CA2501445A1 - Polypeptides involved in spiramycin biosynthesis, nucleotide sequences encoding said polypeptides and uses thereof - Google Patents

Abstract

The invention concerns isolation and identification of novel genes of spiramycin biosynthesis process and novel polypeptides involved in said biosynthesis. The invention also concerns a method for producing sand polypeptides. The invention further concerns the use of said genes for increasing the rate of production and purity in the resulting spiramycin. The invention concerns in particular a micro-organism producing spiramycin I but not producing spiramycin II and III and the use of such a micro-organism. The invention also concerns the use of genes in spiramycin biosynthesis process for constructing mutants capable of leading to synthesis of novel antibiotics or derivative forms of spiramycin. Finally the invention concerns molecules produced through expression of said genes and phamacologically active compositions of one molecule produced through expression of such genes.

Description

LARGE APPLICATION OR PATENT
THIS PART OF THIS APPLICATION OR THIS PATENT INCLUDES
MORE THAN A TOME.

CONTAINING PAGES 1 Ä 291 NOTE: For additional volumes, please contact the Canadian Bureau of patents JUMBO APPLICATIONS / PATENTS

VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office FILE NAME / FILE NAME
NOTE FOR TOME / VOLUME NOTE:

I
POLYPEPTIDES INVOLVED IN THE BIOSYNTHESIS OF SPIRAMYCINS SEQUENCES
NUCLEOTIDE ENCODING THESE POLYPEPTIDES AND THEIR APPLICATIONS
The present invention relates to the isolation and (identification of new genes of the biosynthetic pathway for spiramycins and new polypeptides involved in this biosynthesis. It also relates to (use of these genes in order to increase production rates and the purity of the spiramycin produced.
The invention also relates to the use of these genes for the construction of mutants that can lead to the synthesis of new antibiotics or to forms derived from spiramycins. The invention also relates to the molecules produced thanks to the expression of these genes and finally pharmacologically compositions active of a molecule produced through the expression of such genes.
Streptomyces are filamentous Guam positive soil bacteria. They.
play an important role in the decomposition and mineralization of Contents organic thanks to the great diversity of degradative enzymes they secrete. They present unique morphological differentiation phenomena in prokaryotes accompanied by metabolic differentiation characterized by the production of secondary metabolites with extraordinary diversity of 2o chemical structures and biological activities. Among these metabolites are find them spiramycins produced in their natural state by the bacteria Streptomyces ambofaciens.
Spiramycin is a macrolide antibiotic which is also useful well in veterinary medicine than in human medicine. Macrolides are characterized over there presence of a lactone cycle on which one or more sugars are grafted.
Streptomyces ambofaciens naturally produces spiramycin I, II and III (see Figure 1), however the antibiotic activity of spiramycin I is clearly superior to that of the

2 spiramycins II and III (Liu et al., 1999). The spiramycin I molecule is made up of a lactonic macro-cycle, called platenolide and three sugars:
forosamine, the mycaminosis and mycarosis (see Figure 1). The antibiotic activity of spiramycins is due to inhibition of protein synthesis in prokaryotes by a mechanism involving the binding of the antibiotic to the bacterial ribosome.
Certain compounds which are members of the macrolide family and which also have a lactone cycle have given rise to uses outside the field of antibiotics.
Thus the product FK506 has immunosuppressive effects and offers prospect of therapeutic application in the field of organ transplantation, arthritis rheumatoid and more generally in pathologies linked to reactions Autoimmune. Other macrolides like avermectin have activities insecticides and anthelmintic.
Numerous biosynthetic pathways, concerning antibiotics belonging to various classes as well as other secondary metabolites (for a review, Chater K.
, 15 1990), have so far been studied in Streptomycetes. However, : .la ', k knowledge of the biosynthetic pathways of spiramycins is only very partial to date ~ '~' The biosynthesis of spiramycins is a complex process involving many steps and involving many enzymes (Omura et al., 1979a, Omura et al., 1979b). Spiramycins belong to the large class of polyketides which 2o groups complex molecules which are particularly abundant in soil microorganisms. These molecules are grouped together not by analogy of structure but by a certain similarity at the level of stages of their way of biosynthesis.
Indeed, polyketides are produced by a complex series of reactions But have in common to have in their biosynthetic pathway a series of reactions 25 catalyzed by one or more enzymes called “polyketide synthases” (PKS).
In St ~ eptomyces ambofaciens, the biosynthesis of the lactonic macro-cycle of spiramycin (platenolide) is produced by a series of eight modules coded by five genes PKS
different (Kuhstoss S., 1996, US patent 5,945,320). Spiramycins are obtained at

3 from this lactone cycle. However, the various stages and enzymes involved in the sugar synthesis, as well as their binding to the lactone cycle and the modification of this cycle for obtaining spiramycins are still unknown to this day.
US Patent 5,514,544 describes the cloning of a sequence called srmR in Ambofacian streptornyces. It is assumed in this patent that the gene srmR code a protein that regulates the transcription of genes involved in the biosynthesis of macrolides.
In 1987, Richardson et al. (Richardson et al., 1987) showed that the resistance to S. ambofaciens spiramycin is imparted by at least three genes, these the latter were called srmA, srmB and srmC. US Patent 4,886,757 describes more particularly the characterization of a DNA fragment of S ambofaciens containing the srmC gene. However, the sequence of this gene has not been disclosed. In 1990, Richardson et al. (Richardson et al., 1990) posited the hypothesis of the existence of three biosynthesis genes for spiramycin close to srrnB.
The patent US 5,098,837 reports the cloning of five genes potentially involved in the .
biosynthesis of spiramycin. These genes have been named srmD, srmE, srmF, srmG ~ ét ~ 1 SRMH.
One of the major difficulties in the production of compounds such as spiramycins is that very large volumes of fermentation are necessary to produce a relatively small amount of product. he is therefore desirable to be able to increase the production efficiency of such molecules in order to lower production costs.
The spiramycin biosynthesis pathway is a complex process and it would be desirable to identify and suppress unwanted reactions which could exist at during this process. The purpose of such manipulation is to obtain a antibiotic more pure and / or improved productivity. On this subject, Streptomyces ambofaciens produces in its natural state spiramycin I, II and III (cf. Figure 1), however the activity spiramycin I antibiotic is significantly superior to that of spiramycins II and III

4 (Liu et al., 1999). It would therefore be desirable to have available strains born producing only spiramycin I.
Due to the commercial interest of macrolide antibiotics, obtaining new derivatives, in particular of analogs of spiramycins having properties advantageous is intensively sought. It would be desirable to be able to generate in sufficient quantity the biosynthesis intermediates of the pathway biosynthesis of spiramycins or spiramycin derivatives, in particular for the purpose of make hybrid antibiotics derived from spiramycins.
General description of the invention The present invention results from the cloning of genes whose product is involved in the biosynthesis of spiramycins. The invention relates first of all to new genes of the biosynthetic pathway for spiramycins and new polypeptides involved in this biosynthesis.
The biosynthetic pathway genes and associated coding sequences have summer cloned and the DNA sequence of each was determined. Coding sequences cloned will be designated hereinafter orfl * c, orfZ * c, orf3 * c, orf4 * c, orf5 *, orf6 *, orf7 * c, - orf8 *, orf ~ *, orfl0 *, orfl, orfZ, orf3, orf4, orf5, orf6, orf7, orf8, orf ~ c, orfl0, orfllc, orfl2, orfl3c, orfl4, orfl5c, orfl6, orfl7, orfl8, orfl9, or, f ~ 0, orfZl c, orfZ2c, orfZ3c, orf ~ 4c, orfZSc, orfZ6, orf ~ 7, orfZ8c, orfZ9, orf30c, orf3l, orf32c, orf33 and orf34c. The function of proteins encoded by these sequences in the biosynthetic pathway of the spiramycins is developed in the discussion below which is illustrated by Figures 4,

5, 6 and 8.
1) A first subject of the invention relates to a polynucleotide encoding a polypeptide involved in the biosynthesis of spiramycins, characterized in that that the sequence of said polynucleotide is (a) one of the sequences SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, (b) one of the sequences constituted by the variants of the sequences (a), 5 (c) one of the sequences derived from sequences (a) and (b) due to the degeneration of the genetic code.
2) The present invention also relates to a hybridizing polynucleotide under conditions of high stringency hybridization to at least one of polynucleotides according to paragraph 1) above.
l0 3) The invention also relates to a polynucleotide having at least 70%
80%, 85%, 90%, 95% or 98% nucleotide identity with a polynucleotide including at least 10, 12, 15, 18, 20 to 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1800, 1850 or 1900 consecutive nucleotides of a polynucleotide depending on the paragraph.; 1) above.
4) The invention also relates to a polynucleotide according to paragraph 2) or 3) above characterized in that it is isolated from a bacterium of the genus Streptomyces.
5) The invention also relates to a polynucleotide according to paragraph 2), 3) or 4) above characterized in that it codes for a protein involved in the biosynthesis of a macrolide.

6) The invention also relates to a polynucleotide according to paragraph 2), 3) or 4) above characterized in that it codes for a protein having an activity similar to the protein encoded by the polynucleotide with which it hybridizes or presents identity.

7) The invention also relates to a polypeptide resulting from the expression a polynucleotide according to paragraph 1), 2), 3), 4), 5) or 6) above.

8) Another aspect of the invention relates to a polypeptide involved in the biosynthesis of spiramycins characterized in that the sequence of said polypeptide is (a) one of the sequences SEQ ID N ° 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 29, 31, 32, 33, 35, 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150,;
(b) one of the sequences as defined in (a) except that throughout said sequence one or more amino acids have been substituted, inserted or deleted without affect its functional properties, lo (c) one of the sequences constituted by the variants of the sequences (a) and (B).

9) Another subject of the invention relates to a polypeptide having at least 70%, 80%, 85%, 90%, 95% or 98% amino acid identity with a polypeptide including at least 10, 15, 20, 30 to 40, 50, 60, 70, 80, 90,100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or 640 consecutive amino acids of a polypeptide according to paragraph 8) above.

10) Another aspect of the invention relates to a polypeptide according to the paragraph 9) above characterized in that it is isolated from a bacterium of the genus Streptomyces.

11) Another aspect of the invention relates to a polypeptide according to the paragraph 9) or 10) above characterized in that it codes for a protein involved in the biosynthesis of a macrolide.

12) Another aspect of the invention relates to a polypeptide according to the paragraph 9), 10) or 11) above characterized in that it has an activity similar to that of polypeptide with which it shares identity.

13) Another aspect of the invention relates to a recombinant DNA characterized in that it comprises at least one polynucleotide according to one of paragraphs 1), 2), 3), 4), 5) or 6) above.

14) Another aspect of the invention relates to a recombinant DNA according to the paragraph 13) above, characterized in that said recombinant DNA is included in a vector.

15) Another aspect of the invention relates to a recombinant DNA according to the paragraph 14) above characterized in that said vector is chosen from the d bacteriophages, plasmids, phagemids, integrative vectors, fosmids, the cosmids, shuttle vectors, BAC or PAC.

16) Another aspect of the invention relates to a recombinant DNA according to the paragraph 15) above, characterized in that it is chosen from pOS49.1, pOS49.11, lo pOSC49.12, pOS49.14, pOS49.16, pOS49.28, pOS44.1, pOS44.2, pOS44.4, pSPMS, pSPM7, pOS49.67, pOS49.88, pOS49.106, pOS49.120, pOS49.107, pOS49.32, pOS49.43, pOS49.44, pOS49.50, pOS49.99, pSPMl7, pSPM2l, pSPM502, pSPM504, pSPM507, pSPM508, pSPM509, pSPMI, pBXLl lll, pBXL1112, pBXL1113,.
pSPM520, pSPM521, pSPM522, pSPM523, pSPM524, pSPM525, pSPM527, ..
pSPM528, pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, cj, ~~: ,, :, pSPM4l, pSPM42, pSPM43, pSPM44, pSPM45, pSPM47, pSPM48, pSPM50, pSPM5l, pSPM52, pSPM53, pSPM55, pSPM56, pSPM58, pSPM72, pSPM73, pSPM515, pSPM519, pSPM74, pSPM75, pSPM79, pSPM83, pSPM107, pSPM543 and pSPM106.

17) Another aspect of the invention relates to an expression vector characterized in what it includes at least one nucleic acid sequence encoding a polypeptide according to paragraph 7), 8), 9), 10), 11) or 12) above.

18) The invention also relates to an expression system comprising a appropriate expression vector and a host cell for expression of one or several polypeptides according to paragraph 7), 8), 9), 10), 11) or 12) above above.

19) The invention also relates to an expression system according to the paragraph 18 above characterized in that it is chosen from among the systems of prokaryotic expression or eukaryotic expression systems.

20) The invention also relates to an expression system according to the paragraph 19) above, characterized in that it is chosen from among the systems of expression in E. coli bacteria, baculovirus expression systems allowing expression in insect cells, expression systems allowing a expression in yeast cells, expression systems allowing a expression in mammalian cells.

21) The invention also relates to a host cell in which has been introduces at least one polynucleotide and / or at least one recombinant DNA and / or at minus an expression vector according to one of the pragraphs 1), 2), 3), 4), 5), 6), 13), 14), 15), 16) or 17) above.

22) The invention also relates to a method for producing a polypeptide according to paragraph 7), 8), 9), 10), 11) or 12) above characterized in that that said method comprises the following stages:
a) inserting at least one nucleic acid encoding said polypeptide into a vector appropriate;
b) cultivate, in a medium, ëialture ~ 'i; pprtiprié, urie host cell prior ~
transformed or transfected with the vector from step a);
c) recovering the conditioned culture medium or a cell extract;
d) separate and purify from said culture medium or from the cell extract obtained in step c), said polypeptide;
e) where appropriate, characterize the recombinant polypeptide produced.

23) Another aspect of the invention relates to a microorganism blocked in a step in the biosynthetic pathway of at least one macrolide.

24) Another aspect of the invention relates to a microorganism according to the paragraph 23) above characterized in that it is obtained by inactivating the function of minus a protein involved in the biosynthesis of this or these macrolides in one microorganism producing this or these macrolide (s).

25) Another aspect of the invention relates to a microorganism according to the paragraph 24) above characterized in that the inactivation of this or these proteins is carried out by mutagenesis in the gene or genes coding for said one or more proteins or by expression of one or more antisense RNAs complementary to the RNA or of the Messenger RNA encoding said protein (s). ' s

26) Another aspect of the invention relates to a microorganism according to the paragraph 25) above characterized in that the inactivation of this or these proteins is carried out by irradiation mutagenesis, by action of chemical agent mutagenic, by site-directed or gene replacement mutagenesis.

27) Another aspect of the invention relates to a microorganism according to the paragraph 25) or 26) above characterized in that the mutagenesis or mutagenesis are performed in vitro or in situ, by deletion, substitution, deletion and / or addition of a or several bases in the gene (s) considered or by inactivation gene.

28) Another aspect of the invention relates to a microorganism according to the at 15, paragraph. 23),, 24), 25), 26), or ~ 2?) Above characterized in that ~
that. said microorganism is a bacteria of the genus Streptomyces.

29) Another aspect of the invention relates to a microorganism according to the paragraph 23), 24), 25), 26), 27) or 28) above characterized in that the macrolide is spiramycin.

30) Another aspect of the invention relates to a microorganism according to the paragraph 23), 24), 25), 26), 27), 28) or 29) above characterized in that said microorganism is a strain of S. ambofaciens.

31) Another aspect of the invention relates to a microorganism according to the paragraph 23), 24), 25), 26), 27), 28), 29) or 30) above characterized in what the mutagenesis is carried out in at least one gene comprising a sequence according to Mon paragraphs 1), 2), 3), 4), 5) or 6) above.

32) Another aspect of the invention relates to a microorganism according to the paragraph 25), 26), 27), 28), 29), 30) or 31) above characterized in that the mutagenesis is carried out in one or more genes comprising one of the sequences corresponding to one or more of the sequences SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 5 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 11 l, 113, 115, 118, 120, 141, 143, 145, 147 ~ t 149;

33) Another aspect of the invention relates to a microorganism according to the paragraph 25), 26), 27), 28), 29), 30), 31) or 32) above characterized in what the mutagenesis consists in the gene inactivation of a gene comprising a sequence 10 corresponding to the sequence SEQ ID No. 13.

34) Another aspect of the invention relates to a strain of Streptomyces ambofaciens characterized in that it is a strain chosen from one of the strains deposited with the National Collection of Cultures of microorganisms (CNCM) on July 10, 2002 under registration number I-2909, I-2911, I-2912, .I-2913, I-2914, I-2915, I-2916 or I-2917.

35) Another aspect of the invention relates to a process for the preparation of a macrolide biosynthesis intermediate characterized in that it comprises the steps following a) cultivate, in an appropriate culture medium, a microorganism according to one of the 2o paragraphs 23), 24), 25), 26), 27), 28), 29), 30), 31), 32), 33) or 34) ci above, b) recovering the conditioned culture medium or a cell extract, c) separate and purify from said culture medium or from extract cell obtained in step b), said biosynthesis intermediate.

36) Another aspect of the invention relates to a process for the preparation of a 25 molecule derived from a macrolide characterized in that a intermediary of biosynthesis according to the method of paragraph 35) above and which is modified the intermediary thus produced.

37) Another aspect of the invention relates to a preparation process according to the paragraph 36) above characterized in that one modifies said intermediate per channel chemical, biochemical, enzymatic and / or microbiological.

38) Another aspect of the invention relates to a preparation process according to the paragraph 36) or 37) above characterized in that one introduces into said d microorganism one or more genes encoding proteins capable of edit the intermediary using it as a substrate.

39) Another aspect of the invention relates to a preparation process according to the paragraph 36), 37) or 38) above characterized in that the macrolide is the spiramycin.

40) Another aspect of the invention relates to a preparation process according to the paragraph 36), 37), 38) or 39) above characterized in that the microorganism used is a strain of S. ambofaciens.

41) Another aspect of the invention relates to a microorganism producing, .
i5 spiramycin I but not producing pulps ~ of ~ spiramycirie II et III

42) Another aspect of the invention relates to a microorganism according to the paragraph 41) above characterized in that it comprises all of the genes necessary for the biosynthesis of spiramycin I but that the gene comprising the sequence SEQ ID N ° 13 or one of its variants or one of the sequences derived from 2o these due to the degeneration of the genetic code and coding a polypeptide sequence SEQ ID N ° 14 or one of its variants is not expressed or has been made inactive.

43) Another aspect of the invention relates to a microorganism according to the paragraph 42) above characterized in that said inactivation is produced by mutagenesis in the gene encoding said protein or by the expression of an RNA
antisense 25 complementary to the messenger RNA encoding said protein.

44) Another aspect of the invention relates to a microorganism according to the paragraph 43) above characterized in that said mutagenesis is performed in the promoter of this gene, in the coding sequence or in a sequence not coding of so as to make the encoded protein inactive or to prevent its expression, or her translation.

45) Another aspect of the invention relates to a microorganism according to the claim 43) or 44) above characterized in that the mutagenesis is done by irradiation, by the action of a mutagenic chemical agent, by site-directed mutagenesis or through gene replacement.

46) Another aspect of the invention relates to a microorganism according to the paragraph 43), 44) or 45) above characterized in that mutagenesis is performed in in vitro or in situ, pax suppression, substitution, deletion and / or addition of a or many bases in the gene under consideration or by gene inactivation.

47) Another aspect of the invention relates to a microorganism according to;
, paragraph 41) or 42) above characterized in that said microorgariism is obéiïû ' by expressing the genes of the spiramycin biosynthesis pathway without these don't include the gene comprising the sequence corresponding to SEQ ID No. 13 or one of its variants or one of the sequences derived therefrom due to the degeneration of the genetic code and encoding a polypeptide of sequence SEQ ID No. 14 or one of his variants.

48) Another aspect of the invention relates to a microorganism according to the paragraph 41), 42), 43), 44), 45), 46) or 47) above characterized in that said microorganism is a bacteria of the genus Streptomyces.

49) Another aspect of the invention relates to a microorganism according to the paragraph 41), 42), 43), 44), 45), 46), 47) or 48) above characterized in what said microorganism is obtained from a starting strain producing the spiramycin I, II and III.

50) Another aspect of the invention relates to a microorganism according to the paragraph 41), 42), 43), 44), 45), 46), 47), 48) or 49) above characterized in that it is obtained by mutagenesis in a gene comprising the sequence corresponding to SEQ
ID No. 13 or one of its variants or one of the sequences derived from these due degeneration of the genetic code and encoding a polypeptide of sequence SEQ ID
N ° 14 or one of its variants having the same function.

51) Another aspect of the invention relates to a microorganism according to the paragraph 41), 42), 43), 44), 45), 46), 47), 48), 49) or 50) above characterized in that that said microorganism is obtained from a strain of S. ambofaciens producing spiramycins I, II and III, in which inactivation is carried out gene gene comprising the sequence corresponding to SEQ ID N ° 13 or one of the sequences derived from it due to the degeneracy of the genetic code.

52) Another aspect of the invention relates to a strain of S ambofaciens characterized in that it is the strain deposited with the Collection National of.
Cultures of Microorganisms (CNCM) on July 10. 2002 under number ',.
I-2910.

53) Another aspect of the invention relates to a process for the production of spiramycin I, characterized in that it comprises the following stages (a) cultivate, in an appropriate culture medium, a microorganism Mon from paragraphs 41), 42), 43), 44), 45), 46), 47), 48), 49), 50), 51) or 52) above, (b) recovering the conditioned culture medium or a cell extract, (c) separating and purifying from said culture medium or from the cell extract obtained in step b), spiramycin I.

54) Another aspect of the invention relates to the use of a polynucleotide according to one of paragraphs 1), 2), 3), 4), 5) or 6) above to improve the production in macrolides of a microorganism.

55) Another aspect of the invention relates to a mutant microorganism macrolide producer characterized in that it has a modification genetics in at least one gene comprising a sequence according to one of paragraphs 1), 2), 3), 4), 5) or 6) above and / or that it overexpresses at least one gene comprising a sequence according to one of paragraphs 1), 2), 3), 4), 5) or ~) above.

56) Another aspect of the invention relates to a mutant microorganism according to the paragraph 55) above characterized in that the genetic modification consists of a deletion, substitution, deletion and / or addition of one or more several bases in the gene or genes considered for the purpose of expressing one or more proteins having a lo higher activity or express a higher level of this or these proteins.

57) Another aspect of the invention relates to a mutant microorganism according to the paragraph 55) above characterized in that the overexpression of the gene considered is obtained by increasing the number of copies of this gene and / or by placing a sponsor more active than the wild-type promoter.
I5 58) Another aspect of the invention relates to a mutant microorganism according to the 'v paragraph 55) or 57) above characterized in that the overexpression of the gene considered is obtained by transforming a microorganism producing macrolide by a recombinant DNA construction according to paragraph 13, 14 or 17 above, allowing the overexpression of this gene.
59) Another aspect of the invention relates to a mutant microorganism according to the paragraph 55), 56), 57) or 58) above characterized in that the change genetics is carried out in one or more genes comprising one of the sequences corresponding to one or more of the sequences SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 25 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of his variants or any of the sequences derived therefrom due to the degeneration of genetic code.

60) Another aspect of the invention relates to a mutant microorganism according to the paragraph 55), 56), 57), 58) or 59) above characterized the microorganism overexpress one or more genes comprising one of the sequences corresponding to one or more many sequences SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 5 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of the sequences derived from them due to the degeneracy of the genetic code.
61) Another aspect of the invention relates to a mutant microorganism according to the paragraph 55), 56), 57), 58), 59) or 60) above characterized in that said 10 microorganism is a bacteria of the genus Streptomyces.
62) Another aspect of the invention relates to a mutant microorganism according to the paragraph 55), 56), 57), 58), 59), 60) or 61) above characterized in that the macrolide is spiramycin.
63) Another aspect of the invention relates to a mutant microorganism according to the .
15 paragraph SS), 56), 57), 58), 59), 60), 61) or 62) ei above so what edits microorganism is a strain of S. ambofaciehs.
64) Another aspect of the invention relates to a process for the production of macrolides, characterized in that it comprises the following stages (a) cultivate, in an appropriate culture medium, a microorganism according to Mon 2o of paragraphs 55), 56), 57), 58), 59), 60), 61), 62), 63) or 64) above above, (b) recovering the conditioned culture medium or a cell extract, (c) separating and purifying from said culture medium or from the cell extract obtained in step b), the said macrolide (s) produced.
65) Another aspect of the invention relates to the use of a sequence and / or a Recombinant DNA and / or a vector according to one of paragraphs 1), 2), 3), 4), 5), 6), 7), 8), 9), 10), 11), 12), 13), 14), 15), 16) or 17) above for preparation hybrid antibiotics.

66) Another aspect of the invention relates to the use of at least one polynucleotide andor at least one recombinant DNA and / or at least one vector of expression and / or at least one polypeptide and / or at least one host cell according to one paragraphs 1), 2), 3), 4), 5), 6), 7), 8), 9), 10), 11), 12), 13), 14), 15), 16), 17) or 21) above to carry out one or more bioconversions.
67) Another aspect of the invention relates to a polynucleotide characterized in this that it is a polynucleotide complementary to one of the polynucleotides according to paragraph 1), 2), 3), 4), 5), or 6) above.
68) Another aspect of the invention relates to a producer microorganism lo of at least one spiramycin characterized in that it overexpresses - a gene capable of being obtained by chain amplification by polymerase (PCR) using the pair of primers with the following sequence: 5 ' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ 117 N ° 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N ° 139) and Gommé
matrix the cosmid pSPM36 or the total DNA of Strept4inyces ambofacien.s, - or a gene derived therefrom due to the degeneracy of the code genetic.
Another aspect of the invention relates to a microorganism according to the paragraph 68 - or 90 characterized in that it is a bacterium of the genus S'treptomyces.
70) Another aspect of the invention relates to a microorganism according to the paragraph 68, 69 or 90 characterized in that it is a bacteria of species Ambofacial streptomyces.
71) Another aspect of the invention relates to a microorganism according to the paragraph 68, 69, 70 or 90 characterized in that the overexpression of said gene East obtained by transformation of said microorganism with an expression vector.

72) Another aspect of the invention concerns a strain of Streptomyces ambofaciens, characterized in that it is the OSC2 / pSPM75 (1) strain or the strain OSC2 / pSPM75 (2) deposited with the National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, October 6, 2003 under registration number I-3101.
73) Another aspect of the invention relates to a recombinant DNA characterized in that it includes - a polynucleotide capable of being obtained by chain amplification by polymerase using the pair of primers with the following sequence: 5 ′
lo AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID N ° 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ D7 N ° 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, - or a fragment of at least 10, 12, 15, 18, 20 to 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1460, 1470,, 1480,1490 or 1500 consecutive nucleotides of this polynucleotide.
74) Another aspect of the invention relates to a recombinant DNA according to the paragraph 73 or 91 characterized in that it is a vector.
75) Another aspect of the invention relates to a recombinant DNA according to the paragraph 73, 74 or 91 characterized in that it is a vector expression.
76) Another aspect of the invention relates to a host cell in which a at least one recombinant DNA has been introduced according to one of paragraphs 73, 74, 75 or 91.
77) Another aspect of the invention relates to a method for producing a polypeptide characterized in that said method comprises the following steps:
a) transforming a host cell with at least one expression vector according to the paragraph 75;

b) cultivating, in an appropriate culture medium, said host cell;
c) recovering the conditioned culture medium or a cell extract;
d) separate and purify from said culture medium or from the cell extract obtained in step c), said polypeptide;
e) where appropriate, characterize the recombinant polypeptide produced.
e 78) Another aspect of the invention relates to a microorganism according to the paragraph 51 characterized in that gene inactivation is carried out by deletion in phase of the gene or part of the gene comprising the corresponding sequence at SEQ ID N ° 13 or one of the sequences derived from it due of the l0 degeneration of the genetic code.
79) Another aspect of the invention relates to a microorganism according to one paragraphs 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, S1 or 78 characterized in this in what he over-expresses - a gene capable of being obtained by polymerase chain reaction in is using the pair of primers with the following sequence: 5 ' ~ A ,, AAGCTTGTGTGCCCGGTGTACCTGGGG1 ~ GC 3 '(SEQ ID N ° 138) and 5''. i GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N ° 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, - or a gene derived therefrom due to the degeneracy of the code genetic.
80) Another aspect of the invention relates to an expression vector characterized in that the polynucleotide of sequence SEQ ID No. 47 or a polynucleotide derived from it due to degeneracy of the code genetic is placed under the control of a promoter allowing the expression of the protein encoded by the said polynucleotide in Streptomyces ambofaciens.
81) Another aspect of the invention relates to an expression vector according to the paragraph 80 characterized in that it is the plasmid pSPM524 or pSPM525.

82) Another aspect of the invention relates to a Streptomyces strain ambofaciens transformed by a vector according to paragraph 80 or 81.
83) Another aspect of the invention relates to a microorganism according to one of paragraphs 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 78, 79 or 92 characterized in that that it additionally overexpresses the gene with coding sequence SEQ ID No. 47 or a coding sequence derived therefrom due to the degeneracy of the code genetic.
84) Another aspect of the invention relates to a microorganism according to the paragraph 83 characterized in that it is the strain SPM502 pSPM525 trademark from the National Collection of Cultures of Microorganisms (CNCM) Institute Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, February 26 under registration number I-2977.
85) Another aspect of the invention relates to a process for the production of spiramycin (s), characterized in that it comprises the following stages . (a) cultivate, in an appropriate culture medium, a microorganism according to im paragraphs 68, 69, 70, 71, 72, 78, 79, 82, 83, 84, 90 or 92, (b) recovering the conditioned culture medium or a cell extract, (c) separating and purifying from said culture medium or from the cell extract obtained in step b), the spiramycins.
86) Another aspect of the invention relates to a polypeptide characterized in that than its sequence includes the sequence SEQ ID N ° 112 or the sequence SEQ ID
No. 142.
87) Another aspect of the invention relates to a polypeptide characterized in that that its sequence corresponds to the translated sequence of the coding sequence - a gene capable of being obtained by chain amplification by polymerase (PCR) using the pair of primers with the following sequence: 5 ' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID N ° 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N ° 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, - or a gene derived therefrom due to the degeneracy of the code genetic.
88) Another aspect of the invention relates to an expression vector allowing s the expression of a polypeptide according to paragraph 86, 87 or 93 in Streptomyces ambofaciens.
89) Another aspect of the invention relates to an expression vector according to the paragraph 88 characterized in that it is the plasmid pSPM75.
i0 90) Another aspect of the invention relates to a microorganism according to the paragraph 68 characterized in that the gene capable of being obtained by polymerase chain reaction is the coding sequence gene SEQ ID
No.
141 or a gene derived therefrom due to degeneracy of the code genetic.
91) Another aspect of the invention relates to a recombinant DNA s ~ lon.l ~~: - '!
f.;.
15 paragraph 73 characterized in that the polynucleotide capable of being obtained by polymerase chain reaction is a polynucleotide of sequence SEQ
ID
No. 141.
92) Another aspect of the invention relates to a microorganism according to the paragraph 79 characterized in that the gene capable of being obtained by 2o polymerase chain amplification is the SEQ coding sequence gene ID No 141 or a gene derived therefrom due to degeneracy of the code genetic.
93) Another aspect of the invention relates to a polypeptide characterized in that that its sequence is SEQ ID N ° 142.

General definitions The term "isolated" in the sense of the present invention designates a material organic (nucleic acid or protein) which has been removed from its original environment (the environment in which it is naturally located).
For example a polynucleotide present in the natural state in a plant or a animal is not isolated. The same polynucleotide separated from nucleic acids adjacent in which it is naturally inserted into the genome of the plant or the animal is considered "isolated".
l0 Such a polynucleotide can be included in a vector and / or such polynucleotide may be included in a composition and nevertheless remain in the isolated state of the makes the vector or the composition does not constitute its natural environment.
The term "purified" does not require that the material be present under a made of absolute purity, exclusive of the presence of other compounds. It is rather of born ~ '~'"
relative definition.
A polynucleotide is in the "purified" state after purification of the departure or natural material of at least an order of magnitude, preferably 2 or 3 and preferably 4 or 5 orders of magnitude.
For the purposes of the present invention the term ORF ("Qpen Reading Frame", it is at 2o say open reading frame) was used to designate in particular the sequence coding for a gene.
For the purposes of this description, the expression "nucleotide sequence"
can be used to designate either a polynucleotide or an acid nucleic.
The term "nucleotide sequence" includes the genetic material itself and is therefore not restricted to information concerning its sequence.

The terms "nucleic acid", "polynucleotide", "oligonucleotide" or again "
nucleotide sequence "include RNA, DNA, cDNA or again RNA / DNA hybrid sequences of more than one nucleotide, either under the simple chain form or in the form of duplex.
The term "nucleotide" designates both natural nucleotides (A, T, G, C) so as modified nucleotides which include at least one such modification that (1) a purine analog, (2) a pyrimidine analog, or (3) a sugar similar, examples of such modified nucleotides being described for example in the request PCT No. WO 95/04 064.
i0 For the purposes of the present invention, a first polynucleotide is considered as being "complementary" to a second polynucleotide when each base of the first polynucleotide is paired with the complementary base of the second polynucleotide whose the orientation is reversed. The complementary bases are A and T (or A and U), or C and G.
The term "spiramycin biosynthetic pathway genes" includes also regulatory genes and genes conferring resistance to microôrgariisines, J = ~
producers.
The term “fragment” of a reference nucleic acid according to the invention, a nucleotide sequence of reduced length compared to the nucleic acid of reference and comprising, on the common part, a nucleotide sequence similar to the reference nucleic acid.
Such a "fragment" of nucleic acid according to the invention may be the case appropriate, included in a larger polynucleotide of which it is a constituent.
Such fragments include or alternatively consist of, polynucleotides of length ranging from 8, 10, 12, 15, 18, 20 to 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1650, 1700, 1750, 1800, 1850 or 1900 consecutive nucleotides of an acid nucleic according to the invention.
Pax "fragment" of a polypeptide according to the invention, a polypeptide whose amino acid sequence is shorter than that of the polypeptide of reference and which includes throughout the common part with these reference polypeptides, a identical amino acid sequence.
Such fragments may, where appropriate, be included within a polypeptide larger of which they are part.
Such fragments of a polypeptide according to the invention can have a length l0 dice 10, 15, 20, 30 to 40, 50, 60, 70, 80, 90,100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or 640 amino acids.
By "high stringency hybridization conditions" within the meaning of this invention will be understood to mean hybridization conditions which disadvantage hybridization strands ~ v ~~
non-homologous nucleic acids. Strong hybridization conditions stringerice 'i can for example be described as hybridization conditions in the buffer described by Church & Gilbert (Church & Gilbert, 1984) at a temperature between 55 ° C and 65 ° C, preferably the annealing temperature is 55 ° C, so even more preferred, the hybridization temperature is 60 ° C. and quite way 2o preferred the hybridization temperature is 65 ° C, followed by one or multiple washes performed in 2X SSC buffer (1X SSC buffer corresponds to an aqueous solution 0.15M NaCl, 15mM sodium citrate) at a temperature between 55 ° C and 65 ° C, preferably this temperature is 55 ° C, way even more preferred this temperature is 60 ° C and so quite preferred this temperature is 65 ° C, followed by one or more washes in O.SX SSC buffer at one temperature between 55 ° C and 65 ° C, preferably this temperature is 55 ° C, even more preferably this temperature is 60 ° C. and so absolutely preferred this temperature is 65 ° C.

It goes without saying that the hybridization conditions described above can to be adapted according to the length of the nucleic acid of which the hybridization East sought or the type of marking chosen, according to techniques known from the man of job. Suitable hybridization conditions can for example be adapted according to the work of F. Ausubel et al (2002).
..
f'ar "variant" of a nucleic acid according to the invention, an acid will be understood nucleic acid which differs by one or more bases from the polynucleotide of reference. A variant nucleic acid can be of natural origin, such as a variant allelic found naturally, or may also be an unnatural variant obtained by example by mutagenesis techniques.
In general, the differences between the reference nucleic acid and the acid nucleic variant are reduced so that the nucleotide sequences of nucleic acid, ' and the ~ rariant nucleic acid are very close and, in many . ~
identical regions. Changes in nucleotides present in an acid nucleic t5 variant can be silent, which means that they do not alter the sequences ~
amino acids encoded by said variant nucleic acid.
However, nucleotide changes in a variant nucleic acid can also result from substitutions, additions, deletions in the polypeptide encoded by nucleic acid varying from peptides encoded by nucleic acid of 2o reference. In addition, changes in nucleotides in the regions coding can produce substitutions, conservative or non-conservative in the sequence amino acids.
Preferably, the variant nucleic acids according to the invention encode polypeptides which retain substantially the same function or activity organic that the 25 reference nucleic acid polypeptide or the ability to be recognized by antibodies to the polypeptides encoded by the nucleic acid initial.

Certain variant nucleic acids will thus encode mutated forms of polypeptides whose systematic study will allow to deduce relations structure activity of the proteins in question.
By "variant" of a polypeptide according to the invention, is mainly meant a 5 polypeptide whose amino acid sequence contains one or more substitutions, s additions or deletions of at least one amino acid residue, relative to the sequence amino acids of the reference polypeptide ,. it being understood that substitutions amino acids can be either conservative or non-conservative.
Preferably, the variant polypeptides according to the invention retain sensibly l0 the same biological function or activity as the reference polypeptide or still there ability to be recognized by antibodies to polypeptides initial.
By polypeptide having "a similar activity" to a reference polypeptide at meaning of the invention is meant a polypeptide having a biological activity close but not necessarily identical, to that of the reference polypeptide such as measured in A bioassay suitable for the; measured from the biological activity of polypeptide of reference.
By "hybrid antibiotic" within the meaning of the invention means a compound, generated by building an artificial biosynthesis pathway using the technology recombinant DNA.

Detailed description of the invention The present invention more particularly relates to new genes for the pathway for biosynthesis of spiramycins and new polypeptides involved in this biosynthesis as presented in the detailed description below.
s The genes of the biosynthetic pathway have been cloned and the DNA sequence of these genes has been determined. The sequences obtained were analyzed using the program FramePlot (Ishikawa J & Hotta K. 1999). We have identified, among the phases open from reading, the open reading phases presenting a use of codons typical of Streptomyces. This analysis showed that this region has 44 ORFs, located from 10 on either side of five genes encoding the enzyme "polyketide synthase"
(PKS), and showing a typical codon use of Streptomyces. On either side of these five genes encoding PKS, respectively 10 and 34 ORFs were identified downstream and in .
upstream (downstream and upstream being defined by the orientation of the 5 PKS genes all oriented k.
in the same direction) (see Figures 3 and 37). Thus, the 34 open phases of reading this: ~ ~.
type, occupying an area of approximately 41.7 kb (cf. SEQ 1D N ° 1 presenting a first ':
31 kb region containing 25 ORFs and SEQ 1D N ° 140 with a region of about v 12.1 kb of which 1.4 kb overlap the previous sequence (SEQ ID N ° 1) and about 10.7 kb correspond to the rest of the sequence, this last part of about 10.7 kb containing 9 additional ORFs (including a partial sequence ORF), cf.
also 2o figure 3 and 37 and below), have been identified upstream of the 5 genes coding the PKS and 10 occupying an area of approximately 11.1 kb (SEQ ID No. 2 and Figure 3), have been identified downstream of the PKS genes. The 10 genes located downstream of the 5 PKS genes have so been named orfl * c, orf ~ * c, orf3 * c, orf4 * c, orf5 *, orf6 *, orf7 * c, orfg *, orf9 *, orfl0 * (SEQ
ID No. 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21). The "c" added in the gene name meaning for the ORF in question that the coding sequence is in the reverse orientation (the strand coding is therefore the complementary strand of the sequence given in SEQ ID
# 2 for these Genoa). Using the same nomenclature, the 34 ORFs upstream of the genes the PKS
were named oYfl, orf2, orf3, orf4, o ~ f5, oYf6, orf7, orf $, orf9c, orfl0, orfll c, orfl ~, orfl3c, orfl4, orfl Sc, orfl6, orfl 7, orfl ~, orfl9, oYf ~ O, orfZl c, orfZ2c, oYfl3c, orf ~ 4c, orf25c, orfZ6, orfZ7, orf28c, orf29, orf30c, orf3l, orf32c, orf33 and orf34c (SEQ ID N °
23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149) (cf.
Figures 3 and 37).
The protein sequences deduced from these open reading phases were compared with those present in different databases thanks to different programs: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search, COGs (Cluster of Orthologous Groups) (these three programs are accessible especially at the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland,:;
USA)), FASTA ((Pearson W. R & DJ Lipman, 1988) and (Pearson WR, 1990), BEAUTY (Worley KC. Et al., 1995)) (these two programs are accessible notably with the INFOBIOGEN resource center, Evry, France). These comparisons made it possible to formulate hypotheses on the function of products of these genes and identify those likely to be involved in biosynthesis of the spiramycin.
i5 Genes located downstream of the genes encoding PKS
A schematic representation of the organization of the region is presented in ~~
figure 3. As will be shown below, out of the 10 genes identified in downstream of genes encoding PKS 9 appear to be involved in biosynthesis or resistance to the spiramycin. These are the following 9 genes: orfl * c, orf2 * c, orf3 * c, orf4 * c, orf5 *, orf6 *, orf7 * c, orf8 * and orf ~ *, In the following table 1 are presented the references to the DNA sequence and in amino acids of the 10 genes identified downstream of the 5 PKS genes.
Table 1 Gen Position in the DNA Sequence Polypeptide Sequences SEQ ID sequence orfl 10882 10172 SEQ ID N 3 SEQ ID N 4 *vs orf2 * c 10052 8781 SEQ ID N 5 SEQ ID N 6 orf3 8741 7476 SEQ ID N 7 SEQ ID N 8 *vs orf4 * c 7459 6100 SEQ ID N 9 SEQ ID N 10 orf5 5302 5976 SEQ ID N 11 SEQ ID N 12 *

orf6 * 4061 5305 SEQ ID N 13 SEQ ID N 14 orf7 * c 3665 2817 ~ SEQ ID N 15 SEQ ID N 16 orf $ * 1925 2755 SEQ ID N 17 SEQ ID N 18 orf9 * 1007 1888 SEQ ID N 19 SEQ ID N 20 orfl0 * 710 937 SEQ ID N 21 SEQ ID N 22 The "c" added in the name of the gene indicates that the coding sequence is in reverse orientation (the coding strand is therefore the complementary strand of the sequence given in SEQ ID N ° 2 for these genes).
In order to determine the function of the identified polypeptides, three types . ~~, experiments were carried out: the comparison of the identified sequences with of '' sequences of known functions, gene inactivation experiments, condensing to the ~ '''~~
construction of mutant strains and analyzes of production in spiramycins and in intermediates of biosynthesis of spiramycins by these mutant strains.
The protein sequences deduced from these open reading phases have everything lo was first compared with those present in different databases data thanks to different programs: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search, COGs (Cluster of Orthologous Groups), FASTA ((Pearson W. R & DJ
Lipman, 1988) and (Pearson WR, 1990), BEAUTY (Worley I ~. C .. et al., 1995)).
These comparisons made it possible to formulate hypotheses on the function of products of these genes and identify those likely to be involved in biosynthesis of spiramycin. Table 2 shows proteins with strong similarity with the produces 10 genes located downstream of the 5 PKS genes.

Table 2 Protein Product with AccesScore Number Reported Function a of significant similarity GenBank BLAST *

orfl TyIMI (orf3 *) (S. CAA57473 287 N-* c fradiae) mthyltransfrase orf2 dnrQ Bene product AAD 15266 153 Inconna ~ e *vs (Streptomyces peucetius) orf3 TyIMII (orf2 *) (S. CAA57472 448 Glycosyltransfras * c fradiae) e orf4 * c Crotonyl-CoA rductaseNP_630556 772 Crotonyl-CoA

(S. coelicolor) rductase orf5 * MdmC (S. mycarofacieycs) B42719 355 O-mthyltransfrase orf6 * 3-O-acyltransfrase Q00718 494 Acyltransfrase (S.

mycarofaciens) orf7 * c MdmA (S. A60725 380 Protine impliesy mycarofaciens) in the resist ~ nc;

: .- ~,. .3., the midcam ~ cii ~ 'v'' orfg * ABC-transporter CAC22119 191 ABC-transporter (S.

griseus) orf ~ * ABC-transporter CAC22118 269 ABG-transporter (S.

griseus) orfl0 * putative small NP 627 432 109 Unknown conserved _ hypothetical protein (S.

coelicolor) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
Gene inactivation experiments were carried out to confirm these results.
The methods used consist in performing a gene replacement. The gene target at interrupt is replaced by a copy of this interrupted gene by a cassette conferring resistance to an antibiotic (e.g. apramycin, geneticin or hygromycin). The cassettes used are bordered on both sides by codons from translation completed in all reading phases and by terminators of active transcription at Streptomyces. Inserting the cassette into the target gene can with or without a deletion in this target gene. The size of the regions flanking 5 the cassette can range from a few hundred to several thousand pairs of basics. A
second type of cassette can be used for gene inactivation:
Cassette tapes say "excisable cassettes". These cassettes have the advantage of being able to be excised in Streptomyces by a site recombination event specific after have been introduced into the genome of S. ambofaciens. The goal is to deactivate some '~, ~, 10 genes in Streptomyces strains without leaving in the final strain markers selection or large DNA sequences not belonging to the strain.
After excision there remains only a short sequence of around thirty pairs of basics (called “scar site”) in the genome of the strain (see Figure 10). The setting work of this system consists, at first, in replacing the copy 15 wild target gene (through two homologous recombination events, cf. figure.
9) by a construction in which an excisable cassette has been inserted in this gene :: '.;
target. The insertion of this case is accompanied by a deletion in the target gene (see "~.
figure 9). Secondly, the excision of the excisable cassette from the genome of the strain is caused. The excisable cassette works thanks to a system of 20 site-specific recombination and has the advantage of allowing obtaining mutants of Streptomyces ultimately carrying no resistance gene. We break free also possible polar effects on the expression of genes located downstream of the of genes inactivated (see Figure 10). The strains thus constructed were tested for their spiramycin production.
25 The inactivation of the orfl * c, orf ~ * c, orf3 * c and orf4 * c genes has not been performed because sequence comparison experiments have determined that these Genoa had a relatively large similarity to genes involved in the biosynthesis of a relatively close antibiotic. So the orfl * c gene encodes a protein with an identity of 66% (determined thanks to the BLAST program) with 30 the protein encoded by the tylMl gene which codes for an N-methyltransferase involved in the tylosin biosynthesis and catalyzes 3 N-methylation during production of mycaminosis in Streptomyces fradiae (Gandecha, AR et al., 1997; Issue access GenBank: CAA57473; BLAST score: 287). This similarity to a protein involved in the biosynthetic pathway of another relatively antibiotic close and more particularly in the biosynthesis of mycaminosis suggests that the gene orfl * c encodes an N-methyltransferase responsible for N-methylation during biosynthesis of forosamine or mycaminosis (see Figures 5 and 6). This hypothesis is supported by the fact that the protein encoded by the orfl * c gene has a strong similarity with other proteins of similar function in other organisms (see Table 3).
l0 Table 3 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank mthyltransferase (S. antibioticus) CAA05643 277 mthyltransfrase N, N-dimthyltransferase (S. AAC68678 .268 N, N-venezuelde) ~, :at ~. ~

, ;
dimthyltransfrs ~

probable N-methylase snogX (S. T46679 243 N-methyltransfrase nogalater-) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfZ * c gene encodes a protein with relatively strong similarity (35%
identity) with a protein encoded by the tylMIlI gene encoding a hexose NDP
3.4 isomerase involved in the biosynthesis of tylosin in Streptomyces fradiae (Gandecha, AR, et al., 1997; GenBank access number: CAA57471; BMAST score 130). This similarity with a protein involved in the biosynthetic pathway a other close antibiotic and more particularly in the biosynthesis of mycaminose strongly suggests that the orf * 2c gene encodes an NDP hexose 3,4 isomerase responsible isomerization during the biosynthesis of one of the sugars of spiramycin, eventually mycaminosis (see Figures 5 and 6).
The orf3 * c gene encodes a protein with relatively strong similarity (59%
identity) with a protein encoded by the tylMll gene encoding a glycosyltransferase involved in the biosynthesis of tylosin in Streptomyces fradiae (Gandecha, AR
et al., 1997; GenBank Access Number: CAA57472; Sçore BLAST: 448).
similarity to a protein involved in the biosynthetic pathway of another nearby antibiotic strongly suggests that the orf * 3c gene codes for a glycosyltransferase:.
This hypothesis is supported by the fact that the protein encoded by the orf3 gene * c present.
strong similarity with other proteins of similar function in other organizations (see Table 4).
Table 4 Protein with Similarity Number Score Function Report ~:

BLAST * significant access GenBank ~

Glycosyl transfras AAC68677 Glycosyltransfrase (S. venezuelae) 426 ' Glycosyltransfrase (S. antibioticus) CAA05642 425 Glycosyltransfrase Glycosyltransfrase CAA74710 395 Glycosyltransfrase (Saccharopolyspora erythraea) Glycosyltransfrase (S. antibioticus) CAA05641 394 Glycosyltransfrase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990):
The orf4 * c gene encodes a protein with relatively strong similarity with several crotonyl-CoA reductases. In particular, the protein encoded by orf4 * c possesses a significant similarity with a crotonyl CoA reductase from Streptomyces coelicolor (Redenbach, M et al., 1996; GenBank access number: NP 630556;
Score BLAST: 772). This similarity to a protein involved in the pathway biosynthesis of another close antibiotic strongly suggests that the orf4 * c gene encodes also a crotonyl-CoA reductase. This hypothesis is supported by the fact that the protein coded by the orf4 * c gene has a strong similarity with other proteins of similar function with other organizations (see Table 5).
Table 5 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank trans-2-noyl-CoA rductase 572400 764 trans-2-noyl-CoA

(EC1.3.1.38) (S. collinus) rductase Crotonyl CoA rductase (S. CAA57474 757 Crotonyl CoA rductase fradiae) Crotonyl-CoA rductase (S. AAD53915 747 Crotonyl-CoA rductas ~, cinnamonensis),, ~. ~ Sy ~;
'.

* greater similarity of sequence 1 is associated a BLAST plus score high (Altschul et al., 1990).
The orf6 * gene has some similarity with the mdmB gene present in Streptomyces mycarofaciens (Hara and Hutchisnson, 1992; GenBank access number A42719; BLAST score: 489) producer of macrolide antibiotic. At this producer, the gene is involved in the acylation of the lactone cycle. The orf6 * gene would code so a acyltransferase. This hypothesis is supported by the fact that the protein encoded by the gene orf6 * has a strong similarity with other functional proteins similar at other organizations (see Table 6).

