JP2006501863A5 - - Google Patents

Description

Since only the sequence of the region of about 450 base pairs was determined after the rearrangement analysis, the orf28c sequence was first partially determined (this region is represented by the symbol “N” in the incomplete sequence of SEQ ID NO: 106). ). Nevertheless, this partial sequence of the ORF (SEQ ID NO: 111 ) was used for analysis with the various computer programs described above. Thus, the orf28c gene spans the determined sequence (SEQ ID NO: 112, which is a partial sequence of the Orf28c protein), a regulatory protein involved in carbomycin biosynthesis in Streptomyces thermotolerans. Can be determined to encode a protein that shows 64% identity with the protein encoded by the acyB2 gene that encodes (A. Arisawa et al., 1993; GenBank accession number: JC2032, BLAST score: 329). (Determined using the BLAST program). The similarity between this and proteins involved in the biosynthetic pathway for relatively close antibiotics indicates that the orf28c gene encodes a regulatory protein involved in spiramycin biosynthesis. This hypothesis is supported by the strong similarity of the protein encoded by the orf28c gene to the TylR protein, a regulatory protein involved in tyrosine biosynthesis in Streptomyces fradiae (N. Bate et al., 1999). Year; GenBank accession number: AAF29380, BLAST score: 167).

Claims (19)

The sequence of the polynucleotide is
(A) sequence of SEQ ID NO: 141 or,
(B) any one of SEQ due to the degeneracy of the genetic code (a) or obtained sequence,
A polynucleotide encoding a polypeptide involved in spiramycin biosynthesis. Isolated from the genus Streptomyces bacteria polynucleotide of claim 1. A polypeptide produced by expression of the polynucleotide of claim 1 or 2 . The polypeptide is
(A) the polynucleotide according to claim 1 or 2, or (b) any one of the polynucleotides according to (a) (provided that the sequence of the polynucleotide is encoded by 1 or the same) These amino acids have been substituted, inserted or deleted without affecting their functional properties )
A polypeptide involved in spiramycin biosynthesis, encoded by . 5. The polypeptide of claim 4, which is the sequence of SEQ ID NO: 142. The polypeptide according to claim 4, which is a sequence comprising the sequence of SEQ ID NO: 112. An expression vector comprising at least one nucleic acid sequence encoding the polypeptide according to any one of claims 3-6 . 請 1 or more expression appropriate expression vectors capable of a polypeptide according to any one of Motomeko 3-6, and a combination thereof for expression containing the host cell. A method for producing the polypeptide according to any one of claims 3 to 6 , comprising:
a) inserting at least one of the nucleic acids encoding the polypeptide into a suitable vector;
b) culturing the host cells previously transformed or transfected with the vector of step a) in a suitable medium;
c) recovering the conditioned medium or cell extract;
d) separating and purifying the polypeptide from the medium or from the cell extract obtained in step c);
e) optionally characterizing the produced recombinant polypeptide,
Including the above method. Having Claim 1 or at least one gene modification of a gene comprising a polynucleotide according to 2, and / or overexpress at least one of the genes comprising the polynucleotide of claim 1 or 2, macro Mutant microorganisms that produce rides. The mutant microorganism according to claim 10 , wherein overexpression of the gene of interest is obtained by increasing the copy number of this gene and / or introducing a promoter more active than the wild type promoter. Genetic modification, any one of the sequences corresponding to the sequence of SEQ ID NO: 141, was or rows in one or more genes comprising any one of the sequences derived therefrom due to the degeneracy of the genetic code The mutant microorganism according to claim 10 or 11 , wherein Microorganisms, any one of the sequences corresponding to the sequence of SEQ ID NO: 141, or over-expressing a gene comprising any one of the sequences obtained therefrom due to the degeneracy of the genetic code, claim 10 to 12 The mutant microorganism according to any one of the above. A method for producing macrolides:
(A) culturing the microorganism according to any one of claims 10 to 13 in an appropriate medium;
(B) recovering the conditioned medium or cell extract;
(C) separating and purifying the macrolide produced from the medium or from the cell extract obtained in step ( b);
Including the above method. Use of a polynucleotide and / or vector and / or combination according to any one of claims 1 , 2, 7 and 8 for producing a hybrid antibiotic.   Collection National de Cultures de Microorganisms (CNCM) [National Collection of Cultures And Microorganisms] Paste Institute, 25, rue du Docureur 75 The Streptomyces ambofaciens strain, which is the OSC2 / pSPM75 (1) strain or the OSC2 / pSPM75 (2) strain. -The following sequence primer pairs:
5 ′ AAGCTTGTGTGCCCCGGTGTACCTGGGGAGC3 ′ (SEQ ID NO: 138), and
5 ′ GGATCCCGCCGACGGACACACCGCCGCGGCA3 ′ (SEQ ID NO: 139),
And a polynucleotide obtainable by polymerase chain reaction using cosmid pSPM36 or Streptomyces ambofaciens total DNA as matrix, or
A fragment of at least 1200, 1400, 1450 or 1500 contiguous nucleotides of this polynucleotide , which can be used to amplify the polynucleotide sequence according to claim 1 or 2 ;
Recombinant DNA comprising A host cell into which at least one recombinant DNA according to claim 17 has been introduced. A method for producing spiramycin comprising:
(A) culturing the host cell according to claim 18 in an appropriate medium;
(B) recovering the conditioned medium or cell extract;
(C) separating and purifying spiramycin from the above medium or from the cell extract obtained in step (b),
Including the above method.