene cluster of Saccharopolyspora erythraea that are involved in L-mycarose and D-desosamine production. Microbiology (1997). 143 (Pt 10): 3251-3262.
-Van Mellaert L, Mei L, Lammertyn E, Schacht S, Anne J. Site-specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector.Microbiology. (1998). 144 (Pt 12): 3351-8.
-Vara J, Lewandowska-Skarbek M, Wang YG, Donadio S, Hutchinson CR.Cloning of genes governing the deoxysugar portion of the erythromycin biosynthesis pathway in Saccharopolyspora erythraea (Streptomyces erythreus). J Bacteriol. (1989). 5872-81.
-Vara J, Malpartida F, Hopwood DA, Jimenez A. Cloning and expression of a puromycin N-acetyl transferase gene from Streptomyces alboniger in Streptomyces lividans and Escherichia coli. Gene. (1985). 33 (2): 197-206.
-Wahl, GM, KA Lewis, JC Ruiz, B. Rothenberg, J. Zhao, and GA Evans. Cosmid vectors for rapid genomic walking, restriction mapping, and gene transfer.Proc. Natl. Acad. Sci. USA (1987). 84: 2160-2164.
-Waldron, C., Matsushima, P., Rosteck, PR, Broughton, MC, Turner, J., Madduri, K., Crawford, KP, Merlo, DJ and Baltz, RH Cloning and analysis of the spinosad biosynthetic gene cluster of Saccharopolyspora spinosa (1) Chem. Biol. (2001) 8 (5): 487-499.
-Walczak RJ, Hines JV, Strohl WR, Priestley ND. Bioconversion of the anthracycline analogue desacetyladriamycin by recombinant DoxA, a P450-monooxygenase from Streptomyces sp. Strain C5. Org Lett. (2001). 3 (15): 2277-9.
-Wang, ZX, Li, SM and Heide, L. Identification of the coumermycin A (1) biosynthetic gene cluster of Streptomyces rishiriensis DSM 40489. Antimicrob. Agents Chemother. (2000) 44 (11), 3040-3048.
-Ward, JM, Janssen, GR, Kieser, T, Bibb, MJ, Buttner, MJ & Bibb, MJ
Construction and characterization of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase from Tn5 as indicator. Mol Gen Genet (1986). 203: 468-478.
-Wehmeier UF. New multifunctional Escherichia coli-Streptomyces shuttle vecto
rs allowing blue-white screening on XGal plates. Gene. (1995). 165 (1): 149-150.
-Wilms B, Hauck A, Reuss M, Syldatk C, Mattes R, Siemann M, Altenbuchner J. High-cell-density fermentation for production of LN-carbamoylase using an expression system based on the Escherichia coli rhaBAD promoter.Biotechnol Bioeng. 2001) .73 (2): 95-103.
-Worley KC, Wiese BA, and Smith RF BEAUTY: An enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results.Genome Research (1995). 5: 173-184.
-Wu K, Chung L, Revill WP, Katz L and Reeves CD.The FK520 gene cluster of Streptomyces hygroscopicus var.ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene. (2000). 251 (1) : 81-90.
-Xue Y, Zhao L, Liu HW and Sherman DH.A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: architecture of metabolic diversity.Proc Natl Acad Sci US A. (1998). 95 (21): 12111-12116.
-Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG et Court DL.An efficient recombination system for chromosome engineering in Escherichia coli.Proc Natl Acad Sci US A. (2000). 97 (11): 5978-83.

  The present invention also relates to the use of genes in the spiramycin biosynthesis process to construct mutants that can result in the synthesis of novel antibiotics or derivative forms of spiramycin. Finally, the present invention relates to a molecule produced by expression of said gene and a pharmacologically active composition of any molecule produced by expression of such gene.