Table 6 Protein with Reported Function Score Number a significant similarity of BLAST access *

GenBank AcyA (Streptomyces J4001 450 macrolide 3-O-acyltransfrase thermotolerans);

Midcamycin 4 "-O- BAA09815 234 Midcamycin 4" -O-propionyl propionyl transfrase transfrase, (S

mycarofaciens) Mycarose O-acyltransfraseAAG13909 189 Mycarose O-acyltransfrase (Micromonospora megalomicea subsp.
nigra) * greater sequence similarity is associated with a more BLAST score ~~ ' high (Altschul et al., 1990).
Inactivation of the orf6 * gene was achieved by deletion / insertion into phase and he "' has been shown that the resulting strain no longer produces spiramycin II and III
But only spiramycin I (see Figure 1). This confirms that the orf6 * gene is good involved in the synthesis of spiramycin II and III. The enzyme encoded by this gene East responsible for the formation of spiramycin II and III by fixing a acetyl group or butyryl on carbon 3. Strains no longer expressing the encoded protein by the gene orf6 * are particularly interesting since they no longer produce spiramycin II and III but only spiramycin I. As stated above above, the activity spiramycin I antibiotic is significantly superior to that of spiramycins II and III
(Liu et al., 1999).
The orf5 * gene encodes a protein with relatively strong similarity to several O-methyltransferases. In particular, the protein encoded by orf5 * has a significant similarity with an O-methyltransferase (EC 2.1.1.-) MdmC of Streptomyces mycarofacie ~ s (Hara & Hutchinson, 1992; Access number GenBank: B42719; BLAST score: 355). This similarity to a protein involved in the biosynthetic pathway of another antibiotic strongly suggests that the orf5 gene *
also encodes an O-methyltransferase. The orf5 * gene is implicated in the 5 formation of precursors incorporated into the lactone cycle. Indeed, according to the including sequence sequences, the orf5 * gene product is also relatively close of FkbG which is responsible for the methylation of hydroxymalonyl-ACP according to (Wu and al., 2000; Hoffineister et al., 2000; GenBank Access Number: AAF86386;
Score ~ ° ..
BLAST: 247) (see Figure 8). This hypothesis is supported by the fact that the protein encoded '~' l0 by the orf5 * gene has a strong similarity with other proteins of function' similar in other organisms (see Table 7).
Table 7 Protein with Similarity Number Function Score Reported ~. ~~

significant BLAST * access, GenBank . ::: n ~: ~~ ....

Probable O-mth ~ ltransferase T185537 223 O-mthyltransferas ~ x (VS ' ~ '': 'a: d:
2.1.1.-) airlock (Myxococcus xanthus) 4-O-methyltransferase (EC JC4004 222 O-methyltransfrase 2.1.1.-) -(Streptomyces sp.) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
15 Thanks to the polar effect of the insertion of a non-excised cassette into the 6 * orf gene, it could be determined that the orf S * gene is essential for the pathway biosynthesis of spiramycin. Indeed, the insertion of the excisable cassette in the part gene coding orf 6 * results in a total halt in spiramycin production. However, once the inserted cassette has been excised (and therefore when only the orf6 * gene is inactivated, cf 20 examples 14 and 15), we find a production of spiramycin I. This shows that the 5 * orf gene is essential to the biosynthetic pathway of spiramycins since his inactivation results in a complete halt in production of spiramycins.
The orf5 * gene encodes a protein with relatively strong similarity to several O-methyltransferases. The orf5 * gene would be an O-methyl transferase involved either directly in the synthesis of platenolide, or in the synthesis of a précurseuf methylated (methoxymalonyl, see Figure 8) incorporated into platenolide by the PKS. For verify this hypothesis, CL / SM and NMR analysis experiments were piping on a strain of S. ambofaciens of genotype: orf6 *:: atttl S2hyg +. In this strain lë .r orf5 * gene is not expressed due to the polar effect of insertion, in the orf6 * gene, of the cassette which contains transcription terminators (cf. example 27). He was shown that this strain produces a molecule with a UV spectrum similar to that of spiramycin I but the mass spectrum shows a molecular ion to 829. The mass difference of 14 from the mass of spiramycin can explain yourself by r ~ ..
the absence of methyl on the oxygen carried by carbon n ° 4 of the cycle lactone (there '. ~' . 15 structure of this compound is presented in Figure 39). The obtained results by RMN sont'v'fv r ~.
.,, ..; ~ iFV.
consistent with this assumption. The presented iin compound at 829 allows validate the hypothesis of the role of orf5 * in the biosynthesis of spiramycins. In addition, the product corresponding to spiramycin without the methyl group has a very low microbial activity (10-fold lower) compared to spiramycin no modified, when tested on the microorganism Micrococcus luteus.
The orf7 * c gene encodes a protein with relatively strong similarity to a protein encoded by the mdmA gene from Streptomyces mycarofaeiens, the latter coding a protein involved in midecamycin resistance in this organism producer (Hara et al., 1990; CienBank access number: A60725; BLAST score: 380).
This similarity to a protein involved in the biosynthetic pathway of another antibiotic strongly suggests that the orf7 * c gene also encodes a protein involved in resistance to spiramycin. More specifically, the enzyme coded by the orf7 * c gene has methyltransferase activity and is involved in the resistance to spiramycin in Streptomyces ambofaciens. This gene has been shown to be imparts a resistance of the MLS I type, resistance which we know is due to the mono-methylation at position A2058 of 23S ribosomal RNA (Pernodet et al., 1996).
This hypothesis is supported by the fact that the protein encoded by the orf7 * c gene presents a strong similarity with other proteins of similar function in others agencies (see table 8).
Table 8 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank macrolide-lincosamide-streptograminJC5319 238 23S rRNA
B

resistance determinant (S. methyltransfrase fradiae) 23 S ribosomal RNA methyltransferaseAAL68827 119 23 S rRNA

ErmML (Micrococcus luteus) methyltransfrase * greater similarity in sequence is associated with a more BLAST score i, a high (Altschùh et al.; v1990). ~~ ~ - ' The orfg * gene encodes a protein with relatively strong similarity to a ABC transporter protein in Streptomyces griseus (Campelo, 2002, Number GenBank access: CAC22119; BLAST score: 191). This similarity with a protein of the ABC transporter type strongly suggests that the orfg * gene also encodes a ABC transporter protein that may be involved in resistance to the spiramycin. This hypothesis is supported by the fact that the protein encoded by the gene orfg * has a strong similarity with other functional proteins similar at other organizations (see Table 9).

3 ~
Table 9 Protein with Similarity Access Number Function significant GenBank BLAST * reports AcrW (Streptomyces galilaeus) BAB72060 94 Transporter ABC

Daunorubicin resistance transmembrane P32011 89 Rsistance the protein (Streptomyces peucetius) daunorubicin .

Probable ABC-transporter, NP 626 506 89 Transporter .

transmembrane component. C ~

(Streptomyces coelicolor) * greater sequence similarity is associated with a more BLAST score Student .
(Altschul et al., 1990).
. The orf9 * gene encodes a protein with relatively strong similarity with a ' ,, ',, 'S protein of ABC transptirt type in Streptomyeés griseus (Campelo, 2002, Nunïé ~ 'o ~ $' GenBank access: CAC22118; BLAST score: 269). This similarity with a protein, of the ABC transporter type strongly suggests that the orf ~ * gene also encodes a ABC transporter protein that may be involved in resistance to the spiramycin. This hypothesis is supported by the fact that the protein encoded by the gene l0 orf $ * has a strong similarity with other functional proteins similar at other organizations (see Table 10).
Table 10 Protein with Similarity Number Function Score significant BLAST * access reports GenBank Probable ABC-type transport protein, NP 626505 231 Transporter ATP

binding component (S. coelicolor) ABC

Putative ABC transporter ATP-binding NP 627 624 228 Transporter component (Streptomyces Coelicolor) ABC

* greater sequence similarity is associated with a more BLAST score Student (Altschul et al., 1990).
The orfl0 * gene encodes a protein with relatively strong similarity with a protein of unknown function. However, genes similar to orfl0 * are found in the midst of several groups of genes involved in biosynthesis antibiotics.
Thus a gene close to orfl0 * is found in S. coelicolor (Redenbach and al., 1996, ~, GenBank access number: NP 627432, BLAST score: 109). A close gene (Coin is also found in S. rishiriensis (Wang et al., 2000, access number GenBank: AAG29779, BLAST 97 score).
l0 ö ~.
Genes located upstream of the genes encoding PKS, ';
, ~. . .-In the: DNA sequence located in azriont of genes encoding PKS (downstream and ": ~ ' the upstream being defined by the orientation of the 5 PKS genes all oriented in the same sense) (see Figure 3), 34 ORFs have been identified (see above). So the 34 phases reading openers of this type, occupying an area of approximately 41.7 kb (cf. SEQ
ID # 1 presenting a first region of 31 kb containing 25 ORFs and SEQ ID N °

having a region of around 12.1 kb of which 1.4 kb overlap the sequence previous (SEQ ID N ° 1) and around 10.7 kb correspond to the rest of the sequence), the latter part of approximately 10.7 kb containing 9 additional ORFs (including an ORF of sequence partial), see also Figures 3 and 37 and below). A representation schematic of the organization of the region is presented in FIGS. 3 and 37. The 34 genes identified were named: orfl, orfl, orf3, orf4, orf5, orf6, orf7, orf8, orf ~ c, orfl0, orfllc, orfl2, orfl3c, orfl4, orfl Sc, orfl6, orfl7, orfl8, orfl9, orfZO, orf21 c, orf22c, orfZ3c, orf24c, orf25c, orfZ6, or, f27, orfl8c, or, f29, orf30c, orf3l, orf32c, orf33 and orf34c.

In Table 11 below are presented the references to the DNA sequence and in amino acids of the 34 genes identified upstream of the 5 PKS genes.
Table 11 Gene Position in the DNA DNA sequence) polypeptide (s) 2 S
sequence SEQ ID N

orfl 658 1869 SEQ ID N SEQ ID N 24 orf ~ 1866 2405 SEQ ID N SEQ ID N 26 and 27 orf3 2402 3568 SEQ ID N SEQ ID N 29 orf4 3565 4473 SEQ ID N SEQ ID N 31, 32 and 33 orf5 4457 5494 SEQ ID N SEQ ID N 35 v orf6 5491 6294 SEQ ID N SEQ ID N 37, 38 and 39 orf7 6296 7705 S EQ 1D N 40 SEQ 1D N 41 and 42 i _. '' t. <ri , I

'~:
orf8 8011 9258 SEQ ID NI t ': ~

orf9c 10081 9362 SEQ ID N SEQ ID N 46 orfl0 10656 12623 SEQ ID N SEQ ID N 48 orfll 14482 12734 SEQ ID N SEQ ID N 50, 51 and 52 c 49 orfl2 14601 16031 SEQ ID N SEQ ID N 54, S5, 56, 53 57, 58 and 5 ~

orfl3c17489 16092 SEQ ID N SEQ ID N 61 orfl4 17809 18852 SEQ ID N SEQ ID N 63 orfl5c20001 18961 SEQ ID N SEQ ID N 65 orfl6 20314 21552 SEQ ID N SEQ ID N 67 orfl7 21609 22879 SEQ ID N SEQ ID N 69 orfl8 22997 24175 SEQ ID N SEQ ID N 71 orfl9 24177 25169 SEQ ID N 72 SEQ ID N 73 orf ~ 0 25166 26173 SEQ ID N 74 SEQ ID N 75 orf ~ l 27448 26216 SEQ ID N 76 SEQ ID N 77 vs orfZ2c28560 27445 SEQ ID N 78 SEQ ID N 79 s orf ~ 3c29770 28649 SEQ IID N SEQ ID N 81 gold, 30074 29763 SEQ ID N 82 SEQ ID N 83 orflSc30937 30071 SEQ ID N 84 SEQ ID N 85 Gene Position in the DNA Squences) polypeptide (s) 2 sequence SEQ ID NO

gold, 1647 2864 SEQ ID N 107 SEQ ID N 108 f ~ 6 gold, 2914 3534 SEQ ID N 109 SEQ ID N 110 f7 orfi8c4967 3804 SEQ ID N 141 SEQ D7 N 142 ' orfl9 5656 6663 SEQ ID N 113 SEQ ID N 114 ..;

orf30c7723 6686 SEQ ID N 115 SEQ ID N 116 and 117 orf31 7754 8728 SEQ ID N 118 SEQ ID N 119 orf32c10488 8977 SEQ ID N 145 SEQ ID N 146 orf33 10562 10837 SEQ ID N 147 SEQ ID N 148 orf34c12134 10899 SEQ ID N 149 SEQ ID N 150 'The "c" added in the name of the gene indicates that the coding sequence is in reverse orientation (the coding strand is therefore the complementary strand of the sequence given in SEQ ID N ° 1 or SEQ ID N ° 140 for these genes).
2 When several protein sequences are indicated for a single orf, the corresponding proteins come from several possible sites of start of the translation.

In order to determine the function of the polypeptides identified in the table 11 above, three types of experiments were carried out: the comparison of the identity of sequences identified with sequences of known functions, experiments inactivation of genes and analyzes of the production of spiramycins from these strains mutant.
s The protein sequences deduced from these open reading phases have everything first compared with those present in different databases thanks to different programs: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD- ' search, COGs (Cluster of Orthologous Groups), FASTA ((earson W. R & DJ
10 Lipman, 1988) and (Pearson WR, 1990), BEAUTY (Worley KC. et al., 1995)), (cf. below above). These comparisons made it possible to formulate hypotheses on the function of products of these genes and identify those likely to be involved in the biosynthesis of spiramycin. Table 12 shows the proteins with a strong similarity with the 34 genes located upstream of the 5 PKS genes.
,,; ~ ;;
. 15 Table 12 J;:.
r T

t . 'Grie Protine prsentant a similitude ISSUE
Score Function significant of access BLAST *
reports GenBank orfl Cytochrome P450 tylI (Streptomyces549051 530 Cytochrome fradiae) orf2 ORF15x4 (Listonella anguillarum) AAB81630 113 Unknown orf3 aminotransferase-like proteinAAF59939 431 Amino-(Streptomyces autibioticus) transfrase orf4 alpha-D-glucose-1-phosphate AAC68682 404 alpha-D-glucose thymidylyltransferase (Streptomyces 1-phosphate venezuelae) thymidylyltransf shaves orf5 AprE (Streptomyces tenebrarius) AAG18457 476 dTDP-glucose 4,6-dshydratase orf6 Thioesterase (Streptomyces BAB69315 234 Thioestrase avermitilis) orf7 TyICVI (Streptomyces fradiae) AAF29379 461 dNTP hexose 2,3-dshydratase orf $ probable aminotransferase AAG23279 465 Aminotransfra ~

(Saccharopolyspora spinosa) d orfpcSrmX (Streptomyces ambofaciens) 525204 445 Mthyltransfra;
' orfl0SrmR (Streptomyces ambofaciens) 525203 1074 Protein rgulation orfllSrmB (Streptomyces ambofaciens) 525 202 955 Resistance this.

spiramycin orfl2UrdQ (Streptomyces fr-adiae) AAF72550 634 NDP-hexose 3.4 dshydratase orfl3cSC4H2.17 (Streptomyces coelicolor) T35116 619 Unknown orfl4putative reductase (StreptomycesCAB90862 147 Rductase coelicolor) orflScProbable 3-ketoreductase T5 ~ 1 ~ 102 285 3-ctorductase (Strep ~ omyce ~ ' ntibioticus). .

orfl6Hypothetical NDP hexose 3,4 CAA57471 209 NDP hexose 3.4 isomerase (Streptomyces fradiae) isomrase orfl7Glycosyl transfrase (StreptomycesAAC68677 400 Glycosyl venezuelae) - transfras orfl8Glycosyl transfrase (StreptomycesAAG29785 185 Glycosyl rishiriensis) transfrase orfl9NDP-hexose 4-ctoreductase AAD41822 266 NDP-hexose TyICIV 4-(Streptomyces fradiae) ctorductase orfZOEryBII (Saccharopolyspora AAB84068 491 aldocto erythraea) rductase orf21TyICIII (Streptomyces fradiae) AAD41823 669 NDP-hexose c 3-C

mthyltransfrasf orf22cFkbH (Streptomyces hygroscopicus) AAF86387 463 Involved in the biosynthesis of mthoxymalonyl orf ~ 3eFkbI (Streptomyces hygroscopicus) AAF86388 387 Acyl CoA

dshydrognase orfZ4cFkbJ (Streptomyces ~ hygroscopicus) AAF86389 87 Involved in the biosynthesis of mthoxymalonyl orfSc FkbK (Streptomyces hygroscopicus) AAF86390 268 Acyl CoA
. , dshydrognase orf26 TyICV (Streptomyces fradiae) AAD41824 471 Mycarosyl transferase orfl7 TyICVII (Streptomyces fradiae) AAD41825 243 NDP-hexose 3.5 ~

(or 5-) pimerasE

orfl8cAcyB2 (Streptomyces thermotolerans) JC2032 451 protein rgulatrice .

i ~

or, Bta-mnannase (Sorangium AAK19890 139 Glycosyl fl9 r.
~

Y
w cellulosum) ~, .
hydrolase you orf30cSugar-nucleoside-NP epimrase_600590 89 Epimrase of diphosphate (Corynebacterium sugar-nucloside ~

glutamicum) diphosphate orf31 Oxidorductase (Streptomyces NP_631148 261 Oxidorductase coelicolor) orf32c NP 282 regulatory protein Protein GntR family 824604 (Streptomyces avermitilis) _ regulating orf33 Hypothetical protein (XanthomonasNP_635564 54 Unknown campestris) orf34cArabinofuranosidase (StreptomycesNP 654 Arabinofuranosid coelicolor) _ ase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).

Gene inactivation experiments were carried out to confirm these results. The methods used consist in performing a replacement of uncomfortable. The target gene to be interrupted is replaced by a copy of this interrupted gene by a cassette conferring resistance to an antibiotic (for example apramycin or 5 hygromycin). The cassettes used are bordered on both sides by codons from translation completion in all reading phases and by these terminators of active transcription at Streptomyees. Inserting the cassette into 'the target gene can with or without a deletion in this target gene. The size of the regions flanking the cassette can range from a few hundred to several thousand pairs of bases. IJri r. ~ ',' The second type of cassette can be used for the inactivation of genes:
Cassette tapes say "excisable cassettes" (see above). The strains thus constructed have been tested for their production of spiramycins.
The orfl gene encodes a protein with relatively strong similarity to several cytochrome P450. In particular, the protein encoded by orfl has a unique 15 significant similarity to the protein encoded by the tyll gene involved in v. . ~, tylosin biosynthesis in Streptomyces fradaae (Merson-Davies, LA et al., 1994, ~ '' ~ r:
The ~~ ~ GenBank access number: 549051; BLAST score ~: 530). This similarity with groin asr protein involved in the biosynthetic pathway of another nearby antibiotic suggests strongly that the orfl gene also encodes a cytochrome P450. This hypothesis East 20 supported by the fact that the protein encoded by the orfl gene has a strong similarity - with other proteins of similar function in other organisms (cf.
table 13).
Table 13 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Putative cytochrome P450 034374 248 Cytochrome P450 YJIB

(Bacillus subtilis) Cytochrome P450 113A1 P48635 237 Cytochrome P450 (Saccharopolyspora erythraea) Cytochrome P-450 hydroxylaseAAC46023 208 Cytochrome P-450 homolog (Streptomyces caelestis), ~ hydroxylase Cytochrome P450 monooxygnaseAAC64105 206 Cytochrome P450 (Streptomyces venezuelae) monooxygnase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfl gene encodes a protein with relatively strong similarity to elder dTDP-6-deoxy 3,4-keto-hexulose isomerase from Aneurinibacillus thermoaerophilus (Pfoestl, A. Et al., 2003, GenBank access number: AA006351; BLAST score:
118). ., This similarity strongly suggests that the orfl gene codes for an isomerase responsible for, ~.
the isomerization reaction necessary for the biosynthesis of one of the sugars present in the spiramycin molecule, this sweat may be mycarosis (see Figure 5).
inactivation of the orf2 gene was performed. It has been shown that the resulting strain does not produces more than spiramycin. This confirms that the orfZ gene is indeed involved in the biosynthesis of spiramycin.
The orf3 gene encodes a protein with relatively strong similarity to several aminotransferases. In particular, the protein encoded by orf3 has a significant similarity to an aminotransferase from Streptomyces antibioticus involved in the biosynthesis of oleandomycin (Draeger, G., et al., 1999; Issue access GenBank: AAF59939; BLAST score: 431). This similarity to a protein involved in the biosynthetic pathway of another nearby antibiotic suggests strongly that the orf3 gene codes for a 3 amino transferase responsible for the reaction of transamination necessary for the biosynthesis of one of the amino sugars of spiramycins (cf.
figure 5). This hypothesis is supported by the fact that the protein encoded by the orf3 gene has a strong similarity with other proteins of similar function at others organizations (see Table 15).
Table 15 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank ' Aminotransfrase (StreptomycesT51111 429 Aminotransfrase antibioticus), Transaminase (Streptomyces AAC68680 419 Transaminase venezuelae) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990). ' The orf3 gene was inactivated. It has thus been shown that the strain resulting no longer produces spirarriycins. This confirms that the orf3 gene is good involved in the biosynthesis of spiramycins. The enzyme encoded by this gene is therefore well responsible for a bioconversion step essential to the biosynthesis of spiramycin. The production of spiramycins can be supplemented by expression of the TyIB protein of S. fradiae (cf. example 23). This demonstrates that the gene orf3 code a 3 amino transferase responsible for the transamination reaction necessary for the biosynthesis of mycaminosis (see Figure 5). As mycaminosis is the first sugar to be fixed on platenolide, it is expected that the strain interrupted in orf3 (OS49.67) accumulates platenolide.
Intermediaries of the biosynthesis of the interrupted strain in the orf3 gene have have been studied (cf. example 20). These experiments have demonstrated that this strain produces two forms of platenolide: platenolide A and platenolide B, the structure deduced from these two molecules is presented in FIG. 36. This strain produces also platenolide A + mycarose and platenolide B + mycarose (cf.
example 20 and figure 40). These compounds contain a sugar but do not contain mycaminose. In addition if we compare them to spiramycin (cf. Figure 1), these compounds have mycarose instead of mycaminose. These results are in agreement with the involvement of the orf3 gene product in the biosynthesis of mycaminosis and its role in as long as 3 amino transferase responsible for the transamination reaction necessary for the biosynthesis of mycaminosis (see Figure 5). We can ~ E notice that the specificity of glycosylation does not seem absolute since we find molecules with the mycarose fixed at the position normally occupied by mycaminosis (cf. figure 40).
The orf4 gene encodes a protein with relatively strong similarity to several NDP-glucose synthetases. In particular, the protein encoded by orf4 has a significant similarity with alpha-D-glucose-1-phosphate thymidylyltransferase Streptomyces venezuelae (Xue Y et al., 1998; GenBank access number: AAC68682 ;.
BLAST score 404). This similarity to a protein involved in the pathway ~: ~: ' biosynthesis of another nearby antibiotic strongly suggests that the orf4 gene united code NDP-glucose syntethase responsible for the synthesis of NDP-glucose necessary for the. ~ z ~ s biosynthesis of the three atypical sugars incorporated into the molecule spiramycin (cf ~ ~ t = ~ 7 ' Figure 4, 5 and 6). This hypothesis is supported by the fact that the protein coded by the gèrië ~. ~ 1 orf4 has a strong similarity with other functional proteins similar at other organizations (see Table 16).
Table 16 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Glucose-1-phosphate BAA84594 402 Glucose-1-phosphate thymidyltransfrase (Streptomyces thymidyltransfrase avermitilis) AcIY (Streptomyces galilaeus) BAB72036 400 dTDP-1-glucose synthtase Putative glucose-1-phosphate AAK83289 399 glucose-1-phosphate thymidyltransfrase thymidyltransfrase (Saccharopolyspora spinosa) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orf5 gene encodes a protein with relatively strong similarity to several glucose dehydratases. In particular, the protein encoded by orf5 has a significant similarity with Streptomyces dTDP-glucose 4,6-dehydratase tenebrarius (Li, TB et a1., 2001; GenBank access number: AAG18457, Scoré ', BLAST: 476). This similarity to a protein involved in the pathway biosynthesis from another nearby antibiotic strongly suggests that the orf5 gene codes for one.
NDP
glucose dehydratase necessary for biosynthesis, of the three, atypical sugars incorporated; ~~
io in the molecule of spiranycin (see Figure 4, S and 6). This hypothesis is ~ supported by ~ '''' fact that the protein encoded by the orf5 gene has a strong similarity to other proteins of similar function in other organisms (see Table 17).
Table 17 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank DTDP-glucose 4,6-dshydrataseAAK83290 464 DTDP-glucose 4,6 (Saccharopolyspora spi ~ cosa) dshydratase thymidine diphosphoglucose AAA68211 445 thymidine 4,6 hydratase (Saccharopolyspora diphosphoglucose erythraea) 4,6-dshydratase dTDPglucose 4,6-dshydratase549054 443 dTDPglucose (EC 4,6- ' 4.2.1.46) - (Streptomyces dshydratase fradiae) TDP-glucose-4,6-dshydrataseAAC68681 421 TDP-glucose-4,6-(Streptomyces venezuelae) dshydratase SgcA (Streptomyces globisporus) AAF13998 418. ' dNDP-glucose-4,6 dshydratase * greater sequence similarity is associated with a more BLAST score : _ ~.
high (Altschul et al., 1990).
The orf6 gene encodes a protein with relatively strong similarity to several thioesterases. In particular, the protein encoded by orf6 has a similitude 5 important with a thioesterase from Streptomyces avermitilis (Omura, S. And al., 2001;
GenBank Access Number: BAB69315; BLAST score: 234). This similarity with a: ~ v protein involved in the biosynthetic pathway of another nearby antibiotic suggest 3 ~ r strongly that the orf6 gene encodes equal ~ iént one, thio ~ steraseThis hypothesis is and ~, ~ ée t ', l, Yp .., .. -. . .
by the fact that the protein encoded by the orf6 gene has a strong similarity with y lo other proteins of similar function in other organisms (cf.
table 18).
Table 18 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank RifR (Amycolatopsis mediterrauei) AAG52991 216 Thioestrase Thioestrase - (Streptomyces549055 215 Thioestrase fradiae) Thioestrase (Streptomyces BAB69188 213 Thioestrase avermitilis) Thioestrase II (EC 3.1.2.-) T17413 203 Thioestrase -(Streptomyces venezuelae) PimI protein (Streptomyces CAC20922 201 Thioestrase natalensis) Thioestrase (Streptomyces CAC22116 200 Thioestrase griseus) s s * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orf7 gene encodes a protein with relatively strong similarity to several hexose dehydratases. In particular, the protein encoded by orf 7 has a significant similarity with dNTP hexose 2,3-dehydratase (encoded by the gene TyICVI) of Streptomyces fradiae involved in the biosynthesis of tylosin (Merson-Davies, LA et al., 1994; GenBank Access Number: AAF29379; BLAST score:
461).
This similarity with a protein involved in the biosynthetic pathway of a other nearby antibiotic strongly suggests that the orf 7 gene also codes for a hexose 2-3.
l0 dehydratase necessary for the biosynthesis of two atypical sugars incorporated into the spiramycin molecule (see figures 4 and 6). This hypothesis is supported by the fact that the protein encoded by the orf7 gene has strong similarity to other protein similar function in other organisms (see Table 19).
Table 19 Protein with Reported Function Number similitude BLAST * significant access GenBank Rifl8 (Amycolatopsis mediterranei) AAG52988 459 Hexose dshydratase SimB3 (Streptomyces antibioticus) AAI ~ 06810444 dNDP-4-keto-6-doxy-glucose-2,3-dshydratase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).

The orf ~ gene encodes a protein with relatively strong similarity to several aminotransferases. In particular, the protein encoded by orf ~ has a significant similarity with an aminotransferase probably involved in the biosynthesis of forosamine in Saccharopolyspora spinosa (Waldron, C. and al., 2001;
GenBank Access Number: AAG23279; BLAST score: 465). This similarity with a protein involved in the biosynthesis pathway of another closely related antibiotic, suggests strongly that the orfg gene codes for a 4 amino transferase responsible for reaction of transamination necessary for the biosynthesis of forosamine (see Figure 6).
This hypothesis is supported by the fact that the protein encoded by the gold gene, f $
presents a strong v l0 similarity with other proteins of similar function in others organizations (cf.
table 20).
Table 20 Protein with a. Number Function Score Reports similitude BLAST * significant access GenBank ~.

Putative amino-sugar biosynthesisCAAU7666 213 Protein involves in L

protein (Bordetella bronchiseptica) amino sugar biosynthesis * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orf $ gene was inactivated. It could thus be shown that the strain resulting no longer produces spiramycins. This confirms that the orf $ gene is well involved in the biosynthesis of spiramycins. The enzyme encoded by this gene is therefore well responsible for a bioconversion step essential to the biosynthesis of spiramycin. The validation of the hypothesis of the role played by the gene product orf ~ in the biosynthesis of forosamine is brought about by the fact that an incativated mutant for the gold gene, fg produces forocidin, this mutant is therefore blocked at the forocidin and does not produce neo-spiramycin (cf. FIG. 7 and example 25). These results are in agreement with an implication of the orf ~ gene product in the biosynthesis of forosamine (cf. figure 6).
The orf ~ ca gene already identified in Streptomyces ambofaciens and has been designed srmX by Geistlich et al. (Geistlich, M., Et al., 1992). The similarity of the encoded protein by this gene with several methyltransferases involved in the pathway biosynthesis other closely related antibiotics strongly suggests that the or9c gene codes for a methyl transferase responsible for the methylation reaction necessary for the biosynthesis of mycaminosis or forosamine (see Figures 5 and 6). This hypothesis is supported by the fact .
that the protein encoded by the orfpc gene has a strong similarity with other 10 proteins of similar function in other organisms (see Table 21).
Table 21 Protein with similarity Number Function Score reported ~~ r.

BLAST * significant access GenBank 1, ~
N, N-dimthyltransfrase AAC68678 240 N
NOT-(Streptomyces venezuelae), dimthyltransfras ~ ' Mthyltransfrase (StreptomycesCAA05643 232 Mthyltransfrase antibioticus) Putative amino methylase AAF01819 219 Aminomthylase (Streptomyces nogalater) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfl0 gene has already been identified in Streptomyces ambofaciens and has been designed srmR by Geistlich et al. (Geistlich, M., Et al., 1992). The protein encoded by this gene is involved in regulating the biosynthetic pathway for spiramycins in Ambofacial streptomyces. The orfl0 gene was inactivated. He could so be shown that the resulting strain no longer produces spiramycins. This confirms that the orfl0 gene is well involved in the biosynthesis of spiramycins. Protein coded by this gene is therefore very essential for the biosynthesis of spiramycins.
On the other hand ; the starting point for the translation of orf 10 was determined and he could be shown that overexpression of this gene leads to an improvement in the spiramycin production. The translation start site corresponds to an ATG
located upstream of the ATG proposed by Geistlich et al. (Geistlich, M., Et al., 1992). He has in further been shown that this 5 'end is essential to the function of OrflO since someone messenger truncated in 5 'is inactive (see example 17). To get the effect searched on the ~~~
production of spiramycins, so it is essential that the overexpression of orfl0 either. , made while taking care not to express a messenger truncated in 5 'of orfl0.
The orfll gene has already been identified in Streptomyces ambofaciens and has been designed srmB by Geistlich et al. (Geistlich, M. Et al., 1992) and Schoner et al.
(Schoner B et al., -:
1992). The protein encoded by this gene is involved in resistance to spiramycin. ~, ' at Streptomyces ambofaciens and is an ABC type transporter.
The orfl2 gene encodes a protein with relatively strong similarity to z A ' f-Agi '., ... r -'; -. '' ~, a.
several hexose dehydratases. In particular, the protein encoded by orfl2 has a V
significant similarity with an NDP-hexose 3,4-dehydratase encoded by the gene UrdQ
of Streptomyces fradiae and involved in the biosynthesis of urdamycin (Hoffmeister, D. Et al., 2000; GenBank access number: AAF72550; BLAST score 634). This similarity with a protein involved in the biosynthetic pathway a another nearby antibiotic strongly suggests that the orfl2 gene codes for a 3,4 dehydratase responsible for the dehydration reaction necessary for the biosynthesis of the forosamine (cf. figure 6). This hypothesis is supported by the fact that the protein encoded by the gene orfl2 has a strong similarity with other functional proteins similar at other organizations (see Table 22).

Table 22 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank AknP (Streptomyces galilaeus) AAF73452 625 3-dshydratase d t NDP-hexose 3,4-dehydratase AAD13547 624 NDP
homolog h -exoses 3,4-(Streptomyces cyanogenus) dshydratase , RdmI (Streptomyces purpurascehs) AAL24451 608 hexose-C-3-dshydratase Probable CDP-4-keto-6-deoxyglucose-T46528 602 CDP-4-cto-6-3-dehydratase (El) (Streptomyces doxyglucose-3-violaceoruber) dshydratase Probable NDP-hexose-3,4-dehydratase AAG23278 582 NDP-hexose-3,4-(Saecharopolyspora spinosa) ~; .:; shydratase y, d dNTP-hexose dshydratase AAC01730 576 dNTP-hexose (Amycolatopsis mediterranei) dshydratase fi greater sequence similarity is associated with a higher BLAST score high (Altschul et al., 1990).
Inactivation of the orfl2 gene has been performed. It could be shown that the strain The resulting 5 no longer produces spiramycins. This confirms that the orfl2 gene is good involved in the biosynthesis of spiramycin. The enzyme encoded by this gene is therefore well responsible for a bioconversion stage essential to the biosynthesis of the spiramycin. The validation of the hypothesis of the role played by Orfl2 in the biosynthesis of forosamine is brought about by the fact that an incativated mutant for the gene orfl2 does not produce 10 more forosamine. However, it produces a small amount of forocidin.
This mutant is therefore blocked at the forocidin stage and does not produce neo-spiramycin (cf. figure 7 and example 26). This mutant also produces a compound of the structure presented in figure 38. The latter compound contains two sugars, mycaminose and mycarose but born contains no forosamine. Furthermore if we compare it to the structure of the spiramycin (cf. FIG. 1), this compound contains the mycarose sugar in the expected place of the forosamine. These results are consistent with the implication of the gene product orfl2 'in the biosynthesis of forosamine (cf. Figure 6). We can notice that the specificity glycosylation is not absolute since we observe molecules in which the rnycarose is fixed at the position normally occupied by forosamine (see figure 38).
The orfl3c gene encodes a protein with relatively strong similarity to a R
lo protein of unknown function in Streptomyces coelicolor. This protein has been named SC4Ii2.17 (GeneBank access number: T35116; BLAST score: 619). The protein encoded by the orfl3c gene also has strong similarity to other proteins from other organisms (see Table 23).
Board 5., %!

~

7 f t.
'7 ~
. .
'' Protein prsentant iiiie similitud Ntimr . Score Function rappit ~ y significant of access BLAST *

GenBank hflX protein (Mycobacterium 572938 473 Unknown leprae) Possible ATP / GTP-binding NP 301 739 470 Protein fixing protein (Mycobacterium leprae) ATP / GTP

GTP-binding protein (MycobacteriumAAI ~ 47114 468 Protein binding the tuberculosis CDCI S51) GTP

ATP / GTP-binding protein T44592 388 Protin fixing (Streptomyces fradiae) ATP / GTP

* greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).

No specific function has been assigned to proteins close to that encoded by orfl3c. The inactivation of the orfl3c gene was performed in order to study function of this gene in the spiramycin biosynthesis pathway in Streptomyces ambofaciehs. It has been shown that the resulting strain produces spiramycin. This indicates that the orfl3c gene is not essential for the biosynthesis of spiramycins and that it is not essential for the survival of the bacteria. The enzyme encoded by this gene is therefore not responsible for a bioconversion step essential to the biosynthesis of spiramycin.
The orfl4 gene encodes a protein with relatively strong similarity to a putative reductase (Redenbach, M., et al., 1996; Bentley et al., 2002; issue access ~.
10 GenBank: CAB90862; BLAST score: 147).
Inactivation of the orfl4 gene has been performed. It could thus be shown that the strain resulting no longer produces spiramycins. This confirms that the orfl4 gene is good involved in the biosynthesis of spiramycins. The enzyme encoded pax this gene is therefore . .
well responsible for a stage. of bioconversion essential for biosynthesis '' v '' i5 spiramycins. Inter ~ neda ~ res of biosynthesis of the interrupted strain in the gene ' orfl4 have been studied (see example 20). These eXperiences have made it possible to demonstrate that this strain produces platenolide A but does not produce platenolide B
(cf. figure 36).
The orfl5c gene encodes a protein with relatively strong similarity to 20 several ketoreductases. In particular, the protein encoded by orfl5c has a significant similarity with a 3-ketoreductase in Streptomyces antibioticus (Number GenBak access: T51102, BLAST score: 285). This similarity suggests strongly that the orfl5c gene codes for a 3 keto-reductase responsible for the reaction of reduction necessary for the biosynthesis of forosamine (cf. Figure 6). This hypothesis is supported by 25 the fact that the protein encoded by the orfl5c gene has a strong similarity with other proteins of similar function in other organisms (see table 24).

58 Table 24 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank oxidoreductase homolog (StreptomycesAAD13550 272 Oxidorductase cyanog ~ us) D-oliose 4-ctoreductase CAB96550 265 D-oliose 4-(Streptomyces argillaceus) ctorductase AknQ (Streptomyces galilaeus) AAF73453 263 putative 3-ctorductase Probable NDP-hexose-3-ketoreductaseAAG23275 253 NDP-hexose-3-(Saccharopolyspora spinosa) ctorductase * greater sequence similarity is associated with a more BLAST score :;
high (Altschul et al., 1990). y.
. . s ~ '~. . ' ,. -; . ". ~ ~,,, ~ ,, i .: ~ 1 The orfl6 gene encodes a protein with relatively strong similarity to several isomerases. In particular, the protein encoded by orfl6 has a similitude significant with NDP hexose 3,4 isomerase in Streptomyces fradiae (Gandecha and al., 1997; GenBak access number: CAA57471, BLAST score: 209). This similitude strongly suggests that the orfl6 gene encodes a protein involved in the biosynthesis one of the spiramycin sugars (cf. FIGS. 5 and 6). This assumption is supported by the fact l0 that the protein encoded by the orfl6 gene has a strong similarity with other proteins of similar function in other organisms (see Table 25).

59 Table 25 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Putative tautomerase (StreptomycesAAC68676 145 Tautomrase venezuelae);

TDP-4-cto-6-doxyhexose 3,4-AAG13907 112 TDP-4-cto-6-isomrase (Micromonospora doxyhexose 3,4-megalomicea subsp. nigra) isomrase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfl 7 gene encodes a protein with relatively strong similarity to ,. ..
several glycosyl transferases. In particular, the protein encoded by orfl7 has a significant similarity, with a glycctsyl t ~ ansferase from Streptomyces venezuelae (Xue, Y ~
r, ~~
. there. ' x u .:,. ' . ys'~; ~, .lak'1 et al., 1998; ~ Numéirô v .d ans ~~ e ~ 'ÄAC68 ~ 677; '~ enrolled. BLAST: 400). "
~ The #
~, a-:.
similarity of the protein encoded by the orfl7 gene with several glycosyls transferases ~, involved in the biosynthetic pathway of other closely related antibiotics suggests strongly that this gene also codes for a glycosyl transferase. This assumption is supported by makes the protein encoded by the orfl7 gene very similar with others proteins of similar function in other organisms (see Table 26).
Table 26 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Glycosyltransfrase (StreptomycesCAA57472 399 Glycosyltransfrase fradiae) - -Glycosyltransfrase (StreptomycesCAA05642 378 Glycosyltransfrase antibioticus) Glycosyltransfrase (StreptomycesCAA05641 360 Glycosyltransfrase antibioticus) Glycosyltransfrase ~ CAA74710 344 Glycosyltransfrase (Saccharopolyspora erythraea) * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfl8 gene encodes a protein with relatively strong similarity to several glycosyl transferases. In particular, the protein encoded by orfl8 has a 5 important similarity with a glycosyl transferase from Streptomyces rishiriensis (Wang et a1., 2000; GenBank Access Number: AAG29785; BLAST score: 185). The , similarity of the protein encoded by the orfl8 gene with several glycosyls transferases ., N: ~
li ù ~
ées dans ~ la vôie ~ é ~ ios '' p .9, th ~ s ~ d other antit ~ iott ~ ûés 'rtiches sù' ère fo ~ '~ ~, qp .. ~ rteirient i-that this gene also encodes a glycosyl transferase. This hypoihesis is supported by the 'r l0 causes the protein encoded by the orfl8 gene to have a strong similarity with others proteins of similar function in other organisms (see Table 27).
Table 27 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank NovM (Streptomyces spheroides) AAF67506 184 Glycosyltransfrase probable glycosyl transferase T46519 169 Glycosyltransfrase (Streptomyces violaceoruber) Glycosyl transferase homologAAD13553 167 Glycosyltransfrase (Streptomyces cyanogenus) Glycosyl transferase homologAAD13555 163 Glycosyltransfrase (Streptomyces cyanogenus) s dNTP-hexose glycosyl transfraseAAC01731 160 Glycosyltransfrase (Amycolatopsis mediterranei) * greater sequence similarity is associated with a more BLAST score ~~
high (Altschul et al., 1990).
The orfl9 gene encodes a protein with relatively strong similarity to .
several ketoreductases. In particular, the protein encoded by orfl9 has a similarity.
important with NDP-hexose 4-ketoreductase (TyICIV) from Streptomyces fradiae ': ~
(Bate et a1., 2000; GenBank access number: AAD41822; BLAST score: 266). The :. . ' I
similarity of the protein encoded paf the orfl9 gene, with this. this étoréductasé
implied daria ~ ~ v;
; - ~~, ° y ';
the biosynthetic pathway of an antibiotic preaches ~ so strong that ctide gene lo also a 4-ketoreductase responsible for the reduction reaction necessary for the I, biosynthesis of mycarosis (see Figure 4). This hypothesis is supported by the fact that the protein encoded by the orfl9 gene has strong similarity to other protein similar function in other organisms (see Table 28).
Table 28 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank NDP-4-cto-6-doxyhexose 4- AAL14256 251 NDP-4-cto-6-ctoreductase (Streptomyces doxyhexose 4-uenezuelae) ctorductase EryBIV (Saccharopolyspora AAB84071 249 oxidorductase erythraea) TDP-4-cto-6-doxyhexose 4- AAG13916 218 TDP-4-cto-6-ctoreductase (lllicromonospora doxyhexose 4-megalomicea subsp. Nigra) ctorductase dTDP-4-cto-6-doxy-L-hexose BAA84595 212 dTDP-4-cto-6-reductase (Streptomyces avermitilis) ~ doxy-L-hexose rductase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orf ~ 0 gene encodes a protein with relatively strong similarity to several hexose reductases. In particular, the protein encoded by orf ~ 0 has a significant similarity with the Saccharopolyspora erythraea EryBII gene which code one 1.
dTDP-4-keto-L-6-deoxy hexose 2,3-reductase (Summers, RG, et al., 1997), Number ~~ r access GenBank A ~ Bg4068; Score BLAST: 4 ~? I). The similarity of the protein coded '' ,,. have by the orff0 gene with several hexose reductases involved, in the pathway biosynthesis of other close antibiotics strongly suggests that this gene codes a 2-3 lo reductase responsible for the reduction reaction necessary for the biosynthesis of mycarosis (see Figure 4). This hypothesis is supported by the fact that the protein encoded by orf20 gene has strong similarity with other functional proteins similar with other organizations (see Table 29).
Table 29 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank TyICII (Streptomyces fradiae) AAD41821 464 NDP-hexose 2,3-noyl rductase TDP-4-cto-6-deoxyhexose AAG13914 446 TDP-4-cto-6-2,3 reductase (Micromonospora doxyhexose 2,3-megalomicea subsp. Nigra) reductase dTDP-4-cto-6-doxy-L-hexose BAA84599 377 dTDP-4-cto-6-2,3 reductase (Str ~ ptomyces avermitilis) doxy-L-hexose 2,3-rductase * greater sequence similarity is associated with a more r BLAST score high (Altschul et al., 1990).
The orf ~ lc gene encodes a protein with relatively strong similarity with several hexose methyltransferases. Notably, the protein encoded by gold, wire it has significant similarity with the TylClI1 gene from Streptomyces fradiae which code one '_ NDP-hexose 3-C-methyltransferase (Bate, N et al., 2000; Access number GenBank:, AAD41823; BLAST score: 669). The similarity of the protein encoded by the gene orfZlc ~; ~., with - several hexose methyltransferases involved in the pathway biosynthesis ~ é
yew others ~ aritibiôtic ~ ues 'close, safe ~ fortëinent' than this gene: coded a hexose . ...
i0 methyltransferase responsible for the methylation reaction necessary for the biosynthesis mycarosis (see Figure 4). This hypothesis is supported by the fact that the encoded protein by the gold gene, f21 c has a strong similarity with other proteins of function similar in other organisms (see Table 30).
Table 30 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank EryH (Saccharopolyspora 228448 592 Gene erythraea) biosynthesis of rhythmromycin S-adenosyl-dependent methylAAK71270 358 Mthyltransferase transferase (Coxiella burnet) NovU (Streptomyces spheroides) AAF67514 184 C-methyltransfrase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orf22c gene encodes a protein with relatively strong similarity to the .
protein encoded by the Streptomyces hygroscopicus var fkbH gene.
ascomyceticus which; :.
encodes an enzyme involved in the biosynthesis of methoxymalonyl (Wu, K. and a a1., 2000; GenBank Access Number: AAF86387; BLAST score: 463). The similitude of the protein encoded by the orfl2c gene with this protein involved in the way of biosynthesis of another close macrolide strongly suggests that this gene codes also ~:
an enzyme involved in the biosynthesis of methoxymalonyl in Streptomyces . ' ~ ~ .-ambofaciens (cf. figure 8).
The orfl3c gene encodes a protein with a strong similarity, with the r -. , protein encoded by the Streptomyces hygi'oséopicus var fkbl gene.
ascomyceticus, .Who encodes an acyl CoA dehydrogenase involved in the biosynthesis of methoxymalonyl (Wu, K. Et al., 2000; GenBanle access number: AAF86388; BLAST score 387).
The i5 similarity of the protein coded by the orf23c gene with several acyl CoA
dehydrogenases involved in the biosynthetic pathway of other antibiotics relatives strongly suggests that this gene codes for an acyl CoA dehydrogenase involved in the biosynthesis of methoxymalonyl (cf. Figure 8). This hypothesis is supported by the fact that the protein encoded by the orfZ3c gene has a strong similarity to other proteins with a similar function in other organisms (see Table 31).

Table 31 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Acyl-CoA dshydrognase AAK19892 171 Acyl-CoA

(Polyangium cellulosum) hydrognase Probable acyl-CoA dehydrogenase T36802 160 acyl-CoA
-(Streptomyces coelicolor) dshydrognase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfl4c gene encodes a protein with relatively strong similarity to the 5 protein encoded by the fkbJ gene from Streptomyces hygroscopiciis var.
ascomyceticus qui '~.: v would encode the binding protein of the acyl group (Acyl Carrier Protein (ACP));, ~ f ;.
;, involved in the biosynthesis of methoxymalonyl (Wu, K., et al., 2000; Issue Access GenB, aük ° äAF86389; -Score BLAST 87). ~~ The similarity of the cost protein ~ ~~
. .:, __y 1 1 ~, _.
by the orfZ4c gene with this protein involved in the biosynthesis pathway of another .
1 ~ 0 close macrolide strongly suggests that this gene codes for a protein involved in the biosynthesis of methoxymalonyl in Streptomyces ambofacieus (cf. figure 8).
The orf ~ 5c gene encodes a protein with relatively strong similarity to the protein encoded by the Streptomyces hygroscopicus var fkbK gene.
ascornyceticus which encodes an acyl CoA dehydrogenase involved in the biosynthesis of méthoxyrnalonyl 15 (Wu, K., Et al., 2000; GenBank access number: AAF86390; BLAST score:
268). The similarity of the protein encoded by the orflSc gene with several acyl CoA
dehydrogenases involved in the biosynthetic pathway of other antibiotics relatives strongly suggests that this gene codes for an acyl CoA dehydrogenase involved in the biosynthesis of methoxymalonyl (cf. Figure 8). This hypothesis is supported by the fact that 20 the protein encoded by the orfZSc gene has a strong similarity with other proteins with a similar function in other organisms (see Table 32).

Table 32 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Probable 3-Hydroxybutyryl-CoAP45856 177 3-Hydroxybutyryl-Dehydrogenase (Bacillus CoA dshydrognase subtilis) 3-hydroxybutyryl-CoA dehydrogenaseAAL32270 174 3-hydroxybutyryl-protein (Bacillus thuringiensis CoA dshydrognas serovar kurstaki) 3-hydroxybutyryl-CoA dehydrogenaseNP 294792 167 3-hydroxybutyryl-(Deinococcus radioduraus) CoA dshydrognase * greater sequence similarity is associated with a more v BLAST score high (Altschul et al., 1990).
. ~ The golden ene 6 encodes a '.. r, g, h protein with an identity of 65 ~ o (determined by ~.
in the BLAST program) with the protein encoded p ~ rr the tylCY gene which encodes a mycarosyl ~ ~ ~~
transferase involved in the biosynthesis of tylosin in Streptomyces fYadiae (Bate, N.
et al., 2000; GenBank access number: AAD41824, BLAST score: 471). More in particular, TyICV is a glycosyl transferase binding the molecule mycarosis during of tylosin synthesis. This similarity to a protein involved in the way 10 of biosynthesis of another relatively close antibiotic and more particularly in mycarosis transfer, suggests that the orf ~ 6 gene codes for a glycosyl transferase. This hypothesis is supported by the fact that the protein encoded by the orf26 gene presents a strong similarity with other proteins of similar function in others organizations (cf.
table 33).

Table 33 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Glycosyl transferase (StreptomycesBAA84592 218 Glycosyl transferase avermitilis) CalG4 (Micromonospora echinospora) ~ AAM70365217 Glycosyl transferase CalG2 (Micromonospora echinospora) AAM70348 197 Glycosyl transferase ~.

* greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The orfl7 gene codes for a protein with 70% identity (determined grace BLAST program) with the protein coded by the tylCYll gene which codes for a NDP-3,5- (or 5-) epimerase hexose involved in tylosin biosynthesis in ~~~, Stre tom ces py, fradaae (Bate, N and aZ; ° 2000; GenBank access number: AAD41825 k ; r ~ <<:. ~ s, r 't., BLAST score 243): More p ~ i ~ particularly, 'T ~ ICViI is, a hexose 3,5- (or ~
5). "
epimerase involved in the biosynthesis of mycarosis. This similarity with a the protein involved in the biosynthetic pathway of another antibiotic relatively close and more particularly in the biosynthesis of mycarosis, suggests that the gene orfl7 encodes an epimerase. This hypothesis is supported by the fact that the encoded protein by the orf27 gene has a strong similarity with other proteins of function similar in other organisms (see Table 34). An analysis of close sequences obtained through the BLAST program strongly suggests that the orf ~ 7 gene codes for a epimerase responsible for the epimerization reaction necessary for the biosynthesis of mycarosis (see Figure 4).

Table 34 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank LanZl (Streptomyces cyanogenus) AAD13558 172 NDP-hexose 3,5-epimerase .

Epi (Saccharopolyspora spinosa) AAK83288 169 TDP-4-keto-6-deoxyglucose 3.5 epimerase dNTP-hexose 3.5 epimerase AAC01732 166 dNTP-hexose 3.5 (Amycolatopsis mediterranei) i ep merase * greater sequence similarity is associated with a more BLAST score high (Altschul et al., 1990).
The sequence of orfl8c was first determined so partial, ~ '.:
since the sequence of a region of about 45Ø ~ base pairs has not been determined ' only after resequencing (this region is symbolized by "N" in the sequence I
incomplete SEQ ID N ° 106). The partial sequence of this OIZF (SEQ ID
No. 111) a nevertheless been used for analysis with the different programs IT
as explained above. It could thus be determined that the orf ~ 8c gene encodes a lo protein with an identity of 64% on the determined sequence (SEQ ID
No. 112, which is the partial sequence of the protein Orf28c) (determined by program BLAST) with the protein encoded by the acyB2 gene which encodes a protein regulatory involved in the biosynthesis of carbomycin in Streptomyces thermotolerans (Arisawa, A., Et al., 1993; GenBank access number: JC2032, BLAST score:
329).
This similarity with a protein involved in the biosynthetic pathway of a relatively close antibiotic suggests the orf ~ 8c gene encodes a protein regulator involved in the biosynthesis of spiramycins. This hypothesis is supported by the fact that the protein encoded by the orfl8c gene also has a strong similarity with the TylR protein which is a regulatory protein involved in the tylosin biosynthesis in Streptomyces fradiae (Bate, N. et al., 1999;
Access number GenBank: AAF29380, BLAST Score: 167).
The orfl8c gene could be amplified thanks to oligonucleotides located and else in the sequence not determined and subcloned into a vector expression. He has s could thus be shown that the overexpression of the bone ~ f ~ 8c gene increases significantly the production of the OSC2 strain in spiramycins (cf. example 24). This demonstrates that overexpression of orfl8c leads to increased production of r spiramycins, and confirms its role as regulator of the biosynthetic pathway of spiramycin. "
The partial sequence of orfl8c was subsequently completed and the region missing approximately 450 base pairs have been determined (see SEQ ID No. 140 and SEQ ID No. 141).
The complete sequence of this ORF (SEQ ID N ° 141) was used to analysis with the different computer programs as explained above. He thus could be determined that the orfl8c gene codes for a protein with 69% identity on the r is determined sequence (SEQ ID N ° 142, which is the complete sequence of protein $ ~
_ 1 ~. ,, i.
~ ':. ...
OrfZ8c) (determined thanks to progranin BLAS'T) with the protein encoded by g ~ n ~ ~; "''' acyB2 which codes for a regulatory protein involved in the biosynthesis of carbomycin in Streptomyces thermotolerans (Arisawa, A., et al., 1993; Access number GenBank: JC2032, BLAST Score: 451). This similarity to a protein involved 2o in the regulation of the biosynthesis of a relatively close antibiotic suggests that the orf28c gene codes for a regulatory protein involved in the biosynthesis of spiramycin. This hypothesis is supported by the fact that the protein encoded by the gene however, f ~ 8c also has a strong similarity with the protein TyIR which is a protein regulator involved in the regulation of tylosin biosynthesis in Streptomyces 25 fradiae (Bate, N. Et al., 1999; GenBank access number: AAF29380, Score BLAST
224). The results of the overexpression of this gene (cf. example 24) confirm his role as a regulator of the biosynthetic pathway for spiramycins.

Inactivation of the orfl8c gene has been performed. It could thus be shown that the strain resulting no longer produces spiramycins. This confirms that the orfl8c gene is good involved in the biosynthesis of spiramycins and is essential to the biosynthesis of spiramycin. These results associated with the results of the overexpression of this gene (cf.
5 example 24) are in agreement with an activating role essential to the biosynthesis of spiramycins from Orf28c.
The orfd9 gene codes for a protein with an identity of 31% (determined grace BLAST program) with a probable glycosyl hydrolase located in the group,.
of genes involved in the biosynthesis of soraphen A (an antifungal of the class from r '~.
10 polyketides) in Sorangium cellulosum (Ligon, J., Et al., 2002; Issue access GenBank: AAK19890, BLAST Score: 139). This similarity to a protein involved in the biosynthetic pathway of a relatively close molecule suggests that the orf29 gene encodes a protein with glycosyl hydrolase activity. This hypothesis = F
is supported by the fact that the protein encoded by the gold gene. fl9 presents a strong similarity v ~~ ' ::; ,, 15 with other proteins of similar function in other organisms (cf.
table '35).' ~~ ..;
An analysis of the protein sequence encoded by orfl9, using the program CL ~ i ~~ 1 ' . . . search (c ~ above) also suggests that the o ~ fl9 gene codes for a hydrolyzed glycosyl. ~ ~ ~.
Table 35 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank ManA (Caldicellulosiruptor AAC44232 136 beta-1,4-mannanase saccharolyticus) ManA (Dictyoglomus thermophilurn) AAB82454 129 beta-mannanase - ~ a very similar sequence pms is associated with a BLAST score more Student 20 (Altschul et al., 1990).
Protein sequence analysis deduced from forfl9 by the SignaIP program (http://www.cbs.dtu.dk/services/SignalP~ (Nielsen, H., et al., 1997) shows that this protein has a C-terminal signal sequence with a cleavage site predicted between positions 30 and 31 (QSA / QA). We can predict that this protein is extra-cellular.
It could, as a glycosyl hydrolase, have a role in the reactivation of the spiramycin inactivated by glycosylation by GimA glycosyl transferases and / or GimB
(Gourmelen et al, 1998).
The orf30c gene codes for a protein with an identity of 31% (determined thanks to the BLAST program) with a sugar-nucleoside-diphosphate epimerase of Corynebacterium glutamicum (GenBank Access Number: NP 600590, BLAST Score 89). This similarity suggests that the orf30c gene codes for an epimerase. This hypothesis is, supported by the fact that a sequence analysis thanks to the CD-search program (cf. below above) also suggests that the orf30c gene encodes an epimerase.
The or3030 presents two possible initiation codons (cf. SEQ ID N °
115) who give two possible proteins of 345 and 282 amino acids respectively (SEQ B ~..
N ° 116 and 117). However, the use of codons is typical of Stt-eptomyees only 1to: ~ 'v . 3.
from the second ATG moreover, the protein sequence deduced from the sequence entered the ~ x, ... ,, first ATG and the second rie do not line up with close sequences identified, = ~ ~~
whereas the shortest protein sequence (from the 2nd ATG: SEQ m N ° 144) aligns well with the start of these proteins. We can therefore deduce that the second ATG is the correct initiation codon and therefore the sequence of this orf is that present in SEQ ~ N ° 143 which once translated corresponds to the protein of sequence SEQ ID N °
144.
The orf31 gene codes for a protein with an identity of 52% (determined grace BLAST program) with an oxidoreductase in Streptomyces coelicolor (Number GenBank access: NP 631148, BLAST score: 261). This similarity suggests that the orf31 gene encodes a reductase. This hypothesis is supported by the fact that a analyse of the sequence thanks to the CD-search program (see above) also suggests that the ~~ f31 gene encodes a reductase. This hypothesis is also supported by the makes that the protein encoded by the orf31 gene has strong similarity to other protein similar function in other organisms (see Table 36).
Table 36 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank Putative oxidoreductase BAB79295 173 Oxidoreductase (Streptomyces griseus) MocA (Xa ~ thomonas axonopodis) NP 640644 171 Oxidoreductase ~ 'greater sequence similarity is associated with a more BLAST score Student , (Altschul et al., 1990).
The orf31 gene was inactivated. It could thus be shown that the strain ~~ -, ~.
resulting no longer produces spiramycins. This confirms that the orf31 gene is good ':' ~
involved in the biosynthesis of spiramycmes. The enzyme encoded by this gene is therefore ~ sv,, ~ ", ..,." ~ ,, well responsible for a stage of bioconversion essential to the biosynthesis of ~ R
spiramycin.
The sequence of orf32c was first determined in part (ef.
example 19), since the 5 'coding sequence was only determined in one second time. The partial sequence of this orf (SEQ ID N ° 120) has nevertheless been used to analysis with the different computer programs as explained above above. He has thus it could be determined that the orf32c gene encodes a protein with a identity of 47 ° 1o on the determined sequence (SEQ ID N ° 121, which is the partial sequence of the protein Orf32c) (determined thanks to the BLAST program) with a protein regulator of the GntR family in Streptomyces coelicolor (Access number GenBank NP 625576, BLAST score: 229). This similarity suggests that the orf32c gene code one transcriptional regulator of the GntR family. This hypothesis is supported by the fact that the protein encoded by the orf32c gene has strong similarity to other protein of similar function in other organisms.
The partial sequence of orf32c was subsequently completed and the region missing has been determined (cf. SEQ ID N ° 140 and SEQ ID N ° 145). The complete sequence of this orf encodes a protein with 44% identity (determined by program BLAST) with a regulatory protein of the GntR family in Streptomyces ave ~ mitilis (GenBank access number: NP 824604, BLAST score: 282). This similarity suggests that the orf32c gene codes for a transcriptional regulator of the GntR family.
This hypothesis is supported by the fact that the protein encoded by the orf32c gene presents a strong similarity with other proteins of similar function in others agencies (see table 37).
Table 37 Protein with Similarity Number Function Score Reported BLAST * significant access GenBank ~ 1VP 270 'Protiri regulatory protein GntR 8282 family ~ 1 ~
. lt ~

_. r gu xx ~

(Streptomyces avermitilis) family GntR.

NP 625576266 Regulatory protein Regulatory protein GntR family Family Streptomyces coelicolor) GntR

SCSG8.04 (Streptomyces coelicolor) NP 628991258 Regulatory protein of the family GntR

transcriptional regulator AAF01064 224 Rgulateur (Streptomyces vercezuelae) transcriptional NP regulatory protein 827432239 Regulatory protein GntR family (Streptomyces avermitilis) family GntR

* greater sequence similarity is associated with a more BLAST score Student (Altschul et al., 1990).
Inactivation of the orf32c gene was performed in order to study the function of this gene in the spiramycin biosynthesis pathway in Streptomyces ambofaciens. He has could be shown that the resulting strain produces spiramycins. This indicates that the orf32c gene is not essential for the biosynthesis of spiramycins and that it is not essential for the survival of the bacteria.
The orf33 gene codes for a protein with an identity of 49% (determined thanked v ;:;:
BLAST) with a hypothetical protein from Xanthomonas campestris (GenBank access number: NP 635564, BLAST score: 54).
The sequence of or344 is partial. Indeed, the comparisons made between the product of this orf and the databases suggest that part C-terminale de '; ~~.
. this protein is not in the product deduced from the nucleotide sequence and therefore that,;,, y this orf would be longer and continue outside the re ected segment.
The session qq. ~ rt . '15 partial of this ORF was nevertheless used for the auatysis with the differences, ~, ~ ~. ' t. . ~. . ''., '': ~~ xr ~~
computer programs as explained above. He could thus have been determines that the orf34c gene codes for a protein with 91% identity on the sequence determined (SEQ ID No. 150, which is the partial sequence of the protein Orf34c) (determined thanks to the BLAST program) with an arabinofuranosidase from Streptomyces coelicolor (Bentley et al., 2002; GenBank access number: NP
630,049, BLAST score: 654). In S. coelicolor the gene encoding this arabinofuranosidase does does not appear to be involved in the biosynthesis of secondary metabolites. Chez S.
ambofaciens, this gene is therefore probably not involved in the biosynthesis of spiramycin.
The present invention also relates to hybridizing polynucleotides under conditions of high stringency hybridization to at least one of polynucleotides of sequence SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 11 l, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of sequences derived therefrom due to degeneracy of the code genetic.
Preferably, these said polynucleotides are isolated from a bacterium of the kind Streptomyces, more preferably, these polynucleotides encode protein involved in the biosynthesis of a macrolide and even more preferentially, these 5 polynucleotides encode a protein with activity similar to protein encoded by the polynucleotides with which they hybridize. Conditions strong hybridization stringency can be defined as hybridization conditions disfavoring hybridization of strands of non-homologous nucleic acids. Conditions .
of high stringency hybridizations can for example be described as ~:. ~ :, 10 hybridization conditions in the buffer described by Church & Gilbert (Church &.
Gilbert, 1984) at a temperature between 55 ° C and 65 ° C, from preferred way 1a annealing temperature is 55 ° C, even more preferably the temperature.
hybridization is 60 ° C and most preferably the hybridization temperature is 65 ° C, followed by one or more; s washes in 2X SSC buffer to urié: '1. ~
i5 temperature between 55 ° C and 65 ° C, preferably this temperature is ~ '~:>: ~ ° ~
55 ° C, even more preferably this temperature is

60 ° C and so all ~.
1:
preferred this temperature is 65 ° C, followed by ~ or more washes en tampôn ~; ~~~~ r v O.SX SSC at a temperature between 55 ° C and 65 ° C, from favorite way this' temperature is 55 ° C., even more preferably this temperature is 60 ° C
And most preferably this temperature is 65 ° C.
Conditions described above can be adapted according to the length of the nucleic acid whose hybridization is sought or of the type of labeling chosen according to techniques known to those skilled in the art. The right conditions hybridization can for example be adapted according to the work of F. Ausubel et al., 25 2002.
The invention also relates to a polynucleotide having at least 70%, so more preferred 80%, more preferably 85%, even more preferred 90%, from even more preferably 95% and most preferably 98%
identity in nucleotides with a polynucleotide comprising at least 10, 12, 15, 18, 20 to 25, 30, 30 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850 or 1900 consecutive nucleotides a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID N °
3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of the sequences derived therefrom this due degeneracy of the genetic code, or a polynucleotide of sequence complementary. Preferably, these so-called polynucleotides are isolated from from a bacteria of the genus Streptomyces, more preferably, these polynucleotides code l0 proteins involved in the biosynthesis of a macrolide and even more preferentially, these polynucleotides encode proteins having activities similar to proteins encoded by the polynucleotides with which they show identity. Most preferably, a polynucleotide according to the invention is chosen in the group consisting of the nucleotide sequences SEQ ID No. 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, ~,.:. ' 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or as d ~. ~~ i.
polyriucleotide of sequence, complementary.
;. ,, Optimal alignment of sequences for comparison can be achieved from computer way using known algorithms, for example those of package FASTA (Pearson W. R & DJ Lipman, 1988) and (Pearson WR, 1990), accessible notably with the INFOBIOGEN resource center, Evry, France. As for illustration, the percentage of sequence identity can be determined at the help of LFASTA software (Chan K.-M. et al., 1992) or LALIGN (Huang X. and Miller W., 1991). The LFASTA and LALIGN programs are part of the FASTA package. LALIGN
returns the optimal local alignments: this program is more rigorous, but also slower than LFASTA.
Another aspect of the invention relates to a polypeptide resulting from expression of a nucleic acid sequence as defined above.
Preferably, the polypeptides according to the invention have at least 70%, more preferably 80%, from more preferably 85%, even more preferably 90%, still more preferred 95% and most preferably 98% acid identity amines with a polypeptide comprising at least 10, 15, 20, 30 to 40, 50, 60, 70, 80, 90,100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or 640 consecutive amino acids of a polypeptide chosen from SEQ ID N ° 4, 6, '8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 29, 31, 32, 33, 35, 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and ~ -150, or one of these sequences except that throughout said sequence a or ~ 3 '''7 10 several amino acids have been substituted, inserted or deleted without affect them, ..
functional properties or one of the variants of these sequences.
Preferably the polypeptides according to the invention are expressed in the natural state by a bacterium of the kind Streptomyces, more preferably, these polypeptides are involved in the biosynthesis of a macrolide and even more preferably, these polypeptides they have a..:,,;
. j.?
is activity similar to that of the polypeptide with which it shares identity. In a way preferred, a polypeptide according to the invention is chosen from, the group consisting. of 't ~~~ =
1: 1 6 Wi ~ z polypeptide sequences SEQ ID No. 4, 6 ~ 8, 10, 12, 14, 16; 18, 20, 22, 24, 26, 27, 29, =, 4'a 31, 32, 33, 35, 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63 ~, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 20 144, 146, 148 and 150, or one of these sequences except that throughout said sequence one or more amino acids have been substituted, inserted or deleted without in affect the functional properties or one of the variants of these sequences.
So everything most preferred, a polypeptide according to the invention is chosen from the group made up of SEQ ID N ° 4, 6, 8, 10, 12, 14, 16, 18, 20, polypeptide sequences 22, 24, 26, 27, 29, 25 31, 32, 33, 35, 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150.
Optimal alignment of sequences for comparison can be achieved from computer way using known algorithms, for example those of package FASTA (Pearson W. R & DJ Lipman, 1988) and (Pearson WR, 1990), accessible notably with the INFOBIOGEN resource center, Evry, France. As for illustration, the percentage of sequence identity can be determined at the help of LFASTA software (Chan K.-M. et al., 1992) or LALIGN (Huang X. and Miller W., 1991), using the default settings as defined by the center resources INFOBIOGEN, Evry, France. The LFASTA and LALIGN programs are part of the FASTA package. LALIGN returns the optimal local alignments: this program is more rigorous, but also slower than LFASTA.
Another aspect of the invention relates to a recombinant DNA comprising at '' 10 at least one polynucleotide as described above. Preferably; this DNA
recombinant is a vector. Even more preferably, the vector is chosen from bacteriophages, plasmids, phagemids, integrative vectors, the fosmids,:.
cosmids, shuttle vectors, BAC (Bacterial Artificial Chromosome) where the .
PAC (P1-derived Artificial Chromosome). By way of illustration, there may be mentioned as :;; .
bacteriophages phage lambda and phage M13. As plasmids there may be mentioned the.: ~ ~~
plasmids which coalesce in E. colt, for example pBR322 and its derivatives, pUCl8 and his i. :: ~ ~, ~. . . . ~. ... . , i derivatives, pUCl9 and its derivatives, pG ~ 2 and its ~ derivatives (Churchward G. et al., 1984), S "
pACYC177 (GenBank access number: X06402) and its derivatives, pACYC184 (number GenBank access: X06403) and its derivatives. We can also cite the plasmids themselves replicating in Streptomyces such as for example pIJ101 and its derivatives, pSGS and his derivatives, SLP1 and its derivatives, SCP2 * and its derivatives (Kieser et al. 2000). As phagemids that may be mentioned by way of illustration pBluescript II and its derivatives (marketed in particular by the company Stratagene (LaJolla, California, USA)), pGEM-T and its derivatives (marketed by the company Promega (Madison, Wisconcin, USA)), ~, ZAPII and its derivatives (marketed in particular by the company Stratagene (LaJolla, California, USA)). As integrative vectors, we can cite by way of illustration, the vectors integrative in Streptomyces such as those derived from SLP 1 (Kieser et al, 2000), those derived from pSAM2 (Kieser et al, 2000), the vectors using the systems integration of phages PhiC31 (Kieser et al, 2000) (for example pSET152 (Bierman et al., 1992)) or VWB (Van Mellaert L, et al. 1998), as well as the vectors using the IS 117 integration system (Kieser et al. 2000). As fosmids we can quote to illustrative title the fosmid pFOS 1 (marketed by the company New England Bioloabs Inc., Beverly, Massachussetts, USA) and its derivatives. As cosmids we can quote to illustrative title the cosmid SuperCos and its derivatives (sold in particular over there Stratagene (LaJolla, California, USA)), the cosmid pWEDlS (Wahl and al., 1987) and its derivatives. As shuttle vectors, there may be mentioned by way of illustration the plasmids shuttles E. coli l Streptomyces such as for example pIJ903 and its derivatives, the series of plasmids pUWL, pCA0106, pWHM3, pOJ446 and their derivatives (Kieser et al. 2000), the BAC shuttles E. coli l Streptomyces such as those described in the request ':
WO 01/40497. As BAC (Bacterial Artificial Chromosome) we can to quote by way of illustration, the BAC pBeIoBACI 1 (GenBank access number: U51113). As PAC (P1-derived Artificial Chromosome) we can cite by way of illustration the vector pCYPAC6 (GenBank access number: AF133437). Most preferably, a' vector according to the invention is chosen from pOS49.1, pOS49.11, pOSC49.12, pOS49.14,, ~, ~~, pOS49.16, pOS49.28, pOS44.1, pOS44.2, pOS44.4, pSPMS, pSPM7, pOS49.67, '~~
pOS49 '88, pOS49.106, pOS49 120, pOS49.107, pOS49.32, pOS49.43, pOS49.44.7 ~ a ~
z . .. ~, '~? ~', laughed ~~
osa ~ 9.sô ~ ..pis49;: ~ "~ ..
s,. : p ~ p. . .99pSPMl7, pSPM2l, pSPM502, ~ pSPM504, pSPM507, pSPM508,; '~ ;; ~
k pSPM509, pSPMl, pBXLllll, pBXL1112 pBXL1113, pSPM520, pSPM521, ~ I.
pSPM522, pSPM523, pSPM524, pSPM525, pSPM527, pSPM528, pSPM34, pSPM35, 2o pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM4l, pSPM42, pSPM43, pSPM44, pSPM45, pSPM47, pSPM48, pSPM50, pSPM5l, pSPM52, pSPM53, pSPM55, pSPM56, pSPM58, pSPM72, pSPM73, pSPM515, pSPM519, pSPM74, pSPM75, pSPM79, pSPM83, pSPM107, pSPM543 and pSPM106.
Another aspect of the invention relates to an expression system comprising a appropriate expression vector and a host cell for expression of one or several polypeptides as described above in a biological system.
The expression vectors according to the invention comprise an acid sequence nucleic encoding one or more polypeptides as described above and may be destined for the expression of the various polypeptides according to the invention in various host cells well known to those skilled in the art. By way of example, mention may be made of systems ~ 0 of prokaryotic expression such as expression systems in bacteria E.
coli, the eukaryotic expression systems, such as the baculovirus expression system allowing expression in insect cells, systems expression allowing expression in yeast cells, systems expression allowing expression in mammalian cells, especially cell human. Expression vectors usable in such systems are well known skilled in the art, with respect to prokaryotic cells, one can quote as illustrative of the expression vectors in E. coli for example, of the family pET.
marketed by the company Stratagene (LaJolla, California, USA), the vectors of.
GATEWAY family marketed by lnvitrogen (Carlsbad, California, USA), vectors of the pBAD family sold by the company Invitrogen (Carlsbad, California, USA), the pMAL family vectors marketed over there New England Bioloabs Ine company. (Beverly, Massachussetts, USA), the vectors expression inducible by rhamnose cited in the publication Wilms B and al., 2001, and their derivatives, we can also cite expression vectors in Streptomyces such as for example the vectors pIJ4123, pIJ6021, pPM927, pANT849, pANT 850, ~.
i pANT 851, pANT1200, pANT1201, pANT1202 and their derivatives (Kieser et al., 2000) ~ ~ ;;
As regards the yeast cells, there may be mentioned by way of illustration the vector pESC
marketed by the company Stratagene (LaJolla, California, USA). In what concerned the baculovirus expression system allowing expression in cell of insects that may be mentioned - by way of illustration, the vector BacPAK6 sold over there BD Biosciences Clontech company, (Palo Alto, California, USA). In what concerns the mammalian cells, there may be mentioned by way of illustration vectors including the promoter of the early genes of the CMV virus (Cytomegalovirus) (for example the vector pCMV and its derivatives marketed by the company Stratagene (LaJolla, California, USA), or the SV40 early promoter virus simien vacuolisant SV40 (for example the vector pSGS marketed by the society Stratagene (LaJolla, California, USA).
The invention also relates to a method for producing a polypeptide.
3o as described above, said method comprising the following steps:

a) inserting a nucleic acid encoding said polypeptide into a vector appropriate b) cultivating, in an appropriate culture medium, a host cell beforehand transformed or transfected with the vector from step a);
c) recovering the conditioned culture medium or a cell extract, by for example by sonication or by osmotic shock;
d) separate and purify from said culture medium or from the cell extract obtained in step c), said polypeptide;
e) where appropriate, characterize the recombinant polypeptide produced.
A recombinant polypeptide according to the invention can be purified by passage over an appropriate series of chromatography columns, according to the methods known to those skilled in the art and described for example in F. Ausubel et al (2002). We can quote to '::
illustrative title the “Tag-Histidine” technique, which consists in adding a court r:,. ,, ~ .ï
poly histidine sequence to the polypeptide, to be predicted, the latter. can ensmte to be ~ Cv purified on a nickel column. A polypeptide according to the invention can be also r prepared by ih vitro synthesis techniques. As an illustration of such techniques, a polypeptide according to the invention can be prepared using the "rapid" system translation system (RTS) ”, marketed in particular by the company Roche Diagnostics France HER, Meylan, France.
Another aspect of the invention relates to host cells in which has been introduces at least one polynucleotide and / or at least one recombinant DNA and / or at minus an expression vector according to the invention.
Another aspect of the invention relates to microorganisms blocked in a step in the biosynthetic pathway of at least one macrolide. The interest lies on the one hand in studying the function of mutated proteins and secondly in the realisation of microorganisms producing biosynthesis intermediates. These intermediate can be modified, possibly after separation, either by adding components individuals in production environments, either by introduction into microorganisms mutated from other genes encoding susceptible proteins of modify the intermediary by using it as a substrate. These intermediaries can thus be modified by chemical, biochemical, enzymatic and / or Microbiological.
Microorganisms blocked in a stage of the biosynthetic pathway macrolides can be obtained by inactivating the function of one or more proteins involved in the biosynthesis of this or these macrolides in microorganisms producers.
of this or these macrolides. Depending on the protein (s) inactivated, so get ~; v ~, l0 microorganisms blocked in the different stages of the pathway biosynthesis of this or these macrolides. Inactivation of this protein (s) can be done by any method known to those skilled in the art, for example by mutagenesis in the or the genes encoding said protein (s) or by the expression of one or more many -Antisense RNA complementary to the RNA or messenger RNAs encoding said or ' v said proteins. Mutagenesis can, for example, be carried out by irradiation, by ~ ~ a.
action of mutagenic chemical agent, by directed mutagenesis, by replacement of gene, ~ -;
F
or other other known method c ~ e the hnmrrie of the trade - The conditions suitable '~ R ~~
, ..
such mutagenesis can for example be adapted according to teaching content, in the works of Kieser, T et al (2000) and Ausubel et al., (2002). The mutagenesis 2o can be carried out in vitro or in situ, by deletion, substitution, deletion and / or addition of one or more bases in the gene under consideration or by inactivation gene.
This mutagenesis can be carried out in a gene comprising a sequence such as described above. Preferably, the microorganisms blocked in a stage of the macrolide biosynthesis pathway are bacteria of the genus Streptomyces.
More preferably, the inactivation of the function of one or more proteins involved in the biosynthesis of the macrolide (s) in question is carried out by mutagenesis.
Even more preferably, the macrolide in question is spiramycin and the microorganisms in which the mutagenesis (s) are carried out are strains of S, ambofaciehs. More preferably, mutagenesis is carried out in one or 3o several genes comprising one of the sequences corresponding to one or many of sequences SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149. Preferably, the mutagenesis or mutagenesis are performed by gene inactivation. Most preferably, the mutagenesis consists by gene inactivation of a gene comprising a sequence corresponding to the sequence SEQ ID N ° 13., By way of illustration, the following microorganisms can be cited as example such microorganisms: OS49.16 (orf3 :; .S2hyg, cf. example 2), OS49.67 (orf3délétion in phase, cf. example ~, OS49.107 (orf $ ;: slhyg, cf. example 7), OS49.50 '.
l0 (orfl0:: S2hyg, see example 8), SPM21 (orfl:: att3.s2aac-, see example 10), SPM22 (or, f2:: att3 phase deletion, see example 10), SPM501 (orf6 *:: attl , f2hyg +, cf. example 14), SPM502 (orf6 * :: attl deletion in phase, see example 14), SPM507 (orfl2:: att3Slaac-, see example 11), SPM508 (orfl3c:: att3.flaac-, cf.
example 12),.
SPM509 (orfl4:: att3 ~ lczac-, cf. example 13), SPM107 (orf28c:: att3aac +, cf.
example r ' 29), SPM543 (orf3l :: att3aac +, cf. example 30), SPM106 (orf32c :: att3aac +, cf.
.at , ~:
example 31).
1 'y $} ,.' Another aspect of the invention relates to a process for preparing a '1' macrolide biosynthesis intermediate using microorganisms stuck in a step in the macrolide biosynthesis pathway, as described above.
The process consists in cultivating, in an appropriate culture medium, a microorganism stuck in a step in the macrolide biosynthesis pathway, as described above, recover the conditioned culture medium or a cell extract, for example by sonication or by osmotic shock, separate and purify from said culture medium or still starting cell extract obtained in the previous step, said intermediate biosynthesis.
The culture conditions for such microorganisms can be determined according to techniques well known to those skilled in the art. The culture medium can by example be MPS medium or SL11 medium for Streptomyces and especially for Streptomyces ambofaciens (Pernodet et al., 1993). The skilled person will in particular refer to the work of I ~ ieser et al. (2000) regarding Culture Streptomyces. The intermediary produced can be recovered by all techniques known to those skilled in the art. Those skilled in the art may refer, for example example, to techniques taught in US patent 3,000,785 and above particularly the methods of extraction of spiramycins described in this patent.
Another subject of the invention relates to a process for the preparation of a molecule derived from a macrolide using microorganisms blocked in a stage of the way biosynthesis of this macrolide, as described above. The process is to get a biosynthesis intermediate according to the above process and to be modified intermediate thus produced, optionally after separation from the culture medium. The conditions of ' i0 culture of such microorganisms can be determined according to good techniques known to those skilled in the art. The culture medium could for example be middle MPS or SLll medium for Streptomyces and in particular for Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may in particular refer to the work of Kieser et al. 2000 with regard to the culture of Streptomyces. The intermediate products can be modified, possibly after separation, either by, r .: addition of appropriate components to the production units, ie by introduction in microorganisms of other genes encode proteins capable of edit ~. ' (intermediate using it as a substrate. These intermediates can so be chemically, biochemically, enzymatically and / or microbiologically modified.
More preferentially, the macrolide in question is spiramycin and the microorganisms in which the mutagenesis (s) are carried out are strains of S.
ambofaciehs.
The invention also relates to a microorganism producing spiramycin I but not producing spiramycin II and III. This microorganism includes all of the genes necessary for the biosynthesis of spiramycin I
but do not produces no spiramycin II and III because the gene comprising the sequence corresponding to SEQ ID N ° 13 or one of its variants or one of the sequences derived from these in because of the degeneracy of the genetic code and coding for a polypeptide of sequence SEQ ID N ° 14 or one of its variants is not expressed or has been returned inactive.
The inactivation of this protein can be carried out by any known method of those skilled in the art, for example by mutagenesis in the gene encoding said protein or by the expression of an antisense RNA complementary to the messenger RNA coding said protein, it being understood that if the expression of orf5 * is affected by this handling, another modification will be necessary for the oYfS * gene is 5 correctly expressed. Mutagenesis can be performed in the sequence coding or in a non-coding sequence so as to render the sodium protein inactive or in prevent its expression or translation. Mutagenesis can be performed through site-directed mutagenesis, by gene replacement or any other known method of the skilled person. The suitable conditions for such mutagenesis may through .,', l0 example be adapted according to the teaching contained in the works of Kieser, T and al (2000) and Ausubel et al., 2002. Mutagenesis can be performed in vitro or in situ, by deletion, substitution, deletion and / or addition of one or more bases in the gene considered or by gene inactivation. The microorganism can be also obtained by expressing the genes of the spiramycin biosynthetic pathway without qüe . 15 these do not include the gene comprising the sequence SEQ ID No. 13 or one of its. ' variants or any of the sequences derived therefrom due to the degeneration of '~

general code and coding a ptil ~ pe ~ tic ~ e of 'SE sequence ~~ ID N ° I4' or one of sesx ~ '7 , ..'... .7..y ~:
variants. Preferably, the microorganism is a bacterium of the genus Streptomyces.
More preferably, the microorganism producing spiramycin I but born 20 producing no spiramycin II and III is obtained from a starting microorganism producing spiramycins I, II and III. Even more preferably; the microorganism is obtained by mutagenesis in a gene comprising the sequence corresponding to SEQ ID N ° 13 or one of its variants or one of the derived sequences of these due to the degeneration of the genetic code and encoding a polypeptide 25 of sequence SEQ ID No. 14 or one of its variants having the same function. Even more preferably, this mutagenesis is carried out by gene inactivation.
So preferred the microorganism is obtained from a strain of S. ambofaciehs producing spiramycins I, II and III in which a inactivation gene of the gene comprising the sequence corresponding to SEQ ID No. 13 or one of 30 sequences derived from it due to degeneracy of the code genetic. Of most preferred, gene inactivation is done by deletion in phase of gene or part of the gene comprising the sequence corresponding to SEQ ID
N ° 13 or one of the sequences derived from it due to the degeneration of the coded genetic. By way of illustration, the strain SPM502 (orf6 * :: attl, cf. example 14) can be cited as a microorganism producing spiramycin I but does not not producing of spiramycin II and III.
e The invention also relates to a microorganism producing ~ of the spiramycin I but not producing spiramycin II and III as described above characterized in that it additionally overexpresses i0 - a gene capable of being obtained by chain amplification by polymerase in using the pair of primers of following sequence: 5 ′
AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID N ° 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N ° 139) and Gommé
matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, more ..
preferably it is the gene with coding sequence SEQ ID No. 141, r = '- or a gene derived therefrom due to the degeneracy of the code genetic LJn example of sequence of such a gene is given in SEQ ID N ° 111 (DNA), however this sequence is partial since it does not include the 3 'part of the sequence corresponding coding. The translation into protein of this part of the sequence coding 2o is given in SEQ. ID No. 112. A person skilled in the art will readily be able to complete in particular by using the teaching presented in example 24. The sequence unknown in SEQ ID N ° 111 was determined in a second step and the sequence complete of this orf (orf28c) is given in SEQ ID N ° 141. The protein translation of this coding sequence is given in SEQ ID No. 142. It is presented in the example 24 a method to clone the orfl8c gene and to make a vector expression allowing the expression of orf28c. It is also shown in this example that the overexpression of the orf28c gene in the OSC2 strain leads to the improvement of the production in spiramycins of this strain. Overexpression of the orf28c gene may be obtained by increasing the number of copies of this gene and / or by placing a sponsor more active than the wild-type promoter. Preferably, the overexpression of said gene is obtained by bringing a DNA construct into the microorganism recombinant allowing the overexpression of this gene. Preferably, this construction DNA
recombinant increases the number of copies of said gene and makes it possible to obtain a overexpression of said gene. In this construction of recombinant DNA, the sequence coding gene can be placed under the control of a more active promoter that 1 ~
wild promoter. By way of illustration, mention may be made of the promoter ptrc active expensive Streptomyces ambofaciens (Amann, E. et al., 1988) as well as the promoter ermE *:
Thus, preferably, the copy or copies of the gold gene, f ~ 8c provided are placed under the.
io control of the promoter ermE * as is the case in the construction pSPM75 (cf., example 24).
The invention also relates to a microorganism producing '°
spiramycin I but not producing spiramycin II and III as described above characterized in that it additionally overexpresses the coding sequence gene SEQ ID
No. 47 or a coding sequence derived therefrom due to the degeneration due.; '~ y az i genetic code. Preferably, this microorganism is caraierized in this that it is, I
of the strain SPM502 pSPM525 deposited with the National Collection of Crops ~ ~, of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, February 26, 2003 under registration number I-2977.
2 ~ The invention also relates to a process for the production of spiramycin I, the method consists in cultivating in a suitable culture medium a microorganism producing spiramycin I but not producing spiramycin II and III
such as described above, recover the conditioned culture medium or an extract cellular, separate and purify from said culture medium or from extract cell obtained in the previous step spiramycin I. The conditions for culture of such microorganism can be determined according to well known techniques of the skilled person. The culture medium could for example be the MPS medium where the SL11 medium for Streptomyces and in particular for Streptomyces ambofaciens (Pernodet et al., 1993). A person skilled in the art may in particular refer to the work of Kieser et al. 2000 with regard to the culture of Streptomyces. The spiramycin I
produced can be recovered by any techniques known to those skilled in the art job.
Those skilled in the art may refer, for example, to the techniques taught in the US patent US 3,000,785 and more particularly to methods extraction spiramycins described in this patent.
Another aspect of the invention relates to the use of a sequence nucleotide according to the invention to improve the production of macrolides of a microorganism.
Thus, the invention relates to a mutant macrolide-producing microorganism characterized in that it has a genetic modification in at least one gèü'e ~:
comprising a sequence as defined above and / or that it overexpresses at least a gene comprising a sequence as defined above. The modification genetic may consist of a deletion, a substitution, a deletion and / or a addition of a or several bases in the gene (s) considered for the purpose of expressing a or ~.
proteins with higher activity or express a higher level of this or dice ~~ ~: ~
- ::.
is these proteins. Overexpression of the gene under consideration can be obtained by increasing léwt ~.
..
number of copies of this gene and / or by placing a promoter more active than the promoter ~ f ~ f 1 wild. By way of illustration, mention may be made of the promoter ptrc active in Strèptom ~ ed '~' ambofaciens (Amann, E. et al., 1988) as well as the ermE * promoter (Bibb and al., 1985), (Bibb et al., 1994). Thus the overexpression of the gene considered can be obtained in 2 bringing in a macrolide producing microorganism considered a construction recombinant DNA according to the invention, allowing the overexpression of this gene.
Indeed, certain stages of macrolide biosynthesis are limiting and if we expresses a or several more active proteins or a higher level of expression of the wild proteins involved in these limiting steps we can improve the 25 production of the macrolide (s) concerned. An increase in the rate of production of tylosin was for example obtained from Streptomyces fradiae by gene duplication encoding a limiting methyl transferase converting macrocin to tylosin (Baltz R, 1997). Obtaining expression of a more active protein can be obtained in particular by mutagenesis, the person skilled in the art may for example refer to this topic 3o in the work by F. Ausubel et al (2002). Preferably, these mutant microorganisms improved for their production in macrolides are bacteria of the genus Streptorrcyces.
More preferably, the macrolide in question is spiramycin and the microorganisms in which the mutagenesis (s) are carried out are strains of S. ambofaciens. More preferably, the genetic modification is performed in one or more genes comprising one of the sequences corresponding to one or more many sequences SEQ ID N ° 3, 5, 7, 9, 1 l, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 11 l, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of the sequences derived from them due to the degeneracy of the genetic code. Of way 'w preferred, the microorganism overexpresses one or more genes comprising a of the sequences corresponding to one or more of the sequences SEQ ID N ° 3, 5, 7, 9, 1 l, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 11 l, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of the sequences derived therefrom due to the,: ~~, degeneration of the genetic code. Preferably, the microorganism overexpress the ~ ' gene comprising a sequence corresponding to SEQ ID No. 111 or 141, or one of his,., variants or any of the sequences deviated from them due to the 'degenerate' due ~ = ~~ t ° ti ~. ~.: ~ 7 genetic code. The sequence given in SEQ ID N ° 111 is partial, however I
those skilled in the art can easily supplement it, in particular by using teaching presented in Example 24. The indeterminate sequence in SEQ ID No. 111 has been determined in a second step and the complete sequence of this orf (orf ~ 8c) East given in SEQ ID No. 141. The protein translation of this sequence coding is given in SEQ ID N ° 142. Example 24 is thus presented a method to clone the orf ~ 8c gene and to make an expression vector allowing expression from o ~ f28c.
It is also shown in this example that the overexpression of the orfZ8c gene in the OSC2 strain leads to improved production of spiramycins from this strain.
Overexpression of the orf ~ 8c gene can be achieved by increasing the number of copies of this gene and / or by placing a promoter more active than the wild-type promoter.
In a way preferred, the overexpression of the orf28c gene is obtained by providing in the microorganism a recombinant DNA construct, allowing overexpression of this gene. Preferably, this recombinant DNA construction increases the number copy the orfZ8c gene and allows overexpression of the orfZBc gene to be obtained.
In this recombinant DNA construct, the coding sequence for orf28c can be placed under the control of a more active promoter than the wild type promoter. We can quote as 5 illustrates the ptrc promoter active in Streptomyces ambofaciens (Amann, E. et al., in 1988) as well as the promoter ermE *. Thus, preferably, the one or more gene copies orf ~ 8c brought are placed under the control of the promoter ermE * as it is the case in the construction pSPM75 (see example 24).
Another aspect of the invention relates to a process for producing macrolides 10 using the microorganisms described in the previous paragraph. This process consists of cultivate in a suitable culture medium a microorganism defined in the previous paragraph, recover the conditioned culture medium or an extract cellular, separate and purify from said culture medium or from extrâit ': ~ ~ .., cell obtained in the previous step the macrolide (s) produced. The conditions of, iy ~ :.
. i5 culture of such microorganisms can be determined according to techniques well,. °, Y
= ro known to those skilled in the art. The culture medium outra ar exeril le le le middle,; ~;
. , p,. P p. ,., ~ i ~ ~ n ~ r MPS or SL1 medium for Streptomyces and in particular for Streptomyces'"
ambofaciens (Pernodet et al., 1993). A person skilled in the art may in particular refer to the work of Kieser et al. 2000 with regard to the culture of Streptomyces. The 20 macrolides produced can be recovered by any known techniques of the man of career. Those skilled in the art may refer, for example, to techniques taught in US patent US 3,000,785 and more particularly to Spiramycin extraction methods described in this patent.
Preferably, the microorganisms used in such a process are bacteria of the genus Streptomyces.
25 More preferably, the macrolide in question is spiramycin and the mutant microorganisms improved for their production of spiramycins are strains of S. ambofaciens.
Another aspect of the invention relates to the use of a sequence and / or a vector according to the invention for the preparation of hybrid antibiotics. In indeed the polynucleotides according to the invention can be used to obtain microorganisms expressing one or more mutant proteins giving rise to a modification in the specificity of the substrate or be expressed in multiple microorganisms antibiotic producers for the purpose of generating hybrid antibiotics.
So the polynucleotides according to the invention can allow, by transfer of genes Between producing microorganisms, to make hybrid antibiotics having pharmacologically valuable properties (Hopwood et al., 1985a, Hopwood and al., 1985b, Hutchinson et al., 1989). The principle by which engineering genetics can.
lead to the production of hybrid antibiotics was first proposed par'1 ' Hopwood (Hopwood 1981). It has thus been proposed that the enzymes participating in the biosynthesis of antibiotics often accept linked substrates structurally but different from their natural substrate. It is generally accepted (Hopwood 1981, Hutchinson 1988, Robinson 1988) that the enzymes encoded by the genes of the dice track ::. ~
biosynthesis of antibiotics have a lower substrate specificity than enzymes ~ w of primary metabolism. It has thus been shown that a large number of non-substrates;
natural are transformed by microorganisms producing antibiotics léur ~~
q ~ ~, F7, ... Wc ~ t!, ~
mutants or enzymes purified from the pathway of biosynthesis of these antibioti û s '~~ ~' ~
q ~ ~, 3 ~: w :, (Hutchinson 1988). Using this teaching, a person skilled in the art can to build microorganisms expressing one or more mutant proteins giving rise to to one modification in the specificity of the substrate in order to generate antibiotics hybrids.
The invention also relates to the use of at least one polynucleotide andlor at least one recombinant DNA and / or at least one expression vector and / or at less a polypeptide and / or at least one host cell according to the invention for producing one or several bioconversions. Thus the invention makes it possible to construct strains bacterial or fungal in which we express, under the control of signals appropriate expression, one or more proteins according to the invention. Of such strains can then be used to carry out one or more bioconversions. These bioconversion can be done either using whole cells or using extracts acellular say cells. These bioconversions can transform a molecule in one derived form, with an enzyme of a biosynthetic pathway. For example, Carreras et al.
describes the use of Saccharopolyspora erythraea strain and Streptomyces coelicolor for the production of new erithromycin derivatives (Carreras and al.
2002). Walczar et al. describes the use of a P450 mono-oxygenase from Streptomyces for the bioconversion of deacetyladriamycin (an anthracycline analogue) in from new anthracyclines (Walczar et al., 2001). Olonao et al. described the use of a Streptomyces lividans strain modified for the bioconversion of rhodomycinone-epsilon in rhodomycin D (Olonao et al., 1999). A person skilled in the art can apply this principle to any biosynthesis intermediary.
The invention also relates to a recombinant DNA characterized in that it comprises - a polynucleotide capable of being obtained by chain amplification by polymerase using the pair of primers with the following sequence: 5 ′
AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ) DN ° 138) and 5' GGATCCCGCGACGGACACGACCGÇCGCGCA 3 '(SEQ m N ° 139) and as.':::;
matrix the pSPM36 colon or the total DNA of Streptomyces ambofaciens, plus ~ ~
'-preferably it is a polynucleotide of sequence SEQ ID No.

- or a fragment of at least 10, 12, 15, 18, 20 to 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1460, 1470, 1480, 1490 or 1500 consecutive nucleotides of these polynucleotides.
Preferably; this recombinant DNA is a vector. Even more preferably, the vector is chosen from bacteriophages, plasmids, the phagemids, integrative vectors, fosmids, cosmids, vectors Shuttle Buses, BAC (Bacterial Artificiel Chromosome) or PAC (P1-derived Artificiel Chromosome). By way of illustration, the phage can be mentioned as bacteriophages lambda and phage M13. As plasmids, mention may be made of replicating plasmids.
at E.
coli for example pBR322 and its derivatives, pUCl8 and its derivatives, pUCl9 and its derivatives, pGB2 and its derivatives (Churchward G. et al., 1984), pACYC177 (access number GenBank: X06402) and its derivatives, pACYC184 (GenBank access number: X06403) and its derivatives. Mention may also be made of the plasmids which replicate in Streptomyces such as pIJ101 and its derivatives, pSGS and its derivatives, SLP1 and its derivatives, SCP2 * and its derivatives (Kieser et al. 2000). As phagemids we can cite to title illustrative pBluescript II and its derivatives (marketed in particular by the society Stratagene (LaJolla, California, USA)), pGEM-T and its derivatives (marketed over there Promega (Madison, Wisconcin, USA)), ~, ZAPII and its derivatives (marketed in particular by the company Stratagene (LaJolla, California, USA)). , As integrative vectors there may be mentioned by way of illustration, the vectors integrative, in Streptomyces such as for example those derived from SLP 1 (Kieser et al, 2000) those derived from pSAM2 (Kieser et al, 2000), the vectors using the systems integration of phages PhiC31 (Kieser et al, 2000) (for example pSET152 (Biennan et al., 1992)) or VWB (Van Mellaert L, et al. 1998), as well as vectors using the IS 117 integration system (Kieser et al. 2000).
As fosmides, we can cite by way of illustration the fosmid pFOS 1 (marketed over there . - v New England Bioloabs Inc., Beverly, Massachussetts, USA) and its dénves.
As cosmids we can cite by way of illustration the cosmid SuperCos and its meetings ~ '_' ,:, (marketed in particular by the company Stratagene (LaJolla, California, USA)), the cosmid pWEDlS (Wahl et al., 1987) and its derivatives. As shuttle vectors we 2o may cite by way of illustration the E. coli shuttle plasmids.
Streptomyces as per example pIJ903 and its derivatives, the series of plasmids pUWL, pCA0106, pWHM3, pOJ446 and their derivatives (Kieser et al. 2000), the BAC shuttle E. coli l Streptomyces such as, for example, those described in patent application WO 01/40497. As BAC (Bacterial Artificiel Chromosome) we can cite by way of illustration the BAC
pBeIoBACl l (GenBank access number: U51113). Like PAC (P1-derived Artificial Chromosome) there may be mentioned by way of illustration the vector pCYPAC6 (number GenBank access: AF133437). More preferably, this recombinant DNA is a expression vector. Expression vectors usable in different systems of expression are well known to those skilled in the art, with regard to cell prokaryotes, there may be mentioned by way of illustration the expression vectors in E. coli by example, from the pET family sold by the company Stratagene (LaJolla, California, USA), the GATEWAY family vectors marketed by the Invitrogen company (Carlsbad, California, USA), family vectors pBAD
marketed by the company Invitrogen (Carlsbad, California, USA), the vectors of the pMAL family marketed by New England Bioloabs Inc.
(Beverly, Massachussetts, USA), ~ rhamnose-inducible expression vectors cited in the publication Wilms B et al., 2001 and their derivatives, one can also quote them expression vectors in Streptomyces such as for example the vectors pIJ4123, pIJ6021, pPM927, pANT849, pANT 850, pANT 851, pANT1200, pANT1201, pANT1202 and their derivatives (Kieser et al., 2000). Concerning the cells of yeasts, there may be mentioned by way of illustration the vector pESC marketed by the society Stratagene (LaJolla, California, USA). Regarding the system expression baculovirus allowing expression in insect cells we can quote as illustrative of the BacPAK6 vector marketed by the company BD Biosciences Clontech, (Palo Alto, California, USA). Regarding the cells of ' mammals, there may be mentioned by way of illustration vectors comprising the promoter of ~.
- early genes of the CMV C ome alovirus virus yt g) (for example the vector pCMV and, its derivatives marketed by Stratagene (LaJolla, California, USA), or the promoter of the simian virus's immediate genes (SV40 early promoter) vacuolating SV40 (for example the vector pSGS sold by the company Stratagene (LaJolla, California, USA). Another aspect of the invention relates to host cells in which has been introduced at least one recombinant DNA described in this paragraph.
Another aspect of the invention relates to a method for producing a polypeptide characterized in that said method comprises the following steps:
a) transforming a host cell with at least one expression vector such as described in the above paragraph;
b) cultivating, in an appropriate culture medium, said host cell;
c) recovering the conditioned culture medium or a cell extract;
d) separate and purify from said culture medium or from the cell extract obtained in step c), said polypeptide;

e) where appropriate, characterize the recombinant polypeptide produced.
The recombinant polypeptide thus produced can be purified by passage over a appropriate series of chromatography columns, according to known methods of those skilled in the art and described for example in F. Ausubel et al (2002). We can quote to 5 Illustrative title the technique of "Tag-Histidine", which consists in adding a short poly-histidine sequence to the pQlypeptide to be produced, which can then to be purified on a nickel column. This polypeptide can also be prepared by the in vitro synthesis techniques. As an illustration of such techniques, the polypeptide, can be prepared using the rapid translation system (RTS), marketed 10 in particular by the company Roche Diagnostics France SA, Meylan, France.
Another aspect of the invention relates to a microorganism producing at least minus a spiramycin characterized in that it overexpresses -a gene capable of being obtained by polymerase chain reaction (PCR) in.
using the pair of primers of following sequence: 5 '.' . 15, AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ m N ° 138) and ~' ~ ~ ,, ' I ~ ~ i9 ~
GGäTCCCGCGACGGACACGACCGCCGCGCA 3 '(SöQ ID N ° 139) and as' ~ f matrix the cosmid pSPM36 or the total DNA of Streptomyees ambofaciehs, plus 11 preferably it is the gene with coding sequence SEQ ID No. 141, - or a gene derived therefrom due to the degeneracy of the code genetic.
An example of the sequence of such a gene is given in SEQ ID No. 111 (DNA), however this sequence is partial since it does not include the 3 'part of the sequence corresponding coding. The translation into protein of this part of the sequence coding is given in SEQ ID No. 112. A person skilled in the art can easily complete in particular by using the teaching presented in example 24. It is thus present 25 in this example a method for cloning the orf ~ 8c gene and for manufacturing a vector of expression allowing the expression of orf ~ 8c. It is also shown in this example that the overexpression of the orf28c gene in the OSC2 strain leads to improving the production of spiramycins from this strain. In a way favorite, the overexpressing microorganism - a gene capable of being obtained by amplification in a polymerase chain (PCR) in using the pair of primers of following sequence: 5 ′
AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID N ° 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N ° 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, plus preferably it is the gene of coding sequence SEQ ID No. 141, - or a gene derived therefrom due to the degeneracy of the code genetic is a bacteria of the genus Streptomyces, even more preferably, it is a bacteria of the species Streptomyces ambofaciens. Preferably, the overexpression l0 of said gene is obtained by transformation of said microorganism with a vector of expression, most preferably, the microorganism strain is strain OSC2 / pSPM75 (1) or of the OSC2 / pSPM75 (2) strain deposited with the Collection Nationale de Cultures de Microorganismes (CNCM) Institut Pasteur, 25, rue du Doctor ~
Roux 75724 Paris Cedex 15, France, October 6, 2003 under the number recording ~, 'v ,.
is I-3101.
'.;
..
Another aspect of the invention relates to a method for producing '~';
;;
y ~ spiramycin (s) used the mierôorganismes described in the paragraph previous. This' f ~:
method consists in cultivating in a suitable culture medium a microorganism defined in the previous paragraph, recovering the culture medium conditioned or a 2o cell extract, separate and purify from said culture medium or still from the cell extract obtained in the previous step the spiramycin (s) produced. The culture conditions for such microorganisms can be determined according to of the techniques well known to those skilled in the art. The culture medium can by example be MPS medium or SL11 medium for Streptomyces and especially 25 for Streptomyces ambofaciens (Pernodet et al., 1993). The skilled person will in particular, refer to the work by Kieser et al. 2000 with regard to the culture of Streptomyces. The spiramycin (s) produced can be recovered by all techniques known to those skilled in the art. Those skilled in the art can refer to, through example, to the techniques taught in US patent US 3,000,785 and more 30 particularly to the methods of extraction of spiramycins described in this patent.