It is the chemical structure of spiramycin I, II and III. A cosmid used to sequence a region. It is a composition of genes involved in the biosynthesis pathway of spiramycin. It is a biosynthetic pathway that is said to be related to mycarose. It is a biosynthetic pathway that is said to be related to micaminose. It is a biosynthetic pathway that is said to be related to forosamine. A preferred order of addition of sugars to spiramycin molecules and intermediates. S. It is a biosynthetic pathway that is said to be related to methoxymalonyl in ambofaciens. It is a process that causes gene inactivation. An optional step after gene inactivation by the method described in FIG. 9, this step may be performed if a excisable cassette is used to interrupt the target gene; Amplification of excisable cassettes for use in homologous recombination experiments. Production of a construct to inactivate a target gene using the technique described by Chaveroche et al., 2000. Plasmid pWHM3. Strepto ori: A map of Streptomyces origin of replication. It is a map of plasmid pOSV508. It is an example of the structure of the cassette which can be cut out. It is a map of plasmid pBXL1111. It is a map of plasmid pBXL1112. This is a microbiological test for spiramycin production based on the susceptibility of Micrococcus luteus strains to spiramycin. It is a HPLC chromatogram of the culture medium supernatant which OSC2 strain | stump | stock filtered. It is a HPLC chromatogram of the filtered culture medium supernatant of SPM501 strain. It is a HPLC chromatogram of the filtered culture medium supernatant of SPM502 strain. It is a HPLC chromatogram of the filtered culture medium supernatant of SPM507 strain. It is a HPLC chromatogram of the filtered culture medium supernatant of SPM508 strain. It is a HPLC chromatogram of the filtered culture supernatant of SPM509 strain. ORF3 protein (SEQ ID NO: 29) obtained using the FASTA program and S. cerevisiae. Alignment with the Fradiae TylB protein (SEQ ID NO: 87). S. cerevisiae obtained using the FASTA program. It is alignment with the MdmA protein (sequence number 88) of mycalofaciens, and SrmD protein (sequence number 16). It is an example of the remaining part arrangement | sequence after cutting out the cassette which can be cut out. Figure 2 is a diagrammatic representation of the orf10 gene, the location of PCR primers used, and the constructs obtained using each primer pair. This is the construction of the cassette pac-oritT. It is a map of cosmid pWED2. A group of genes involved in the biosynthesis pathway of spiramycin; FIG. 3 is a diagrammatic representation of the position of the three probes used to isolate the cosmid of the genomic DNA library of Streptomyces ambofaciens OSC2 strain in E. coli (see Example 19). E. FIG. 4 is the position of the cosmid insert isolated from the genomic DNA library of Streptomyces ambofaciens strain OCS2 in E. coli (see Example 19). Subcloning of PstI-PstI fragment of cosmid pSPM36 (insert of plasmid pSPM58), subcloning of StuI-StuI fragment of cosmid pSPM36 (insert of plasmid pSPM72), and subcloning of EcoRI-StuI (insert of plasmid pSPM73). Position of the open reading frame identified in the PstI-PstI insert of plasmid pSPM58 and the EcoRI-StuI insert of plasmid pSPM73. Side-by-side HPLC chromatograms of filtered media supernatants of OS49.67 strain obtained at 238 nm and 280 nm (top), and UV spectra of molecules eluted at 33.4 and 44.8 minutes (bottom) . It is the molecular structure of a platenolide A and a platenolide B molecule. It is a composition of genes involved in the biosynthesis pathway of spiramycin. It is the molecular structure of a biosynthetic intermediate produced by SPM507 strain. Genotype orf6 ^* :: att1Ωhyg + S. cerevisiae obtained from a strain overproducing spiramycin It is the structure of a biosynthetic intermediate produced by an ambofaciens strain. It is the molecular structure of the platenolide A + mycarose and the platenolide B + mycarose molecules produced by the OS49.67 strain. Subcloning of the PstI-PstI fragment of cosmid pSPM36 (insert of plasmid (pSPM79)), the position of the open reading frame identified in the PstI-PstI insert of plasmid pSPM79, and the position of the sequence of SEQ ID NO: 140.