Preferably, the microorganisms used in such a process are bacteria of the genus Streptomyces. More preferably, the microorganisms are strains from S. ambo, faciens.
Another aspect of the invention relates to an expression vector characterized in that the polynucleotide of sequence SP ~ Q ID No. 47 or a derived polynucleotide of it due to the degeneracy of the genetic code is placed under the control of a promoter allowing the expression of the protein encoded by the said polynucleotide in Streptomyces ambofaciens. Examples of vectors of expression usable in Streptomyces have been given above.
Preferably, such an expression vector is characterized in that it is the plasmid pSPM524 or pSPM525.
Another aspect of the invention relates to a strain of Streptomyces ambofaciens transformed by a vector defined in the previous paragraph.
Another aspect of the invention relates to a polypeptide characterized in that, , its sequence will include the sequencer'SöQ ID N °. .11,2. The invention is also, ~~ ~~. ~ N ~
relating to a polypeptide characterized in that its sequence corresponds to the sequence.
translated from coding sequence - a gene capable of being obtained by chain amplification by polymerase (PCR) using the pair of primers with the following sequence: 5 ' 2o AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID N ° 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N ° 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, plus preferably it is the gene with coding sequence SEQ ID No. 141, -or a gene derived therefrom due to the degeneracy of the code genetic.
Preferably, these polypeptides are expressed in the natural state by a bacteria, genus Streptomyces, more preferably, these polypeptides are involved in the biosynthesis of spiramycins.

Another aspect of the invention relates to an expression vector allowing the expression of a polypeptide as defined in the preceding paragraph in Ambofacial streptomyces. Examples of Usable Expression Vectors in Streptomyces have been given above. Preferably, the vector expression in question is the plasmid pSPM75.
at LIST OF FIGURES ' Fi ure 1: Chemical structure of spiramycins I, II and III.
Fi ure 2: Cosmids used for sequencing the region.
Figure 3: Organization of a group of genes involved in the pathway biosynthesis of 1o spiramycins.
Figure 4: Proposed biosynthetic pathway for mycarosis.
Figure 5: Proposed biosynthetic pathway for mycaminosis.
File 6: Proposed biosynthesis pathway for forosamine.
Fi, re 7: Preferential order of addition of sugars in the molecule of spiramycin 'and .- ~~
intermediate. _, W ~, '. 'd ~. . .
Figure 8: Biosynth pathway ~ is prtiposed ~ methoxymalonyl chë ~ S.
atnbôfaciens. 'Cétté j ~ ~
route is proposed by analogy with the biosynthesis of methoxyrnalonyl in n, Streptomyces hygroscopicus var. ascomyceticus (Wu, K. et a1., 2000).
Figure 9: Steps leading to gene inactivation:
A) Cloning of the target gene into a vector replicating in E. coli but not in Streptomyces;
B) Insertion of the resistance cassette into the target gene (by cloning or recombination between short identical sequences);
C) Introduction of the plasmid into Streptomyces ambofaciehs (by transformation or conjugation with E. coli) and selection of the clones having integrated the cassette then screening of clones having lost the vector part to have a gene replacement;
D) Region of the chromosome of the mutant strain in which the target gene is inactivated by gene replacement.

Figure 10: Optional steps following the inactivation of a gene according to the described method in figure 9, which can be driven if an excisable cassette has been used for interrupt the target gene E) Introduction into the mutant strain of the plasmid pOSV508 carrying the genes xis and i ~ t of pSAM2 whose products will allow efficient excision by site-specific recombination between the attL and attR sequences bordering the cassette;
F) Obtaining clones having lost the excisable cassette and sensitive to the antibiotic to which the cassette imparted resistance;
G) After growth and sporulation on solid medium without antibiotic the plasmid pOSV508 is lost at high frequency. We can thus obtain clones sensitive to thiostrepton in which the target gene contains a deletion in phase. Deleted target gene sequence can be controlled by amplification PCR and sequencing of the PCR product.
Figure 11: Amplification of the excisable cassette in order to use it for a Homologated recombination experiment ~ naisôn L ~ ~ echmq'ue ' ,, ~;
. ~ '; ~, a ~. . . . , k. ,. r .:
thanks to short hornologüés sequences has been described by (Chaveroche et al., 2000). The ' 39 or 40 deoxy-nucleotides located at (5 'end of these oligonucleotides behave a sequence corresponding to a sequence of the gene to be inactivated and the deoxy-2o nucleotides located most in 3 'correspond to the sequence of one of the ends of the excisable cassette.
Figure 12: Obtaining a construct for the inactivation of a target gene thanks to the technique described by (Chaveroche et al., 2000).
Figure 13: Map of plasmid pWHM3. Strepto ori: origin of replication St ~ eptomyces.
Figure 14: Map of plasmid pOSV508.
Figure 15: Example of the structure of an excisable cassette. This is made up of the S2hyg cassette (Blondelet-Rouault et al., 1997) bordered by the attR and attL sites (Raynal and al., 1998), between which a recombination event will allow excision of the cassette, thanks to the expression of the xis and int genes.
FIGURE 16: Map of plasmid pBXL1 111.
FIGURE 17: Map of plasmid pBXL1112.
Figure 18: Microbiological test for spiramycin production, based on sensitivity of a strain of Micrococcus luteus with spiramycin. Micrococcus strain luteus used is a strain naturally sensitive to spiramycin but resistant to congocidine. The different strains of Streptomyces to be tested have been grown in 500 ml Erlenmeyer flasks containing 70 ml of MPS medium, inoculated into a concentration 2.5 106 sporeslml initial and pushed at 27 ° C with stirring orbital 250 rpm. Samples of fermentation musts were taken after 48, 72 and 96 hours of culture and centrifuged. A dilution to a tenth of these supernatants in some sterile culture medium is used for the test. The indicator strain of Mic ~ ococcus luteus resistant to congocidine but sensitive to spiramycin (Gourmelen et al., ' , is 1998) was grown in a 12x12 cm square box. Discs in Whatman paper '~ .:' AA were soaked with 70 ~, l of the 1/10 dilution of each supernatant and drop $ 2 ~;
on the surface of the box. Disks soaked in an il solution spiramycinèv'dé 1 ~~
different concentrations (2-4-8 p, g / ml in MPS culture medium) are used, as standard range. The dishes are incubated at 37 ° C for 24 to 48 hours.
If the disc contains spiramycin, which diffuses into agar and inhibits growth of the indicator strain of Micrococcus luteus. This inhibition creates a "halo"
around disc, this halo reflecting the area where the strain of Micrococcus luteus did not pushed. The presence of this halo is therefore an indication of the presence of spiramycin and allows determine whether the strain of S. ambofaciens in question is productive or not producer of spiramycin. A comparison with the inhibition diameters obtained for the standard range provides an indication of the amount of spiramycin produced by this strain.
Figure 19: HPLC chromatogram of the filtered supernatant of the culture medium the OSC2 strain.

Figure 20: HPLC chromatogram of the filtered supernatant of the culture medium the strain SPM501.
Figure 21: HPLC chromatogram of the filtered supernatant of the culture medium the strain SPM502.
Fi re 22: HPLC chromatogram of the filtered supernatant of the culture medium of the strain SPM507. ' Figure 23: HPLC chromatogram of the filtered supernatant of the culture medium ~
the strain SPM508.
Figure 24: HPLC chromatogram of the filtered supernatant of the culture medium the . .
1o strain SPM509.
Figure 25: Alignment of the Orf3 protein (SEQ ID No. 29) with the TyIB protein (SEQ
ID No. 87) of S fradiae produced thanks to the FASTA program.
Figure 26: Alignment of the MdmA protein of S. mycarofaciens (SEQ ID
N ° 88) with the protein SrmD (SEQ ID N ° 16) produced thanks to the FASTA program.
. Figure 27: Example of sequences of residual sites after excision of the cassette excisable. In bold is indicated the minimum att26 site as defined in Raynal et al, y ~ ..,. .,. ,.
.. 1998. The sequence of phase 1, (~ ttl) of, 33, uleucleotides, is pre-prescribed.
in SEQ ID. 1V ° I ~~~~
104, the sequence of phase 2 (att2) of 34 nucleotides is presented in SEQ
ID No. 105 ,. 4, the sequence of phase 3 (att3) of 35 nucleotides is presented in SEQ ID
N ° 95. Fi ~ ure 28: Schematic representation of the orfl0 gene, localization of PCR primers utlisées and construction obtained with each pair of primers.
Figure 29: Construction of the pac-o ~ itT cassette.
Fi re 30: Map of the cosmid pWED2.
Figure 31: Schematic representation of the group of genes involved in way of biosynthesis of spiramycins and the location of the three probes used to isolate the cosmids of the genomic DNA bank of the OSC2 strain of Streptomyces ambofaciens in E. coli (see example 19) Figure 32: Location of the inserts of the cosmids isolated from the genomic DNA library of the OSC2 strain of Streptomyces ambofaciens in E. coli (cf. example 19).

New cosmid DNA bank. Fi re 33: Subcloning of the PstI-PstI fragment of cosmid pSPM36 (insert of the plasmid (pSPM58), under cloning of the StuI- fragment StuI of cosmid pSPM36 (insert of plasmid pSPM72) and under cloning of an EcoRI- fragment StuI (insert of plasmid pSPM73).
Figure 34: Location of the open reading phases identified in the PstI- insert PstI of the plasmid pSPM58 and in the insert EeoRI-StuI of the plasmid pSPM73.
Figure 35: Superimposition of HPLC chromatograms of the filtered supernatant of the middle culture strain OS49.67 performed at 238 and 280nm (high) and UV spectra of the molecules eluted at 33.4 minutes and 44.8 minutes (bottom).
Figure 36: Molecular structure of platenolide A and platenolide molecules B.
Figure 37: Organization of the group of genes involved in the pathway biosynthesis of spiramycin.
Figure 38: Molecular structure of a biosynthesis intermediate produced over there strain SPM507.
Figure 39: Structure of a biosynthesis intermediate produced by a strain of S, ~.
ambofaciens of genotype orf6 * ~: attlS ~ hyg + obtained from a strain s' w ", ~ ~.,, overproducing spiramycins. The insertion of ~ the attl Sèh cassette ~ g + in orf6 * exercises '~' ~ s ..at,::
a polar effect preventing the expression of orf5 *.
Fi ure 4p; Molecular structure of the platenolide A + mycarose molecules and platenolide 2o B + mycarosis produced by the strain OS49.67 FIGURE 41: Subcloning of a PstI-PstI fragment of the cosmid -pSPM36 (insert of plasmid (pSPM79)), location of the identified open reading phases in the PstI-PstI insert of the plasmid pSPM79 and localization of the sequence SEQ ID
No. 140.

The present invention is illustrated by means of the following examples, which have to be considered as illustrative and not limiting.
In summary, the genes of the spiramycin biosynthetic pathway have been isolated at from a genomic DNA bank of Streptomyces ambofaciens. This bank has been obtained by partial digestion of the genomic DNA of Streptomyces ambofaciens, by the restriction enzyme BamHI. Large DNA fragments, from 35 to 45 kb in average, were cloned into the cosmid pWED 1 (Gourmelen et al., 1998) derived from cosmid pWEDlS (Wahl et al., 1987). These cosmids were introduced into E. coli thanks to Has phage particles. The bank thus obtained was hybridized with a probe (from.
sequence SEQ ID No. 86) corresponding to a part of the tylB gene of S.
fradiae (Merson-Davies ~ Cundliffe, 1994, GenBank access number: U08223). After hybridization, a cosmid of the 4 hybridizing with the probe was more particularly selected. This cosmid named pOS49.1 was then digested with SacI and a 3.3 kb fragment containing the region hybridizing with the probe was subcloned into the vector pUCl9 and. ~:
sequence. Four open reading phases were identified and one of them,; ~ '' encodes a protein (SEQ ID N ° 29) with strong similarities sequence with the; t .. -: r. ., ~. . , ~ ~ '.r ~' n ~,. ~
TyIB protein of S fradiae (SEQ ID N ° ~ 87) (see Figure 25) ~ This gene has been ~ named orf3 ° 'v (SEQ ID No. 28) and has been inactivated in S. ambofaciens. He may have been demonstrated that clones inactivated in the orf3 gene no longer produce spiramycins. This watch the involvement of the orf3 gene or of genes located downstream in the biosynthesis of spiramycin.
Once this confirmation is obtained, a larger region of the cosmid pOS49.1 was sequenced on either side of the SacI fragment previously studied.
So from of cosmid pOS49.1, the sequence of a region comprising seven open phases of entire reading and two others incomplete, located on either side of these seven phases full open, could be obtained. Through a search in the databases of data, it could be shown that one of the open phases of incomplete reading corresponded to srmG locus (region encoding an enzyme called "polyketide synthase" (PKS)).
The Corresponding genes were cloned by Burgett S. et al. in 1996 (Patent american us 5945320). In addition, the other open reading phases, the seven ORFs whole named: orfl, orf2, orf3, orf4, orf5, orf6, orf7 (SEQ ID N ° 23, 25, 28, 30, 34, 36, 40) and the beginning of the eighth ORF named orf $ (sequence SEQ ID N ° 43) did not not been found in the databases.
Secondly and in order to clone other genes involved in the biosynthesis of spiramycins, other cosmids containing fragments of the genome S ambofaciens in this same region have been isolated. For that, a new series Colonization hybridizations were performed using three probes. The first respondent ° ':
corresponds to a DNA fragment of 3.7 kb containing orfl, orfl and the beginning of orf3, under ~~ ~~
cloned from pOS49.1. The second probe corresponds to a 2 kb fragment DNA
containing part of orf7 and part of orf $ and subcloned from pOS49.1. A .
third probe was also used. The latter corresponds to a DNA fragment,. .
1.8 kb containing the srmD gene. The srmD gene is a gene isolated from S.
ambofacieris vw ' able to confer resistance to spiramycin. Indeed, works previous '' ~~:
., had allowed the cloning of several determinants of resistance of S.
ambofacie is ~ <
'~ ~ üa conferring resistance to spiramycin to a stiuche of S griseofuscus (sense strain ~~ le ~ i : ~! 7 hC, ~ 7 ~, spiramycin) (Pernodet et, al. 1993 ' (Pernodet et al., 1999). For the isolation of resistance genes, a cosmid library of S-strain genomic DNA
ambofaciens had been carried out in the cosmid pKC505 (Richardson MA et al., 1987).
This cosmid pool had been introduced in S. griseofuscus, naturally sensitive to _ spiramycin. Five cosmids capable of imparting resistance to apramycin and the spiramycin in S. griseofuscus had thus been obtained. Among these 5 cosmids, a cosmid named pOS44.1 has in its insert the srmD gene which codes for a protein showing some similarity with the protein encoded by the mdmA gene of Streptomyces mycarofacie ~ zs and involved in resistance to midecamycin at this producer organization (Hara et al., 1990, Genbank access number: A60725) (Figure 26). The third probe used to locate the biosynthesis genes of spiramycin a was an insert of about 1.8 kb including the srmD gene.

These three probes were used to hybridize the genomic DNA library described above and allowed to choose two cosmids (pSPM7 and pSPMS) likely to contain the longest inserts and not having bands municipalities. The cosmid pSMPS hybridized with the first and second probes, but did not hybridize with the third probe, while the cosmid pSPM7 hybridized with the third probe only. These two cosmids were sequenced in full by the technique of shotgun sequencing. The sequences of the inserts of these two cosmids: pSPM7 and pSPMS could be assembled because although not overlapping, each of the inserts included a known sequence at one of its ends.
Indeed;;.:.:
l0 each of these inserts contained a fragment of the sequence of one of the genes coding a enzyme called "polyketide synthase" (PKS). These 5 genes have been cloned by Burgett S.
et al. in 1996 (US patent US 5,945,320) (see Figure 2). So he was able to be determined a unique genomic DNA sequence from S. ambofaciehs. A sequence of 30943 nucleotides starting, in 5 ', from an EcoRI site located in the first gene PKS et.
going to a BamHI site in 3 'is presented in SEQ ID N ° 1. This sequenced "Tr ''' corresponds to the upstream region of the PKS enes cf. fi g (station 2 and 3). A second "~
_; . ..
~. region of 11171 nucleotides, with a 5 'sile'PstI and going until uri ~ Bst site ~ ~ E '~ C ~~~~, kk ~ r in 3 'located in the fifth gene of PKS is presented in SEQ ID N °
2. This region t is the downstream region of PKS genes (downstream and upstream being defined by orientation 2o of the 5 PKS genes all oriented in the same direction) (cf. Figures 2 and 3).
Thirdly and in order to clone other genes involved in the biosynthesis of spiramycins, other cosmids containing fragments of the genome of S. ambofaciens in this same region were isolated (cf. example 18 and 19).

EXAMPLE 1 Construction of a Genomic DNA Bank of the Strain ATCC23877 of Streptomyces ambofaciens in E. coli ll Extraction of Enomic DNA from Str AT tomyces ATCC23877 ambofaciens.
The ATCC23877 strain of Streptomyces ambofaciens (accessible in particular '' from the American Type Culture Collection (ATCC) (Manassas, Virginia, USA), under number 23877) was grown in YEME (Yeast Extract-Malt Extract) ((Kieser,,, T, et a1., 2000) and the genomic DNA of this strain was extracted and purified according to the ~~ "1 ~
standard lysis and precipitation techniques (I ~ ieser T. et al., 2000).
l0 1.2. Construction of the genomic DNA library The genomic DNA of the ATCC23877 strain of Streptomyces ambofaciens tël .- ~., .:.:
.., r., that isolated above was partially digested by the restriction enzyme BamHI de ~; ~ _; -:
~, T,.,. ~:
so as to obtain DNA fragments of size between approximately 35 and 45 kb ~ ''' 1 tbsp ', These fragments were cloned into the cosmid, pWEDl (Gourrnelen et al., 1998) digested ""
_: ~~ '~~ r âr ~ is' prior to BamHI. The cosmid pWEDlr is, derived from the cosmid pWElS
(Wahl; 'e ~~; .r' al., 1987) by deletion of the 4.1 kb HpaI-HpaI fragment containing the module r , active expression in mammals (Gourmelen et al., 1998). The mixture of ligation was then packaged in vitro into lambda phage particles thanks to "Packagene ~ Lambdà DNA packaging system" system marketed by society 20 Promega following the manufacturer's recommendations. The particles phage obtained were used to infect the SURE ~ strain of E. coli marketed by Stratagene (LaJolla, California, USA). The selection of clones has been performed on LB + ampicillin medium (50 ~, g / ml) since the cosmid pWEDl confers the resistance with ampicillin.

EXAMPLE 2: Isolation and characterization of genes involved in the biosynthesis of spiramycins in Streptomyces ambofaciens 2.1 Colony hybridization of E coli clones from the enomic library of Strez ~ ambofacian tomyces ATCC23877 e Approximately 2000 clones of E. coli from the bank obtained above, have been transferred on filter for hybridization on colonies. The probe used for hybridization is a NaeI-NaeI DNA fragment (SEQ ID No. 86) comprising part of the gene tylB from Streptomyces, f-ADIAE. This fragment corresponds to nucleotides 2663 to 3702 of fragment ~~.
DNA described by Merson-Davies, LA & CundlifFe E. (Merson-Davies, LA & 1 1o Cundliffe E., 1994, GenBank access number: U08223), in which the sequence coding agent for the tylB gene corresponds to nucleotides 2677 to 3843.
The NaeI-NaeI fragment of DNA carrying part of the Streptomyces tylB gene fradiae (SEQ 1D N ° 86) was marked with 32P by the technique of "
random priming »
(Kit marketed by Roche) and used as a probe for hybridization of ., '15 2000 clones of the bank, traï ~ sferés on filter. The membranes used are ~ dice., ~
Hybond N nylon membranes sold by the company Amersham (Amersham. ~ l ~
Biosciences, Orsay, France) and the hybridization was carried out at 55 ° C.
in the described buffer by Church ~ c Gilbert (Church & Gilbert, 1984). Washing was done in 2X
SSC to 55 ° C for 15 minutes and two successive washings in O.SX SSC have then been 2o carried out at 55 ° C, lasting 15 minutes each. In these hybridization conditions and washing, 4 clones among the 2000 hybridized presented a strong signal hybridization.
These 4 clones were cultured in LB + ampicillin medium (50 ~, g / ml) and the 4 cosmids correspondents were extracted by standaxd alkaline lysis (Sambrook et al., 1989). He has then verified that the hybridization was due to a DNA fragment present in 25 the insert of these four cosmids. For this, the cosmids have been digested independently by several enzymes (BamHI, PstI and SacI). Digestion products have been separated on agarose gel, transferred to Nylon membrane and hybridized with the fragment Nael-Nael of DNA comprising a part of the tylB gene of Streptomyces fradiae (cf. below) above) in the same conditions as above. The four cosmids could be validated and one of these cosmids was more particularly retained and was named pOS49.1.
2.2 Verification of the involvement of the identified region and sequencing of the insert of cosmid pOS49.1 Several ~ rs fragments of the insert of the cosmid pOS49.1 have been so-cloned and their sequences have been determined. The cosmid pOS49.1 has been digested by the enzyme SacI and he was shown by Southern blot, under the conditions described above, one 3.3 kb fragment contains the region hybridizing with the tylB probe. This 3.3 'fragment:''' kb was isolated by electroelution from a 0.8% agarose gel and then cloned in the lo vector pUCl9 (GenBank access number M77789) and sequenced. The plasmid so obtained was named pOS49.11. Four open reading phases presenting a use codons typical of Streptomyces could be identified in this fragment (of them complete and two truncated), thanks to the FramePlot program (Ishikawa J & Hotta K.
1999). Sequence comparisons using the FASTA program (cf. (Pearson W. R ~ ~.
& DJ Li man 1988 and p,) (Pearson WR, 1990), available in particular from center 3 of INFOBIOGEN E resources vry, Francé) allowed to show that the protein, '7 ~ °
deduced from one of these 4 open reading phases presents strong similarities of sequence with the TyIB protein (SEQ ID No. 87; GenBank access number:
U08223) of S. fradiae (see Figure 25). This protein was named Orf3 (SEQ ID
N ° 29).
2o In order to test whether the corresponding gene (the orf3 gene (SEQ ID
# 28)) was involved in the biosynthesis of spiramycins in S. ambofaciens, this gene has summer interrupted by a S ~ hyg cassette (Blondelet-Rouault MH. et al., 1997, issue access GenBank: X99315). For this, the plasmid pOS49.11 was digested with the enzyme XhoI and the fragment containing the four open reading phases (two complete and of them truncated, including entire orf3) has been subcloned at the XhoI site of the pBC vector SK + marketed by the company Stratagene (LaJolla, Califormie, USA). The plasmid thus obtained was named pOS49.12. In order to inactivate orf3, a fragment PmlI-BstEII internal to orf3 has been replaced by the S2hyg cassette by end cloning frank in this last plasmid. For this, the plasmid pOS49.12 was digested with the enzymes PmII and BstEII whose unique site is in the coding sequence of the orf3 gene.
The ends of the fragment corresponding to the vector were made blunt ends by a treatment with the Klenow enzyme (large fragment of DNA polymerase I). The cassette, i2hyg was obtained by digestion with the plasmid enzyme BamHI
pHP45 S2hyg (Blondelet-I ~ .ouault et al., 1997, GenBank access number: X99315). The fragment corresponding to the, cassette, f ~ hyg was recovered on agarose gel and its ends have been made blunt by treatment with the Klenow enzyme. Both fragments free ends thus obtained (the Sdhyg cassette and the plasmid pOS49.12) were ganged up and the 10 ligation products were used for the transformation of E. bacteria coli. The plasmid thus obtained was named pOS49.14 and contains the gene o ~ f3 interrupted by the cassette S ~ hyg.
The insert of the plasmid pOS49.14, in the form of an XhoI XhoI fragment, the ::
ends were made non-cohesive by treatment with the enzyme Klenow, a .15 was cloned at the EcoRV site of the plasmid pOJ260 (the plasmid pOJ260 is a ~., conjugative plasmid capable of replicating in E. ~ coli but incapable of replicate . . ,. ~, z ..
in S. ambofaciens ~ (Biermari 1 M et al., ~ 1992). This plasmid confers the resistance 'to' ~
fapramycin in E. coli and Streptomyces). The plasmid obtained (insert of plasmid pOS49.14 cloned into the plasmid pOJ260) was named pOS49.16. The latter was 20 transferred to the strain ATCC23877 of S. ambofaciens by conjugation to using the E. coli S17-1 conjugative strain, as described by Mazodier et al. (Mazodier et al., 1989). The E. coli S17-1 strain is derived from the E. coli 294 strain (Simon and al., 1983) (Simon, et al., 1986). Transconjugating clones having the marker of resistance to the hygromycin carried by the cassette, S2hyg and having lost the marker resistance to 25 apramycin carried by the vector pOJ260 could be obtained. For it, after conjugation, the clones are selected for their resistance to fhygromycin.
The clones resistant to hygromycin are then subcultured respectively on middle with hygromycin (antibiotic B) and on medium with apramycin (antibiotic A) (cf. figure 9). Clones resistant to fhygromycin (HygR) and sensitive to fapramycin (After) 3o are in principle those where a double recombination event has occurred and that therefore have the orf3 gene interrupted by the S ~ hyg cassette. Replacing of the wild copy of orf3 by interrupted copy was checked by two hybridizations successive. Thus, the total DNA of the clones obtained was digested by different enzymes, separated on agarose gel, transferred to membrane and hybridized with a probe corresponding to the S2hyg cassette (see above)) to check for the presence of the cassette in genomic DNA, clones obtained. A second hybridization was performed.
using as probe XhoI XhoI insert of plasmid pOS49.11 containing the four open reading phases (two complete and two truncated, including orf3 in integer). The genotype verification can also be performed by any known method of those skilled in the art and in particular by PCR using the oligonucleotides appropriate and sequencing of the PCR product. One of the orf3 ::, f ~ hyg clones thus obtained and of which the genotype has been verified, has been chosen and has been named OS49.16.
The spiramycin production of the clone OS49.16 thus obtained was tested using at production test described below (see example 15). It could thus be demonstrated that this '' i5 strain no longer produces spiramycin, confirming (involvement of orf3 and / or genes ':' ~ a located downstream com ~ ïe for example orf4, in the, biosynthesis of spiramycins.
Once this confirmation is obtained, a larger region of the cosmid pOS49.1 ' was sequenced on either side of the SacI fragment previously studied.
So from of cosmid pOS49.1, the sequence of a region comprising seven open phases of entire reading and two others incomplete, located on either side of these seven phases full open, could be obtained. Through a search in the databases of data, it could be shown that one of the open phases of incomplete reading corresponded to srmG locus (region encoding an enzyme called "polyketide synthase" (PKS)).
The Corresponding genes were cloned by Burgett S. et al. in 1996 (Patent american us 5945320). In addition, the other open reading phases: the seven ORFs whole named: orfl, orf ~, orf3, orf4, orf5, orf6, orf7 (SEQ ID N ° 23, 25, 28, 30, 34, 36 and 40) and the beginning of the eighth ORF named orf ~ (the entire sequence of this orf is given in SEQ ID N ° 43) were not found in the databases of data.

EXAMPLE 3 Isolation and Characterization of Other Genes Involved in the biosynthesis of spiramyeins in Streptomyces ambofaciens Secondly and in order to clone other genes involved in the biosynthesis of spiramycins, other cosmids containing fragments of the genome of S. ambofaciens in this same region have been isolated. For this he was proceeded to a new series of colony hybridizations using three probes - The first probe used corresponds to a BamHI-PstI DNA fragment from 3,7kb. .
containing a fragment of the PKS gene (The genes corresponding to PKS have summer cloned by Burgett S. et al. in 1996 (US patent US 5,945,320)), orfl, orf ~ and the start of orf3, subcloned from pOS49.1 and going from a BamHI site located 1300 pairs of bases upstream of the EcoRI site defining position 1 of SEQ ID N °
1, to the site.
PstI located in position 2472 (SEQ ID N ° 1). This BamHI-PstI fragment was sub cloned to from pOS49.1 in the plasmid pBC SK +, which made it possible to obtain the plasmid . , pOS49.28.
. . .,, '"~ z, - The deûXièrrié ~ probe used horns ond ~ a fra PstI-BamHI DNA fragment of approximately ","
2kb containing a fragment of orf7 and gold, f ~, subcloned from pOS49.1 and going from one PstI site located in position 6693 of SEQ 1D N ° 1 to the BamHI site located in position 8714 of SEQ ID No. 1. This PstI-BamHI fragment was subcloned from from pOS49.1 in the pBC SK + plasmid, which made it possible to obtain the plasmid pOS49.76.
- A third probe was also used. The latter corresponds to a DNA fragment of 1.8 kb EcoRI-HindIII containing the srmD gene. The srmD gene is a gene isolated from S. ambofaciens capable of conferring resistance to spiramycin. Indeed, previous work had allowed the cloning of several determinants of resistance of S. ambofaciens, conferring resistance to spiramycin on a strain of S.
griseofuscus (strain sensitive to spiramycin) (Pernodet et al., 1993) (Pernodet et al., 1999). To isolate resistance genes, a cosmid DNA bank genomics of the ambofaciens strain S ATCC23877 was carried out in the cosmid pKC505 (Richardson MA et al., 1987). For this, the genomic DNA of the strain S
ambofaciens ATCC23877 had been partially digested with Sau3AI so as to obtain fragments of size between approximately 30 and 40 kb. Genomic DNA as well digested (3 ~, g) had been ligated with 1 ~ g of pKC505 previously digested with the enzyme Bam (Pernodet et al., 1999). The ligation mixture was then packaged in in vitro phage particles. The phage particles obtained had been used for infect the strain of E. coli HB 1 O1 (accessible in particular from the American Type Culture Collection (ATCC) (Manassas, Virginia, USA), number 33694).
About 20,000 clones of E. apramycin-resistant coli had been pooled and the cosmids of these. '.:'' lo clones had been extracted. This cosmid pool was introduced by transformation of protoplasts in strain DSM 10191 of S. griseofuscus (Cox KL & Baltz RH.
1984) naturally sensitive to spiramycin (Rao RN et al., 1987, this strain is available notably from the German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, DSMZ), (Braunschweig, Allamagne), under number DSM 10191). Transformants had been ~~~~: e selected on a medium containing apramycin. 1300 clones pushing on F, ~ ~ i ,,. . medium containing, the aprampcme had been transferred to medium containing Spg / ml ~ of ~ 6, ~ #
spiramycin. Several clones resistant to apramycin also had pushed f on medium containing spiramycin and the cosmids from these colonies had been extracts and 2o used to transform E. coli and S. griseofuscus (Pernodet et al., 1999). Five cosmids Capable of conferring apramycin resistance to E. coli and co-resistance to apramycin and spiramycin in S. griseofuscus had thus been obtained.
Among these 5 cosmids, it has been determined that a cosmid named pOS44.1 has in its insert a gene (SEQ ID No. 15) which codes for a protein (SEQ ID No. 16) presenting some similarity to a protein encoded by the Streptomyces mdmA gene mycarofacie cs ~
(SEQ ID No. 88), this gene was named srmD (cf. alignment presented in figure 26 made thanks to the FASTA program (ef. (Pearson W. R & DJ Lipman, 1988) and (Pearson W.
R., 1990), accessible in particular from the INFOBIOGEN resource center, Evry France).

To isolate the resistance determinant contained in the plasmid pOS44.1, the one-ci was partially digested with the restriction enzyme Sau3AI so as to get fragments of about 1.5 to 3 kb in size, these fragments were ligated in the vector pIJ486 linearized by the enzyme BamHI (Ward et al., 1986). A plasmid has been selected for its ability to confer resistance to spiramycin in the DSM strain 10191 from S. griseofuscus (Rao RN et al., 1987), naturally sensitive to spiramycin (cf. below above). For this, the pool of plasmids corresponding to the Sau3AI fragment of pOS44.1 ligated in the vector pIJ486 (cf. above), was introduced by transformation of protoplasts in strain DSM 10191 and the transformants were selected for ' their resistance to thiostrepton (due to the tsr gene carried by pIJ486). Clones pushing on medium containing thiostrepton were transferred to medium containing of the spiramycin. Several thiostrepton resistant clones have also grown on middle containing spiramycin and the plasmids from these colonies were extracted.
A
plasmid conferring resistance and containing an insert of approximately 1.8 kb has been selected and named pOS44.2. This insert of l.8kb can be easily removed thanks to a HindIII site ~.
and an EcoRI site present in the vector on either side of the insert. This insert of l.8kb,.
". ... ~..
HindIII EcoRT has been se ~ quençk and the resistance gene ~ which i1 contains has been named srmD ~ 'n ~~.
::. :,. ~. : _. .,. ..; .
.,, This fragment containing the srmD gene could thus be easily subcloned into ~~~
vector pUCl9 (GenBank access number M77789) opened by EeoRI-HindIII, the plasmid obtained was named pOS44.4. The insert of l.8kb HindIII-EcoRI, containing the srmD gene, this plasmid was used as a probe to locate genes of biosynthesis of spiramycin (see below).
A sample of an Escherichia Coli DHSa strain containing the plasmid pOS44.4 has been deposited with the National Collection of Cultures of microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, The 10 July 2002 under registration number I-2918.
About 2000 bank clones, obtained above (cf. example 1), were transferred to filter for hybridization on colonies according to techniques conventional (Sambrook et al., 1989).

The three probes described above were labeled with 32P by the technique of "
random priming "(Kit marketed by Roche) and used for hybridization of the 2000 bank clones, transferred to filter. Hybridization has been completed at 65 ° C in the stamp described by Church & Gilbert (Church & Gilbert, 1984). A wash has summer performed in 2X SSC at 65 ° C for 15 minutes and two successive washes then have were carried out in O.SX SSC at 65 ° C, with a duration of 15 minutes each.
In these hybridization and washing conditions, 16 clones among the 2000 hybridized presented a strong hybridization signal with at least one of the probes. However, none cosmid. .
did not hybridize with the three probes. The 16 cosmids were extracted and digested through 10 the BamHI restriction enzyme. The comparison of restriction profiles of these different cosmids between them, led to choosing two cosmids likely to contain the longest inserts in the region and having no common bands.
So two cosmids one named pSPMS and the other pSPM7 were chosen. The cosmid pSPMS
hybridized with the orfl to orf4 probes and the gold, fg probe, but did not hybridize with the probe srmD. pSPM7 hybridized only with the srmD probe and not with the other two ° '' probes.
_, ': _ ~ (71 IF ~~' I
'' 1 ~ '~' ~ _ '~',, j ~ _. .. ~; _ ,, ~. . .
These two cosmids have been completely sequenced by the technique of Sequencing by ~
blind ("shotgun sequencing"). The sequences of the inserts of these two cosmids pSPM7 and pSPMS could be assembled because although not overlapping, each 2o of the inserts included a known sequence at one of its ends. In effect each of these inserts contained a fragment of the sequence of one of the genes encoding a enzyme called "polyketide synthase" (PKS). These 5 genes were cloned by Burgett S. et al.
in 1996 (US patent US 5,945,320) (see Figure 2). So it could be determined a unique genomic DNA sequence of S. ambofaciens. A sequence of 30943 nucleotides leaving 5 ′ from an EcoRI site located in the first PKS gene and from up to a 3 'BamHI site is presented in SEQ ID No. 1. This sequence corresponds to the upstream region of the PKS genes (cf. FIGS. 2 and 3). A second region from 11171 nucleotides, starting from a PstI site in 5 'and going to a NeoI site in 3' located in the fifth PKS gene is presented in SEQ ID No. 2. This second region is the downstream region of PKS genes (downstream and upstream being defined by the orientation of the 5 PKS genes all oriented in the same direction) (cf. Figures 2 and 3).
EXAMPLE 4 Analysis of the nucleotide sequences, determination of the phases open reading and characterization of genes involved in biosynthesis of the spiramycin.
The sequences obtained were analyzed using the FramePlot program (Ishikawa J & Hotta K. 1999). This made it possible to identify, among the phases open from reading, open reading phases with typical codon usage from.:, Streptomyces. This analysis determined that this region has 35 ORFs located on either side of five genes encoding the enzyme "polyketide synthase »
(PKS). Respectively 10 and 25 ORFs were identified downstream and upstream of these genes (downstream and upstream being defined by the orientation of the 5 PKS genes all oriented ~ ' in the same direction) (see Figure 3). Thus, the 25 open reading phases of this type,, occupying an area of approximately 31 kb (SEQ 1D N ° 1 and figure 3) have been identified in ~ °
upstream of the 5 genes encoding PKS and 10 occupying a region of approximately 11.1 kb (SEQ ID
fi ~~ ~, r;
No. 2 and Figure 3), have been identified downstream from the PKS. The genes of re ~ dn ~ ~ t '' ,. ~,. ~
,,. .:. ... ~, _.,.:. ,. .
upstream were named orfl, orfl, ôrf3, orf4, ~ orf5, orf6, orf7, orf8, orf ~ c, orfl0, orfllc, orfl2, orfl3c, orfl4, orfl Sc, orfl6, orfl7, orfl8, orfl9, orf20, orf ~ lc, orf ~ 2c, orf ~ 3c, orfl4c and orf ~ Sc (SEQ ID N ° 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82 and 84). The downstream region genes have been appointed orfl * c, orf ~ * c, orf3 * c, orf4 * c, orf5 *, orf6 *, orf7 * c, orf8 *, orfp *, orfl0 *
(SEQ ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21). The "c" added in the name of the gene meaning for the ORF in question that the coding sequence is in the reverse orientation (the coding strand is therefore the complementary strand of the sequence given in SEQ ID N ° 1 or SEQ ID N ° 2 for these genes) (see Figure 3).
The protein sequences deduced from these open reading phases were compared with those present in different databases thanks to different programs: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search, COGs (Cluster of Orthologous Groups) (these three programs are accessible especially at the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W. R & DJ Lipman, 1988) and (Pearson WR, 1990), BEAUTY (Worley KC. Et al., 1995)) (these two programs are accessible notably with the INFOBIOGEN resource center, Evry, France). These comparisons made it possible to formulate hypotheses on the function of products of these genes and identify those likely to be involved in biosynthesis of spiramycin.
EXAMPLE 5 Gene Inactivation: Principle of Building a Strain Interrupted ambofacial streptomyces The methods used consist in performing a gene replacement. The gene target to be interrupted is replaced by a copy of this interrupted gene by a cassette conferring resistance to an antibiotic (e.g. apramycin or hygromycin), as illustrated in figure 9. The cassettes used are bordered on the side and else by translation termination codons in all reading phases and by .
active transcription terminators at Streptomyces.
i: ..; a ~. '; , ~ .a. , The insertion of the cassette into the target can be accompanied or not by a deletion; ,, in this target gene. The size of the regions flanking the cassette can range from a few hundreds to several thousand base pairs.
The constructions necessary for the gene to be inactivated by the cassette have been obtained at E. coli, a benchmark organization for obtaining DNA constructs recombinant. The interrupted gene was obtained in a replicating plasmid at E.
coli but cannot replicate in Streptomyces.
The constructions were then subcloned into vectors to allow the transformation and inactivation of the desired gene in S. ambofaciens. For it, of them plasmids were used - pOJ260 (Bierman M. et al., 1992) (cf. example 2) which confers resistance to fapramycin in E, coli and Streptomyces and which was used when the gene target was interrupted by a cassette conferring resistance to fhygromycin.

- pOSK1205 (4726pb). This plasmid is derived from the plasmid pBK-CMV (marketed by the company Stratagene (LaJolla, California, USA)) in which a fragment Avrll containing the sequence coding for resistance to Neomycin / Kanamycin a been replaced by a sequence encoding resistance to hygromycin, while retaining the promoter P SV40. For this, the plasmid pHP45-S ~ hyg (Blondelet-Rouault et al., 1997) was digested with the enzymes NotI and PflmI and the fragment conferring resistance to hygromycin has been subcloned at the site AprII from pBK-CMV vector after all ends are blunt by treatment with the Klenow enzyme. In pOSK1205, the cassette which confers the resistance to hygromycin is preceded by the promoter pSV40. This plasmid Y
confers resistance to hygromycin in E. coli and Streptomyces and has been used when the target gene has been interrupted by a cassette conferring the resistance to fapramycin.
The cassettes were introduced into the target gene either by cloning in using w ;:
is restriction sites present in the target gene, either by recombination between courts ° ~ '' v identical sequences as described by exerilple by. Chaverôche et al (Chaveroche MKh ~~ ~~
,, î
et al., 2000). - - '' - '~ ~~ _ The plasmid carrying the gene interrupted by the cassette can then be introduced to Streptomyces ambofaciens, for example by conjugation between E. soli and Streptomyces (Mazodier P, et al., 1989). This technique has been used in cases where the basic vector is the vector pOJ260. A second technique can be used:
technique of transformation of protoplasts after denaturation by alkaline treatment of DNA
(Kieser, T et al., 2000), to increase the frequency of recombination as described for example by Oh & Chater (Oh & Chater, 1997). This technique was used in the case where the basic vector is pOJ260 or pOSK1205 (see below). The transformants are then selected with the antibiotic corresponding to the cassette present in the target gene (see Figure 9, antibiotic B). We thus select a mixture of clones among which there was integration by one or two events of recombination. Secondly, we are looking for clones sensitive to the antibiotic for which the resistance gene is present in the vector (out of recombination cassette) (cf. FIG. 9, antibiotic A). We can thus select the clones for which there have in principle been two recombination events leading replacing the wild-type gene with the copy interrupted by the cassette. These steps are shown schematically in Figure 9.
Several cassettes can be used for gene interruption targets. We can for example use the S2hyg cassette which gives resistance to hygromycin (Blondelet-Rouault et al., 1997, GenBank access number: X99315).
l0 EXAMPLE 6: Construction of a strain of Streptomyces ambofaciens interrupted in phase in the orf3 gene The orf 3 gene had been interrupted by the S ~ hyg cassette (cf. example 2.2) and he could ~.
'. be shown that an orf3 :: Slhyg strain no longer produces spiramycin, confirming, ~ v (involvement of one or more genes from the cloned region in biosynthesis .ë ~
spiramycins (cf. example 2.2). ' In view of their gold: entâtion ~ une coRanscriptic ~ n of ÖRFs ~ 2 1 to 7 is likely (see Figure 3), and. the phenotype observed (non ~ producer from ~~ ' spiramycins) may be due to the inactivation of one or more of the co-transcribed with orf3. To confirm the involvement of orf3 in the biosynthesis of spiramycins, a further inactivation of the orf3 gene has been performed, the latter being performed in phase.
For this, a DraIII fragment internal to orf3 of 504 base pairs was deleted. A
DNA fragment obtained from pOS49.1, going from the EcoRI site located in position 1 (SEQ ID N ° 1) to the SacI site located in position 5274 (SEQ ID
N ° 1) and which includes a deletion between the two DraIII sites at positions 2563 and 3067 (504 nucleotides removed) was cloned into plasmid pOJ260 (Bierman M. et al., 1992). The plasmid thus obtained was named pOS49.67.
The insert of pOS49.67 therefore consists of a DNA fragment from S.
ambofacie ~ cs containing the genes orfl, or, f ~, orf3 with the deletion in phase, orf4 and a part of orf5.
The vector into which this insert has been subcloned is pOJ260, the plasmid pOS49.67 therefore confers resistance to fapramycin and was introduced by transformation of protoplasts in strain OS49.16 (cf. example 2). The OS49.16 strain being resistant at fhygromycin, transformants hygR and apraR were obtained. After two crossings such clones on a non-selective medium, clones sensitive to apramycin and to hygromycin (apraS and hygS) were sought. In some of these clones, we indeed expects a recombination event between sequences counterparts lead to the replacement of the copy of orf3 interrupted by the cassette .f2hyg (content in the genome of the strain OS49.16) by copying orf3 with the deletion in phase present on the vector. The clones resulting from this recombination are expected Gommé
apraS and hygS after (elimination of vector sequences. The genotype of Stem ~~~ ~
thus obtained can be verified by hybridization or by PCR and sequencing of the product of.
PCR (to verify that only a copy of deleted phase orf3 is present in the genome of the clones obtained). Clones having only the copy of orf3 with a deletion ~
in phase were thus obtained and their genotype was verified. A clone presenting the ~;
.
i5 characteristics sought was more particularly selected and has was named :: ', OS49.67.
"~ E;
. . ? ~; ~ tl ~, . :. -. ; t!, st ~ St ~ dp - 'a', '~ ~. ' A sample of the strain OS49.67 was deposited near the Collec ~ iori ':;
Nationale de Cultures de Microorganismes (CNCM) Institut Pasteur, 25, rue du Doctor Roux 75724 Paris Cedex 15, France, on July 10, 2002 under the number Registration 2o I-2916.
EXAMPLE 7 Construction of a Streptomyces ambofaciehs strain interrupted in the orf8 gene To achieve inactivation of the orfb gene, a construct in which the cassette S2hyg was introduced into the coding sequence for orfg was obtained. For that, the plasmid pOS49.88 was first constructed. Plasmid pOS49.88 is derived from plasmid pUCl9 (GenBank access number M77789) by insertion of a fragment of 3.7 kb (PstI-EeoRI fragment obtained from the cosmid pSPMS), containing the end of orf7, orf $ and the start of orfp, cloned into the PstI-EcoRI sites of pUCl9. The S2hyg cassette (in the form of a BamHI fragment, made blunt end by treatment with the enzyme Klenow) has been cloned at the unique SaII site of pOS49.88 located in orf $
after that all the ends have been made blunt end by treatment with the enzyme of I ~ lenow.

The cloning being blunt, two types of plasmids were obtained according to the meaning cassette insertion: pOS49.106 in which the hyg and orf $ genes are in the same orientation and pOS49.120 in which the hyg and gold genes, f8 are in of the opposite directions. The insert of the plasmid pOS49.106 was then subcloned in the 10 plasmid pOJ260 to give pOS49.107. For this, the plasmid pOS49.106 has summer digested with the enzyme Asp718I and the ends were made blunt end by treatment at the enzyme of I ~ lenow, this digestion product was redigested by the enzyme PstI
and the 'v fragment containing the orfg gene into which the .slhyg cassette has been inserted, has been cloned. ' in the vector pOJ260 (cf. above). For this, the vector pOJ260 was digested by the 'w' :. 15, EcoRV and PstI enzymes and used for ligaixon. This manipulation so allows''' ; a ~ ~ f to obtain an oriented ligation since each of the dexes, ~ frâgnients is end franc of a '°' side and PstI on the other. The plasmid obtained was named pOS49.107.
The plasmid pOS49.107 was introduced into the strain ATCC23877 of S.
ambofacies by transformation of protoplasts (Kieser, T et al., 2000). After 20 transformation of the protoplasts, the clones are selected for their resistance to hygromycin. Clones resistant to hygromycin are then subcultured respectively on medium with hygromycin (antibiotic B) and on medium with apramycin (antibiotic A) (see Figure 9). Clones resistant to hygromycin (HygR) and sensitive to apramycin (ApraS) are in principle those where a double event of 25 crossing over has occurred that have the orfg gene interrupted by S ~ hyg cassette.
The replacement of the wild copy of gold, f ~ by the copy interrupted by the cassette S ~ hyg was verified by Southern Blot. Thus, the total DNA of the clones obtained, was digested by several enzymes, separated on agarose gel, transferred to the membrane and hybridized with a probe corresponding to the S ~ hyg cassette to check the presence of the cassette in the genomic DNA of the clones obtained. A second hybridization was carried out in using as probe the PstI-EcoRI insert containing the end of orf7, orfg and the beginning of orf ~ with a size of about 3.7 kb of the plasmid pOS49.88. Verification of genotype can be carried out by any method known to those skilled in the art and in particular through PCR using the appropriate oligonucleotides and drying of the product PCR.
An orf $ :: Sdhyg clone was chosen and named OS49.107. A sample of the strain OS49.107 has been deposited with the National Collection of Cultures of ~ ~~
Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedeac 15, France, July 10, 2002 under registration number I-2917.
EXAMPLE 8 Construction of a Streptomyces ambofaciens strain.
interrupted in the gold gene, f10 A DNA fragment, 1.5. internal kb 'at the gèrië. orfl0 was obtained by PCI ~
in 1 ri z .: r,. ". ',;' ~ _.., '..
. ~ - 15 using as matrix, the genomic DNA ~ of S afrcbàfaciens and following primers SRMR1: 5 'CTGCCAGTCCTCTCCCAGCAGTACG 3' (SEQ ID N ° 89) - SRMR2: 5 'TGAAGCTGGACGTCTCCTACGTCGG 3' (SEQ ID N ° 90) This DNA fragment from the PCR was cloned into the vector pCR2.1 marketed by the company Invitrogen (Carlsbad, California, USA). The plasmid as well got was 2o named pOS49.32. The cassette, ~ hyg (in the form of a BamHI fragment, see below above) a was cloned at the unique BstEII site internal to the fragment of the orfl0 gene, after all ends have been made blunt end by enzyme treatment from Klenow.
The cloning being blunt, two types of plasmids were obtained according to the meaning cassette insertion: pOS49.43 in which the hyg and orfl0 genes are in the 25 same orientation and pOS49.44 in which the genes hyg and orfl0 are in of the opposite directions. The insert of plasmid pOS49.43 has been transferred (under shape of a Asp718I XbaI fragment, the ends of which were made blunt by treatment at Klenow enzyme) in the EcoRV site of the plasmid pOJ260 which allowed get the plasmid pOS49.50. Plasmid pOS49.50 containing the fragment of the orfl0 gene interrupted by the S2hyg cassette was introduced into the ATCC23877 strain of Ambofacial streptomyces. After transformation, the clones; are selected for their resistance to hygromycin. Clones resistant to hygrorriycin are then transplanted respectively on medium with hygromycin (antibiotic B) and on medium with apramycin (antibiotic A) (see Figure 9). Clones resistant to hygromycin (HygR).
and sensitive to apramycin (ApraS) are in principle those where a double event of crossing over has occurred which have the orfl0 gene interrupted by the cassette S2hyg. Clones which possessed the marker for resistance to fhygromycin carried by the cassette and who had lost the fapramycin resistance marker carried speak vector pOJ260 were thus obtained. Copy replacement event wild.
of orfl0 by interrupted copy orflO :: Sdhyg has been verified by Southern Blot. So, the total genomic DNA of the obtained clones, was digested by several enzymes, separate ~ ,.
on agarose gel, transferred to the nib and then hybridized with a probe urie correspondent ~. Ia. ' S2hyg cassette to verify the presence of the cassette in genomic DNA
clones obtained. A second hybridization was carried out using as probe the product 1.5 kb PCR internal to the orfl0 gene (see above).
A clone with the expected characteristics (orfl0 ::, ~ hyg) was more particularly selected and named OS49.50. It could indeed be verified thanks to two hybridizations that the cassette, S ~ hyg was present in the genome of this clone and that we obtain the expected digestion profile in the case of a replacement, at following a double recombination event, of the wild-type gene by copying interrupted by the cassette, ~ hyg in the genome of this clone. The cheking process of genotype can also be carried out by any method known to man of the job and in particular by PCR using the appropriate oligonucleotides and sequencing of PCR product.

EXAMPLE 9 Gene Inactivation: Principle of Building a Strain of Streptomyces ambofaciehs interrupted using the "cassette" technique excisable ”(see Figure 9 and 10) s A second type of cassette can be used for the inactivation of genes:
the cassettes known as “excisable cassettes”. These cassettes have (advantage to be able to be excised in Streptomyces by a specific recombination event of site after being introduced into the genome of S. ambofaciens. The goal is to inactivate.
l0 certain genes in Streptomyces strains without leaving in the strain final of selection markers or large DNA sequences not belonging to the strain.
After excision there remains only a short sequence of approximately one thirty ~ ' base pairs (called a “scar” site) in the genome of the strain (cf. figure 10).
The implementation of this system consists, at first, in replacement is saved from the target era ": pgg (race" with two recombination events s ~:, ., 'i,; ~, i-â; ..
homologous, cf. "~ figure ~ 9 '~' by a coristr <iction in which an excisable cassette was ~: '' inserted into this target gene. The insertion of this cassette is accompanied of a deletion in the target gene (see Figure 9). Secondly, the excision of the cassette excisable genome of the strain is caused. The excisable cassette works thanks 20 to a site-specific recombination system and has the advantage of to permit obtaining mutants of Streptomyces which ultimately do not carry a gene for resistance.
We also get rid of possible polar effects on the expression of genes located in downstream of the inactivated gene (s) (c ~ Figure 10).
The use of excisable cassettes has been described and used in many agencies 25 including mammalian, yeast and E. coli cells (Bayley et al., 1992; Brunelli & Pall, 1993; Camilli et al., 1994; Dale and Ow, 1991; Russell et al., 1992; Lakso et al., 1992). These excisable cassettes all use the specific recombinase of Cre site acting on lox sites. This recombination system comes from bacteriophage P 1.

For the construction of an “excisable cassette” type system at Streptomyces, it was taken advantage of the site specific recombination system described for the element pSAM2 mobile genetics of Streptomyces ambofaciens (Boccard et al., 1989a and b). The system put in place initially consists of building a vector recombinant comprising the gene to be interrupted in which a cassette excisable. Insertion into the bible gene of the excisable cassette is accompanied by a deletion in the target gene. It can be performed by cloning using sites of restriction present in the target gene or by recombination between short sequences identical as described for example by Chaveroche et al (Chaveroche MK and al .; ~.
2000). The excisable cassette can be constructed using for example the cassette S2hyg (Blondelet Rouault et al., 1997). This cassette was bordered by attR sequences and attL which normally flank the integrated copy of pSAM2 (cf. Figure 1 S).
The attL and attR sequences contain all the sites necessary for the site recombination- "
specific for excising pSAM2 or any DNA fragment located between these two regions (Sezonov et al., 1997, Raynal et al., 1998). The construction of a such, cassette is obviously not limited to the use of a cassette, S ~ hyg, but others t '':
E. '. ~., '~ ", ~' ,. ~.. ';' .t resistance cassettes can be used as a basis for the construction of this cassettte ~~ (by ~~~;
example the S2aac or Swph cassette (Blondelet Rouault et al., 1997)).
After obtaining this construction, the Streptomyces strain is transformed 2o with the recombinant plasmid. The transformants are then selected with the antibiotic corresponding to the cassette present in the target gene (cf.
figure 9, antibiotic B, for example a selection by hygromycin if the cassette excisable drift from the cassette, S ~ hyg). We thus select a mixture of clones among which have been integrated by one or two events of recombination.
Secondly, we are looking for clones sensitive to the antibiotic to which the resistance gene is present in the vector (outside the cassette recombination) (cf. figure 9, antibiotic A). We can thus select the clones for which there have been in principle two recombination events leading to the replacement of the uncomfortable wild by the copy interrupted by the cassette. These stages are schematized figure 9, the genotype of the clones thus obtained is verified by Southern blot and a strain with the desired characteristics (replacement of the wild-type gene with the copy interrupted by the excisable cassette) is selected.
In a second step, the strain selected above, is transformed by a plasmid allowing the expression of the xis and int genes which are both necessary for the site specific recombination between attR and attL sites. This recombination s causes the excisable cassette to leave the genome of the strain, thanks to a event recombination (see Figure 10) (Raynal et al., 1998). It is interesting to choose the vector carrying the xis and int genes among the relatively unstable vectors chéz: e: v Streptomyees (for example derived from the Streptomyces pWHM3 vector, (Vara et al., . ~~ v 1989)), this makes it possible to obtain a strain having lost this latter vector after a few sporulation cycles in the absence of selection pressure.
To excise the cassette, one can for example use the plasmid pOSV508 (cf. figured; y ' 14) which is introduced by transformation of protoplasts into the strain of S
ambofaeiens ~ ï, ~;
. containing a gene interrupted by the excisable cassette. Plasmid pOSV508 is derived k ~~
WHM3 plasmid i5 k,; ; . pp (Vara J et a1., 1989) (cf. figure 13) in which were added Ifs ~ ~ ° f ', r ~ ~ xis and ~ int genes of pSAM2 (Boccard ~ F. et ~ al., 1989'b) placed under the control ~ fdû ~ a ' ptrc promoter (Amann, E. et al., 1988). The xis and int genes placed under the control of, ptrc promoter were subcloned into the plasmid pWHM3 from the plasmid pOSint3 (Raynal et al., 1998) (see Figure 14). Introduction into the strain mutant of plasmid pOSV508 carrying the xis and int genes of - pSAM2 will allow excision effective by site-specific recombination of the excisable cassette between attL sites and attR flanking this cassette (Raynal A. et al., 1998) (Figure 10). Among the transformants, selected for their resistance to thiostrepton due to the gene tsr carried by pOSV508, we choose those that have become sensitive to the antibiotic to which the presence of the cassette provides resistance (see Figure 10). Excision is effective and it was observed that more than 90% of transformants are of this type. After one or more cycles of growth and sporulation on a solid medium devoid of thiostrepton, we gets clones having lost the plasmid pOSV508. These clones are identifiable by their sensitivity at thiostrepton. Deleted target gene sequence can be verified by PCR
and sequencing of the PCR product.
Finally, the resulting strain carries at the level of the inactivated gene (deletion internal by example) a “scar” att site corresponding to the minimal attB site (Râynal et al., 1998), resulting from the recombination between the attR and attL sites. This attB site minimal which subsists is similar to that naturally present in strains of Streptomyces ambofaciens, Streptomyces pristi ~ caespiralis and Streptomyces lividans (Sezonov et al., 1997).
The gene that we want to deactivate can be cotranscribed with other genes located in lo downstream. To prevent the inactivation of one of the genes to have a polar effect on expression genes downstream in the operon, it's important to get a deletion in phase after excision of the cassette. The excisable cassette system as described below above allows to meet such a requirement. Those skilled in the art will, in fact, easily build three separate excisable cassettes, these leaving after united excision ò
sequence of 33, 34 or 35 nucleotides respectively, without stop codon which let there be ~ i reading phase. Knowing the 'sequence' of the target gene and the size of the deletion associated with the insertion of the cassette, it is possible to choose between these three cassettes excisable so that excision leads to a deletion in phase. Sure the 33, 34 or 35 nucleotides added, 26 correspond to the minimal attB sequence (cf.
figure 27).
2o In the case of the present request, two excisable cassettes have been used. These two cassettes are as follows: attlS ~ hyg + (SEQ ID N ° 91) and att3S ~ aac- (SEQ ID N °
92), these cassettes leave 33 and 35 nucleotides respectively after excision. They contain respectively the SZhyg cassette or the S2aac cassette, the + signs and -corresponding to the orientation of the resistance cassette. These two cassettes have been constructed and cloned at the EcoRV site of the vector pBC SI ~ +, the HindIII site has been previously deleted. The plasmids obtained were named pattlS2hyg +
and patt3SZaac- respectively. Excisable cassettes can be easily outputs by digestion of the plasmid with EcoRV.

EXAMPLE 10 Construction of a Streptomyces ambofaciens strain interrupted in the orfl gene The orfZ gene was inactivated using the cassette technique excisable (see above). The starting strain used is the strain Streptomyces ambofaciens OSC2 which is derived from the ATCC23877 strain. However, the OSC2 strain differs from ATCC23877 in that it has lost the genetic element mobile pSAM2 (Boccard et al., 1989a and b). This moving part can be lost from way .
spontaneous during protoplastization (action of lysozyme to digest the wall ',, bacterial and fragment the mycelium (Kieser et al., 2000)) and regeneration of 10 protoplasts of the ATCC23877 strain. To select clones with lost pSAM2 element, it was set up a screen, based on the repression of pra gene by the transcription repressor KorSA (Sezonov et al., 1995) (Sezonov G. and al., 2000).
For this, a DNA fragment containing the promoter of the pra gene placed upstream from. ~.;
aph gene (conferring resistance to kanamycin and lacking its own promote ~) ~ v ~~:
was cloned into the unstable vector WHM3H '' p yg, the latter descendant of the plasmid,.;
~,, _ a pWHM3 (Vara et al., 1989) in which the tsr gene has been replaced by the ' h ~ g t (conferring resistance to hygromycin). The plasmid thus obtained was named ' pOSV510. The strain ATCC23877 was transformed after protoplastization by the plasmid pOSV510. The Pra promoter is a promoter repressed by the repressor KorSA, the gene encoding the latter being located within the mobile element pSAM2 (Sezonov G. et al., 2000). After transformation with the plasmid pOSV510, the bacteria are selected for their resistance to kanamycin (due to aph gene worn by pOSV510). The clones having lost the integrative element pSAM2 have lost the repressor KorSA and the promoter Pra is therefore no longer repressed and allows the expression of kanamycin aph resistance gene. Selection with kanamycin after transformation with the plasmid pOSV510 therefore makes it possible to select the clones having lost the integrative element pSAM2 (and therefore KorSA) and having the plasmid pOSV510.
The plasmid pOSV510 being unstable, after a few sporulation cycles without antibiotic, isolated clones are subcultured on medium with kanamycin, on middle with hygromycin and on medium without antibiotic. Clones sensitive to kanamycin and to hygromycin lost pOSV510. The loss of the pSAM2 element has been verified through hybridization and PCR. A clone with the desired characteristics was selected and was named OSC2.
A sample of the OSC2 strain has been deposited with the Collection national ~ 5 of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur ginger 75724 Paris Cedex 15, France, on July 10, 2002 under the number I-2908.
The orf2 gene was inactivated using the cassette technique . V
excisable (see above and figure 10). For this, a 4.5 kb insert including the sequence leaves from the EcoRI site located in position 1 to the BamHI site located in position 4521 (SEQ
ID No. 1) has been subcloned at the EcoRI and BamHI sites of plasmid pUC 19 (GenBank access number M77789) from the cosmid pSPMS. The plasmid as well ~ ~
obtained was named pOS49.99.
This plasmid was. introduced into the strain. ~ eoli KS2.72 which contained already, ~ le t '~, ~
d., .Y,.
i.
'15 plasmid pKOBEG (Chaveroché et al., 2000) (see fig. 12).
In parallel, the att3 excisable cassette, Sdaac- (SEQ ID N ° 92, cf. here above) was amplified by PCR using as plasmid the plasmid pOSK1102 (The plasmid pOSK1102 is a plasmid derived from the vector pGP704Not (Chaveroche et al., 2000) (Miner VL & Mekalanos JJ, 1988) in which the att3S2aac- cassette was cloned as 2o an EcoRV fragment in the unique EcoRV site of pGP704Not) and using the primers following 5 'CCCGCGCGGCAGCCTCTCCGTGATCGAGTCCGGCGTGACCATCGCGCGCGCTTCGTTCGG-3' (SEQ
25 ID No. 93) 5 'GCTCCGTGCGTCATGCAGGAAGGTGTCGTAGTCGCGGTAGATCTGCCTCTTCGTCCCGAA-3' (SEQ
ID # 94) The 40 deoxy-nucleotides located at the 5 'end of these oligonucleotides contain a sequence corresponding to a sequence in the target gene (orfZ
in the present case) and the 20 most deoxy-nucleotides located 3 '(shown in bold above) correspond to the sequence of one end of the excisable cassette att3, i2aac- (cf.
figure 11).
The PCR product thus obtained was used to transform the strain E.
here container the plasmids pKOBEG and pOS49.99 as described (Chaveroche et al., 2000) (cf.
figure 12). So the bacteria were transformed by electroporation and selected for their resistance to fapramycin. The plasmids of the clones obtained were extracts and digested by several restriction enzymes, in order to verify that the profile of digestion obtained corresponds to the expected profile if there has been insertion of the cassette (att3S ~ aac-) in the target gene (orfl), i.e. if there has been recombination homologous between the ends of the PCR product and the target gene (Chaveroche and al.
2000). Construction verification can also be performed by any method.
known to those skilled in the art and in particular by PCR using the oligonucleotides ~, ' ' at.
and sequencing of the PCR product. A Glone. whose plasmid owns '~~ "a ~' ,, tenderized profile has been selected and the corresponding plasmid has been nominated pSPMl7. Ce ~, ~ r plasmid derived from pOS49.99 in which orfZ is interrupted by the cassette ' apramycin (see Figure 12).
2o The insertion of the cassette is accompanied by a deletion in gold, fç, between nucleotides 211 and 492 of the coding part of orfZ.
The plasmid pSPM17 was digested with the EcoRI enzyme and the ends were made blunt by treatment with the Klenow enzyme, this product of digestion was then digested with the enzyme XbaI and the insert containing the deleted orfl gene has been cloned in the vector pOSK1205 (cf. above). For this, the vector pOSK1205 was digested by the enzyme BamHI then the ends were made blunt end by treatment at Klenow enzyme, this product was then digested with the enzyme XbaI, and used for the ligation with the insert obtained from pSPMl7 as above. This handling therefore makes it possible to obtain an oriented ligation since each of the two fragments is bout frank on one side and ~ YbaI on the other. The plasmid thus obtained was named pSPM2l, it carries a gene for resistance to fhygromycin (vector part) and an insert in whichone deleted orfl gene is replaced by the att3S ~ aac- cassette.
The vector pSPM21 was introduced into the Streptomyces ambofaciens OSC2 strain.
(see above) by transformation of protoplasts (Kieser, T et al., 2000).
After transformation, the clones are selected for their resistance to fapramycin clones resistant to apramycin are then subcultured respectively on middle with apramycin (antibiotic B) and on medium with hygromycin (antibiotic A) (cf. figure 9). Clones resistant to fapramycin (ApraR) and sensitive to fhygromycin (HYGS) are in principle those where a double crossing over event has occurred and who lo have the orfl gene interrupted by the att3S2aac- cassette. These clones have been selected and replacing the wild copy of gold, f ~ with the copy interrupted by the cassette has been checked. The presence of the att3S ~ aac- cassette was verified by PCR on colony. Hybridization was also carried out. For this, the total DNA of clones obtained, was digested with several enzymes, separated on agarose gel, transferred to, membrane and hybridized with a 3 kb probe corresponding to an EcoRI- fragment I
BamHI of the insert of the plasmid pOS49.99 (cf. above). Verification of genot ~ pe,, ..
. '' ~ ~. ~ yr ~~ s', can also be carried out by means of methode known to T'hom ~ è du métiër and. '.
in particular by PCR using the appropriate oligonucleotides and sequencing of .
PCR product.
A clone with the expected characteristics has been selected and named SPM21. It was possible to verify by PCR and hybridization that the cassette att3 ~ AAC-was present in the genome of this clone and that we obtain the profile of digestion expected in the case of a replacement, following a double event of recombination of the wild-type gene by the copy interrupted by the cassette att3S ~ aac- in the genome of this clone. This clone therefore has the genotype: orf ~:: att3s2aac-.
A sample of the strain SPM21 has been deposited with the Collection national of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur ginger 75724 Paris Cedex 15, France, on July 10, 2002 under the number I-2914.

The strain SPM21 was transformed by the vector pOSV508 by transformation of protoplasts to cause excision of the cassette (see Figure 14). The plasmid pOSV508 is derived from the plasmid pWHM3 (Vara J et a1., 1989) (cf. FIG. 13) in to which the xis and int genes of pSAM2 have been added (Boccard F. et al., 1989b) placed under control of the ptrc promoter (Amann, E. et al., 1988) (cf. FIG. 14).
The introduction in the strain SPM21 of the plasmid pOSV508 carrying the xis and int genes of pSAM2 allows efficient excision by site-specific recombination of the cassette excisable between the attL and attR sites flanking this cassette (Raynal A. et al., 1998) (figure 10).
u Among the transformants selected for their resistance to thiostrepton due to the tsr gene carried by pOSV508, we choose those that have become sensitive to apramycin, the gene resistance is carried by the att3Slaac- cassette, excision results in effect the loss of this resistance gene (see Figure 10). The plasmid pOSV508 is unstable and after of them successive passages on medium without antibiotic isolated clones are transplanted on-rw medium with thiostrepton and on medium without thiostrepton. Sensitive clones at. ~~, r, thiostrepton have lost pOSV508. It has been verified that the excision of the cassette ends well ~ ~ r, to a deletion in phase in the gold gene, f ~ by PCR and sequencing of the product ~ PCR, ~ 'rv . ... ~, Gy °
excision of the cassette indeed leaves a 'scarring' sequence att3 feature '. '~' (which is similar to the original attB site after recombination between the sites attL and attR) 5 'ATCGCGCGCGCTTCGTTCGGGACGAAGAGGTAGAT 3' (SEQ ID N ° 95).
The strain thus obtained and having the desired genotype (orfZ:: att3) was named SPM22.
A sample of the strain SPM22 has been deposited with the Collection national of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur ginger 75724 Paris Cedex 15, France, on July 10, 2002 under the number I-2915.

EXAMPLE 11 Construction of a Streptomyces ambofaciens strain interrupted in the orfl2 gene For the inactivation of orfl2, orfl3c and orfl4 the same starting plasmid (pSPM504) was used to introduce a cassette at different positions Of type s "excisable cassette". This plasmid has a 15.1 kb insert which corresponds to the J
region from orf7 to orfl7. To construct this plasmid a ~ BgIII fragment of 15.1 kb from the digestion of the cosmid pSPM7 (see above) was cloned into the plasmid pMBL18 (Nakano et al., 1995) digested with BamHI. BamHI and BgIII ends being compatible, plasmid pSPM502 is obtained after ligation. All of the insert of pSPM502 was then subcloned (as a HindIIIlNhel fragment) into the plasmid pOSK1205 (digested with HindIIIlNheI) which made it possible to obtain the plasmid pSPM504.
This plasmid was introduced into the E. coli KS272 strain which already contained the plasmid pKOBEG (Chaveroche et al., 2000) (cf. FIG. 12).
.
,.:. ..,.
In parallel, there ~ excisable cassette ütt3d2aac- â was amplified by PCR in use there as matrix the plasmid pOSK1102 (the plasmid pOSK1102 is a plasmid derivative of the vector pGP704Not (Chaveroche et al., 2000) (Miner VL & Mekalanos JJ, 1988) in which the att3S2aac- cassette was cloned as an EcoRV fragment in the site unique EcoRV of pGP704Not), the primers used are as follows EDR8: 5 'CGGGATGATCGCTTGTCCGGCGGCCGGATGCCTAGCCTCATCGCGCGCGCTTCGTTCGG 3' (SEQ ID N ° 96) EDR9: 5 'CCCGATCCAGAACGTCTGGTCGGTGATCAGGTCGCTGTTCATCTGCCTCTTCGTCCCGAA 3' (SEQ ID N ° 97) The 40 (only 39 for EDRB) deoxy-nucleotides located at the 5 'end of these oligonucleotides have a sequence corresponding to a sequence in the uncomfortable target (orfl2 in this case) and the 20 most deoxy-nucleotides in 3 '(shown in above) correspond to the sequence of one end of the excisable cassette att3S2aac- (see Figure 11).
The PCR product thus obtained was used to transform the strain E.
coli s KS272 containing the plasmids pKOBEG and pSPM504 (cf. above), as described by Chaveroche et al. (Chaveroché et al., 2000) (see Figure 12 for the principle, the plasmid pOS49.99 must be replaced by the plasmid pSPM504 and the plasmid obtained is not anymore pSPMl7 but pSPM507). So the bacteria were transformed by electroporation by this PCR product and the clones were selected for their resistance at lo fapramycin. The plasmids of the clones obtained were extracted and digested by many restriction enzymes, in order to verify that the digestion profile got corresponds to the expected profile if the cassette has been inserted (att3S2aac-) in the gene target (orfl2), i.e. if there is indeed, homologous recombination between the extremities of the PCR product and the target gene (Chaveroche et al., 2000). The verification of the ~.
Construction can also be carried out by any known method of the man of profession and notatnméüt gar PCR in. use the appropriate oligonucleotides and sequencing r ..,. tr of the PCR product: A clone whose plasmid has the expected profile has been selected r ~~ ' and the corresponding plasmid was named pSPM507. This plasmid is derived from pSPM504 in which orfl2 is interrupted by the att3S2aac- cassette (see Figure 12).
The insertion of 20 the cassette is accompanied by a deletion in the orfl2 gene, the interruption starts at level of the thirtieth codon of orfl2. The last 46 remain after the cassette codons of orfl2.
The vector pSPM507 was introduced into the Streptomyces ambofaciens strain (see above) by transformation of protoplasts (Kieser, T et al., 2000).
After 25 transformation, the clones are selected for their resistance to apramycin. The clones resistant to apramycin are then subcultured respectively on middle with apramycin (antibiotic B) and on medium with hygromycin (antibiotic A) (cf. figure 9). Clones resistant to fapramycin (ApraR) and sensitive to fhygromycin (HYGS) are in principle those where a double crossing over event has occurred and who 30 have the orfl2 gene interrupted by the att3S ~ aac- cassette. These clones were more particularly selected and replacing the wild copy of orfl2 over there copy interrupted by the cassette was verified by hybridization. So DNA
total clones obtained, was digested with several enzymes, separated on agarose gel, transferred on membrane and hybridized with a probe corresponding to the att3 cassette, SZaac-for verify the presence of the cassette in the genomic DNA of the clones obtained.
A
second hybridization was carried out using a fragment as probe DNA
obtained by PCR and corresponding to a very large part of the coding sequence of the gene orfl2.
Genotype verification can also be performed by any method known to ò
those skilled in the art and in particular by PCR using the oligonucleotides appropriate and sequencing of the PCR product.
A clone with the expected characteristics (orfl2 :: att3, S ~ aac-) was more particularly selected and named SPM507. It could indeed be verified thanks to two hybridizations that the att3S2aac- cassette was indeed present in the genome of ce .v ~
clone and that we obtain the expected digestion profile in the case of a ~ '.: ~
r replacement, following a double event of recombination, of the gene wild not 'fi t .. e the copy interrupted by the att3Sdaac- cassette in the genome of this clone. This cloned ~ ' therefore has the genotype: orfl ~:: att3, s2aac- and was named SPM507. It is useless to excise the cassette to study the effect of inactivation from orfl2, to seen from the orientation of the genes (cf. figure 3). Indeed, the fact that orfl3c either oriented in opposite direction to orfl2 shows that these genes are not co-transcribed.
The use of a excisable cassette, however, allows you to get rid of selection marker at any time, in particular by transformation by the plasmid pOSV508. A sample of the strain SPM507 has been deposited with the Collection Nationale de Cultures de Microorganismes (CNCM) Institut Pasteur, 25, rue du Doctor Roux 75724 Paris Cedex 15, France, on July 10, 2002 under the number Registration I-2911.

EXAMPLE 12 Construction of a Streptomyces ambofaciens strain interrupted in the orfl3c gene The att3S ~ aac- excisable cassette was amplified by PCR using as matrix the plasmid pOSK1102 (cf. above) using the following primers EDR3: 5 'ACCGGGGCGGTCCTCCCCTCCGGGGCGTCACGGCCGCGGAATCTGCCTCTTCGTCCCGAA 3' (SEQ ID N ° 98) EDR4: 5 'CACGCAGCGAGCCGACGCACTGATGGACGACACGATGGCCATCGCGCGCGCTTCGTTCGG 3' (SEQ ID N ° 99) The 40 deoxy-nucleotides located at (5 'end of these oligonucleotides behave a sequence corresponding to a sequence in the target gene (orfl3c in the case present) and the 20 deoxy-nucleotides furthest 3 '(shown in bold here-above) ~ '' w correspond to the sequence of one end of the excisable cassette att3S ~ aac- (see;
is figure 11).
The PCR product thus obtained was used to transform the strain E.
éoli; â} i KS272 containing the plasmids pKOBEG and pSPM504 (cf. above), as described by i ~~
Chaveroche et al. (Chaveroche et al., 2000) (see Figure 12 for the principle, the plasmid pOS49.99 must be replaced by the plasmid pSPM504 and the plasmid obtained is not anymore pSPMl7 but pSPM508). So the bacteria were transformed by electroporation by the PCR product and the clones were selected for their resistance at fapramycine. The plasmids of the clones obtained were extracted and digested by many restriction enzymes, in order to verify that the digestion profile got corresponds to the expected profile if the cassette has been inserted (att3S ~ aac-) in the gene target (orfl3c), i.e. if there was indeed homologous recombination between the extremities of the PCR product and the target gene (Chaveroche et al., 2000). The verification of the construction can also be carried out by any method known to man of profession and in particular by PCR using the appropriate oligonucleotides and sequencing of the PCR product. A clone whose plasmid has the expected profile was selected and the corresponding plasmid was named pSPM508. This plasmid is derived from pSPM504 in which orfl3c is interrupted by the apramycin cassette (cf. FIG. 12).
insertion of the cassette is accompanied by a deletion in the orfl3c gene, the interruption start at the level of the sixth codon of orfl3c. After the cassette, the 3 last codons of orfl3c.
The vector pSPM508 was introduced into the Streptomyces ambofacie ~ s strain.
OSC2 (see above) by transformation of protoplasts (Kieser, T et al., 2000). After transformation, the clones are selected for their resistance to fapramycine. The clones resistant to apramycin are then subcultured respectively on middle with apramycin (antibiotic B) and on medium with hygromyciria (antibiotic A) (cf. figure v.
9). Clones resistant to fapramycin (ApraR) and sensitive to fhygromycin (HYGS) are in principle those where a double crossing over event has occurred and who have the orfl3c gene interrupted by the att3S2aac- cassette. These clones have been over, specially selected and replacing the wild copy of orfl3c over there copy interrupted by the cassette was verified by hybridization. So DNA
total clones obtained, was digested with several enzymes, separated on agarose gel, transferred;.:,:,;:
on membrane and hybridized with a probe corresponding to the att3Saaac- cassette roast ~ 1 ' ti!. 't,. ,. ' '' check the presence of the cassette in the genomic DNA of the clones obtained.
Uné ~ ' second hybridization was carried out using a product of PCR
corresponding to a sequence spanning over a hundred base pairs in upstream and in downstream of the coding sequence for orfl3c. Genotype verification can also be carried out by any method known to a person skilled in the art and in particular by PCR in using the appropriate oligonucleotides and sequencing the PCR product.
A clone with the expected characteristics (orfl3c:: att3. ~ Aac-) has been over particularly selected and named SPM508. It could indeed be verified thanks to two hybridizations that the att3, S2aac- cassette was indeed present in the genome of this clone and that we obtain the expected digestion profile in the case of a replacement, following a double recombination event, of the gene wild by the copy interrupted by the att3S ~ aac- cassette in the genome of this clone. This clone therefore has the genotype: orfl3c :: att3S2aac- and has been named SPM508. It is useless to excise the cassette to study the effect of inactivation from orfl3c, to seen from the orientation of the genes (cf. figure 3), the fact that orfl4 is oriented in opposite direction to orfl3c shows that these genes are not co-transcribed. The use of a cassette excisable, on the other hand, allows you to get rid of the marker of selection at any time. A sample of the strain SPM508 has been deposited near National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, July 10, 2002 under the number I-2912.
EXAMPLE 13 Construction of a Streptomyces ambofaciens strain interrupted in the orfl4 gene The att3S2aac- excisable cassette was amplified by PCR using as ~
~~
matrix the plasmid pOSKl 102 (cf. above) using the following primers ,. :;,, ., ~,, 'P ~'. EDR5: 5 ' GGGCGTGAAGCGGGCGÄGTGTGGATGTCATGCGAGTACTCATCt ~ C (iCGCQCTTCGTTC (~ 3 ', ~~
(SEQ ID N ° 100) EDR6: 5'CGGGAAACGGCGTCGCACTCCTCGGGGGCCGCGTCAGCCCATCTGCCTCTTCGTCCCGAA 3 ' (SEQ ID N ° 101) The 40 deoxy-nucleotides located at the 5 ′ end of these oligonucleotides behave 2o a sequence corresponding to a sequence in the target gene (orfl4 in the case present) and the 20 deoxy-nucleotides furthest 3 '(shown in bold here-above) correspond to the sequence of one end of the excisable cassette att3, ~ aac- (ef.
figure 11).
The PCR product thus obtained was used to transform the strain E.
coli KS272 containing the plasmids pKOBEG and pSPM504 (cf. above), as described through Chaveroche et al. (Chaveroche et al., 2000) (see Figure 12 for the principle, the plasmid pOS49.99 must be replaced by the plasmid pSPM504 and the plasmid obtained is not anymore pSPMl7 but pSPM509). So the bacteria were transformed by electroporation by the PCR product and the clones were selected for their resistance at fapramycine. The plasmids of the clones obtained were extracted and digested by many restriction enzymes, in order to verify that the digestion profile got corresponds to the expected profile if the cassette has been inserted (att3S2aac-) in the gene target (orfl ~, ie if there was indeed homologous recombination between the extremities .
of the PCR product and the target gene (Chaveroche et al., 2000). The verification of the ~ '~
construction can also be carried out by any known method of the man of profession and in particular by PCR using the appropriate oligonucleotides and sequencing of the PCR product. A clone whose plasmid has the expected profile was selected, and the corresponding plasmid was named pSPM509. This plasmid is derived from pSPM504 '_ . in which orfl4 is interrupted by the apramycin cassette (cf. FIG. 12).
The insertion of ..
the cassette is accompanied by a deletion in the orfl4 gene, the interruption starts at ~ .F .a- ~
level of the fourth codon of ôrfl4. There remains after the cassette the last codon of orfl4 '~ -'. '. ; . . ; . â ~ xn ~.
The vector pSPM509 was introduced into the strain Streptomyces ambofaciehs' ~
~. ~
OSC2 (see above) by transformation of protoplasts (I ~ ieser, T et al., 2000). After transformation, the clones are selected for their resistance to fapramycine. The clones resistant to apramycin are then subcultured respectively on middle with apramycin (antibiotic B) and on medium with hygromycin (antibiotic A) (cf. figure 9). Clones resistant to fapramycin (ApraR) and sensitive to fhygromycin (HYGS) are in principle those where a double crossing over event has occurred and who have the orfl4 gene interrupted by the att3S2aac- cassette. These clones have been over specially selected and replacing the wild copy of orfl4 over there copy interrupted by the cassette was verified by hybridization. So DNA
total clones obtained, was digested with several enzymes, separated on agarose gel, transferred on membrane and hybridized with a probe corresponding to the att3S2aac- cassette for verify the presence of the cassette in the genomic DNA of the clones obtained.
A
3o second hybridization was carried out using a product of PCR

corresponding to a sequence spanning over a hundred base pairs in upstream and in downstream of the coding sequence for orfl4. Genotype verification can also be carried out by any method known to a person skilled in the art and in particular by PCR in using the appropriate oligonucleotides and sequencing the PCR product.
A clone with the expected characteristics (orfl4:: att3S2aac-) was more particularly selected and named SPM509. It could indeed be verified thanks to two hybridizations that the att3S ~ aac- cassette was indeed present in the genome of this.
clone and that we obtain the expected digestion profile in the case of a replacement, following a double recombination event, of the gene wild by the copy interrupted by the att3S ~ aac- cassette in the genome of this clone. This clone therefore has the genotype: orfl4:: att3S2aac- and was named SPM509. It is useless to excise the cassette to study the effect of inactivation from orfl4, to seen from the orientation of the genes (cf. figure 3), the fact that orfl5c is oriented in opposite direction ~ ~.
at orfl4 shows that these genes are not co-transcribed. The use of a cassette excisable, on the other hand, allows you to get rid of the die marker ~: ~ -; v ï, f7% ~.
selection at any time. A sample of the pouch SPM509 has been deposited near National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue. 1 du Docteur Roux 75724 Paris Cedex 15, France, July 10, 2002 under the number I-2913.
EXAMPLE 14 Construction of a Streptomyces a ~ nbofaciens strain interrupted in the orf6 * gene The orf6 * gene was inactivated using the cassette technique excisable (see above and figure 10). For this, the cosmid pSPM7 has been used as template to amplify a fragment of the orf6 * gene using oligonucleotides following 09583: 5 'CTGCAGGTGCTCCAGCGCGTCGATCT 3' (oligo sense) (SEQ ID N ° 102) C9584. 5 'CTGCAGACGGAGGCGGACCTGCGGCT 3' (oligo antisense) (SEQ ID
No.
103) The 20 deoxy-nucleotides located at the 3 'end of these oligonucleotides correspond to a sequence located in the coding part of the orf6 * gene (SEQ
ID No 13) and the 6 deoxy-nucleotides located most in S 'correspond to the site sequence d PstI allowing to facilitate cloning thereafter. The DNA fragment amplified makes a size of about 1.11 kb. This PCR product is cloned into the vector pGEM-T
Easy (marketed by the company Promega (Madison, Wisconcin, USA)) which has allowed to obtain the plasmid named pBXL1111 (cf. FIG. 16).
10 The attl.f2hyg + excisable cassette was then introduced into the sequence coding of the orf6 * gene. For this, the plasmid pBXLllll was digested by the enzymes of restriction SmaI and Asp718I and the digestion product was treated with the enzyme of;
Klenow. This manipulation allows for an internal deletion of 120 bp in the coding sequence for the orf6 * gene (see Figure 15). In addition, on both sides ~~ sites.
restrictions, there remain 511 bp and 485 bp respectively, of the sequence of orf6 * =, qlu ~ ..,. .. ... ', ~ ~'",, ~ ~; a will allow approved recombination for the inactivation of the orf6 * gene. The casset ' excisable attl S2hyg + was prepared from the plasmid pattl S2hyg + (see below above) by digestion of this plasmid with EcoRV. The latter was then subcloned in the vector pBXLllll previously prepared as described above (SmaI digestion and Asp718I then treatment with the Klenow enzyme). The plasmid obtained was named pBXLl 112 (see Figure 17). In this construction, the orf6 * gene has a deletion of 120bp and is interrupted by the attl S2hyg + cassette.
The plasmid pBXL1112 was then digested with the enzyme PstI (site bordering the cassette since present in PCR oligonucleotides) and the PstI insert of 3.7 kb including a part of orf6 * interrupted by the attl.s2hyg + a cassette then been cloned at the PstI site of the plasmid pOJ260 (cf. above). The plasmid as well got was named pBXLl 113.

The vector pBXL1113 was introduced into the Streptomyces ambofaciens strain OSC2 (see above) by transformation of protoplasts (Kieser, T et al., 2000). After transformation, the clones are selected for their resistance to hygromycin. The clones resistant to fhygromycin are then subcultured respectively on middle with hygromycin (antibiotic B) and on medium with apramycin (antibiotic A) (cf. figure 9). Clones resistant to fhygromycin (HygR) and sensitive to fapramycin (After) are in principle those where a double crossing over event has occurred and who have the orf6 * gene interrupted by the attls2hyg + cassette. These clones have been over particularly selected and the replacement of the wild copy of orf6 *
over there:
copy interrupted by the cassette was verified by the Southern technique blot. So, the total DNA of the clones obtained was digested with several enzymes, separated on gel of agarose, transferred to the membrane and hybridized with a probe corresponding to the hyg gene (obtained by PCR) to verify the presence of the cassette in genomic DNA
of the clones obtained. A second hybridization was carried out using as probe 1s the PstI-PstI insert containing the orf6 * gene, about 1.1 kb in size and got from .. ' ~ ': r ~ tr' ~ ..: I
of the plasmid pBXLl111 (cf. above and fgu ~ e 16). Genotype verification can 4; ~, also êtrerealized by any known method dë ~ I'hômme of the trade and especially ' by PCR using the appropriate oligonucleotides and product sequencing of PCR.
A clone with the expected characteristics (orf6 *:: attl S2hyg +) has been over 2o particularly selected and named SPMSO1. It could indeed be verified thanks to .
two hybridizations that the attl S2hyg + cassette was indeed present in the genome of this clone and that we obtain the expected digestion profile in the case of a replacement, following a double recombination event, of the gene wild by the copy interrupted by the attl S2hyg + cassette in the genome of this clone.
This clone 25 therefore has the genotype: orf6 *:: attl S2hyg + and was named SPM501. A
sample of the strain SPM501 has been deposited with the National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, July 10, 2002 under registration number I-2909.

The strain SPM501 was transformed by the vector pOSV508 by transformation protoplasts to cause excision of the cassette (see Figure 14). The plasmid pOSV508 is derived from the plasmid pWHM3 (Vara J et a1., 1989) (cf. FIG. 13) in which the xis and int genes of pSAM2 (Boccard F. et al., 1989b) placed under the control of the ptrc promoter (Amann, E. et al., 1988) were added (cf. FIG. 14).
The introduction in the strain SPM501 of the plasmid pOSV508 carrying the xis and int genes of pSAM2 allows (efficient excision by specific site recombination of the cassette excisable between the attL and attR sites flanking this cassette (Raynal A. et al., 1998) (figure 10).
Among the transformants, selected for their resistance to thiostrepton due to the tsr gene l0 carried by pOSV508, we choose those that have become sensitive to hygromycin, the gene for resistance is carried by the attl ~ 2hyg + cassette, excision results in effect the loss of this resistance gene (see Figure 10). The plasmid pOSV508 is unstable and after of them .
successive passages on medium without antibiotic isolated clones are transplanted on medium with thiostrepton and on medium without thiostrepton. Sensitive clones at thiostrepton have lost pOSV508. It has been verified that the excision of the cassette got it right.
place in phase in the orf6 * gene by PCR and, sequencing of the PCR product.
The interruption ';
. . , s ~ 2r. ' . ': ~ ~ starts ati 158' ~ "'e côdon, 40 cds are deleted (120p1i) et excision of the cassette ' leaves a characteristic "scar" attl sequence of 33bp: 5 ' ATCGCGCGCTTCGTTCGGGACGAAGAGGTAGAT 3 '(SEQ ID N ° 104).
The strain thus obtained and having the desired genotype (orf6 * :: attl) was named SPM502.
A sample of the strain SPM502 has been deposited with the Collection National of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux Paris Cedex 15, France, July 10, 2002 under registration number I-2910.

EXAMPLE 15 Analysis of Strains of Streptomyces ambofaciens Interrupted in the orf ~, orf3, orf8, orfl0, orfl2, orfl3c, orfl4, orf6 * genes To test the production of spiramycin of the various strains obtained, a test microbiological based on the sensitivity of a strain of Micrococcus luteus a been put point (cf. (Gourmelen A. et al.,; 1998)). Micrococcus luteus strain used is a strain derived from strain DSM1790 naturally sensitive to spiramycin (this strain is available in particular from the German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, ';
DSMZ), (Braunschweig, Germany), under number DSM1790), the strain used i0 in this test differs from strain DSM1790 in that it is resistant to congocidine. This strain is a spontaneous mutant obtained by selection on middle containing increasing doses of congocidine. One such strain has been selected from Streptomyces ambofaciens produces both spiramycin and the. ~ :: ' ....
congocidine. The goal is to measure the production of spiramycin of the various souches'y ~ v:
obtained through a microbiological test based on the sensitivity of a strain ~. of ~
.. ..:. ..
-. Micrococcûs- luteus ~ ~ it is necessary to dispose of a strain resistant to '' ~ la '~~
congocidine.
The different strains of Streptomyces to be tested were cultivated in 500 ml baffled erlenmeyer flasks containing 70 ml of MPS environment (Pernodet et al., 1993). The baffled Erlenmeyer flasks were inoculated at a concentration initial of 2.5 106 spores / ml of the different strains of S. ambofaciens and updates push at 27 ° C with orbital shaking at 250 rpm. Samples of 2 ml of suspensions were made after 48, 72 and 96 hours of culture and centrifuged. The different supernatants were then frozen at -20 ° C. A dilution to the tenth of these supernatants in sterile culture medium is used for the test (cf.
figure 18).
The indicator strain of Micrococcus luteus resistant to congocidine but sensitive to spiramycin was cultured in 2TY medium (Sambrook et al., 1989) containing congocidine at 5 ~, g / ml for 48 h at 37 ° C. The density optical (DO) of the culture is measured and this culture is diluted so as to adjust the optical density at 4.
0.4 ml of this preculture is diluted in 40 ml of DAMS medium (Difco Antibiotic Medium 5, marketed by the company Difco), previously brought to a temperature about 45 ° C. This medium is then poured into a square box of 12x12 cm and left to stand at room temperature.
Once the medium has cooled and solidified, Whatman AA paper discs (Cf.
Gourmelen A. et al., 1998) of 12 mm in diameter were soaked with 70 ~, l of dilution to the tenth of each supernatant and deposited on the surface of the dish. of the discs soaked in a solution of spiramycin of different concentrations (2-4-8 wg / ml in 10 of MPS culture medium) are used as a standard range. The boxes are left to 4 ° C for 2 h so as to allow the diffusion of antibiotics in fagar then are incubated at 37 ° C for 24 to 48 hours.
If the disc contains spiramycin, it diffuses into the agar and inhibits 1 ~ P
growth of the indicator strain of Micrococcus luteus. This inhibition create a "Halo" around the disc, this halo reflecting the ztine where the strain Microcoecus lutezïs, .. ,,. Y,. . _. ~. ~ ',.,. . "~ ',',.. ~. ' v '"..' ~~ .. '_, ~ ~' .: .v - ,. "~, ° 'n ".. 1.' ~ e. ~
did not grow. The pi ~ esericë of cë ~ halo is therefore 'an indication of the presence of spiramycin and helps determine if the strain of S ambofaciens corresponding to disc in question is producing or not producing spiramycin. A
comparison with the inhibition diameters obtained for the standard range makes it possible to obtain a indication of the quantity of spiramycin produced by this strain.
The different strains described in the previous examples were used in this test to detect their production of spiramycin. The results obtained were grouped in Table 38.

Table 38 Gene strain inactive Example in Phenotype which the Producer (+) strain is where described as non-producer (-) of spiramycin e ATCC23 $ 77 None 1 (+) OS49.16 orf3; :, ~ hyg 2 (-) OS49.67 orf3dltion in phase 6 (-) OS49.107 or, f ~; : .f2hyg 7 (-) OS49.50 orfl0 :: Slhyg ~ 8 - (-) OSC2 None 10 (+) .rz;

at:, have ; ,. . ','. . , 'y ~ w''''. : '. . , i ..
SPM21 orfZ:: att3s2aac- 10 (-) .

SPM22 orf2:: att3 dltion 10 (-) phase SPM501 orf6 *:: attl S2hyg + 14 (-) SPM502 orf6 *:: attl dltion 14 (+) phase SPM507 orfl2:: att3S2aac- 11 (-) SPM508 orfl3c:: att3.S2aac-12 (+) SPM509 orfl4:: att3.f ~ aac- 13 (-) These results allow a number of conclusions to be drawn regarding concerns the function of the different genes involved in the biosynthesis of spiramycin. Thus the orf3 gene is essential for the biosynthesis of spiramycin. Indeed phase inactivation in this gene leads to a strain (OS49.67, (cf.
example 6)) no longer producing spiramycin. Phase inactivation eliminates the assumption of a possible influence of the cassette introduced on the expression of genes located in downstream of orf3.
Likewise; the orf $ and orfl0 genes encode proteins essential for biosynthesis of spiramycin since the strains OS49.107 and OS49.50 have a phenotype nori.
producer. In addition, in these last two strains, it's good inactivation of the r 'gene correspondent who is responsible for this non-producing phenotype, since in view of l0 the orientation of the different orfs (cf. figure 3), the construction introduced cannot have polar effect.
The study of strains with an excisable cassette also makes it possible to draw a number of conclusion regarding gene function interrupted. The '~ strain SPM507 has the genotype: orfl2:: att3Slaac-. There is no point in to proceed to ë
excision of the cassette for ~ the study of the effect of inactivation of orfl2, in view of w the orientation of the genes (cf. FIG. 3). The fact that orfl3c is oriented in opposite direction to orfl2 shows that these genes are not co-transcribed. The use of a cassette excisable, on the other hand, allows you to get rid of the marker of selection at any time. The phenotype of the strain SPM507 is non-producer, we can therefore conclude that the orfl2 gene is a gene essential for biosynthesis of the spiramycin in S. ambofaciens.
The strain SPM508 has the genotype: orfl3c:: att3S2aac-. There is no point in excise the cassette to study the effect of inactivation from orfl3c, to seen from the orientation of the genes (cf. figure 3). The fact that orfl4 is oriented in the opposite way at orfl3c shows that these genes are not co-transcribed. The use of a cassette excisable, on the other hand, makes it possible to get rid of the marker of selection at any time. The phenotype of the strain SPM508 is productive, we can therefore conclude that the orfl3c gene is not a gene essential for biosynthesis of spiramycin in S. ambofaciens.
The strain SPM509 has the genotype: orfl4:: att3 ~ laac-. There is no point in excise the cassette to study the effect of inactivation from orfl4, to seen from the orientation of the genes (cf. figure 3), the fact that orfl5c is oriented in the opposite way at orfl4 shows that these genes are not co-transcribed. The use of a cassette excisable, on the other hand, allows you to get rid of the marker of selection at any time. The phenotype of the strain SPM509 is non-producer, we can therefore conclude that the orfl4 gene is a gene essential for biosynthesis of the l0 spiramycin in S. ambofaciens.
The SPM21 strain has the genotype: gold, f ~:: att382aac-. The phenotype of this strain is not a producer of spiramycins. However, the orientation of genes orfl to orfg (cf. figure 3) suggests that these genes are cotranscribed. Also, the phenotype.
observed may be due to a polar effect of the cassette introduced into orfl on the expression ïv: ~:
, it 1 ~ 15 of genes located downstream in the body. The SPM22 strain has the orfl ~ genotype: âtt3 s; ~ ' .. ,, _,. . ,,., ..
and was obtained after. excision in phase of the inserted cassette.
Excision from cassette leaves only a characteristic “scar” sequence (cf.
example 10).
The SPM22 strain also being of non-producing phenotype, we can conclude that the orf ~ gene is an essential gene for the biosynthesis of spiramycin in S.
20 ambofaciens. We observe here only the effect due to the inactivation of orf ~.
The strain SPM501 has the genotype: orf6 *:: attl S2hygl-. The phenotype of this strain is not a producer of spiramycins. However, the orf5 * and orf6 *
(see Figure 3) having the same orientation, the phenotype observed may be due to an effect polar of the cassette introduced in orf6 * on the expression of orf5 *. The provision of 25 these genes suggest that they may be cotranscribed. To answer to this question, the strain SPM502 was obtained after excision in phase of the cassette introduced.
In this strain, we only observe the effect of inactivation of orf6 *. This strain has the orf6 * :: attl genotype (see example 14). The excision of the cassette leash only a “scar” phase sequence (see example 14). Strain has a producer phenotype (this strain, however, only produces spiramycin I (cf. *. example 16)). We can therefore conclude that the orf5 * gene is a gene essential for the biosynthesis of spiramycin in S. ambofaciens, since its indirect inactivation in strain SPM501 leads to a non-phenotype producer.
On the other hand ; the orf6 * gene is not a gene essential for the biosynthesis of spiramycin I
in S. ambofaciens (on the other hand it is essential for the production of spiramycin II and III
(cf. example 16)).
EXAMPLE 16. Determination of the production of spiramycins I, II and III in the mutant strains obtained The different strains. to be tested were each grown in 7 erlensmeyers ,, at '<baffles of S00 ml cost ~. at the same time 70 'ml of medium MPS ~ (Pernodet et al., 1993). Les er1 'e ~''Z~' ~ f . ~ é. .,: ,, ..
were inoculated with 2.5 106 spores / ml of the different strains of S.
ambofaciens ~ ét ~ w pushed at 27 ° C with orbital shaking at 250 rpm for 72 hours. The cultures corresponding to the same clone are collected, possibly filtered sure pleated filter, and centrifuged 15 min at 7000 rpm. The different supernatants then been stored at -30 ° C.
2o The assays were carried out by High Liquid Chromatography Performance (HPLC) by ion pairing. HPLC analysis of the culture medium makes it possible to precisely determine the concentration of the three forms of spiramycin. The column used (Macherey-Nagel) is filled with a Nucleosil silica phase octyl grafted.
The particle size is 5 ~ .m and the pore size 100. The internal diameter of the column is 4.6mm and its length 25cm. The mobile phase is a mixture of buffer H3PO4 (pH2.2) and acetonitrile 70/30 (v / v) containing 6.25 g / L of perchlorate of NaC104. The analysis is performed in an isocratic regime with a flow rate set to 1 ml / min. The column is thermoregulated at 23 ° C. Detection is ensured by UV spectrophotometry at 238nm. The sample is refrigerated at + 10 ° C and the quantification is determined from of the peak area (by external calibration). Under these conditions, the times of retention spiramycin I, II and III are approximately 17, respectively; 21 and 30 minutes like it could be verified thanks to a commercial sample comprising the three forms of spiramycin.
The OSC2 strain has a spiramycin-producing phenotype. It's here parental strain used to obtain strains with a cassette excisable ~.
(cf. example 15). This strain was therefore used as a positive control for production 10 of the three forms of spiramycin. This strain produces all three forms of spiramycins as verified by HPLC (see Figure 19).
The study of strains with an excisable cassette makes it possible to derive a certain :' number of conclusions regarding the function of interrupted genes. The stumped .v SPM507 has the genotype: orfl2:: att3S2aaë-. The phenotype of the strain is nonproductive (cf. example 15), ori, can therefore eri conclude that the gene orfl2 is an f ,.
essential gene for the biosynthesis of spiramycin chéz S. ambofaciens. This strain laughs produces more spiramycins as verified by HPLC (see Figure 22).
This result confirms the essential character of the orfl2 gene in the biosynthesis of spiramycin.
The strain SPM508 has the genotype: orfl3c:: att3S,? Aac-. The phenotype of the 2o strain SPM508 is producer of spiramycin (cf. example 15), one can therefore in conclude that the orfl3c gene is not a gene essential for the biosynthesis of spiramycin in S. ambofaciens. This strain produces spiramycin I, II
and III
as verified by HPLC (see Figure 23). This result confirms that the orfl3c gene is not a gene essential for the biosynthesis of spiramycins I, II and III
ches S.
ambofacie ~ zs.
The strain SPM509 has the genotype: orfl4:: att3. ~ 2aac-. The phenotype of the strain SPM509 is non-producer, we can therefore conclude that the orfl4 gene is a gene essential for the biosynthesis of spiramycin in S. ambofaciens. This strain no produces more spiramycins as verified by HPLC (see Figure 24).
This result confirms the essentiality of the orfl4 gene in the biosynthesis of spiramycin.
The SPMSO1 strain has the genotype: orf6 *:: attl.l2hyg +. The phenotype of this strain is not a producer of spiramycins. This strain no longer produces of spiramycins as has been verified by HPLC (cf. FIG. 20). However, the ' Genoa orf5 * and orf6 * (see Figure 3) having the same orientation, the phenotype observed may be due to a polar effect of the cassette introduced in orf6 * on the expression of orf5 * in operon. This suggests that these genes are cotranscribed. To answer to this lo question, the strain SPM502 was obtained by excision of the cassette introduced producing a phase deletion in the or6 * gene and restoring expression from orf5 *.
This strain has the genotype orf6 *:: attl (cf. examples 14 and 15).
The excision of the.
cassette leaves only a “scar” att sequence in phase (cf.
example 14). The v strain SPM502 has a spiramycin-producing phenotype. However, as he .
has been proven by HPLC, this strain only produces spiramycin I and does not not product ., of spiranycin Ii and III (cf. ~ figure 21) .. ~ 'Ori can therefore conquer these results that the gene ~ ' orf5 * is a gene essential for the biosynthesis of spiramycin in S
ambofaciens, since its indirect inactivation in the strain SPM501 leads to a phenotype no producer of spiramycin (cf. FIG. 20). On the other hand ; the orf6 * gene is not not a gene essential for the biosynthesis of spiramycin I in S. ambofaciens, since inactivation of this gene leads to a spiramycin I producing phenotype (cf. FIG. 21).
However, orf6 * is essential for the production of spiramycin II and III (cf.
example 16)).
The orf6 * gene therefore encodes an acyl transferase responsible for the modification of platenolide at position 3 (see Figure 1).