Claims (19)

The sequence of the polynucleotide is
(A) the polynucleotide sequence of SEQ ID NO: 141, or (b) the base of the polynucleotide sequence of SEQ ID NO: 141 is replaced with another base due to the degeneracy of the gene code, but the encoded amino acid sequence is the amino acid of SEQ ID NO: 142 A polynucleotide encoding a polypeptide involved in spiramycin biosynthesis , which is a sequence .   The polynucleotide of claim 1 isolated from a bacterium of the genus Streptomyces.   A polypeptide produced by expression of the polynucleotide of claim 1 or 2. The polypeptide is
(A) the polynucleotide of claim 1 or 2, or (b) any one of the polynucleotides of (a), provided that the sequence of the polynucleotide is encoded by one or more These amino acids have been substituted, inserted or deleted without affecting their functional properties, but exhibit at least 90% amino acid identity with the amino acid sequence of SEQ ID NO: 142 )
A polypeptide involved in spiramycin biosynthesis, encoded by. The polypeptide according to claim 4, which is the amino acid sequence of SEQ ID NO: 142. The polypeptide of claim 4, which is an amino acid sequence comprising the amino acid sequence of SEQ ID NO: 112.   An expression vector comprising at least one nucleic acid sequence encoding the polypeptide according to any one of claims 3-6.   7. A suitable expression vector capable of expressing one or more of the polypeptides according to any one of claims 3 to 6, and a combination for expression comprising a host cell. A method for producing the polypeptide according to any one of claims 3 to 6, comprising:
a) inserting at least one of the nucleic acids encoding the polypeptide into a suitable vector;
b) culturing the host cells previously transformed or transfected with the vector of step a) in a suitable medium;
c) recovering the conditioned medium or cell extract;
from d) above medium or from cell extract obtained in step c), as engineering separating and purifying the polypeptide,
Including the above method.   A macro having a genetic modification in at least one of the genes comprising the polynucleotide of claim 1 or 2 and / or overexpressing at least one of the genes comprising the polynucleotide of claim 1 or 2. Mutant microorganisms that produce rides.   The mutant microorganism according to claim 10, wherein overexpression of the gene of interest is obtained by increasing the copy number of this gene and / or introducing a promoter more active than the wild type promoter. Genetic modification, any one of the polynucleotide sequence corresponding to the polynucleotide sequence of SEQ ID NO: 141, or, due to the degeneracy of the genetic code, but replacing the base of the polynucleotide sequence of SEQ ID NO: 141 into another base, 12. The mutant microorganism according to claim 10 or 11, wherein the encoded amino acid sequence is the amino acid sequence of SEQ ID NO: 142, and is carried out with one or more of the genes comprising any one of the sequences obtained therefrom. Microorganisms, any one of the polynucleotide sequence corresponding to the polynucleotide sequence of SEQ ID NO: 141, or, due to the degeneracy of the genetic code, but replacing the base of the polynucleotide sequence of SEQ ID NO: 141 into another base, code The mutant microorganism according to any one of claims 10 to 12, which overexpresses a gene containing any one of the sequences obtained from the amino acid sequence of SEQ ID NO: 142 . A method for producing macrolides:
(A) culturing the microorganism according to any one of claims 10 to 13 in an appropriate medium;
(B) recovering the conditioned medium or cell extract;
(C) separating and purifying the macrolide produced from the medium or from the cell extract obtained in step (b);
Including the above method.   Use of a polynucleotide and / or vector and / or combination according to any one of claims 1, 2, 7 and 8 for the manufacture of a hybrid antibiotic.   Collection National de Cultures de Microorganisms (CNCM) [National Collection of Cultures And Microorganisms] The Streptomyces ambofaciens strain, which is the OSC2 / pSPM75 (1) strain or the OSC2 / pSPM75 (2) strain. -The following sequence primer pairs:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
, And the it can be used to amplify a polynucleotide sequence according to claim 1 or 2, the sequence primer pairs. A host cell into which at least one of the polynucleotides according to claim 1 or 2 has been introduced. A method for producing spiramycin comprising:
(A) culturing the host cell according to claim 18 in an appropriate medium;
(B) recovering the conditioned medium or cell extract;
(C) separating and purifying spiramycin from the above medium or from the cell extract obtained in step (b),
Including the above method.

Images