EXAMPLE 17: Determination of the starting point for the translation of orf 10 and improved production of spiramycins 17.1 Construction of the plasmids pSPM523 pSPM524 and pSPM525 The orfl0 gene has been identified in Streptomyces ambofaciens and has been designated srmR by Geistlich et al. (Geistlich, M., et al., 1992 ~ b Inactivation due orfl0 a gene been carried out (see example 8). It could thus be shown that the strain resulting no produces more spiramycins (see example 15). This confirms that the orfl0 gene East well involved in the biosynthesis of spiramycins. The protein encoded by this gene v: ~ '.
is therefore essential for the biosynthesis of spiramycins. However, the analysis of the sequence shows that two ATG codons located in the same reading phase can be used for the translation of orfl0 (see Figure 28). One of the two codons possible (the most upstream codon) starts at position 10656 of the sequence given in SEQ ID N ° 1, whereas (other possible codon located further downstream starts at ~.
position 10809 (see SEQ ID N ° 1). Before testing for a possible effect of the overexpression of sr »zR on the production of spiramycin, it is important of determine in uri first time ~~ the start point of the translation.
In order to determine the translation start site, three constructions comprising three forms of orfl0 were carried out. These last have been obtained by PCR using oligonucleotides comprising either a 2o HindIII restriction, ie a BamHI restriction site.
The first pair used for the amplification corresponds to the oligonucleotides following 5'CCCAAGCTTGAGAAGGGAGCGGACATTCATGGCCCGCGCCGAACGC3 ' (SEQ ID N ° 122) (the HindIII site is in bold) 5'CGGGATCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGC3 ' (SEQ ID N ° 123) (the BamHI site is in bold) The pair of primers EDR39-EDR42 allows the amplification of a fragment of orfl0 comprising fATG located most in 3 '(position 10809 in the sequence given in SEQ ID N ° 1) (see Figure 28). The fragment obtained is a size about 2 kb and will be called subsequently "short orfl0", it does not contain the promoter of orfl0. This 2kb fragment was cloned into the vector pGEM-T easy to give birth at plasmid pSPM520. ;
The second torque used for the amplification corresponds to oligonucleotides following l0 5'CCCAAGCTTGAGAAGGGAGCGGACATTCAATGCTTTGGTAAAGCAC3 ' (SEQ ID N ° 124) (the Hi ~ dIII site is in bold) 5'CGGGATCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGC3 ' (SEQ ID N ° 123) (the BamHI site is in bold) The pair of primers EDR40-EDR42 allows (amplification of a fragment of orfl0 comprising fATG located most in 5 '(position 10656 in the given sequence eri ,, _, °. . v,.,. . , SEQ ID No. 1) (c ~ Figure 28). This fragment of 2.2 kb, ~ called later "long orfl0"
was cloned into the vector pGEM-T easy to give rise to the plasmid pSPM521, this plasmid does not contain the orfl0 promoter.
2o The third couple used for the amplification corresponds to oligonucleotides following CCCAAGCTTTCAAGGAACGACGGGGTGGTCAGTCAAGT 5'-3 ' (SEQ ID N ° 125) (the HindIII site is in bold) EDR42:
5'CGGGATCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGC3 ' (SEQ ID N ° 123) (the BamHI site is in bold) The pair of primers EDR41-EDR42 allows (amplification of the orfl0 gene with two ATGs, as well as its own promoter (see Figure 28). This 2.8 fragment kb subsequently called "orfl0 pro" was cloned into the vector pGEM-T easy for give birth of the plasmid pSPM522.
The "orfl0 pro" fragment was obtained using DNA as a template chromosome of the OSC2 strain. The fragments "orfl0 short" and "orfl0 long"
have as for them were obtained by using as DNA template of the fragment "orfl0 pro"
previously purified. ;
The HindIII-BamHI inserts of the plasmids pSPM520, pSPM521 and pSPM522 were then subcloned into the vector pUWL201 (plamside derived from plasmid pUWL199 (Wehmeier UF, 1995) in which the KphI-BamHI fragment of the region of the promoter of ermE (cf. Bibb et al., 1985, in particular FIG. 2) carrying a mutation increasing the strength of the promoter (ermE * promoter) (Bibb et al., 1994) a was introduced (cf. Doumith et al., 2000)) previously digested by enzymes HihdIII-Bam. Thus, three plasmids were obtained: pSPM523 (derived from ~, pUWL201 with the form "orfl0 court" as insert), pSPM524 (derived from.
pUWL201 with the form "orfl0 long" as an insert) and pSPM525 (derived from: ~ ::
;,:;
pUWL201 with the form "orfl0 pro") (Figure 28).
17.2 Transformation of the strain OS49 50 by the constructions ~ SPM523 pSPM524 e ~ SPM525 The strain OS49.50 (strain interrupted in the orfl0 gene, cf. example 8) was transformed independently by transformation of protoplasts (Kieser, T and al., 2000) by each of the plasmids pSPM523, pSPM524 and pSPM525. A negative control has also carried out by transforming the strain OS49.50 with the plasmid pUWL201 without insert. After transformation of the protoplasts, the clones are selected for their resistance to thiostrepton. The transformation of the clones by each of the plamids is verified by extraction of these plasmids. Thus four new strains have summer obtained: the strain OSC49.50 pUWL201, resulting from the transformation by plasmid pUWL201 without insert, the OSC49.50 pSPM523 strain, resulting from the transformation speak plasmid pSPM523, the strain OSC49.50 pSPM524, resulting from the transformation by the plasmid pSPM524 and finally the strain OS49.50 pSPM525, derived from transformation by the plasmid pSPM525.
The production of spiramycins from each of these four strains was tested by HPLC. For this, the different strains of Streptomyces to be tested have been grown in 500 ml baffled Erlenmeyer flasks containing s 70 ml of MPS medium (Pernodet et al., 1993). When the strain contains the plasmid pUWL201 or one of its derivatives, 5 μg / ml of thiostrepton is added. The baffled Erlenmeyer flasks were inoculated at an initial concentration of 2.5 106 sporeslml of different strains of S. ambofaciens and cultures were incubated at 27 ° C with orbital shaking at 250 rpm for 96 hours. Cells then have were separated from the medium by centrifugation and the supernatant was analyzed by HPLC (cf.
Example 16) to determine the amount of spiramycin produced. Thanks to a standard sample and by measuring the air in the peaks, it was possible to determine the '~
amount of each of the spiramycins produced by these strains. The results of this , analysis are presented in table 39, the data are expressed in mg by lüre ~ '; ~ P ,;
v of supernatant. ~ Corréspoüderit results ~, ~ total production eri , spiramycines '' (obtained by adding the spiramycin I, II and III production).
Table 39. Production in spiramycins of strains derived from OS49.50, (results expressed in mg / 1).
Strain Production in Spiramycins OS49.50 0 pUWL201 OS49.50 0 pSPM523 OS49.50 93 pSPM524 OS49.50 149 pSPM525 As the results given in Table 39 show, the negative control (strain OS49.50 transformed by the plasmid piJWL201) does not produce spiramycin. When the plasmid pSPM523 (which contains the form "short orfl0"
) East introduced into the strain OS49.50, no production of spiramycin is observed.
On the other hand, the presence of the plasmid pSPM524 (which contains the form "orfl0 long") and plasmid pSPM525 (which contains the form "orfl0 pro") restores the production of spiramycin in the host strain OS49.50. So only the fragments of orfl0 containing the most upstream fATG allow to restore the synthesis of spiramycin.
In order to confirm these results, the plasmid pSPM521 (plasmid 1o pGEM-T easy containing the form "orfl0 long") was digested with fenzyrne XhoI restriction (this enzyme has a unique site in this plasmid, located between '; 4 the two ATGs (see Figure 28)). The XhoI ends were then rendered free butt by treatment with the Klenow enzyme. The plasmid was then closed on itself-mixed ~ 'i,' ~~
by the action of T4 DNA ligase to give rise to the plasmid pSPM527. Yes '' the most upstream ATG (position 10656 in the sequence given in SEQ ID
N ° 1) is well used as a translation initiation site, this processing will result in a shift of the reading frame at the XhoI site and will have the effect of production a protein having no activating activity. On the other hand if the initiation of the translation takes place at the ATG level further downstream (position 10809 in the sequence 2o given in SEQ ID N ° 1), this treatment should have little or no effect on the expression of OrflO (taking into account the location of the starting point of the transcription) and no effect on the protein produced.
The BamHI-HindIII insert of pSPM527 was then subcloned into the vector pUWL201 to give rise to the plasmid pSPM528. This plasmid was introduced in strain OS49.50 and a clone having the desired plasmid has more particularly been selected. Spiramycin production of the strain The resultant was then tested by HPLC (see example 16 and above).
In contrary to what had been observed with the plasmid pSPM524 (cf. table 39), the presence of plasmid pSPM528 in strain OS49.50 does not restore the production of spiramycin. This confirms that the start of translation of the orfl0 gene is fATG located furthest downstream (ATG 1 see Figure 28).
s 17.3 Improvement in the production of spiramycins of the OSC2 strain of S
ambofaciens In order to test (effect of overexpression of the orfl0 gene on the production of spiramycins, plasmids pSPM523, pSPM524, pSPM525 and pSPM528 were l0 introduced into the OSC2 strain. For this, protoplasts of the strain OSC2 have been transformed (Kieser, T et al., 2000) independently by each of the plasmids pSPM523, pSPM524, pSPM525 and pSPM528. A negative control was also produced by transforming the OSC2 strain with the plasmid pUWL201 without insert.
After transformation of the protoplasts, the clones are selected for their resistance to ~ =. 'Y. ~. : '15 at thiostrepton. Thus five new strains have been obtained: the OSC2 strain .
pUWL201,, issued from ~ transformation with the plasmid. pUWL201 without insert, ~
the ,: .., ~. ,. .,,. . . .
OSC2 strain pSPM523, resulting from the transformation by the plasmid pSPM523, the OSC2 strain pSPM524, resulting from the transformation by the plasmid pSPM524, the OSC2 strain pSPM525, resulting from the transformation with the plasmid pSPM525 and 2o finally the OSC2 strain pSPM528, resulting from the transformation by the plasmid pSPM528. The production in spiramycins of these strains was then analyzed by HPLC (in the same way as in Example 17.2). Analysis of production in spiramycin of the OSC2 strain was also carried out in parallel for comparison. The results of this analysis are presented in Table 40, the 25 data are expressed in mg per liter of supernatant. The results match the total production of spiramycins (obtained by adding the production in spiramycin I, II and III).

Table 40. Production in spiramycins of strains derived from OSC2, (results expressed in mg / 1).
Spiramycin production strain pUWL201 pSPM523 pSPM524 pSPM525 '' OSC 2 6g. r. .

pSPM528 Thus, it is observed that the presence of the plasmid pSPM524 or of the plasmid pSPM525 significantly increases spiramyein production of the strain OSC2. This clearly shows that the overexpression of OrflO has a positive effect on the spiramycin production. On the other hand, the plasmid pSPM528 has no effect on the spiramycin production.
The plasmids pSPM525 and pUWL201 were similarly introduced.
lo in the strain SPM502 (cf. example 14). So two new strains have summer obtained: strain SPM502 pUWL201, resulting from transformation with plasmid 15 ~
pUWL201 without insert, and the strain SPM502 pSPM525, resulting from the transformation through the plasmid pSPM525.
A sample of the strain SPM502 pSPM525 (this strain contains the plasmid pSPM525, cf. above) has been deposited with the National Collection of Cultures of a 5 Microorganismes (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, February 26, 2003 under registration number I-2977.
Spiramycin production of strains SPM502 pUWL201 and SPM502 pSPM525 was analyzed by HPLC (in the same way as in Example 17.2).
Analysis of the spiramycin production of the strain SPM502 was also done in parallel for comparison. The results of this analysis are presented in Table 41, the data are expressed in mg per liter of supernatant.
The results correspond to the production of spiramycin I. Indeed, none of these strains only produced spiramycin II and III.

Spiramycin strain I

SPM502 pUWL201 72 SPM502 pSPM525 130 Table 41. Prtiduction in spiramycme I of strains derived from SPM502, ~ 'f I ~, . ~. (results expressed in nig / 1).
. 7. ,, Thus, it could be observed that the overexpression of the orfl0 gene in the strain SPM502 significantly increases the production of spiramycin I.

EXAMPLE 18 Construction of a Genomic DNA Library of the OSC2 Strain of Streptomyces ambofaciens in E. soli in the cosmid pWED2.
18.1 Construction of the cosmid pWED2 In order to facilitate the inactivation of genes in Streptomyces, a cosmid carrying the sequence oriT of the plasmid RK2 (which allows its introduction by conjugation in Streptomyces from an appropriate strain of E. coli) and also carrying an antibiotic resistance gene conferring a phenotype locatable at Streptomyces, was built. Such a cosmid containing great genomic DNA inserts from Streptomyces ambofaciens can be used in l0 gene inactivation experiments.
To construct this vector, a pac-oriT cassette (EcoRV fragment) was introduced into the cosmid pWEDl (Gourmelen et al., 1998), derived from the cosmid 'pWEDlS (Wahl et al., 1987), at the level of the single site HpaI. The pac cassette oriT a was obtained by PCR. For this, the pac gene was amplified by PCR from the . plasmid pVF 10.4 (Vara et al., 1985; Laçalle et al. 1989) using like ji "~ 'A
~ r:
_:
first primer, the arnôrce ~ ~ A 1 (of sequence 5'-CCAGTAGATATCCCGCCAACCCGGAGCTGCAC-3 '(SEQ ID N ° 126), the site EeoRV restriction has been underlined and the bold sequence of 20 nucleotides corresponds to a region upstream of the pac gene promoter) and as a second primer, primer B (of sequence 5'-GAAAAGATCCGTCATGGGGTCGTGCGCTCCTT-3 '(SEQ ID N ° 127), which has at its 5 ′ end a sequence of 12 nucleotides corresponding to the beginning of the oriT sequence (double underlined) and a 20 nucleotide sequence (in bold) corresponding to the end of the pac gene (see Figure 29, 1st pCR).
The oriT gene was amplified by PCR from the plasmid pPM803 (Mazodier, P. Et al., 1989) using as the first primer, primer C (from sequence 5'-CACGACCCCATGACGGATCTTTTCCGCTGCAT-3 '(SEQ ID N °
128)), which has at its 5 'end a sequence of 12 nucleotides corresponding to a sequence downstream of the coding sequence of the pac gene (in bold) and a sequence of 20 nucleotides corresponding to the start of the oriT sequence) and as the second primer, primer D (of sequence 5'-GAGCCGGATATCATCGGTCTTGCCTTGCTCGT-3 '(SEQ ID N ° 129)) which has the EcoRV restriction site (underlined single) and a sequence of 20 nucleotides corresponding to the end of the oriT sequence (double underlined) (cf.
Figure 29, 2nd pCR). ;
The amplification product obtained with primers A and B and that obtained with primers C and D have at one end a common sequence of 24 nucleotides. A third PCR was carried out by mixing the two products .
lo amplification obtained previously and using as primers, the primers A and D (see Figure 29, 3rd PCR). This made it possible to obtain a product amplification corresponding to the pac + oriT set. This pac-oriT fragment was then cloned in the vector pGEM-T Easy (marketed by the company Promega (Madison, Wisconcin, USA)), which made it possible to obtain the plasmid pGEM-T pac-oriT. The insert of this .: '~:
plasmid was then subcloned into the cosmid pWED1. For this the plasmid''-.
;.:, -;.;..
pGEM paç-oriT was digested with the EcoRV enzyme and the EcoRV insert containing <<
~;
ï. .... q,: ~ ..... '..,,, '~ the whole pac + oriT has been inserted in the côsW ide pWEDl open to prior "by a ~ '. ~
the enzyme HpaI. The cosmid thus obtained was named pWED2 (cf. Figure 30).
This cosmid facilitates the inactivation of genes in Streptomyces.
2o Indeed, it carries the sequence oriT (which allows its introduction by conjugation in Streptomyces from an appropriate strain of E. coli) but also a antibiotic resistance gene conferring a recognizable phenotype in Streptomyces. Such a cosmid containing large inserts of genomic DNA from Streptomyces ambofaciens can be used in inactivation experiments of Genoa.
Thus a cosmid derived from pWED2 containing the target gene will be able to example to be introduced into the E. coli KS272 strain containing the plasmid pKOBEG (cf. Chaveroche et al. 2000) and a cassette will be introduced in the uncomfortable target according to the technique described by Chaveroche et al. 2000. The cosmid obtained through this technique (cosmid in which the target gene is inactivated), may then be introduced into an E. coli strain such as strain S 17.1 or any other strain making it possible to transfer, by conjugation, plasmids containing the sequence ori towards Streptomyces.
After conjugation between E. soli and Streptomyces, clones of Streptomyces in which the wild copy of the target gene has been replaced by the copy interrupted can be obtained as described in Example 2.
The resistance gene expressed in Streptômyces present on this new cosmid is the pac gene of Streptomyces alboniger (Vara, J et al., 1985;
Lacalle and al., 1989) which codes for puromycin N-acetyl transferase and which confers resistance to 10 puromycin. During gene inactivation experiments, we will look for clones in which a double recombination event will have taken place. These clones will have eliminate the cosmid pWED2 and will therefore become sensitive to puromycin again.
18.2 Construction of a genomic DNA library of the OSC2 strain of: '', Strentomvces ambofaciehr in E c ~ li in the cosmid pWED2 ..... r ~: ~~
The genomic DNA of 1 ~, strain USG2 of Streptomyces ambofaciehs ~ was, was ,, ~ ,, '~ ~,,. . ~ .. 'rr ~:' partially digested ~ ~ by 1 enzyriïe d ~ "'-restrictiôri BcimHI de matuere to 'get' from '_' DNA fragments between about 35 and 45 kb in size. These fragments have then been cloned into the cosmid pWED2, the latter having been previously digested by BamHI, then treated with alkaline phosphatase. The ligation mixture has then been packaged in vitro in lambda phage particles thanks to the “
Packagene ~
Lambda DNA packaging system ”marketed by the company Promega (Madison, Wisconcin, USA) following the manufacturer's recommendations. The particles phage obtained were used to infect the SURE ~ strain of E. coli marketed by the company Stratagene (LaJolla, California, USA). The selection of clones was carried out on LB medium + ampicillin (50 pg / ml), the cosmid pWED2 conferring resistance to ampicillin.

EXAMPLE 19 Isolation of Cosmids from the New Bank Covering the Region of the biosynthetic pathway for spiramycins. Under cloning and sequencing of fragments of these cosmids.
19.1 Hybridization on colonies of the e ~ que Str ~ tomyces bank ambofaciens OSC2 Cosmids from the new bank of Streptomyces ambofaciens OSC2 (cf.
example 18) covering orfl * to orfl0 * or some or all of orfl to orf ~ Sc, or a region further upstream of the or25c have been isolated. For this, hybridizations successive on E. colonies. coli obtained according to example 18 were made in l0 using the following 3 probes (see Figure 31):
. - The first probe used corresponds to a DNA fragment of approximately 0.8kb amplified by PCR using as matrix the cosmid pSPMS and the primers following:
ORF23c: ~ '-ACGTGCGCGGTGAGTTCGCCGTTGC 3'', (SEQ .ID N ° 130).: And f is ~ '~ ÖRF25c: 5'-CTGAACGÄCGCCäTCGCGG'T ~ GT ~ C 3' (SEQ ID N ° 13I).
The PCR product thus obtained contains a fragment from the start of the orf23c, the orZ4c in integer and the end of the gold ~ 5c (cf. figure 31, probe I).
- The second probe used corresponds to a DNA fragment of approximately 0.7kb amplified by PCR using as a template the total DNA of the strain S.
20 ambofaciens ATCC23877 and the following primers ORFl * c: 5'-GACCACCTCGAACCGTCCGGCGTCA-3 '(SEQ ID N ° 132) and ORF2 * c: 5'-GGCCCGGTCCAGCGTGCCGAAGC-3 '(SEQ ID No. 133).
The PCR product thus obtained contains a fragment of the end of orfl * c and from the start orfl * c (see Figure 31, probe II).
25 - The third probe used corresponds to an EcoRI-BamHI fragment about 3kb containing orfl, orfZ and orf3 and obtained by digestion of the plasmid pOS49.99 (cf. figure 31, probe III).

About 2000 clones of the bank obtained in Example 18.2 were transferred on filter for hybridization on colonies according to conventional techniques (Sambrook et al., 1989).
The first probe (see Figure 31, probe I) was marked at 3 ~ 'P by the technical of "random priming" (Kid marketed by the company Roche) and used for hybridization on 2000 bank clones, after transfer to a filter.
The hybridization was performed at 65 ° C. in the buffer described by Church & Gilbert (Church &
Gilbert, 1984).
Two washes were carried out in 2x SSC, 0.1% SDS at 65 ° C, the first during 10 v minutes and the second for 20 minutes and a third wash of a duration from 30 minutes was then carried out in 0.2X SSC, 0.1% SDS at 65 ° C. In these terms hybridization and washing, 20 clones among the 2000 hybridized presented a strong signal, hybridization with the first probe. These 20 clones were grown in medium LB + v ampicillin (50 p, g / ml) and the corresponding cosmids were extracted by lysed alkaline (Sambrook et al., 1989) then they were digested by the enzyme restriction, ~ '~~, = BamHI. The digestion products were then separated on agarose gel, Trans ~ ~~~~ Eres' ry._, ~ ~. . '"~ K
, .. ,,, ~. "tA ~ ~ ~
',;. 'v ~;, ° x ~,' i ' sure inérribrane 'of ~ Nylôn and hybridized by the first probed (cf. above'.
the product ; from F, i ' ORF23c-ORF25c PCR, probe I) under the same conditions as above. Twelve cosmids possessed a BamHI fragment strongly hybridizing with the probe used.
These 12 cosmids were named pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM4l, pSPM42, pSPM43, pSPM44 and pSPM45. -The profiles, after digestion with BamHI, these 12 cosmids were compared with each other and with that of the cosmid pSPMS. In addition PCR amplification experiments using different primers corresponding to different genes already identified in the orfl- region orf25c allowed to position the insert of some of these cosmids compared to others and also to determine the location of these inserts in the orfl- region orf25c already known (see Figure 32). The cosmid pSPM36 has more particularly summer chosen because it was likely to contain a large region upstream of the or2525c (cf.
Figure 31 and 32).

Secondly, and using the same conditions as those described above, the 2000 clones of the bank of Streptomyces ambofaciens OSC2 have been hybridized with the second probe corresponding to the PCR product: ORF1 * c-ORF2 * c (see Figure 31, probe II). This hybridization made it possible to isolate cosmids including the insert is located in the region of orfl * c to orfl0 * c. In the conditions hybridization used, 16 clones among the 2000 hybridized showed a strong signal hybridization with this second probe. These $ 16 clones were cultured in LB + ampicillin medium (50 ~, g / ml) and the 16 corresponding cosmids were extracted by alkaline lysis (Sambrook and al., 1989) then they were digested with the restriction enzyme BamHI. The profiles of digestion (after digestion with BamHI) of these 16 cosmids were compared between them and with that of the cosmid pSPM7. PCR amplification experiments with primers ORF1 * c and ORF2 * c made it possible to choose two cosmids which contained well .
the genes o ~ fl * c and orfl * c and whose profiles had bands common but ~ ' also different bands. In addition, other amplification experiments by PCR éri wv, v ~. ~ is using different primers corresponding to different genes already identified in. La '~ Y' reg ~ .on orfl * c à ot ~ fl0 * c penriis to posihoniler the insert of these cosmids some, para tai .. with respect to details and details of the location of these inserts in the Fw region orfl * c to orfl0 * c already known (see Figure 32). The two more cosmids particularly selected were named pSPM47 and pSPM48 (see Figure 32).
Using the same conditions as those described above, the 2000 clones from the OSC2 Streptomyces ambofaciens bank were also hybridized with the third probe corresponding to the EcoRI-BamHI DNA fragment of the plasmid pOS49.99 (see figure 31 probe III). This hybridization made it possible to isolate the cosmids containing the region from orfl to orf3 and likely to contain either a big part of the PKS genes, i.e. a large part of the orfl to orfd5c genes of the way of biosynthesis of spiramycins. Under these hybridization conditions, 35 clones from 2000 hybridized showed a strong hybridization signal with the third probe. These 35 clones were cultured in LB + ampicillin medium (50 ~ .g / ml) and the 35 cosmids correspondents were extracted by alkaline lysis (Sambrook et al., 1989) then digested by the restriction enzyme BamHI. The profiles, after digestion with BamHI, of these cosmids were compared with each other and with that of cosmid pSPMS. Moreover of the PCR amplification experiments using different primers corresponding to different genes already identified in the orfl region at orfZSc have made it possible to check that these cosmids contained many inserts coming from the orfl region at orf25c and de position the inserts of these cosmids relative to each other and by compared to the the already known orfl to orfZSc region (see Figure 32). Five cosmids were more particularly selected, they were named pSPM50, pSPM5l, pSPM53, pSPM55 and pSPM56 (see Figure 32).
19.2 Under cloning and sequencing of part of the insert of the cosmid pSPM36.
The approximately 0.8 kb probe obtained by PCR with the primers ORF23c and ORF25c (see above and figure 31, probe I) has also been used in experiences of Southern blot on the total DNA of S. ambofaciens OSC2 digested with the PstI enzyme.
In 'v: ~
the hybridization conditions described above, this probe reveals a fragment unique ~
. ZS PstI of approximately 6 kb when hybridized on the total AD1V of S. ambofaciens OSC2 digested per ~ L ' the PstI enzyme. There was a PstI site at the gold level, f23c (cf. SEQ ID
# 80) but no w other PstI site to the end (BamHI site) of the known sequence (cf.
SEQ ID N °
1). This PstI-BamHI fragment has a size of approximately 1.4 kb. The PstI fragment of 6 kb hybridized on the total DNA of S. ambofaeiens digested by the enzyme PstI contains so a region of approximately 4.6 kb located upstream of orfZSc. This region is susceptible to contain other genes whose products are involved in the pathway biosynthesis of spiramycin. It was verified by digestion that the cosmid pSPM36 contained well what 6 kb PstI fragment. This fragment was isolated from pSPM36, for the purpose of determine the sequence further upstream of orf25c. For this, the cosmid pSPM36 has summer digested with the restriction enzyme PstI. The size PstI-PstI fragment about 6kb was isolated by electroelution from a 0.8% agarose gel and then cloned in the vector pBI ~ -CMV (4512bp) (marketed by the company Stratagene (La Jolla, California, USA)). The plasmid thus obtained was named pSPM58 (cf. FIG. 33) and the sequence of its insert has been determined. The sequence of this insert is presented in SEQ ID
No. 134.

However, the entire sequence has not been determined and there is a hole about 450 nucleotides, the part of the sequence not determined has been denoted by a succession of "N" in the corresponding sequence.
19.3 Analysis of new nucleotide sequences determination of phases open reading and characterization of genes involved in biosynthesis of the s spiramycin. ' The sequence of the insert of the cosmid pSPM58 obtained was analyzed using;
FramePlot program (Ishikawa J & Hotta K. 1999). This made it possible to identify, among the open reading phases, the open reading phases presenting a use of codons typical of Streptomyces. This analysis determined that this insert includes 4 new ORFs upstream of gold, fi5e (see Figure 34). These genes have been named orfl6 (SEQ ID N ° 107), orfl7 (SEQ ID N ° 109), orfl ~ c (SEQ
ID No. 111, the sequence of this orf has not been determined completely since a hole about 450 '. ~.
nucleotide subsite during sequencing of the insert of pSPM58, these 450 nucleotides ~ v fis appear as a series of "N" s in the, sequence SEQ ID
N ° 111) and orf ~ 9 .. (la ar;
i have .., '''' seqûence dë c'etté ~ last orf was inctiïnplète (in this insert). The <<
~ c "added in the, ~~.
name of the gene signifying for the ORF in question that the coding sequence is in reverse orientation (see Figure 34).
The protein sequences deduced from these open reading phases were compared with those present in different databases thanks to different programs: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search, (these two programs are accessible in particular from the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W.
R & DJ Lipman, 1988) and (Pearson WR, 1990) (this program is available in particular from the 1NFOBIOGEN resource center, Evry, France). These comparisons made it possible to formulate hypotheses on the function of products of these genes and identify those likely to be involved in biosynthesis of spiramycin.

19.4 Under cloning and sequencing of another part of the cosmid insert pSPM36.
The approximately 0.8 kb probe obtained by PCR with the primers ORF23c and ORF25c (see above and figure 31, probe I) has also been used in experiences of Southern blot on the total DNA of the OSC2 strain digested by the StuI enzyme. In the hybridization conditions described above for this probe, this probe reveals a single StuI fragment of approximately 10 kb when hybridized to the total DNA of the strain OSC2 digested with the enzyme StuI. Given the presence of a StuI site in the orfl3c (cf. SEQ ID N ° 80) and the location of this site in relation to the site PstI, this fragment, 10 kb io includes the entire previously studied PstI fragment (insert of pSPM58) and provides access to an area not yet studied of around 4 kb. (cf.
figure 33). He has been verified by digestion that the cosmid pSPM36 did indeed contain this fragment StuI of 10 kb. This fragment was isolated from the cosmid pSPM36, for the purpose of determine the sequence of the end of orif9 and other genes further upstream of gold, fi9. For this, the ~ ~.
v cosmid pSPM36 was digested with the restriction enzyme StuI. The Shard Stu-Stu _ i with a size of about 10 kb ~ â waso ~ é ~ by electroelutiori ~ â p ~ .rtir an agartized gel a;
. , 'S. not;
0.8% then cloned into the vector pBK-CMV (4512bp) ~ (marketed by society Stratagene (La Jolla, California, USA)). The plasmid thus obtained was named pSPM72 (see Figure 33). The latter was then digested with EcoRI (EcoRI site in the insert of PSPM58) and HindIII (HindIII site in the multiple cloning site of vector, immediately after the StuI site of the tip of the insert) (see Figure 33).
The Shard of EcoRI-HindIII DNA thus obtained, corresponds to a fragment of the insert of the plasmid pSPM72 (see Figure 33) and was subcloned into the vector pBC-SK +
(marketed by Stratagene (La Jolla, California, USA)) digested beforehand by EcoRI and HindIII. The plasmid thus obtained was named pSPM73 and the sequence of its insert a been determined. The sequence of this insert is presented in SEQ ID N °
135.
An assembly of the sequences of the inserts of pSPM58 and pSPM73 is presented in SEQ
ID No. 106. This sequence starts from the PstI site at the level of the orf23c (cf.
SEQ ID N ° 80) and goes to the StuI site at the orf32c (see figure 34). The sequence of the or28c (SEQ
3o ID N ° 111), not being complete (cf. example 19.3), a region about 450 nucleotides is not sequenced, these 450 nucleotides appear in the form of a series of "N" in the sequence SEQ ID No. 106).
19.5 Analysis of new nucleotide sequences, determination of phases open reading and characterization of genes involved in biosynthesis of the spiram c ~ ' The partial sequence of the insert of the cosmid pSPM73 obtained was analyzed grace to the FramePlot program (Ishikawa J & Hotta K. 1999). This allowed to identify, ~ '.r among the open reading phases, the open reading phases presenting a use l0 codons typical of Streptorrcyces. This analysis made it possible to determine that this insert has 4 ORFs, one incomplete and three complete (see Figure 34). ORF
incomplete corresponds to the 3 ′ part of the coding sequence of gold, f ~ 9, which made it possible to complete the sequence of this gene thanks to the partial sequence of this same orf obtained during du, ï ~;: ,, sequencing of the insert of the plasmid pSPM58 (cf. example 19.2 and 19.3), all ~~., two sequences to thus perrnis ~ to obtain the sequ ~ ncé çomplète, de.ôrfl9. The 4 genes have,. ~> ~, thus been named orflQ (SEQ D7 ~ N ° 113), orf30c (SEQ ~ ID N °
1.15), orf31 (SEQ m N ° 'n 118) and orf32c (SEQ ID No. 120). The "c" added in the name of the gene meaning for the ORF in question that the coding sequence is in the reverse orientation (cf.
figure 34).
The protein sequences deduced from these open reading phases (SEQ ID
No.
114 for orf29, SEQ ID N ° 116 and 117 for orf30c, SEQ ID N ° 119 for orf31 and SEQ
ID N ° 121 for orf32c) were compared with those present in different bases data through different programs: BLAST (Altschul et al., 1990) (Altschul and al., 1997), CD-search, (these two programs are accessible in particular from of National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, LJSA)) FASTA ((Pearson W. R & DJ Lipman, 1988) and (Pearson WR, 1990) (this program is accessible in particular from the INFOBIOGEN resource center, Evry, France).
These comparisons made it possible to formulate hypotheses on the function of products of these genes and identify those likely to be involved in the biosynthesis of spiramycin.
19.6 Subcloning and sequencing of a third part of the cosmid insert pSPM36.
A probe (0.8 kb DNA fragment) corresponding to an internal sequence orf32c was obtained by PCR using the total fADN matrix of strain of Ambofacial streptomyces and the following primers KF36: 5'- TTGCCGTAGCCGAGGACCAGCG-3 '(SEQ ID N ° 151) and KF37: 5'- CACATGGCCCTGGAGGACCCTG-3 '(SEQ ID No. 152).
The PCR product thus obtained represents an internal sequence of forf32c. This' ~~.
probe used in Southet ~ n Blot DNA experiments chromosomal '. = :.
'of the OSC2 strain and on the DNA of the cosmid pSPM36 digested' by the enzyme PstL
E ~,, ~ ', rri using, the. ïnê ~ nes hybridization conditions, g ~ .e those déèrWs' ci below (cf. exeyple rl i . . :. :,.
19.1), this probe reveals two PstI 'fragments of approximately 3.4kb and 2, Skb when hybridized ~ ' on the total DNA of the OSC2 strain and on the DNA of the cosmid pSPM36 digested by the PstI enzyme. Given the presence of a PstI site in the probe used we can explain these results. The first DNA fragment that is about the size of 3.4kb is a fragment whose sequence is already known in full. The sequence of fragment of 2.5 kb is only partially known, over a region of 700 bp. This fragment.
was isolated from the cosmid pSPM36 in order to determine the sequence of the end of forf32c and other genes upstream of the latter. For this, the cosmid pSPM36 was digested by the restriction enzyme PstI. The PstI-PstI fragment with a size of approximately 2, Skb was isolated by purification from a 0.8% agarose gel and then cloned into the pBK- vector CMV (4518bp) (marketed by Stratagene (La Jolla, California, USA)). The plasmid thus obtained was named pSPM79 (cf. FIG. 41) and the sequence of its insert has been determined.

The sequence of the orfZ8c (SEQ ID N ° 111) was not complete (cf.
example 19.3).
Indeed, a region of around 450 nucleotides could not be determined, these 450 nucleotides appear as a sequence of "N" in the sequence SEQ ID
N ° 106.
The sequence of the entire missing region was determined by resequencing of this region. The sequence of the inserts of pSPM58 and pSPM73 has therefore been determined in whole. The complete sequence of the coding part of orj '~ 8c is presented in SEQ ID
N ° 141 and the protein deduced from this sequence in SEQ ID N °
142. The sequence of the insert of the plasmid pSPM79 is presented in SEQ ID No. 161.
An assembly of the sequences of the inserts of pSPM58, pSPM73 and pSPM79 is presented in SEQ ID N ° 140 (cf. figure 41). This sequence starts from the site PstI level from the gold ~ 3c (see SEQ ID N ° 80) and goes to the PstI site at the or3434 (cf. figure 41).
19.7 Analysis of new nucleotide sequences, determination of 'phases ~ w ; ,, open reading. and characterize genes that may be involved in 'la ~;. ~;
â o ~ it a 4. ,, '~' r ~ ,,;
. i5. , biosynth ~ se des sp ~ rariycm ~ s Y ~ r, . ::; f ~: y,. . . -. ..,, .. ..,. ".. ~. .. -'a,. ~., .. ...,. ~ .., ,,,. ,,., ~. . ,.
The sequence of the insert of the plasmid pSPM79 obtained was analyzed using the FramePlot program (Ishikawa J & Hotta I ~. 1999). This made it possible to identify, among the open reading phases, the open reading phases presenting a use of codons typical of Streptomyces. This analysis determined that this insert has 3 ORFs, two incomplete (orf32c and orf34c) and one complete (or, f33) (Cf.
figure 41).
The first incomplete ORF corresponds to the 5 ′ part of the coding sequence of orf32c. This made it possible to complete the sequence of this gene thanks to the sequence partial of this same orf obtained during sequencing of the insert of the plasmid pSPM73 (Cf.
example 19.4 and 19.5), the combination of the two sequences thus made it possible to obtain the complete sequence of orf32c. (SEQ ID No. 145). The "c" added in the gene name means for the ORF in question that the coding sequence is in the orientation reverse (cf. figure 41). The complete gold was named orf33 (SEQ ID N ° 147). The third ORF
was named orf34c (SEQ ID N ° 149). The "c" added in the name of the gene means for the ORF in question that the coding sequence is in the reverse orientation (cf. figure 37). The comparisons made between the product of this orf and the banks of data suggest that the C-terminal part of this protein is not in the product deducted from the nucleotide sequence and therefore that this orf would be longer and would continue in outside the sequenced region.
The protein sequences deduced from these open reading phases were l0 compared with those present in different databases thanks to different programs: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search, (these two programs are accessible in particular from the National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W .. ~ ..
r,,: ..
R & DJ Lipman, 1988) and (Peârson WR, 1990) (this program is available ~
~ .15 y in particular at the resc center ~ prcës: INFOBIOGEN: E '. ~ Rai ~ ce ~ ~ Çés'i2 ~, 1 ~ V 1 ~ 1 ~~
~~ ~ ~ r'r ~ 'y r. 7. t. ' t. h .. ~ i., r sv:: ~ côi ~ npâraisaris held license to form ~~ from hypti ~. ~ sës ~ sür la fozlctiôn ~ dices préducts of these;
genes and identify those likely to be involved in biosynthesis of. .
spiramycin.
EXAMPLE 20 Analysis of the production of biosynthesis intermediates spiramycin 20.1 Preparation of samples The different strains to be tested were each cultivated in 7 Erlenmeyer flasks 500 ml baffles containing 70 ml of MPS medium (Pernodet et al., 1993). The Erlenmeyer flasks 25 were inoculated with 2.5 106 spores / ml of the different strains of S.
ambofacie ~ s and pushed at 27 ° C with orbital shaking at 250 rpm for 96 hours. The cultures corresponding to the same clone are collected, possibly filtered sure pleated filter, and centrifuged 15 min at 7000 rpm.
The pH of the must is then adjusted to 9 with sodium hydroxide and the supernatant is extract with methyl iso-butyryl ketone (MIBK). The organic phase (MIBK) is so recovered and evaporated. The dry extract is then taken up in lml acetonitrile, then diluted at 1110 (100.1 qsp lml with water) before being used for the analyzes in liquid chromatography coupled to mass spectrometry (CL / SM).
20.2 Analysis of samples in CL / SM
10 The samples were analyzed by CL / SM in order to determine the mass of different products synthesized by the strains to be tested.
The high performance liquid chromatography column used is a column Kromasil C8 150 * 4,6mmm, .5 ~ nmm, 1.00. .
The mobile phase is a gradient consisting of a mixture of acetonitrile and a solution: ' . , aqueous trifluoroacéhque acid â 0 OS ° / a, the ,, üébn is fiz ~ é at 1 mllmin. The temperatures ~ "
~ -, ,;
. . from which a colonized oven is unavailable at '3d ° C, UV detection at the column outlet was carried out at two lengths wave different: 238 nm and 280 nm.
The mass spectrometer coupled to the chromatography column is a apparatus Single Quadripole marketed by the company Agitent, with voltages of tones at 30 and at 70V.
20.3 Analysis of the biosynthesis intermediates produced by the strain OS49 67 The strain OS49.67 in which the orf3 gene is inactivated by a deletion in phase does not produce spiramycins (cf. examples 6 and 15).
A sample was prepared according to the method described above (cf.
paragraph 20.1) and was analyzed by CL / SM as described above (see paragraph 20.2).

More particularly, the analysis by chromatography was carried out in gradient of solvent with mobile phase: 20% acetonitrile of time T = 0 to Smin then linear rise to 30% at T = 35 minutes, followed by a plateau until T = 50 minutes.
Under these conditions, two products were more particularly observed: a absorbent at 238 nm (retention time 33.4 min) and absorbent at 280 nm (time retention of 44.8 min) (see Figure 35). Figure 35 shows the superimposition of HPLC chromatograms performed at 238 and 280nm (high) as well as the UV spectra of the molecules eluted at 33.4 minutes and 44.8 minutes (bottom).
The conditions of analysis in coupled mass spectrometry were the following,.:, i0: the scan is done in scan mode, covering a range of mass included between 100 and 1000 Da. The gain of the electro-multiplier was 1 V. Regarding the source electrospray, the spray gas pressure was 35 psig, the flow rate of the drying gas of 12.0 l.miri 1, the temperature of the drying gas of 350 ° C, the voltage of the was. ~ ..:
brought to +/- 3000 V. These experiments made it possible to determine the mass of of them separate products. These masses are respectively 370 glmole for the product eluted in 'f ~~
first ([M-H20] + = 353 produZt ma ~ onta ~ re), and 368 g / mole for the second product ([M, ~ ~~
k ~ '. f.,: '~ ~ .7 ~ v. '~~' ~ aal . H2U] + - 351 ~ prôdmt ma ~ ôritàirè). . ~ -, ~ ~ zr . ' In order to obtain the structure, the products mentioned above have been isolated and, purified under the following conditions: the mobile phase is a mixture of solution aqueous 0.05% trifluoroacetic acid and 70/30 acetonitrile (v / v). The chromatography is carried out in isocratic regime with a fixed flow rate of 1 ml / min. In these conditions, the retention times of the 2 products are respectively 8 and 13.3 minutes. Also in this case, the sample prepared (see paragraph 20.1) is not diluted in water before injecting 101.
The 2 products are recovered at the outlet of the chromatographic column and isolated under the following conditions: an Oasis HLB 1 cc 30mg cartridge (Waters) is conditioned sequentially with 1 ml of acetonitrile, then 1 ml water / acetonitrile (20v / 80v) and lml of water / acetonitrile 80/20. The sample is then introduced and the cartridge washed successively with 1 ml of water / acetonitrile (95/5), lml water / deuterated acetonitrile (95/5), then eluted with 600.1 water / acetonitrile deuterated 40/60.
The recovered solution is then directly analyzed by NMR.
The NMR spectra obtained for these two compounds are as follows - First product eluted: Platenolide A: (Specter 9646 1H spectrum in CD3CN ~ (chemical shifts in ppm): 0.90 (3H, t, J = 6Hz), 0.93 (3H d J = SHz) 1 27 (3H d J = 5Hz) between 1 27 and 1 40 (3H m) 1 51 (1H m) 1 95 >>>>;>>>>>>>>>>>
(1H, m), 2.12 (1H, m), 2.30 (1H, d, J = 12Hz), 2.50 (1H, d, J = 11Hz), 2.58 (1H, dd, J = 9.
and 12 Hz), 2.96 (1H, d, J = 7Hz), 3.43 (3H, s), 3.70 (1H, d, J = 9Hz), 3.86 (1H, d, J = 7Hz),. ~ _ '.;
l0 4.10 (1H, m), 5.08 (1H, m), 5.58 (1H, dt, J = 3 and 12Hz), 5.70 (1H, dd, J = 8 and 12 Hz), 6.05 (1H, dd, J = 9 and 12Hz), 6.24 (1H, dd, J = 9 and 12Hz).
-Second product eluted: Platenolide B: (Specter 9647 1H spectrum in CD3CN (chemical shifts in ppm): 0.81 (3H, t, J = 6Hz), 0.89:;. ~~;
(1H, m), 1.17 (3H, d, J = 5Hz), 1.30 (4H, m), 1.47 (2H, m), 1.61 (1H, t, J = 10Hz), 2.20 ò ~ '<v (1H, m), 2.38 (1H, d, J = 13Hz), 2.52 (1H, m), 2.58 (1H, m), 2.68 (1H, dd, J = 8 and l3Hz), ~ ~ i 3.
1H ~ d D-:., . , (,, 7Hz),, 0 (3H, s), 3.611 (1H, il, T 8Hz), ~ -3 ~ 82 (1H, d, J-= '7Hz),' 5.09 (1.- ~, ø. ~~, m), 6.20 (1H, m), 6.25 (1H, dd, J = 9 and 12 Hz), 6.58 (1H, d, J = 12 Hz), 7.19 (1H, dd, J = 9.
and 12Hz).
These experiments thus made it possible to determine the structure of these two compounds.
The first product eluted is platenolide A and the second is platenolide B, the structure deduced from these two meolëcules is presented in figure 36.
It could also be determined using the CL / SM technique associated with the NMR, under conditions slightly different from those described previously but whose development is well known to those skilled in the art, that the strain OS49.67 produces in addition to platenolide A and B a derivative of these two compounds.
It's about platenolide A + mycaorse and platenolide B + mycarosis (the structure of these of them compounds is shown in Figure 40). The results of the wort analysis strain OS49.67 are presented in Table 42.
Table 42. The results of the CL / SM analysis of the must of the strain OS49.67 Identit [] Masses of ionsMax (m L) abso tion [M + Na] +
.

Platnolid A 16.1 393.0 231nm [M + K] +

Exact mass = 370,408.9 Formula [M - H20 + H] +

353.0 Molculaire = C2oH34O6 [2M + Na] +

763.2 [M - H2O + H] +

Platnolid B 1.4 351.0 283nm +
you Exact mass = 368 ~, 391 O:;

'[M + K]

. Form 406.9 Molcul ~
ire = C fj ~ H

'', a "t + v '' 2 '+.

~.
~. . ~ ~

,. . ', . Na ~
[2M

759.1 [M + Na] +

Platnolide A + 'mycarose'4,27 537 0 230nm Exact mass = 514 [M + K] +

Formula 553.0 Molculaire = C2-H4609 [M + Na] +

Platnolide B + 'mycarose'ND 535 0 284nm [M + K] +

Exact mass = 512,550.9 Formula [PlatB - H20 +

Molecular = C2 ~ H4409 H +350.9 20.4 Analysis of the biosynthesis intermediates produced by the strain SPM509 The strain SPM509 in which the orfl4 gene is inactivated (orfl4:: att3S ~ aac-) born produces no spiramycins (see examples 13, 15 and 16). A sample was prepare according to the method described above (see paragraph 20.1) and has been analyzed by LC / MS
as described above (see section 20.2 and 20.3). Analysis of intermediaries of biosynthesis present in the culture supernatant of the strain SPM509 cultivated in MP5 medium has shown that this strain only produces the B form of platenolide ("Platenolide B", cf. figure 36) but not form A ("platenolide A", cf.
Figure 36).
EXAMPLE 21 Interruption of the orfl4 gene in a strain interrupted in the orf3 gene (OS49.67) The orfl4 gene product is essential for the biosynthesis of spiramycins (c ~: ~;
example 13, 15 and 16: la. strain SPM509 in which this gene is interrupted born ~~ ~~ ' k ~
produces more spir ~ nycin ~ s) The analysis: bios thesis intermediaries resents d. ~ âüsa . 3'n. P
,.
. . ..,: {- ~ ~ ~~ c ~
i5 ~ the supernatant of cûltùrë dë ~ the sôüchë 'SPM509 grown in MP5 medium a shown ~ that this strain produced only form B of platenolide but not form A
(Cf.
example 20). One of the hypotheses that can explain this observation is that the product of orfl4 is involved in converting form B of platenolide to form A by an enzymatic reduction step. To test this hypothesis, the orfl4 gene has been inactivated in a mutant no longer producing spiramycin, but producing the forms A and B of platenolide. This is the case of strain OS49.67 (cf. example 6 and 20) in which the orf3 gene is inactivated by a phase deletion (~ orf3). For inactivate the orfl4 gene in this strain the plasmid pSPM509 was introduced by transformation of protoplasts of the strain OS49.67 (I ~ ieser, T et al., 2000). Inactivation of orfl4 gene has already been described in the case of the OSC2 strain (cf. example 13) and it has been process of same manner for the inactivation of the orfl4 gene in the strain OS49.67. After transformation by the plasmid pSPM509, the clones are selected for their resistance to fapramycin. The clones resistant to apramycin are then transplanted respectively on medium with apramycin and on medium with hygromycin. The clones resistant to fapramycin (ApraR) and sensitive to fhygromycin (HygS) are principle those where a double crossing over event has occurred and in which the uncomfortable orfl4 has been replaced by a copy of orfl4 interrupted by the cassette att3.f2aac-. These clones were more specifically selected and the replacement of the wild copy of orfl4 by the copy interrupted by the cassette has been checked by hybridization: So, the total DNA of the clones obtained was digested with several enzymes, separated on gel of agarose, transferred to the membrane and hybridized with a probe corresponding to the cassette att3Slaac- to verify that the gene replacement had taken place. The verification l0 of the genotype can also be carried out by any known method of the man of profession and in particular by PCR using the appropriate oligonucleotides and sequencing of the PCR product.
A clone with the expected characteristics (~~ rf3, orfl4 :: att3, slaac-) has been more specifically selected and named SPM510. He could indeed be checked thanks ~ v to the two hybridizations that the att3 ~ acic cassette was good, present in the 'genome;
... , _. ~, _ ~ 5 y "' this clone and that we obtain the expected 'prti ~ ò' of dyestitin '. iiàns "
the case of a = ~~ ' replacement, following a double recombination event, of the gene wild orfl4 by the copy interrupted by the att3. ~ 2aac- cassette in the genome of this clone.
2o EXAMPLE 22: Functional complementation of the interruption of the orfl4 gene 22.1 Construction of the plasmid pSPM519 The orfl4 gene was amplified by PCR using the pair of oligonucleotides next: EDR31: S 'CCCAAGCTTCTGCGCCCGCGGGCGTGAA 3' (SEQ ID N °
136) and EDR37: 5 'GCTCTAGAACCGTGTAGCCGCGCCCCGG 3' (SEQ ID N °
137) and as a template the chromosomal DNA of the OSC2 strain. The oligonucleotides EDR31 and EDR37 carry the HindIII and lXbaI restriction site respectively (sequence in bold). The 1.2 kb fragment thus obtained was cloned into the vector pGEM-T easy (marketed by the company Promega (Madison, Wisconcin, USA)) to give birth of the plasmid pSPM515. This plasmid was then digested by enzymes HindIII and XbaI restriction. The 1.2 kb HindIIIlXbaI insert obtained was cloned in the vector pUWL201 (cf. example 17.1) previously digested with the same enzymes.
The plasmid thus obtained was named pSPM519.
22.1 Transformation of the strains SPM ~ 09 and SPM510 far the plasmid pSPM519 The plasmid pSPM519 was introduced into the strains SPM509 (cf. example 13) : ~ ' and SPM510 (cf. example 17) by transformation of protoplasts (Kieser, T and al., 2000).
lo After transformation, the clones are selected for their resistance to thiostrepton.
The clones are then subcultured on a medium containing thiostrepton.
The strain SPM509 is a strain which does not produce spiramycins (cf. example F
13, 15 and 16 and Figure 24). Spiramycin production of the strain SPM509 r;
transformed by the vector pSPM519, (strain named SPM509 pSPM519) has been vs . . f Ç 4 ', ~ ~ r <~ rL ~ øa ..
r .. °; ,, n, ~, _ be I ~~., ._ is '' anal.
. . yséé. by cultivating cettè'souehc .dati ~ du rn ~ l ~ eu MP.S ~. en, eserice dé
thi ~ s ~ torir, es ~, a . ,. . . , V ... y .. .. '~ y S ~ t I w ~
culture supernatants were then analyzed by HPLC (cf. example 16 and 17). Les ~ '~
results of this analysis are presented in Table 43, the data are expressed in mg per liter of supernatant. The results correspond to the production total in spiramycins (obtained by adding the production of spiramycin I, II and III). He was 20 observed that the presence of the vector pSPM519 in the strain SPM509 restores the production of spiramycins (see Table 43).
Table 43. Production in spiramycins of the strain SPM509 transformed by the vector pSPM519, (results expressed in mg / 1 of supernatant).
Strain Production in spyramicines SPM509 pSPM5195g The strain SPMS 10 transformed by the plasmid pSPM519 was named SPM510 pSPM509.
EXAMPLE 23 Functional complementation of the interruption of the orf3 gene by the tylB gene of S. fradiae 23.1 Construction of the plasmid pOS49.52 The plasmid pOS49.52 corresponds to a plasmid allowing the expression of, the ,, TyIB protein in S. ambofaciens. To construct it, the coding sequence of tylB ~ v gene de S fradiae (Merson-Davies & Cundliffe, 1994, GenBank access number: U08223 i0 (region sequence), SFU08223 (DNA sequence) and AAA21342 (sequence protein)) was introduced into the plasmid pKC1218 (Bierman et al., 1992, Kieser and.
,. al., 2000, an E. coli strain containing this plasmid is accessible especially with r.
from PARS (NRRL) Agricultural Reseârch Service Culture Collection) (Peoria, Illinois, i USA), under number B-14790). In addition, this coding sequence has been placed under ~ lé, '~ û ~ "
i5 control of the ermE * romoteur cf. above especially the 17 1 Bibb et al 19 ~, & 5 x ~ ' a 'p (~ p>>
tt ~, ~
~~, '. . Bibb et al., 1994). '..
23.1 Transformation of the OS49 67 strain by the plasmid ~ OS49 52 The strain OS49.67 in which the orf3 gene is inactivated by a deletion in phase does not produce spiramycins (cf. examples 6 and 15). The plasmid pOS49.52 was 20 introduced into strain OS49.67 by transformation of protoplasts (Kieser, T et al., 2000). After transformation, the clones are selected for their resistance at apramycin. The clones are then subcultured on a medium containing apramycin.
A clone was more particularly selected and was named OS49.67 pOS49.52.
As demonstrated above, the OS49.67 strain does not produce 25 spiramycins (cf. examples 6 and 15). Spiramycin production of strain OS49.67 transformed by the vector pOS49.52 was analyzed by the technique described in Example 15. It was thus possible to demonstrate that this strain has a phenotype producer of spiramycins. Thus the protein TyIB allows complementation functional breakdown of the orf3 gene.
EXAMPLE 24 Improvement of the production of spiramycins by overexpression of the orfZ8c gene 24.1 Construction of the ~ pSPM75 plasmid The orfi8c gene was amplified by PCR using a couple oligonucleotide having a HindIII restriction site or a BamHI restriction site. These primers v have the following sequence 1o KF30: 5 'AAGCTTGTGTGCCCGGTGTACCTGGGGAGCC 3' (SEQ ID N ° 13 ~) with a HindIII restriction site (which is in bold) KF31: 5 'GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEQ ~ N ° 139) with the BamHI restriction site (which ~ gurè éri gras) Primers KF30 and KF31 respectively carry the HindlB restriction site and .,,:.
is BamHI (bold sequence). The ccit ~ pl ~ of a ~ norcës KF30 and: ~ K. ~~, l; erïriet:
d'àm lifter u ~, ~; ~~
,; j ~. , ph '; ~, ~ F, s' ~ f DNA fragment of an envirinin size I, S kb contiguous ~~~ gold gene, f28c en using ~ 'x ~ â
as a matrix the cosmid pSPM36 (cf. above). The 1.5 kb fragment as well got to been cloned into the vector pGEM-T easy (sold by the company Promega (Madison, Wisconcin, USA)) to give rise to the plasmid pSPM74. The plasmid 2o pSPM74 was then digested by the restriction enzymes HindIII and BamHI
and the insert HihdIIIlBamHI of approximately 1.5 kb obtained was subcloned in the vector pUWL201 (Cf.
Example 17.1) previously digested with the same enzymes. The plasmid as well got to was named pSPM75, it contains the entire coding sequence of orfZ8c placed under the control of the promoter ermE *.
25 24.2 Transformation of the OSC2 strain by the ~ pSPM75 plasmid The plasmid pSPM75 was introduced into the OSC2 strains by transformation protoplasts (Kieser, T et al., 2000). After transformation of protoplasts, the clones are selected for their resistance to thiostrepton. The clones are then subcultured on a medium containing thiostrepton and the transformation by the plasmid is verified by extraction of plasmids. Two clones have more particularly summer selected and named OSC2 / pSPM75 (1) and OSC2 / pSPM75 (2).
A sample of the strain OSC2 / pSPM75 (2) has been deposited with the National Collection of Cultures of Microorganisms (CNCM) Pasteur Institute, 25, rue 'from Doctor Roux 75724 Paris Cedex 15, France, October 6, 2003 under the number I-3101.
In order to test (effect of overexpression of the orfZ8c gene on the production of . ~ ..
spiramycins, the production in spiramycins of the clones OSC2 / pSPM75 (1) and OSC2 / pSPM75 (2) was tested by the technique described in Example 15.
Analysis of the production in spiramycins of the OSC2 strain was also carried out in parallel v, ~, for comparison. It was thus observed that the presence of the plasmid pSPM7 ~ 5 ''' significantly increases the production of spiramycins of the OSC2 strain.
This ° w ~
demonstrates that overexpression of orfl8c leads to an increase in production '',. } 15 in spiramycins and cQnfirtne its role as a regulator. ' i ~~~~ ~~~~
6 ~. $,,,, ~,. '.,. ~,,. . ~ nt ~ i ~~ tli rt .. ~. , ', ~, _ 5 .. ~ fi7 ~ 4 ES. ~~
~ IN4, L
f -. '. "m,; jl The production in spiramycins of the clones OSC2 / pSPM75 (1). ~ and OSC2 / pSPM75 (2) was also analyzed by HPLC (in the same way as in Example 17.2). Analysis of the spiramycin production of the OSC2 strain at also performed in parallel for comparison. The.results of this analysis are.
presented in table 44, the data are expressed in mg per liter of supernatant.
The results correspond to the total production of spiramycins (obtained in adding the production of spiramycin I, II and III).
Table 44. Production in spiramycins of strains derived from OSC2 transformed by pSPM75, (results expressed in mg / 1).
Spiramycins strain OSC2 / pSPM75 (1) 120 OSC2 / pSPM75 (2) 155 '' It is thus observed that the presence of the plasmid pSPM75 increases significantly the production in spiramycins of the OSC2 strain. This demonstrate well ..
that the overexpression of orf28e has a positive effect on the production in spiramycin.
~><;
EXAMPLE ZS: Analysis of the production of biosynthesis intermediates spiramycins of an inactivated strain in the orf8 gene The strain OS49.107, in which the orf8 gene is inactivated by insertion of there. ',' i ' cassette .flhyg, does not produce spirasnycins (cf. examples 7 and 15). The orf8 gene code ~ r. '.
1o a protein having a relatively strong similarity with several aminotransferases et. '° ~: -:
a ,, strongly suggests that the oxf8 gene encodes a 4 amino transferase responsible for 'the, ',, t. , r. :: r ~, ò, ~ '? ~ trçH:
transamination reaction necessary for the biosynthesis of fortisamine (cf.
figure "6), z '~
It is therefore expected that the biosynthesis of spiramycins will be blocked at stage of the. I
forocidin (see Figure 7). The strain OS49.107 which is non-producer of spiramycin should therefore produce forocidin.
A sample of OS49.107 supernatant was prepared according to the method described above (cf. example 16, without extraction with MIBK) and was analyzed by CL / SM as described above (see paragraph 20.2 and 20.3). In SIM mode, the mass 558 relating to the molecular ion of forocidin has been selected and several peaks have 2o have been detected. The presence of compounds of mass 558 is compatible with the hypothesis of role of gold in forosamine synthesis.

1 ~ 3 EXAMPLE 26 Analysis of the production of biosynthesis intermediates spiramycins of an inactivated strain in the orfl2 gene The strain SPM507, in which the orfl2 gene is inactivated, does not produce spiramycins (cf. examples 11 and 15). The orfl ~ gene would encode a 3,4 dehydratase responsible for the dehydration reaction necessary for the biosynthesis of the forosamine (see Figure 6). We therefore expect that the biosynthesis of spiramycins either blocked at the forocidin stage (see Figure 7). The SPM507 strain which is not producer of spiramycin should therefore produce forocidin.
A sample of SPM507 supernatant was prepared according to the method t lo described above (see example 16, without MIBK extraction) and was analyzed by CL / SM
as described above (see section 20.2 and 20.3). In these conditions, time to retention of forocidin is approximately 12.9 minutes. In SIM mode, the mass relating to the molecular ion [M + H] + of forocidin was selected and a pic was .. '~ -o.,,.
detected. The presence of a compound at 558 makes it possible to validate the hypothesis of the role ~ the 'v':
product of orfl2 in the biosynthesis of spiramycins.
~ However, forocidin is present in a small amount ~ elâtivernent and in test ~~ ' ~ ~ S ~ P ~ C:
conditions, an absorbent product at 238 nm was more particularly observed (time to retention of 17.1 min). LC / SM analysis made it possible to determine the mass of this compound which is 744.3 g / mole ([M + H] + = 744.3 majority product).
In order to obtain the structure, the above mentioned product was isolated and purified under the conditions described above (see paragraph 20.1)). The sentence organic (MIBK) is then recovered and evaporated. The dry extract is taken up with water and extract with heptane. The aqueous solution is then extracted by fixing on a cartridge Oasis HLB 1 g (Waters SAS, St-Quentin en-Yvelines, France). The compound is recovered by elution with a water / acetonitrile mixture 30/70. This solution is then injected (100 ~ L) on the analytical column and the fractions recovered on cartridge Oasis HLB 1 cc 30mg (Waters). Before use, the Oasis HLB 1 cc 30mg cartridges (Waters) are conditioned sequentially with acetonitrile, then a mélangeeau / acetonitrile (20v / 80v) and a mixture of water / acetonitrile 80/20.

The Oasis HLB 1 cc 30mg cartridge (Waters) is then washed successively with 1 ml water / acetonitrile (95/5), lml water / deuterated acetonitrile (95 / S), then eluted with 600.1 water / deuterated acetonitrile 40/60. The recovered solution is then directly analyzed by NMR.
The NMR spectrum obtained for this compound is as follows (NMR spectrum 19312V) 1H spectrum in CD3CN / D20 (chemical shifts in ppm): 0.92 (3H, d, J = 6Hz), 1.10 (1H, m), 1.14 (3H, s), 1.17 (3H, d, J = 6Hz), 1.22 (3H, d, J = 6Hz), 1.25 (3H, d, J = 6Hz), 1.40 (1H, m), 1.75 (1H, dd, J = 12 and 2Hz), 1.81 (1H, m), 1.90 (1H, d, J = 12Hz), '..,.' 2.05 (1H, m), 2.12 (3H, s), 2.15 (1H, m), 2.35 (2H, m), 2.45 (6H, s broad), 2.53 (1H, m), l0 2.64 (1H, dd, J = 12 and 9Hz), 2.80 (1H, dd, J = 9 and l6Hz), 2.95 (1H, d, J = 8Hz), 3.23 (2H, m), 3.34 (1H, d, J = 7Hz), 3.45 (3H, s), 3.49 (1H, m), 3.93 (1H, dd, J = 7 and 3Hz), 4.08 (1H, m), 4.37 (1H, d, J = 6Hz), 4.88 (1H, m), 5.05 (2H, m), 5.65 (2H, m), 6.08 (1H, dd, ° ' J = 8 and 12Hz), 6.40 (1H, dd, J = 12 and 9Hz), 9.60 (1H, s).
';"
.. 3 ~, These experiments have thus made it possible to determine the structure of this compound, cellè- ~ v: v =
~ 15 is shown in Figure 38. '~, ~~, '' ,. , ' t; -y .... ~ ',', '. ', .. ~ ,, .v'.> H '(;
EXAMPLE 27 Analysis of the production of biosynthesis intermediates spiramycins of an inactivated strain in the orf5 * gene The strain SPM501 has the genotype orf6 * :: attlS2hyg +. Thanks to the effect polar 20 of the insertion of the attl S2hyg + cassette into the orf 6 * gene, it could be determined that the 5 * orf gene is essential for the biosynthetic pathway of spiramycins. In effect, insertion of the excisable cassette into the coding part of the orf 6 * gene causes a stop total production of spiramycins by polar effect on the expression of orf5 * gene.
However, once the inserted cassette has been excised (and therefore when only the gene 25 orf6 * is deactivated, see examples 14 and 15), a production of spiramycin I.
This demonstrates that the orf 5 * gene is essential for the biosynthesis of spiramycin since its inactivation results in a total cessation of production in spiramycin.

The orf5 * gene encodes a protein with relatively strong similarity to several O-methyltransferases. The orf5 * gene would be an O-methyl transferase involved in the biosynthesis of platenolide. To verify this hypothesis, experiences CL / SM and NMR analysis were carried out on a strain of S. ambofaciens of genotype orf6 * :: attlS ~ hyg + obtained from a strain overproducing spiramycin.
A sample of the supernatant of this strain was prepared according to the method described above (cf. example 16, without extraction with MIBK) and was analyzed by CL / SM
as described above (see section 20.2 and 20.3). However, the column used is:; =. ':
an X-Terra column (Waters SAS, St-Quentin en-Yvelines, France), and the summer tension cone of the spectrometer is set to 380V to obtain the fragmentation of the compound analysis. Under these conditions, a product whose retention time is about 13.1 . ï .....
minutes is observed. The mass spectrum of this compound has a similar appearance to that of 'v:: ~
spiramycin I but the molecular ion is 829. The difference in mass of 14 days: ~: J = v, .r; ':
is compared to the mass of spiramycin can be explained by the absence of grouping y ':::
methyl on the oxygen carried by carbon n ° 4 of the lactone cycle (the structure of, ~ c ~;, '~' ~~
~~ s ,; . . _. , '~, k ~ yk ° ~~
. ', ..'. ~ t s corilpose is presented eri ~ figure 39). The ~ presenee of a cone at 829 p'ërri ~ ét de vàlid ~, '~'"
'' the hypothesis of the role of orf5 * in the biosynthesis of spiramycins.
By a microbioogic test carried out on a sensitive strain of M. luteus (cf.
example 15 and Figure 18) it has been shown that the intermediate molecule (spiramycin less methyl group whose structure is presented in figure 39) produced by strain orf6 * ::. f? atthyg + is much less active (by a factor of 10) than the spiramycin of origin with the methyl group in position 4.
EXAMPLE 28 Construction of new "excisable cassettes"
New excisable cassettes have been built. These tapes are very similar to the excisable cassettes already described in example 9. The difference main between old and new tapes is the lack in these last sequences corresponding to the ends of the S2 interposon, sequences which contain a transcription terminator from phage T4.
In cassettes without terminators, the gene that confers resistance to a antibiotic is flanked by the attR and attL sequences allowing excision. The gene resistance is the aac (3) IV gene which encodes an acetyltransferase which confers resistance to fapramycine. This gene is present in the S2aac cassette (access number GenBank X99313, Blondelet-Rouault, MH et al., 1997) and was amplified by PCR in using as a template the plasmid pOSK1102 (cf. above) and as primers the oligonucleotides KF42 and KF43 each containing the HindIII restriction site (in -., 10 bold) (AAGCTT) in 5 '.
KF42: 5'-AAGCTTGTACGGCCCACAGAATGATGTCAC-3 '(SEQ ID N ° 153) and y. . KF43: 5'-AAGCTTCGACTACCTTGGTGATCTCGCCTT-3 '(SEQ ID No. 154).
The PCR product obtained of approximately 1 kb was cloned into the E. coli vector pGEMT
go i Y ~ ,:
Easy giving rise to the plasmid pSPM83.
. . . ,,. r.
The vector pSPM83 was digested by fenzyne de.restriction Hindlll. The Shard ~, ~;
~ A. ' : ~. .. ':'; . r1, ~ 'f ç' HindIIi-HandIIi ydë the insert was isolated by pû ~ ificàtion from ~ from a gel agarose Ö, 8 ° / a * '''' ~
then cloned into the HindIII site located between the attL and attR sequences of different plasmids carrying the various possible excisable cassettes (cf. example 9 and figure 27) so as to replace the HindIII fragment corresponding to, ~ acc by the fragment HindIII corresponding to the aac gene alone. This made it possible to obtain the cassettes attlaac, att2aac and att3aac (depending on the desired phase, see example 9). according to gene orientation aac compared to the attL and attR sequences, a distinction is made between attl aae +, attl aac-, att2aac +
att2aac-, att3aac + and att3aac- (according to the same conventions as those adopted in Example 9).

EXAMPLE 29 Construction of a strain of S. ambofaciens interrupted in the orf gene ~ 8c Inactivation of the orfl8c gene was achieved using the technique of tapes excisable. The att3aac + excisable cassette (see example 28) has been amplified by PCR in using as matrix plasmid pSPM101 (Plasmid pSPM101 is a plasmid derived from the vector pGP704Not (Chaveroche et al., 2000) (Miller VL & Mekalanos NOT A WORD, 1988) in which the att3aac + cassette was cloned as an EcoRV fragment in the -EcoRV single site of pGP704Not) and using the following primers lo KF32:
5'CAACCGCTTGAGCTGCTCCATCAACTGCTGGGCCGAGGTATCGCGCGCG
CTTCGTTCGGGACGAA 3 '(SEQ ID N ° 155) and KF33:
v ~ <;
. 5'TGGGTCCCGCCGCGCGGCACGACTTCGACTCGCTCGTCTATCTGCCTCTT ~~ v ' CGTCCCGAAGCAACT 3 '(SEQ ID N ° 156) v ~ ~ '~' É ~~; fis :, '''' ~ ". '..' ~, ~ y ~ F ~ v The 39 nucleotides located at 1 end 5 of these oligonucleotides' count one = ~ ' sequence corresponding to a sequence in the orfZ8c gene and the 26 nucleotides located the longer in 3 '(shown in bold and underlined above) correspond to the sequence of one of ends of the att3aac + excisable cassette The PCR product thus obtained was used to transform the strain E.
soli hyper-recombinant DY330 (Yu et al., 2000) (this strain contains the exo, bet genes and gain phage lambda integrated into its chromosome, these genes are expressed at 42 ° C, it has been used in place of the E.coli KS272 strain (Chaveroche et al., 2000)) containing the cosmid pSPM36. So the bacteria were transformed by electroporation by PCR product and the clones were selected for their resistance to fapramycine. The cosmids of the clones obtained were extracted and digested with (enzyme of restriction BarrcHI, in order to verify that the digestion profile obtained matched the profile expected if the cassette (att3aac +) has been inserted into the orf ~ 8c gene, ie if he there had indeed been homologous recombination between the ends of the PCR product and the gene target. Construction verification can also be performed by any method known to those skilled in the art and in particular by PCR using the oligonucleotides and sequencing of the PCR product. A clone whose cosmid possesses the profile expected was selected and the corresponding cosmid was named pSPM107. This cosmid is a derivative of pSPM36 in which orfZBc is interrupted by the cassette att3aac +. The insertion of the cassette is accompanied by a deletion in the gene orf28c, the interruption begins at the 28th codon of orf28c It remains after the cassette the last 137 codons of orf28c.
l0 The cosmid pSPM107 was first introduced into the strain E.
coli DFiSa then in the Streptomyces ambofaciens OSC2 strain by transformation of protoplasts. After transformation, the clones are selected for their resistance to fapramycine. Clones resistant to apramycin are then subcultured respectively on medium with apramycin (antibiotic B) and on medium with puromycin (antibiotic;
A) (see Figure 9). Clones resistant to fapramycin (ApraR) and sensitive to the '' r-puromycin (PuroS) are in principle those where a double crossing event over ~, , ..,, _., <:;.
s pr ~ dmt Vit; that has the cirfZ8c gene interrupted by the cassette att3aac +. It is ... .. _. ° .. ~ .. ~ ,, clones were more specifically selected and the replacement of the saved copy ~
of orfl8c by the copy interrupted by the cassette has been checked by hybridization. So, the total DNA of the clones obtained was digested with several enzymes, separated on gel of agarose, transferred to the membrane and hybridized with a probe corresponding to the cassette att3aac + to check the presence of the cassette at the expected locus in the DNA
genomics of the clones obtained. Genotype verification can also be conducted by any method known to those skilled in the art and in particular by PCR in using the appropriate oligonucleotides and sequencing of the PCR product.
A clone with the expected characteristics (orf ~ 8e:: att3aac +) was more particularly selected and named SPM107. This clone therefore has the genotype orfZBc :: att3aac + and was named SPM107. There is no need to excision of cassette for studying the effect of inactivation of orfé8c, in view of orientation of genes (see Figure 3). Indeed, the fact that orf29 is oriented in the opposite direction at orf28c shows that these genes are not co-transcribed. Using a cassette excisable however allows the possibility of getting rid of the marker selection at at any time, in particular by transformation with the plasmid pOSV508.
In order to test the effect of the extinction of the orf ~ 8c gene on the production of spiramycins, the production in spiramycins of the strain SPM107 was tested over there s technique described in Example 15. It was thus possible to demonstrate that this strain has a non-spiramycin-producing phenotype. This demonstrates that the gene orfl8c is a gene essential for the biosynthesis of spiramycin in S.
ambofaciens.
EXAMPLE 30 Construction of a strain of S. ambofaciens interrupted in the orf31 gene The orf31 gene was inactivated using the technique of cassettesJ: ~ ~;
excisable. The att3aac + excisable cassette was amplified by PCR in using comriië ~ ' matrix the plasmid pSPM101 and the oligoi ~ nucleotides EDR71 and EDR72. ~ =, ~, "i P '. i. . EDR71: - ~, ~ aa ~~, w ~. ~ a * k ",,"'... i3 ~ i ~ ~ TE
5. ° CGTCATCGACGTGCGGGGAAGACAGAGGTGATACCGATGATCGCGCGC ~~
GCTTCGTTCGGGACGAA 3 '(SEQ ID N ° 157) EDR72:
5'GCCAGCACCTCGTCCAGCTGCTCGACGGAACTCACCCCCATCTGCCTCT
TCGTCCCGAAGCAACT 3 '(SEQ ID N ° 158) The 39 nucleotides located at the 5 'end of these oligonucleotides contain a sequence corresponding to a sequence in the orf31 gene and the 26 nucleotides located on more in 3 '(shown in bold and underlined above) correspond to the sequence of one of ends of the att3aac + excisable cassette.
The PCR product thus obtained was used to transform the strain E.
coli KS272 containing the plasmid pKOBEG and the cosmid pSPM36, as described by Chaveroche et al. (Chaveroche et al., 2000) (see Figure 12 for the principle, the plasmid pOS49.99 must be replaced by the cosmid pSPM36 and the plasmid obtained is not more pSPMl7 but pSPM543). So the bacteria were transformed by electroporation by this PCR product and the clones were selected for their resistance at fapramycine. The cosmids of the clones obtained were extracted and digested by many restriction enzymes, in order to verify that the digestion profile got corresponds to the expected profile if the cassette has been inserted (att3aac +) in the gene orf3l, i.e. if there was indeed homologous recombination between the ends of the PCR product and the target gene. Construction verification can also be carried out by any method known to a person skilled in the art and in particular by PCR
eïi ~; ' using the appropriate oligonucleotides and sequencing the PCR product. A
clone ' whose cosmid has the expected profile has been selected and the cosmid corresponding was named pSPM543. This cosmid is a derivative of pSPM36 in which orf ~ l is interrupted by the att3aac + cassette (see Figure 12). The insertion of the cassette is accompanied by a deletion in the orf3l gene, the interruption begins at level of ~, thirty sixth codon of orf3l. The last 33 remain after the cassette codons from orf3l .. ~ ~ 'w ~
.. ~, - r F:
~ fr.,,, # 'yxt The cosmid pSPM543 has been reduced, 'in the strain ~ Streptomyces ambofaçaéns if . . : Tas;., OSC2 (see above) by transformation of protoplasts (Kieser, T et al., 2000). After transformation, the clones are selected for their resistance to fapramycine. The clones resistant to apramycin are then subcultured respectively on middle with apramycin (antibiotic B) and on medium with puromycin (antibiotic A) (cf. figure 9). Clones resistant to fapramycin (ApraR) and sensitive to puromycin (Puros) are in principle those where a double crossing over event has occurred and who have the orf31 gene interrupted by the att3aac + cassette. These clones have been over specially selected and replacing the wild copy of orf31 over there copy interrupted by the cassette was verified by hybridization. So DNA
total clones obtained, was digested with several enzymes, separated on agarose gel, transferred on membrane and hybridized with a probe corresponding to the att3aac + cassette for verify the presence of the cassette at the expected locus in the genomic DNA of clones obtained. A second hybridization was carried out using as probe a DNA fragment obtained by PCR and corresponding to a very large part of the sequence coding for the orf3l gene.
Genotype verification can also be performed by any method known skilled in the art and in particular by PCR using oligonucleotides and sequencing of the PCR product.
A clone with the expected characteristics (orf3l:: att3aac +) was more particularly selected and named SPM543. It could indeed be verified thanks to two hybridizations that the att3aac + cassette was indeed present in the genome of this clone and that we obtain the expected digestion profile in the case of a v.
l0 replacement, following a double recombination event, of the gene wild by the copy interrupted by the att3aac + cassette in the genome of this clone. This clone therefore has the genotype: orf3l :: att3aac + and has been named SPM543. It is useless to excise the cassette to study the effect of inactivation from orf3l, at, seen from the orientation of the genes (cf. figure 3). Indeed, the fact that orf32c either oriented in . ., ~, ...
opposite direction to orf31 shows that these genes are not co-transcribed.
Using a ~.
excisable cassette, on the other hand, makes it possible to get rid of the ii if ~; . . ,, v. ,,, yti;
..; ::: yra;
dice marker ~ selection at any time, notary piàr ~ transformation ~ pale the plasmid '' pOSV508.
In order to test the effect of the extinction of the orf31 gene on the production of spiramycins, the production in spiramycins of the strain SPM543 was tested over there technique described in Example 15. It was thus possible to demonstrate that this strain has a non-spiramycin-producing phenotype. This demonstrates that the gene orf31 is a gene essential for the biosynthesis of spiramycin in S. ambofaciens.
EXAMPLE 31 Construction of a strain of S. ambofaciens interrupted in the orf32c gene The orf32c gene was inactivated using the technique of tapes excisable. The att3aac + excisable cassette was amplified by PCR in using like 3o matrix the plasmid pSPM101 and using the following primers KF52:
5'GATCCGCCAGCCTCACGTCACGCCGCGCCGCCTCCCTGACATCGCGCGC
GCTTCGTTCGGGACGAA 3 '(SEQ ID No. 159).
and KF53:
5'GAGGCGGACGTCGGTACGCGGTGGGAGCCGGAGTTCGACAATCTGCCTC
TTCGTCCCGAAGCAACT 3 '(SEQ ID N ° 160). ;
The 40 nucleotides located at the 5 ′ end of these oligonucleotides comprise a , sequence corresponding to a sequence in the orf32c gene and the 26 nucleotides located v ~ ' the longer in 3 '(shown in bold and underlined above) correspond to the sequence of a the ends of the att3aac + excisable cassette.
The PCR product thus obtained was used to transform the strain E.
coli;
hyper-recombinant DY330 (Yu et al., 2000) containing the cosmid pSPM36. So, the .
bacteria were transformed by electroporation with this PCR product and clones have been selected for their resistance to fapramycin. The cosmids of cloned obtained were extracted and digested by BamHI restriction enzymes, in the goal of ,;
'~ _ ~''check that the digestion profile obtained: correspônd aû profile waited if there was ~ ' insertion of the cassette (att3aac +) into the orf32c gene, i.e. if there is well had homologous recombination between the ends of the PCR product and the target gene.
The 2o verification of the construction can also be carried out by any known method of those skilled in the art and in particular by PCR using the oligonucleotides appropriate -and sequencing the PCR product. A clone whose cosmid has the profile expected a was selected and the corresponding cosmid was named pSPM106. This cosmid is a derived from pSPM36 in which orf32c is interrupted by the att3aac + cassette, The insertion of the cassette is accompanied by a deletion in the orf32c gene, interruption begins at the 112th codon of orf32c. After the cassette, the last codons of orf32c.
The cosmid pSPM106 was first introduced into the strain E.
coli DHSa then, in the Streptomyces ambofacie ~ es OSC2 strain by transformation.
After transformation, the clones are selected for their resistance to fapramycine. The clones resistant to apramycin are then subcultured respectively on middle with apramycin (antibiotic B) and on medium with puromycin (antibiotic A) (cf. figure 9). Clones resistant to fapramycin (ApraR) and sensitive to puromycin (Puros) are in principle those where a double crossing over event has occurred and who have the orf32c gene interroihpu by the att3aac + cassette. These clones have been over specially selected and replacing the wild copy of orf32c over there copy interrupted by the cassette was verified by hybridization. So DNA
total of.
clones obtained, was digested with several enzymes, separated on agarose gel, to transfer:"
10 on membrane and hybridized with a probe corresponding to the att3aac + cassette for verify the presence of the cassette in the genomic DNA of the clones obtained.
The genotype verification can also be performed by any known method of those skilled in the art and in particular by PCR using the oligonucleotides appropriate: ' and sequencing the PCR product.
. ~ ,,,.
A clone with the expected characteristics (orf32c:: att3aac +) was more a ~ ~ t ~.
'partçulièrenzent selectxoï ~ àé Ce: cltine '~ ôssèdë therefore le ~ ~~ ô. r '''~ g _ ~
. P. $ en., tYP ~: o ~ f32c:: att3aac + e ~ a $, k you was named SPM106. There is no need to excise the cassette for the study of ~ '~' the effect of inactivation of orf32c, given the orientation of the genes (cf.
figure 3). In .
Indeed, the fact that orf33 is oriented in the opposite direction to orf3 ~ c shows that these genes are not co-transcribed. However, the use of an excisable cassette allows to have the possibility to get rid of the selection marker at any time, especially by transformation with the plasmid pOSV508.
In order to test the effect of the extinction of the orf32c gene on the production of spiramycins, the production in spiramycins of the strain SPM106 was tested over there technique described in Example 15. It was thus possible to demonstrate that this strain has a spiramycin-producing phenotype. This demonstrates that the gene orf32c is not a gene essential for the biosynthesis of spiramycin in S.
ambofaciens.

List of constructions described in this request List of abbreviations: Am: Ampicillin; Hyg: Hygromycin; Sp:
Spiramycin; ts Thiostrepton; Cm: Chloramphenicol. Kn: Kanamycin, Apra: apramycin.
Name of the marker Main characteristics Reference selection construction pWElS Am (Wahl, and agi., 1987) pWEDl Am pWElS in which a (Gourmeleri et al., fragment HpaI-HpaI 1998) 4.1 kb was dlt pOJ260 Apra Conjugative, not replicative (Bierman and at al., Streptomyces 1992) pHP45 SlhygHyg Cassette Sahyg in (Blondelet-Rouault pHP45.

'et al., 1997) , pKC505 Apra Cosmide (Richardson ~
MA and ~

al., 1987) pIJ486 Ts Plsmid xphcttf,. (Wa ~ d and ' 'al., 1986) =
' at.

~ tr-, ', h;
. :.
~ c, ~. 6 ...
riiiiltictipies'St ~ ptotriyces . .

pOSint3 Am pt ~ c-xis-iht in pTrc99A (Raynal et al., 1998) pWHM3 Am, Ts Replicative shuttle vector (Vara et al., E. 1989) colilStreptomyces.

pKOBEG Cm (Chaveroche et al., 2000) pGP704Not Am (Chaveroche et al., 2000) pMBL18 Am (Nakano et al., 1995) pGEM-T EasyAm vector E. coli for Mezei et al., cloning 1994 PCR products pOS49.1 Am pWEDl with insert in Example 2 level of the BamHI site pOS49.11 Am Fragment SacI from pOS49.1 Example 2 in pUC 19.

pOSC49.12 Ch Fragment XhoI of pOS49.11 Example 2 in pBC SK +

pOS49.14 Cm, Hyg pOSC49.12 with gene Example 2 o ~~ f3 interrupted by the cassette ~ s hyg pOS49.16 Apra, Hyg Insert from pOS49.14 Example 2 in pOJ260 Cm Fragment BamHI-PstI Example 3 of pOS49.28 3.7kb from pOS49.1 in pBC;, i.

, SK +; '. ~ Y;

f pOS44.1 Apra, Sp pKC505 containing a (Pernodet and:
insert al., 5 ctrixarit h, 'rsistance, 1999 ~ ~. ~
;.,,. ~ la) ~, 'st' ~
,:, _ ~ ,, spiramycin in S.

griseofuscus pOS44.2 Ts, Sp Fragment Sau3AI from Example 3 1.8 kb pOS44.1 in pIJ486 pOS44.4. Am Insert of pOS44.2 in Example 3 pSPMS Am pWEDl with ADNE insert Example 3 of S. ambofaciens at the level of BamHI website pSPM7 Am pWEDl with ADNE insert example 3 of S. ambofaciens at the level of BamHI website pOSK1205 Hyg pBK-CMV in which Example 5 hyg replaces neo pOS49.67 Apra Fragment EcoRI-SacI Example 6 of pOS49.1, comprising a internal deletion of nucleotides, in pOJ260 pOS49.88 Am Fragment of 3.7 kb Example 7 PstI-POS49.1 EcoRI in pOS49.106 Am p049.88 with hyg in Example 7 orfg (hyg and gold, f ~ in the same orientation) pOS49.120 Am pOS49.88 with hyg Example 7 in gold, f ~

(hyg and orf in opposite directions) you OS49 ~ .107 ~ r,. ~ d ~, ; pa, Hyg Irisert ile., p ~ S49..106. ~
p 'loris Example 7, ,. ~ ,,, ~ ~.
.

pOJ260 pOS49.32 Am, Kn Fragment of 1.5 kb Example 8 internal orfl0 in pCR2.1-TOPO

pOS49.43 Am, Kn pOS49.32 with hyg Example 8 in orfl0 (hyg and orfl0 in the same orientation) pOS49.44 Am, Kn pOS49.32 with layg Example 8 in orfl0 (lzyg and orfl0 in of the opposite directions) pOS49.50 Apra, Hyg Insert from pOS49.43 Example 8 in pOJ260 pWHM3Hyg Am, Hyg pWHM3 in which Example 10 tsr is replaced by hyg pOSV508 Am, Ts ptrc-xis-int in pWHM3 Example 9 pattlS2hyg + Cm, Hyg Cassette attlS2hyg + Example 9 in pBC

SK + including the HindIII site was deleted patt352aac-Cm, Gn Cassette att3S2aac- Example 9 in pBC

SK + including the HindII ~ .a site t deleted pOSV510 Am, Hyg pro pra Amh in Example 10 pWHM3Hyg pOS49.99 Am Fragment EcoRI-BamHI Example 10 of 4.5 kb of pSPMS in pUCl9 pOSKl 102 Am, Apra pGP704Not containing Example 10 the cassette att3S2aac-pSPMl7 Am, Apra pOS4 ~ .99 in which Example 10 orf2 is interrupted by the cassette . . . att3Saaac, :, .. v ~. -v. ~

af . pSPM21 Hyg, AprapSK1205 ~ ctirtnant Exempl 10 l '.
the insert PSPMl7 EcoRI-XbbaI
(in which orfZ is interrupted by the att3S ~ aac- cassette) pSPM502 Am Fragment BgIII of 15.1 Example 11 kb from pSPM7 in pMBLl8 pSPM504 Hyg Insert of pSPM502 in Example 11 pOSK1205 pSPM507 Hyg, AprapSPM504 in which Example 11 orfl2 is interrupted by The tape att3, S ~ AAC-pSPM508 Hyg, AprapSPM504 in which Example 12 orfl3c is interrupted by The tape att3S ~ AAC-pSPM509 Hyg, Apra pSPM504 in which Example 13 orfl4 is interrupted by The tape att3S2aac-pBXLllll Am Fragment of l, ll kb Example 14 containing orf6 * amplifi through PCR from pSPM7, in the vector pGEM-T Easy pBXL1112 Am, Hyg pBXLl lll in which Example 14 the attl cassette S ~ hyg +
was introduced after deletion of 120 bp in sequence coding gene orf6 *

pBXLl 113 Apra, Hyg Insert PstI of 3.7 Example 14 kb from pBXLl 112 in pOJ260 v pSPM520 Am Amplified PCR fragment Example 17 through 'l the oligonucleotides Ik : EDR39- ~
~
r ~ ' EI) R42 ~ in pGEM-T ... , '' Esy ~ - ~
, ~~, '' .
' pSPM521 Am Amplified PCR fragment Example 17 through oligonucleotides EDR42 in pGEM-T Easy pSPM522 m Amplified PCR fragment Example 17 through oligonucleotides EDR42 in pGEM-T Easy pUWL201 Am, Ts (Doumith and al.

2000) pSPM523 Am, Ts Fragment HindIII-BamHI Example 17 of insert of the plasmid pSPM520 in the vector pUWL201 pSPM524 Am, Ts Fragment HindIII-BamHI Example 17 of insert of the plasmid pSPM521 in the vector pUWL201 pSPM525 Am, Ts Fragment HindIII-BamHI Example 17 of insert of the plasmid pSPM522 in the vector pUWL201 pSPM527 Am pSPM521 with offset Example 17 of frame of, reading at level of XhoI website pSPM528 Am, Ts Fragment HiheIIII-BamHIExample 17 of insert of the plasmid pSPM527 in the vector pUWL201 pVF 10.4, (Vara et al., 1985;

Lacalle et al., 1989) pPM803 Ts (Mazodier, P., et al., , ~
_ ~~

o: v, ~. '', ~ ~
. . f 1989) r1 pGEM-T pac-Am Pac-oriT cassette (amplifies Example 18 oriT by PCR from pVF 10.4 and pPM803) in in pGEM

T Easy pWED2. Am Pac-oriT cassette obtained Example 18 from pGEM-T pac-oriT

insert into pWEDl pSPM34 Am pWED2 with insert in Example 19 level of the BamHI site pSPM35 Am pWED2 with insert in Example 19 level of the BamHI site pSPM36 Am pWED2 with insert in Example 19 level of the BamHI site pSPM37 Am pWED2 with insert in Example 19 level of the BamHI site pSPM38 Am pWED2 with insert in Example 19 level of the BamHI site pSPM39 Am pWED2 with insert in Example 19 level of the BamHI site pSPM40 Am pWED2 with insert in Example 19 level of the BamHI site pSPM41 Am pWED2 with insert in Example 19 level of the BamHI site pSPM42 Am pWED2 with insert in Example 19 level of the BamHI site pSPM43 Am pWED2 with insert in Example 19 level from the BamHI sit ,;
.

pSPM44 Am pWED2 with insert in Example 19 level ~~ ~ R T.
'of the sit. ,. ,;
BamHI. ~, l ~ t, E ~
"

, ~
a ~ r ~

pSPM4 Am 5 Example 19 y pWED2 with insert at t level, a ~.

of the BamHI site pSPM47 Am pWED2 with insert in Example 19 level of the BamHI site pSPM48 Am pWED2 with insert in Example 19 level of the BamHI site pSPM50 Am pWED2 with insert in Example 19 level of the BamHI site pSPM51 Am pWED2 with insert in Example 19 level of the BamHI site pSPM52 Am pWED2 with insert in Example 19 level of the BamHI site pSPM53 Am pWED2 with insert in Example 19 level of the BamHI site pSPM55 Am pWED2 with insert in Example 19 level of the BamHI site pSPM56 Am pWED2 with insert in Example 19 level of the BamHI site pSPM58 Kn Fragment PstI-PstI Example 19 about 6kb of insert pSPM36 in pBK-CMV

pSPM72 Kn Fragment StuI-S'tuI Example 19 about 10 kb from the insert of pSPM36 clon in pBK-CMV

pSPM73 Cm Fragment EcoRI HindIIIExample 19 of pSPM72 insert in pBC-SK +, . _ pSPM515 ~. Fragenrit de FCR an ~ lifi.pa ~ Exempt 22 ~
. v. '' lT ~ f '~' ~

at' ..
,. , EDR31-EDR37 in pGEM-T

easy pSPM519 Am, Ts Insert HihdIIIlXbaI Example 22 of pSPM515 in pUWL201 pOS49.52 Apra Squence coding from Example 23 tylB under promoter control ermE *

in plasmid pKC1218 pSPM74 Am Amplified PCR fragment Example 24 through KF30-KF31 in pGEM-T

easy pSPM75 Am, Ts Insert HindIIIlBamHI Example 24 of pSPM74 in pUWL201 pSPM79 Kn Fragment PstI-PstI Example 19 about 2, Skb of the insert of pSPM36 in pBK-CMV

pSPM83 Am Amplified PCR fragment Example 28 through at KF42-I ~ F43 in pGEM-T

easy pSPM107 Am, Apra pSPM36 in which Example 29 orfZ8c is interrupted by The tape att3aac +

pSPM543 Am, Apra pSPM36 in which Example 30 orf31 is interrupted by the cassette att3aac +, pSPM106 Am, Apra pSPM36 in which Example 31 orf32c is interrupted by t The tape ..

. att3aac +

/
f, ~

. ~! I
: ~. _. . .. 7 .., .. ~
. lT.
~ ..

.. .... . t - ,, ..
' . . . . ", Deposit of biological material The following organizations were registered on July 10, 2002 with the Collection Nationale de Cultures de Microorganismes (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, according to the provisions of the Budapest Treaty.
- OSC2 strain under registration number I-2908.
- SPM501 strain under registration number I-2909.
- SPM502 strain under registration number I-2910.
- SPM507 strain under registration number I-2911.
- SPM508 strain under the registration number I-2912.

- SPM509 strain under the registration number I-2913.

- SPM21 strain under the registration number I-2914. ;:..at ...
at ~ '' ~ l r '~

. , . ,.
- SPM22 strain under the registration number I-2915.

- Strain OS49.67 under the registration number I-2916.
- Strain OS49.107 under registration number I-2917.
- Escherichia coli DHSa strain containing the plasmid pOS44.4 under the number I-2918.
The following organizations were registered on February 26, 2003 with the Collection Nationale de Cultures de Microorganismes (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, according to the provisions of the Budapest Treaty.
- strain SPM502 pSPM525 under registration number I-2977.

The following organizations have been deposited with the National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux Paris Cedex 15, France, October 6, 2003 according to the provisions of the Treaty of Budapest.
- OSC2 / pSPM75 (2) strain under the registration number I-3101.
'' 'v, - ,. :. _,; . ° ~:. ',, ::',,, '; , "

All cited publications and patents are incorporated into this application through reference.
Bibliography - Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. JMol Biol. (1990). 215 (3): 403-410.
'- Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. (1997). 25 (17): 3389-402.
- Amann, E., Ochs, B. and AbeI, KJ Tightly regulated tac promoter vectors useful r ...
for the expression of unfused and fused proteins in Escherichia coli Gene (1988) 69 (2), 301-315.
- Arisawa, A., Kawamura, N., Tsunekawa, H., Okamura, K., Tone, H. and Okamoto, R. Cloning and nucleotide sequences of two genes involved in the 4 "-O-acylation of macrolide antibiotics from Streptomyces thermotolerans. Biosci:
Biotechnol. Biochem. (1993). 57 (12): 2020-2025.
-. - Arisawa A, Kawamura N, Takeda K, Tsunekawa H, Okamura K, Okamoto R.
y: = ~: ~
Cloning of the macrolide antibiotic biosynthesis gene acyA, which encodes 3-O
,, acyltransferase, from Streptomyces thermotolerans and its use for direct; ~ r y ~ 20 ~; fermentative production, ~ of;, a: hybrid macrolidë an ~ ibiotic: ' Appl Ehvat ~ iar ~, R ~;
7: t ~ t ~
Microbiol (1994). 60 (7): 2657-2660.
- August, PR, Tang, L., Yoon, YJ, Ning, Streptomyces, Mueller, R., Yu, TW, Taylor, M., Hoffinann, D., Kim, CG, Zhang, X., Hutchinson, CR and Floss, HG
Biosynthesis of the ansamycin antibiotic rifamycin: deductions from the molecular analysis of the rif biosynthetic Bene cluster of Amycolatopsis mediterranei 5699. Chem: Biol. (1998) 5 (2), 69-79.
- Ausubel Fred M., Brent Roger, Kingston Robert E., Moore David D., Seidman JG, Smith John A., Struhl Kevin (Editors). Current Protocols in Molecular Biology, published by John Wiley & Sons Inc. Current Protocols Customer Service, 605 Third Avenue, 9th Floor New York, NY 10158 USA (updated edition of March 2002).
- Baltz RH, McHenney MA, Cantwell CA, Queener SW, Solenberg PJ.
Applications of transposition mutagenesis in antibiotic producing streptomycetes.
Ahtonie Yan Leeuwenhoek. (1997). 71 (1-2): 179-187.
- Bate N, Butler AR, Gandecha AR, Cundliffe E. Multiple regulatory genes in tea tylosin biosynthetic cluster of Streptomyces fradiae. Chem Biol. (1999). 6 (9):
617-624.

- Bate, N., Butler, AR, Smith, LP. and Cundliffe, E. The mycarose-biosynthetic Genoa of Streptomyces fradiae, producer of tylosin. Mierobiology (2000). 146 (Pt 1), 139-146.
- Bayley C., Morgan, Dale EC, Ow DW Exchange of Bene activity in transgenic plants catalyzed by the Cre-lox site specific system. Plant Mol.
Biol (1992). 18: 353-361.
- Bentley, SD, Chater, KF, Céirdeno-Tarraga, AM, Challis, GL, Thomson, NR, James, KD, Harris, DE, Quail, MA, Kieser, H., Harper, D., Bateman, A., Brown, S., Chandra, G., Chen, CW, Collins, M., Cronin, A., Fraser, A., Goble, A., l0 Hidalgo, J., Hornsby, T., Howarth, S., Huang, CH, Kieser, T., Larke, L., Murphy, L., Oliver, K., O'Neil, S., Rabbinowitsch, E., Rajandream, MA, Rutherford, K .. ,, Rutter, S., Seeger, K., Saunders, D., Sharp, S., Squares, R., Squares, S., Taylor, K.,, .1 Warren, T., Wietzorrek, A., Woodward, J., Barrell, BG, Parkhill, J. and Hopwood, DA Complete genome sequence of the model actinomycete Streptomyces coelicolor A3 (2). Nature (2002). 417 (6885), 141-147.
- Bibb MJ, Findlay PR, Johnson MW. The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable ~.
identification of protein-coding sequences. Uncomfortable. (1984) 30 (1-3): 157-166.
- Bibb MJ, Janssen GR, Ward JM. Cloning and analysis of the promoter region of ~; ~:
. 20 the erythromyein resistance Bene (ermE) of Streptomyces, erythraeus.
Genes, a _, (1985). 38 (1-3): 215 26.. >
~% y ::
..., e. . ', .It - Bibb MJ, White J, Ward JM, Janssen GR. The mRNA for the 23S rRNA
methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site. mol Microbiol.
(1994). 14 (3): 533-45.
- Bierman-M; Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Uncomfortable. 1992; 116 (1): 43-9.
- Blondelet-Rouault MH., Weiser J., Lebrihi A., Branny P. and Pernodet JL.
Antibiotic resistance gene cassettes derived from the S2 interposon for use in E.
coli and Streptomyces. Gene (1997) 190: 315-317.
- Boccard F., Smokvina T., J.-L., Pernodet Fridmann A., and Guérineau M., Structural analysis of loci involved in pSAM2 site-specific integration in Streptomyces. Plasmid, (1989a). 21: 59-70.
- Boccard F., Smokvina T., J.-L., Pernodet Fridmann A., and Guérineau M .. The integrated conjugative plasmpid pSAM2 of Streptomyces ambofaciens is related to temperate bacteriophages. EMBO J. (1989b) 8: 973-980.

- Brunelli JP, Pall ML, A series of Yeast / E. coli lambda expression vectors designed for directional cloning of cDNA and cre / lox mediated plasmid excision.
Yeast. (1993) 9: 1309-1318.
- Camilli A., Beattie DT and Mekalanos JJ Use of genetic recombination as at reporter of people expression. Proc. Natl. Acad. Sci. USA (1994) 91 (7), 2634-2638.
- Çampelo, AB and GiI, JA The candicidin gens cluster from Streptomyces gxiseus IMRU 3570. Microbiology (2002) 148 (Pt 1), 51-59. .
- Carreras C, Frykman S, Ou S, Cadapan L, Zavala S, Woo E, Leaf T, Carney J, Burlingame M, Patel S, Ashley G, Licari P. Saccharopolyspora erythraea-catalyzed bioconversion of 6-deoxyerythronolide B analogs for production of :. ' novel erythromycins. JBiotechn ~ l. (2002). 92 (3): 217-28.
- Chao K.-M., Pearson WR, Miller W. Aligning two sequences within a specified diagonal band. Comput. Appl. Biosci. (1992) 8: 481-487.
- Chater KF The improving prospects for yield increase by genetic engineering in antibiotic-producing Streptomycetes. Biotechnology. (1990). 8 (2): 115-121.
- Chaveroche MK, Ghigo JM, d'Enfert C. A rapid method for efficient gens' v . replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Resv; 4 ~.:
2000; 28 (22): E97. 'ï
,,,;
~ .N. . '. ~ '. t. ~., - Church GM, Crilbert W. Gerlômic seqûencing. Proc Natl Acad Sci US A. (1984) 'v 81 (7): 1991-5.
- Churchward G, Belin D, Nagamine Y. A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors. People. (1984) 31 (1-3): 165-71.
- Comstock, LE, Coyne, MJ, Tzianabos, AO and Kasper, DL Interstrain variation of the polysaccharide B biosynthesis locus of Bacteroides fragilis:
characterization of the region from strain 6388 J. Bacteriol. (1999). 181 (19) 6192-6196.
- Cox KL, Baltz RH. Restriction of bacteriophage plaque formation in Streptomyces spp. JBacteriol. (1984) 159 (2): 499-504.
- Dale EC, Ow DW, Gene transfer with subsequent removal of the selection Bene from the host genome. Proc. Natl. Acad. Sci. USA (1991). 88: 10558-10562.
- Doumith M, Weingarten P, Wehmeier UF, Salah-Bey K, Benhamou B, Capdevila C, Michel JM, Piepersberg W, Raynal MC. Analysis of genes involved in 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol Gen Genet. (2000) 264 (4): 477-485.
- Draeger, G., Park, Streptomyces-HH and Floss, HG Mechanism of the 2-deoxygenation step in the biosynthesis of the deoxyhexose moieties of the antibiotics granaticin and oleandomycin J. Am. Chem. Soc. (1999) 121: 2611-2612.
- Gandecha, AR, Large, SL and Cundliffe, E. ~ Analysis of four tylosin biosynthetic genes from the tylLM region of the Streptomyces fradiae genome. Uncomfortable. (1997).
184 (2): 197-203.
- Geistlich, M., Losick, R., Turner, JR and Rao, RN Characterization of a novel regulatory gene governing the expression of a polyketide synthase gene in Ambofacial streptomyces. Mol. Microbiol. (1992). 6 (14): 2019-2029.
- Gourmelen A, Blondelet-Rouault MH, Pernodet JL. Characterization of a glycosyl transferase inactivating macrolides, encoded by gimA from Ambofacial streptomyces. Antimierob Agents Chemother. (1998). 42 (10): 2612- ' 9.
- Huang X. and Miller W. A time-efficient, linear-space local similarity algorithrïl. ~
Adu. Appl. Math. (1991). 12: 337-357.
r. - Hara O and Hut ~ hmstin CR. Clo ~ ng a ~ decam ~ cin (MLS) -resistance genes: frôm - ~: ~, - '~~ 2ü Streptoïnycès zriycârtifâc'iéüs, Strêpttirri ~ cés lividâns and Streptomyces coelicôlor A3 (2). JAntibiot (Tokyo). (1990). 43 (8): 977-991.
- Hara O and Hutchinson CR. A macrolide 3-O-acyltransferase gene from the midecamycin-producing species Streptomyces mycarofaciens. J Bacteriol.
(1992). 174 (15): 5141-5144.
- Hoffmeister D, Ichinose K, Domann S, Faust B, Trefzer A, Drager G, Kirschning A, Fischer C, Kunzel E, Bearden D, Rohr J and Bechthold A. The NDP-sugar co substrate concentration and the enzyme expression level influence the substrate specificity of glycosyltransferases: cloning and characterization of deoxysugar biosynthetic genes of the urdamycin biosynthetic gene cluster. Chem Biol.
(2000). 7 (11): 821-831.
- Hopwood, DA Future possibilities for the discovery of new antibiotics by genetic engineering. In Beta-lactam antibiotics. Edited by MRJ Salton and GD
Shockman. New York: Academic Press. (nineteen eighty one). 585-598.
- Hopwood DA, Malpartida F., Kieser HM, Ikeda H., Duncan J., Fujü L, Rudd AM, Floss HG and Omura S. Production of 'hybrid' antibiotics by genetic engineering. Nature. (1985a). 314 (6012): 642-644.

- Hopwood DA, Malpartida F., Kieser HM, Ikeda H. and Omura S. (1985b) In Microbiology (ed S. Silver). American Society for Microbiology, Washington D.
C., 409-413.
- Houben Weyl, 1974, in Meuthode der Organischen Chemie, E. Wunsch Ed., Volume 15-I and 15-II, - Hutchinson, CR Prospects for the discovery of new (hybrid) antibiotics by genetic engineering of antibiotic-producing bacteria. Med Res Rev. (1988). 8 (4) 557-567.
- Hutchinson CR, Borell CW, Otten SL, Stutzman-Engwall KJ and Wang Y.
lo Drug discovery and development through the genetic engineering of antibiotic-producing microorganisms J. Med. Chem. (1989) 32 (5): 929-937.
- Ishikawa J, Hotta K. FramePlot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G + C content.
FEltISMicrobiol Lett. (1999) 174 (2): 251-3.
- Kieser, T, Bibb, MJ, Buttner MJ, Chater KF, Hopwood DA. Practical .:
Streptomyces Genetics. 2000. The John Innes Foundâtion, Norwich LTIC.
- Kuhstoss et al. Production of a novel polyketide through the construction of at hybrid polyketide synthase: Gene. (1996). 183 (1-2): 231-236.
ax via 4, F, ,. . - Lacalle RA, Pulido D, Varâ J, Zàlacaui M, Jimenez A. Molecûlar analysis of the; The 2o pac gene encoding a puromycin N-acetyl transferase from Streptomycés alboniger. Uncomfortable. (1989). 79 (2): 375-380.
- Lakso M, Sauer B, Mosinger B Jr, Lee EJ, Manning RW, Yu SH, Mulder KL, Westphal H. Targeted oncogene activation by site-specific recombination in transgenic mice. ProcNatlAcad Sci ZJSA. (1992) 89 (14): 6232-6.
- Li, TB, Shang, GD, Xia, HZ and Wang, YG Cloning of the sugar related biosynthesis Bene cluster from Streptomyces tenebrarius H6. Sheng Wu Gong ChengXue Bao (2001). 17 (3): 329-331.
- Ligon, J., Hill, S., Beck, J., Zirkle, R., Molnar, L, Zawodny, J., Money, S. and Schupp, T. Characterization of the biosynthetic gene cluster for the antifungal polyketide soraphen A from Sorangium cellulosum So ce26. Gene (2002). 285 (1-2), 257-267.
- Liu L, Saevels J, Louis P, Nelis H, Rico S, Dierick K, Guyomard S, Roets E, Hoogmartens J. Interlaboratory study comparing the microbiological potency of spiramycins I, II and III. JPharm Biomed Anal. (1999). 20 (1-2): 217-24.

- Mazodier P, Petter R, Thompson C. Intergeneric conjugation between Escherichia coli and Streptomyces species.JBacteriol. (1989). 171 (6): 3583-5.
- Merrifield RB, 1965a, Nature, 207 (996): 522-523.
- Merrifield RB., 1965b, Science, 150 (693): 178-185.
- Merson-Davies, LA and Cundliffe, E. Analysis of five biosynthetic tylosin Genoa from the tyllBA region of the Streptomyces fradia ~ genome, Moleeular microbiology. (1994). 13 (2): 349-355.
- Miller VL, Mekalanos JJ. A novel suicide vector and its use in construction of.
insertion mutations: osmoregulation of outer membrane proteins and virulence :. ~ ,, determinants in Vibrio cholerae requires toxR. JBacteriol. (1988) 170 (6): 2575-83.
- Nakano, Y., Yoshida, Y., Yamashita, Y. & Koga, T. Construction of a series of pACYC-derived plasmid vectors. Gene (1995). 162: 157-8.
- Nielsen H., Engelbrecht J., Brunak S. and von Heijne G. Identification of:, prokaryotic and eukaryotic sigc ~ al peptides and prediction of their cleavage Site (s.
. Protein Engineeri ~ tg. (1997) .10: 1-6.
- Oh SH, Chater KF. Denaturatiori of circular or lmear DNA facilitates targeted k integraüve transfoimat ~ ori''of Sireptonz ~ ces eôëlicolor ä3 (2): 'ossible relev ~ ü ~ é ~;
the ~,,. . , ...,. ~,; ',' - ", .. ~ v 3 Nef; P ,.
to other organisms. JBaë'tériol. ~ 1 ~ 997; "1'79 (1) ¿22 7.
- Olano C, Lomovskaya N, Fonstein L, Roll JT, Hutchinson CR. A two-plasmid system for the glycosylation of polyketide antibiotics: bioconversion of epsilon rhodomycinone to rhodomycin D. Chem Biol. (1999). 6 (12): 845-55.
- Omura S, Kitao C ~ Hamada H, Ikeda H. Bioconversion and biosynthesis of 16-membered macrolide antibiotics. X. Final steps in the biosynthesis of Spiramycin, using enzyme inhibitor: cerulenin. Chem Pharm Bull (Tokyo). (1979a). 27 (1):
176-82.
- Omura S, Ikeda H, Kitao C. Isolation and properties of spiramycin I 3-hydroxyl acylase from Streptomyces and ambofaciens. JBiochem (Tokyo). (1979b). 86 (6):
1753-8.
- Omura, S., Ikeda, H., Ishikawa, J., Hanamoto, A., Takahashi, C., Shinose, M., Takahashi, Y., Horikawa, H., Nakazawa, H., Osonoe, T., Kikuchi, H., Shiba, T., Sakaki Y. and Hattori, M. Genome sequence of an industrial microorganism Streptomyces avermitilis: Deducing the ability of producing secondary metabolites. Proc. Natl. Acad. Sci. USA (2001). 98 (21), 12215-12220.

- Pearson WR and DJ Lipman. Improved Tools for Biological Sequence Analysis. Proc. Natl. Acad. Sci. ÜSA 1988, 85: 2444-2448.
- Pearson WR Rapid and Sensitive Sequence Comparison with FASTP and FASTA. Methods in Enzymology. 1990, 183: 63-98.
- Pernodet JL, Simonet JM, Guerineau M. Plasmids in different strains of Streptomyces ambofaciensd free and integrated form of plasmid pSAM2. mol Gen Genet. (1984); 198 (1): 35-41.
- Pernodet JL, Alegre MT, Blondelet-Rouault MH, Guerineau M. Resistance to spiramycin in Streptomyces ambofaciens, the producer organism, involves at least two different mechanisms. J Gen Microbiol. (1993); 139 (Pt 5): 1003-11.
- Pernodet JL, Fish S, Blondelet-Rouault MH, Cundliffe E. The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using a specifically deleted, antibiotic-sensitive strain of Streptomyces lividans.
Antimicrob Agents Chemother. (1996), 40 (3): 581-5.
- Pernodet JL, Gourmelen A, Blondelet-Rouault MH, Cundliffe E. Dispensable:, ribosomal resistance to spiramycin conferred by srmA in the spiramycin produc ~. ~ ..
Ambofacial streptomyces. Microbiology. (1999), 145 (Pt 9): 2355-64.
,. . ~. ., if: ï
-, Pfoestl, A., Hofinger, A., Kosriia, P., ~ And Messner, P. Biosynthesis of dTDP 3 '' acetairiido-3,6-ïüdeô ~ ~ -al hâ D- ali ~ ctôsê in ~ Anëû inibacillus thermoaero y, p,. b. , z .g,. ~ '. Phiru. ~ D, J, 2Ø v L420-91'T. J Biol Cherü (2003), 278 (29): 26410-26417.
- Rao RN, Richardson MA, Kuhstoss S. Cosmid shuttle vectors for cloning and analysis of Streptomyces DNA. Methods Enzymol. (1987); 153: 166-98.
- Raynal A, Tuphile K, Gerbaud C, Luther T, Guerineau M, and Pernodet JL ..
Structure of the chromosomal insertion site for pSAM2: - functional analysis in Escherichia coli. Molecular Microbiology (1998) 28 (2) 333-342.
- Redenbach, M., Kieser, HM, Denapaite, D., Eichner, A., Cullum, J., Kinashi, H.
and Hopwood, DA A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3 (2) chromosome Mol. Microbiol.
(1996). 21 (1): 77-96.
- Richardson MA, Kuhstoss S, Solenberg P, Schaus NA, Rao RN. A new shuttle cosmid vector, pKC505, for streptomycetes: its use in the cloning of three different spiramycin-resistance genes from a Streptomyces ambofaciens library.
Uncomfortable. (1987); 61 (3): 231-41.
- Robinson, JA Enzymes of Secondary Metabolism in Microorganisms. Chem Soc Rev. (1988). 17: 383-452.

- Russell SH, Hoopes JL, Odell JT. Directed excision of a transgene from the seedling genome. Mol Geh Genet. (1992). 234 (1): 49-59.
- Sambrook J, Frisch EF, Maniatis T. Molecular Cloning: a laboratory manual 2na ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York USA
(1989).
- Schoner B, Geistlich M, Rosteck P Jr, Rao RN, Seno E, Reynolds, P, Cox K, Burgett S and Hershberger C. Sequence similarity between macrolide-resistance determinants and ATP-binding transport proteins. Uncomfortable. (1992). 115 (1-2), 93-96.
l0 - Sezonov G, Hagege J, Pernodet JL, Friedmann A and Guerineau M .:
Characterization of pra, a Bene for replication control in pSAM2, the integrating.
element of Streptomyces ambofaciens. Mol Microbiol. (1995). 17 (3): 533-44.
- Sezonov G., Blanc V., Bamas-Jacques N., Friedmann A., Pernodet JL and M.
Guerineau, Complete conversion of antibiotic precursor to pristinamycin lIA by -.
over expression of Streptomyces pristinaespiralis biosynthetic genes, Nature Biotechnology. (1997) 15: 349-353.
- Sezonov G, Possoz C, Friedmann A, Pernodet JL, Guerineau M. KorSA from the ~ Tv:
Streptomyces integrative element pSAM2 is a central transcriptional repressoi :,; .yt target genes and binding sites JBacteriol (2000 182 (5) ,: 1243-50.
'''~,,; ..
- Simon R .; Priefer U tond Piihler. A broâd hôst rangé mobilization system for mp.
vivo genetic engineering: transposon mutagenesis in grain negative bacteria.
BiolTech ~ cology (1983). 1: 784-791.
- Simon, et al., Plasmid vectors for the genetic analysis and manipulation of rhizobia and other grain-negative bacteria, p. 640-659. In A. Weissbach, and H.
Weissbach (eds.), Methods in enzymology, vol 118, Academic Press, Inc., Orlando, 1986 - Summers, RG, Donadio, Streptomyces, Staver, MJ, Wendt-Pienkowski, E., Hutchinson, CR and Katz, L. Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene cluster of Saccharopolyspora erythraea that ax involved in L-mycarose and D-desosamine production. Microbiology (1997). 143 (Pt 10): 3251-3262.
- Van Mellaert L, Mei L, Lammertyn E, Schacht S, Anne J. Site-specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector. Microbiology. (1998). 144 (Pt 12): 3351-8.

- Vara J, Lewandowska-Skarbek M, Wang YG, Donadio S, Hutchinson CR.Cloning of genes governing the deoxysugar portion of the erythromycin biosynthesis pathway in Saccharopolyspora erythraea (Streptomyces erythreus).
J
Bacteriol. (1989). 171 (11): 5872-81.
- Vara J, Malpartida F, Hopwood DA, Jimenez A. Cloning and expression of a puromycin N-acetyl transferase gene from Streptomyces alboniger in Streptomyces lividans and Escherichia cgli. Ge ~ e. (1985). 33 (2): 197-206.
- Wahl, GM, KA Lewis, JC Ruiz, B ~ Rothenberg, J. Zhao, and GA
Evans.
Cosmid vectors for rapid genomic walking, restriction mapping, and gene l0 transfer. Proc. Natl. Acad. Sci. USA (1987). 84: 2160-2164.
- Waldron, C., Matsushima, P., Rosteck, PR, Broughton, MC, Turner, J., Madduri, K., Crawford, KP, Merlo, DJ and Baltz, RH Cloning and analysis of tea spinosad biosynthetic Bene cluster of Saccharopolyspora spinosa (1) Chem.
Biol.
(2001) 8 (5): 487-499.
- Walczak RJ, Hines JV, Strohl WR, Priestley ND.Bioconversion of the:.: ' anthracycline analogue desacetyladriamycin by recombinant DoxA, a P450-monooxygenase from Streptomyces sp. strain C5. OrgLett. (2001). 3 (15): 2277-ar °
..,;
9.
at - Wang, ZX, "Li, SM and Heide, L Identification of the coumermycin A (1) sri biosyàthetiç gene cluster tif Streptoni ~ ées rishiriènsis DSM 40489.
Antimicrob ~, ~ r Agents Chemother_ ~ (2Ö00) ~ 44 (11), 3040-3048.
- Ward, JM, Janssen, GR, Kieser, T, Bibb, MJ, Buttner, MJ & Bibb, MJ
Construction and characterization of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase from Tn5 as indicator. Mol Gen Genet (1986). 203: 468-478.
- Wehmeier UF. New multifunetional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on XGa1 plates. Uncomfortable. (1995). 165 (1):
149-150.
- Wilms B, Hauck A, Reuss M, Syldatk C, Mattes R, Siemann M, Altenbuchner J.
High-cell-density fermentation for production of LN-carbamoylase using an expression system based on the Escherichia coli rhaBAD promoter. Biotechnol Bioeng. (2001). 73 (2): 95-103.
- Worley KC, Wiese BA, and Smith RF BEAUTY: An enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results. Genome Research (1995). 5: 173-184.

- Wu K, Chung L, Revill WP, Katz L and Reeves CD. The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Uncomfortable. (2000). 251 (1):

90.
- Xue Y, Zhao L, Liu HW and Sherman DH. A Bene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: architecture of metabolic diversity.
ProcNatlAcad Sci USA. (1998). 95 (21): 12111-12116.
- Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG and Court DL. An efficient recombination system for chromosome engineering in Escherichia coli. proc lo Natl Acad Sci USA. (2000). 97 (11): 5978-83.

SEQUENCE LISTING
<110> Aventis Pharma SA
CNRS
<120> POLYPEPTIDES INVOLVED IN THE BIOSYNTHESIS OF SPIRAMYCINS, NUCLEOTIDE SEQUENCES ENCODING THESE POLYPEPTIDES AND THEIR
APPLICATIONS
<130> FRAV2002 / 0028 <150> FR 0212489 <151> 2002-10-08 <150> FR 0302439 <151> 2003-02-27 ' <150> Us 60 / 493,490 <151> 2003-08-07 <160> 161 <170> Patentln version 3.2 <210> 1 <211> 30943 <212> DNA
<213> Streptomyces ambofaciens <400> 1 gaattcggca attcccgggg cgccgggaaa ccggcacgcc attccgacca cggcaacggc 60 gtcggaccgg tcgtcactgc gggaaatcgc gagttctcca gacacctgca tccctcatat 120 gttcgccgta ccacgccgtg gcttttctgc cttttcttga tettcccgag cgtacagcgg 180 gcgaactgcc gggcgacagg aacggccggt gaacgacaat caattgtgtc aagttcggag 240 attgtccacc gattctcgtc accggagacg gcgcgggatc atgcgggacc acacggcatc 300 gcaccaggtc egcagggtcg gcgctccgac gtcccggccg gtcgcgcact ccggtgacct 360 gcacgcggag tcctgggcga gcggagaaga tttcagtacc tcgcggcgcg ggacaaccac 420 ttcgcgacga atatgtcagg tctccccgag cggtccgtgc cgccccgccc tgacccgtcc 480 gcgcccgtcc cgctccgccc cggtcgtcat ctcggccgga atttcagtcg gcagctcatt 540 -gtgtcaggtt cgccttgccg acattctccg gagattccta agctctgccg gtaaccggga 600 ccggaaccac cgtgccgcgc gttcggtcca cacaccgctt ttcgaggagt ccgactgatg 660 ggtgaggccg tgacgggacc gatggagctg agcaaggacg cggacgcccg ggggctgctt 720 gagtggttcg cgtacaacag gacgcgtcat ccggtgttct gggacgagac ccgacaggcg 780 tggcaggtct tcggctacga cgactacgtg acggtgtcga acaacccgca gttcttctcc 840 tcggacttca acatggtgat gccgacgccg cccgaactgg agatgatcat cggtccgggc 900 acgatcggcg cgctggaccc gcccgcgcac ggaccgatgc gcaagctggt gagccaggcg 960 ttcacccccc gacggatcgc ccggctggag cccagggtgc gcgcgatcac cgaggagctc 1020 ctggacaagg tggggcagca ggacgtcgtc gacgccgtgg gtgacctgtc ctacgcgctg 1080 ccggtcatcg tgatcgccga actgctgggc atacccgccg gcgaccgtga cctgttccgg 1140 gagtgggtcg acaccctgct gacgaacgag ggcctggagt acccgaacct cccggacaac 1200 ttcaccgaga egatcgcgcc cgcgctcaag gagatgaccg actacctcct gaagcagatc 1260 cacgccaagc gggacgcgcc cgccgacgac ctggtcageg ggetggtcca ggeggagcag 1320 gacggecgcc ggctgaccga cgtcgagatc gtcaacatcg tcgcgctgct cetgacggcg 1380 gggcacgtet ectccagcac cctgctcagc aacetgttcc tggtcctgga ggagaacecg 1440 caggcgctgg aggacctgcg ggccgatcgc tccctggtge ccggcgcgat egaggagacg 1500 ctgcgctacc gcagcccctt caacaacatc ttccggttcg tcaaggagga caccacegtc 1560 ctcggtccgc tcatggagaa gggccagatg gtgatcgcct ggagccagtc cgcca ~ ecgg 1620 gacccceggc acttcccgga cccggacacc ttcgacatec gecgetcgga cggcacecgg 1680 cacatggcct tcgggcacgg catccaccac tgcetgggtg ecgccctcgc ccgcctggag 1740 ggcaaggtca tgctcgaact cctcctggac cgggtccaag gcttccgcat cgaccacgag 1800 cacaccgtgt tctacgaggc cgaccagctc actccgaagt acctgcccgt ccgggtcgac 1860 tggaactgaa cccgagggtc tcgtcccgga gtccagggec gtccegagcc ggccctggac 1920 ctcacgaccg cccgataagg agcgccgcca tcgccgagaa cacagccgag ctccctgccc 1980 ggcgggtcgg caggatcaag ccgtgceggc tgatcaggct cgagcagcac atcgacccgc 2040 gcggcagcct ctccgtgatc gagtccggcg tgaccgtgga cttccccgtc cgacgcgtct 2100 actacatgca tggccagacc cagtcctctc ecccgcgcgg cctgcacgcg caccgcaccc 2160 tggaacaact cgtcatcgcc gtccacggcg ccttctccat caccctcgac gacggcttcc 2220 agcacgccac ctaccgtctg gacgaacccg gagccggact ctgcatcggc eccatggtct 2280 ggcgcgtcct gaaggacttc gaccccgaca ccgtggccct ggtcctcgcc tcgcagcact 2340 acgaggagtc cgactactac cgcgactacg acaccttcct gcatgacgca cggagcctca 2400 catgaccatc cccttectcg acgcgggcgc cggctaccgg gagttgcgag ecgagatcga 2460 cgcggccctg cagcgggtgt ccgcctccgg ccgctatctg ctcgacgcgg aactcgcggc 2520 cttcgaggag gagttcgccg cgtactgega caacgaccac tgtgtggcgg tgggcagtgg 2580 ctgcgacgcg ctggagctgt ccctgcgggc getggacatc ggtccegggg acgaggtggt 2640 ggtgcccgegcacaccttcatcgggacctggctggccgtgtccgctaccggggcacggcc2700 ggtggccgtcgaccegacgccggacgggctctcectcgacccggcgctggtggaggcggc2760 gctcacccctcggaccagagccctgatgccggtgcacctgcacgggcacccggccgacct2820 cgacccgctactggcgatcgccggacggcacggcctggccgtggtcgaggacgccgcgca2880 ggcccacggcgcccgttaccggggccgcaggatcggctegggccacgtggtcgcgttcag2940 ettctaccccggcaagaaccteggcgccatgggggacggcggcgcggtggtcacgggtga3000 ctecggtgtggccgagcggatccggttgctgcgcaactgcggctcgcgggagaagtaccg3060 gcacgaggtgcgctcgacccactcccggctcgacgagttccaggcggcegtgctgcgggc3120 caaaetgccgcggctcgacgcgtggaacgcccgccgggccggcacggccgaacggtacgg3180 gcgggecctgggtccggtaccgcagatcgccgtcccggtcaccgctccctgggccgaccc3240 ggtgtggcacct tac tcc ct ggagcgcgacgagctgcgccgccggctgga3300 tacc 9 9 9 9 gg acgagccggggtccagaccctgatccactaccccgtgcccccgcaccggtccccggccta3360 cgccgacgacccggccggcgcaccggcggggacccacccgctcagtgagcgcctggcggc3420 gcagagcctcagccttcccctgggaccgcacctcggggaggacgaggcccgcgccgtcgt3480 ggcggcggtccgggcggcgtccgcagggctggcggcgtacccgacgccggacggccagcg3540 ttttcctctagtgacggagaaacgatgaccgaggtcatgtcagggcgtcccggaatgaaa3600 gggatcatcctcgcaggcggcggagggacccgcctacgccccttgaccggcacgctgtcc3660 aagcaactgctgcccgtctacgacaagccgatgat ~ tactacccgctgtccgtcctgatg3720 ctgggcggcatccgcgagatcctcgtcgtctcctccacccagcacatcgagctgttccag3780 cggctgctgggcgacggctcccgcctcggcctcgacatcacctacgccgaacaggccgag3840 cccgagggcatagcgcaggccatcaccatcggcaccgaccacatcggcgactcaccggtc3900 gcgctcatcctgggcgacaacatcttccacggccccggcttctcggccgtgctccagggc3960 agcatccgccacctcgacggctgtgtgctgttcggctacccggtcagcgacccgaagcgc4020 tacggcgtcggcgagatcgacgaccagggcgtactgctgtccctggaggagaaaccggcc4080 cggccccgctccaacctcgccgtcaccggcctctacctctacgacaacgacgtggtcgac4140 atcgccaagaacatccggccctcggcgcgcggcgaactcgagatcacggacgtcaacagg4200 acctacctggagcagaaacgcgcccggctcatcgaactgggccacggcttcgcctggctc4260 gacatgggcacccacgactccctcctccagggcggccagtacgtccagctcatcgagcag4320 cgccagggagtgcggatcgcctgcatcgaggagatcgccctgcgcatgggcttcategac ,,, gccgacaccctccaccggctcggccgcgaactgggcacctccggatacggcgcgtacctg4440 atggaggtggccacccgtgcaggcaccgaatgagacgccgcgccggcccgcccgctccgc4500 cggecgacggccgccggcccggatcctcgtcaccgggggcgccggcttcatcggctcgcg4560 cttcgtgaacgcgctgctggacggctccctgccggagttcggcaaacccgaggtgagggt4620 gctcgacgcgctcacctacgcgggcaacctggccaatctg-gccccggtgggcgactgtcc4680 ccggctgcggatcttcccgggggacatccgcgaccgcggcgcggtcacccaggcgatggc4740 gggggtcgacctggtggtgcacttcgcggccgagtcgcacgtggaccgctcgatcgacga4800 cgccgacgccttcgtgcgcaccaacgtgctgggcacccaggtcctcctccaggaggcact4860 ggccgtacgccccgggctgttcgtgcacgtctcgacggacgaggtgtacggctccatcga4920 ggaggggtcctggcccgaggagcacccgctgaaccccaactcgccctacgccgcctcgaa4980 ggcgtcctccgacctgctggcgctggcccaccaccgcacgcacggactgccggtgtgcgt5040 cacccgctgctccaacaactacgggccctaccagtacccggagaagatcatcccgctgtt5100 caccagcagcctcctcgacggcgggaccgtcccgctctacggggacggcggcaaccggcg5160 cgactggctgcacgtggacgaccactgccggggcatcgccctggtggcccggggcggccg5220 gcccggcgaggtctacaacatcggcggcggcaccgagctgagcaacgtcgagctcacgga5280 gcgtctgctgaaactgtgcggagccgactggtcggcggtgcggcgggtgcccgaccgcaa5340 gggccacgaccggcgctactccgtcgactacaccaagatcgcggacgagctgggttacgc5400 gccgcggatcaccatcgacgaagggctggagcggaccgtgcactggtaccgggagaaccg5460 cgcgtggtgggcgcccgcgaagagggggcgatgacggtgacgaccgcatccgtggacccg5520 ctcgacctgtggctccgccggtaccagccgtccgcgtcacccgccgtccggctggtgtgc5580 ttcccgcacgcgggcggctcggcgagttcgttcctgccgttcacccggcagctgccggac5640 cggatcgaggtcgtggccgtccagtaccccgggcgccaggaccgcaggagcgaaccgctg5700 gtcgacaccatcgagggactggccgagcccctggccggcctgctggaggcgcaggccggc5760 cccccggtggtgctgttcgggcacagcatgggcgcgctggtggcctacgaggtcgcccgc5824 gcgctccagcggcggggagcggctccggtgcgcctggtggtctccgggcgccgggccccc5880 gccgtcgaccggccgatgaccgtgcacctctacgacgacgaccggctggtcgaggaactc5940 cgcaagctcgacggcaccgacagccaggtgttcgccgatccggagctgctccggctggtg6000 ctgccegtgatccgcaacgactaccgggccgtggcggcctacgcccaccgcccgggggcg6060 ccgctggactgccccctcaccgtgttcaccggcgccgacgaccccaccgtgaccgcggcc6120 gaggcggcggcctggcacgaggcggcggcgtccgacgtcgagacgcgcaccttccccggt6180 ggccacttcttcccgtaccagcggaccgcggaggtgtgcggggccctggtcgacacgctc6240 gagccgctgctgtcggccgggacgcgcggtgtccggcgggtccgcccggggtgacgtggg6300 cacggtcgagtacgccgtccaccggcgtaccgcggaacgggtgagggtctccgccgacac6360 cctggacagcccggtcaccgcgctggcggaggtgccccgctggctggaggaataccaccg6420 ggcgcaccgcttccacgtcgagccgatccccttcgaccggctccggcggtggtccttcga6480.r .r gccgggeaccggcgacctgcggcacgagacgggccgcttcttctccgtggaggggctgcg6540 caccagctcggacgccgatccggtcgcccgtgtccagccgatcatcgtgcagcccgaggt6600 ggggctgctcggcatcctggcccgggagttcgacggggtgctgcacttcctgatgcaggc6660 caaacccgagcccggcaacgtcaacgggctgcagatctcccccacggtgcaggccacgcg6720 cagcacttcgacgaggtgcaccacggccggtccaccccgttcctcgaccacttcatcca6780 ccgccccggccgccgggtcctgatcgacagcatccagtccgaacagggcgactggttcct6840 gcacaagcgcaaccgcaacatggtcgtcgagatcgacaccgacatcgaggccgacgccgc6900 gttccgctggctgaccctcgggcagatccgccggctgatgctccaggacgacctcgtcaa6960 catggacacccgcagtgtgctggcctgtctgcccaccgcgcacggcacgcccgacgacgg7020 tgacgactccttcccggcggcgctgcgccgctccctctacggggagaccgcgccgttgca7080 cgatctgcacgccatcaccagctgcctcaccgacgtccgggcgctgcgggtgctgcgcca7140 gcagagcgtgccgctcgacgacgcccggcgggacggctgggagcggaccgggagcgcgat7200 ccggcatcgcagcggcaggcatttcgagatcatggcggtggaggtgaccgcggagcgccg7260 tgaagtggcctcgtggacccagccgttgctgcgcccgtgctcgcagggactggcggccct7320 gatcacccggcggatcaacggggtgctgcacgccctggtggcggcgcggtcggaggtcgg7380 cacgctcaac gtcgccgagt tcggaccgac cgtccagtgc cggcccgacg aggcggacgg 7440 ccagtcgccc ccgtacctgg accgggtgct gacggccgga gccgaccgcg tccgctacga 7500 cgtggtgcag tcggaggagg gcgggcgctt ctaccacgcg cgcaaccgct atctggtggt 7560 cgaggcgggg ccggagctcg acacgggctg cccgcccggc ttctgctggg ctaccttcgg 7620 ccagctcacc gaactgctcg cgcacggcaa ctatctcaac gtcgaactcc gcaccctcat 7680 ggcgtgcgca cacgcctcct actgaatggt cacgaaagct gcaccgcgcg ggagaatcgg 7740 cagcgcgcca ccggccggcc ggcacccgga aggtaaagcg ccgttctccc gcatcggcgc 7800 cctgcgggaa acggcggaac ggccggcccg gaccgcgcgc aattc ~ ccggc gggacacggt 7860 gggagcccgc acgaggaacc gctttccccg ccttcggtgc gcccggccgc gggaccaccc 7920 ccgcctcccg gccgggccgc ggaatacgac gggggcggcc gaggacattc ctttcccgcc 7980 tccggaaaag cgcgccccga gggcccccga atgccgggcg ggacggacgg cgactgcgcg 8040 cggacggcgg cccggcgtcg aacgcacctg cccgagtccg gacgagacag cgcgacgcga 8100 gaggcgaaaa tgatcaatct cttccagccc cagatggggg ccgaggaact ggcggcggtg 8160 tccgaggtct tcgacgacca atggctcggt cacggacccc ggaccgcggc gttcgagtcc 8220 gcgttcgccg agcacctcgg ggtcggcccc gagcacgtcg tcttcctcaa ctcgggcacc 8280 gccggcctct tcctggccct ggagtcgctc.ggcctgcggc ccggcgacga ggtcgtgctc 8340 ccctcgccca gcttcctcgc cgcggcgaac gccgtacagc tctcgggagc gcgcccggtg 8400 ttctgcgaca ccgacccgcg gacgctgaac cccgccctgg ageacatcga ggcggccgtc 8460 accccgcgca ccagggccgt catcgcgctc cactacggcg gccaccccgg cgacatcgtg 8520 cgcatcgccg agcgctgccg ggagcggggc atcaccctga tcgaggacgc cgcgtgctcc 8580 ' gtggcctccc gcgtcgacgg ccgaccggtc ggcaccttcg gcgacctcgc catgtggagc 8640 ttcgacgcca tgaaggtcct ggtcaccggc gacggaggga tgatctacgt caaggacccc 8700 ggggcggccg cccggatccg gcgcctcgcc taccacggcc tcacgcggtc cagcggcctg 8760 ggatacgcca gggtctcggc gcgctggtgg gagatggacg tccccgaacc gggccgccgc 8820 gtcatcggga acgacctcac cgcggccatc ggcgcggtcc agttgcgccg gcttcccggc 8880 ttcgtggccc gccgcaggga gatcgtcgcc ctgtacgaca gcgaactgag ctcgctggag 8940 ggcgtgctga caccgcccgc gccacccgcg gggcacgagt ccacgcacta cttctactgg 9000 atccagctgg cccccggcgt ccgggaccgg gtggcacgcg acctgctcac cgacggcatc 9060 tacaccacct tccgctacgc acctctgcac aaggtgcccg cctacggcca caccggaggc 9120 gaactgcccg gcgtggagcg ggcgtccgaa cggaccctgt gcctgcccct gcaccccggc 9180 ctgtcggacg ccgacgtccg caccgtcgtg tcctccctgc gcagagccct gagcgccgcg 9240 gatccggccc ccgcctgacg cgcgcacgcg ccacggcccc tgtcccggcg gtgaccgccg 9300 ggacaggggc cgtggcgcgt cctgcggacg gtccgggcca ccccgccgtc ccgtcggtgc 9360 gtcagcgacg cgtgccgagg aagaagcccg gtgagccctc gcccgtcacg acgtactcga 9420 cgtccaggcc ggccttgcgg tacgcggcct cgtactccgc acgcgagaac agcgtgaggt 9480 agtccacctc gctgcggtgc cggatgccct ccgcggtgtg cgcgatcagg tagtggatct 9540 ccatccgggt ccgcccgccc tcccgggtcg agtgggagac acgggcgacg ccctggtcgc 9600 ccggtgccgt ccgcagggcg tgggtggaga cgtggccgtc caggaaggtg tcggggaagt 9660 accacggttc gacggccagg acaccgtccg cggtcaggtg ccgcgccatg gcggcgacgg 9720 cgtcctccag gtcggccgtg gtctccaggt acccgatcga gctgaacatg cagaccacgg 9780 cgtcgaacgt ctcgccgagg tcgaacgccc gcatgtcacc gcggtggagg gtgacgccgg 9840 ggagccgctc ctcggcgcgg gccgccatcc actcggacag ctccaggccg ctcacgcggt 9900 cgtagagctt ggcgaaggcc tccaggtggg taccggtgcc gcacgcgatg tcgagcaggc 9960 tggccgcgtc cggcgtacgt tcccggatca ggtcggtgac ccgggcggcc tcacccgcgt 10020 agtccttgcg gtcctggtag agcaggtcgt agacctcggc ggcactgtcg ttctcgtaca 10080 tgggaatcct ccgggccgtg aagggggaac cgtgggtctg tcgaagagga gtgcgccgtg 10140 cgctcggggc gggggcggcc tgccgccggc ccctcgcgat gatctccgta cggacaccca 10200 acagttcacg ccgagccggg gtcaaggaac gacggggtgg tcagtcaagt cgggcgctcc 10260 gcccccgggg cggggcgcgc cggcgacgcg cacggattcg gccaaccggt tgctcgttcc 10320 gccggaaatc acggtgtggc ccccgggcca ccgggtagct tatgcctcgt tcaccgcagc 10380 ggttgaagag gcagccttca accccggccc ggcctttatg gaattcattt ccaccgtgcc 10440 gcaacaccca ctgaaggacg gccggatatc ggccatgaag ccccggcctt tcagccaggc 10500 accctctctt gtcgaataga gtatgtcctc cgctgaagcc gccgaagacg gacgaagggg 10560 ..
.: a at ,, acgaacggtc acctcggtcg atctagacgg aatccttgaa agcgtaatag cctgtcaatg 10620 ctttggtaaa gcacagggat gggggtgcct gcgggatgag tgacctgggt tctggtgaag 10680 aagggtccga agaagacgag tcggacgacg cactcgcctt cctcgagttc atcgcccggt 10740 cggcaccacg gagcgaatac gaccggctca tggcccgcgc cgaacgctcg ggcgccgacg 10800 aggaccggat gcgccgactg gagcgcttca accggctcgc cctcaccgcg cagtcgatga 10860 tcgagtaccg ccgcgaccgg gaggcggagc tcgcggccct ggtcgacgcc gcgcacgagt 10920 tcgtcgccgc ccggcggggc aaggacctgc tggagtccat cgcccgcaga gcacggctgc 10980 tgctgaagct ggacgtctcc tacgtcggcc tgcacgagga ggaccggccc ggcacggtgg 11040 tgctgagcgc cgacggcaac gcggtcaagg tcgccgagag ctaccggctg ccggccgacg 11100 gcggactggg cgccatggtg cgcacctgcc gcgctccctt ctggaccccg gactacctcg 11160 gggacaacag cttcacgcac gtcgaggccg tcgacgacat cgtccgcgcc gaaggcctgc 11220 gcgcggtcct ggccgtcccg ctgtgcgccg ggggcgaacc gatgggggtc ctctacgtcg 11280 ccgaccgtca ggtgcggcat ctgaccccca acgaggtcac cctgctgtgc tcgctcgccg 11340 atctggccgc ggtggcgatc gagcgcaacc ggctggtcga ggagctccac gacaccatcg 11400 ggcaactgcg ccaggacatc ggcgaggccc gcaccgccct cgcgcgcacc cgcaggtccg 11460 ccgacctcca gtcgcacctg gtcacgcagg tgatggacag gcgcggcgcc gactcgttac 11520 tcgcgacggc cgccgaggcg ctcggcggcg gagccggcct gtgcagcccg ctcgggcgcc 11580 cgctcgccga gtacgggacc ctgcgccccg tcgcccccac ggaactgcgc gcggcgtgcc 11640 gccgggccgc cgagaccggc eggcccacct ccgtggcccc gggggtctgg acggtgcccc 11700 tgcttcccgg gggcaacgcc ggcttcctgc tgaccgacct cggtccggac gcggaccaca 11760 ccgccgtccc cctgctcccg atggtcgccc gcaccctcgc gctgcacctg cgcgtccagc 11820 acgacgactc ccccaaggcg cagagccacc aggagttctt cgacgacctg atcggggcgc 11880 cccgctcacc cacgctcctc agggaacgcg ccctgatgtt ctccctcagc ttccgccgcc 11940 cgcacgtggt gctggtggcg gacggacccc gcgggacctc gccgcggctg gaggCctccg 12000 gcgccgacta cgcgaaggag ctcggcgggc tgtgcagcgt gcgggacggc gccgtcgtcc 12060 tgctgctgcc cggcgacgac cccgtcgccg tggcgcagac cgccgccccg gagctgaccg 12120 accgcgccgg gcaccccgtc accgtggggg tcgcgggccc cgcctcgacc gtcgacggca 12180 tcgccgacgc gcaccgtgag gccgcgaagt gtctggagac cctccgcgcg ctcggcggcg 12240 acggcggcac cgcgtgcgcc tccgacctgg gtttcctcgg catgctcctc gccgaggaga 12300 acgacgtccc cggttacatc aggacgacga tcggccccgt ggtcgactac gacacccacc 12360 gcttcacgga tctggttccc actctgaggg tgtacctgga gtcgggcagg agccccacgc 12420 gtgccgcaga gacactgcgc gtgcacccga acaccgtctc acggcggctg gagcgcatcg 12480 gcgtactgct gggagaggac tggcagtcac cggagcgggt gctggacata caactggccc 12540 tgcggctcta tcaggtgcgc tcggcgctct cctcgcaacc ggcgtccgag acccgggccg 12600 tgctcggatc gctgcgcgag tgacctctcc ggcacgggcg gcgccccgcc cgtcggcgcg 12660 gatcgcgccg acaggcgggc gttgaccacc ggccaccggt cccccgtacg acgaggtccc 12720 gggcccgcgt ggttcagccg gcgctgaact cggcgatgcg cccgtctccc atggtcagcc 12780 gggcgccggt gaaccgggac cgcatccgac ggtcgtgggt gacgaccacg acggcgccgc 12840 ggtagtccgc gagtgcctgc tccaactcct ccaccagcac cggggtgagg tggttggtgg 12900 gctcgtccag cagcagcagg tccatcgggt cgctcaccag ccgggcgatc tcgatccggc 12960 ggcgctgccc gtaggacaga tccttcacgc gtcgccgcag gtcggacggg ctgaacaggc 13020 cgagcgacag cagtttctcc gcgtggtcct ccaggtagcc ctcccggccc tgggcgaagg 13080 cccgcagcac ggtcagtccg ggcgcccagg gcgtctcgtc ctgccgcaga tgaccgaccc 13140 ggcagccgac gcgcaccgag ccgccgtccg gctccagttc cccggacagc acccgcaaca 13200 aggtggactt gcccgcaccg ttgggacctg tgacgagcag ccgttcgccg ggccggatcg 13260 tcagggagtc cacggcgagc cgacccgcga cgcgcacgtc ggtgagttcg gccaccgcct 13320 cctccgcctc cgggcccgcg gtgtcgatgc gggcggcgaa ggacaacggg tcggcgggag 13380 cgtggaccgg gttctcggtc agctgcgcca cgcgttgctt cgcgttgcgg atccgcacca 13440 tcgcgccgtg gtcgcgccct cgcctgcggt aggcgccgtg gccgaacacg gagagggaca 13500 tcttgcgcgg gatgccgtcc atccgcgcca cgttggaggt gatcagcccg cggttgcggt 13560 cgagttcggc acgccactcc tcgtactccc gcagccgccg ctcgcgttcc acggccttgg 13620 ccgtcaggta gccctcgtag ccgttgccgt agcgggtgac gctgccggag tcgacctcca 13680 ggatcgtggt ggtgagccgg tcgaggaaga cccggtcgtg ggtgaccgcg atcaccgtgc 13740 cgcggtggcc ggccaggtgg tcctccagcc attccatcgc ccggtcgtcg aggtcgttgg 13800 tcggttcgtc caggagcagc agctccggcg acgaggcgag ggtcgcggcg agcgcgaggc 13860 gggagcgttc gccaccggag agggttccga gcttgcggtc gcggtccagg ctcggcagtc 13920 cgaggccgtg cagcgcgacc tccacgcgca cgtcggcctc gtagccgcca cgcgcctggt 13980 actgctcgac cagagcggcg tagcgctgga ggccggcgga cagctcgcgc tcggagccgt 14040 tctegtcgct ctcgcccagc tccgcctcgg cctcgcgcat cgccgcttcg agctcgcgca 14100 ggtcggacag ggccaggtcg acggcgtcct ggacggtggc gtcgaggggc agttccagtg 14160 tctgcgccag gtagccgacg ccgccgggag cgaccacggt gagcgcgecg ttgtcgggct 14220 ccacgcggcc ggcgaggatc ttgagcagcg tggacttgcc ggaaccgttg tcgccgatca 14280 cgccgacctt ctcgcccggc ttgatgctga aaccgacccg gtcgagcacg acacagtcgt 14340 ggtagcgctt cgtgatgtcg tgtagggcgt attgcgcaat cgacacgcgt aagtctcctg 14400 tttccacgat gaggatgagt ggatgcgtga gcgcgctcgc agaaagaacg gaaagcagaa 14460 gggacgccac cactgcggac atggccggtc agggggtgtc acgagcacgc tgctggatgc 14520 ggcaggcgga gtcagctcaa cgccgggcat cctcatctat cacagagatc ccatgcgaag 14580 aactatagcc gtgctacccg gtgccgcgca acggtatgcg tgtcgcaccg gccgacgtga 14640 tgcagtcgga ccgggatgat cgcttgtccg gcggccggat gcctagcctc gggagcaacc 14700 acagcggtct ttcacgagag gggtcgacca t gggcgatct caggaaccgc atcaccgagc 14760 ".
tggtccgcgc gtaccaccgg gaacaggcgc ccgggggctt cgttcccggg acgacgcacg 14820 taccggtctc cggcgcggtg ctgagcgagg aggaccggct ggcgctggtg gagacggcgc 14880 tggagatgcg gatcgcggcc ggcccggcct cccggggctt cgagcggcag ttcgcccggt 14940 acctcgggct ccggaaggcg cacctgacca actccggttc ctccgccaac ctcctcgccc 15000 tcggcgcgct cacctcgccg cagctggagg agagacggct gcgtccgggg gacgaggtcg 15060 tcacggtcgc cgccgggttc cccacgacgg tcaacccgat cttccacaac gggctggtgc 15120 ccgtcttcgt ggacgtcgag ctcggcacgt acaacacgac gcccgagcgc atcgagcggg 15180 ccatcggccc ccggaccagg gcgatcatga tcgcgcacgc cctgggcaac cccttcgagg 15240 ccgaagaggt ggcccgcctc gcggacgagc gggagctgtt cctcatcgag gacaactgcg 15300 acgcggtggg gtcccgctac cggggcaggc tcaccggctc cttcggcgac ctgtcgaccg 15360 tcagcttcta tcccgcgcac cacatcgcga tgggtgaggg gggctgcgtg ctcaccgaca 15420 acctggccct ggcgcggatc gtggaatcac tgcgcgactg ggggcgcgac tgctggtgcg 15480 agccgggtga ggacaaccgc tgcctcaagc ggttcgacca gaagatgggt gacctgccgc 15540 ccgggtacga ccacaagtac atcttctcgc acgtcggtta caacctgaag tcgaccgacc 15600 tgcaggcggc cctcgggctg tcccagctga cccggatcga ggagttcacc gaggccaggc 15660 gcgccaactg gcggcatctg, cgcgccgcgt tgga gggct gcccggtctg ctgctgcctc 15720 atgccacacc gggcagcgat ccgagctggt tcgggttcct catcaccgtg gacccggacg 15780 ccgcgtacag cagggcggcc ctggtcgacc acctggaatc gcgccggatc agcacccgcc 15840 gcctgttcgg gggcaacctc gtgcggcacc ccgcctacac cgaccgtcgg taccgggtgt 15900 ccggctccct ggagaacagc gacctgatca ccgaccagac gttctggatc ggggtcttcc 15960 ccggcatcac cccggagatg atcgcctacg tcggcgacac gatccgggag tgcgtgctcâ 16020 agcactcctg aggggcggcg gtacgggggt gcgcgtggag gggaggaccg gggcggtcct 16080 cctccggggc gtcacggccg cggaagcgtc cgaagctccg aggcgaggtc ggggtggacc 1640 cgcgcggtga gcagggtgcc ctccggcgtg tgctcggtgc tgagcacctc gccctcgtcg 16200 tgcacccgcg ccaccaggct cccctcgtcg taggggatca cgacctccac ctccacctcg 16260 gggtgcggca gcaggcggtc gatcagttcc cgcagctcgt cgatgccccg aeccgaacgg 16320 gcggacacga cgatcgcgtc cggctcctgc tccagcagac gggcgaggac gtecgggtcc 16380 gcgacatcgg ccttgttgac gaccacgacc tcggtggact cgccggcgcc cacgtcccgc 16440 agcacctcgc gcaccgaggc cagctgcgcg ccggggtccg ggtgcgaacc gtcgaccacg 16500 tgcagcacca gatgcgcgtc cgcgacctct tcgatcgtgg aacggaaegc ctccaccagg 16560 tggtgcggga ggtggcgtac gaagcccacg gtgtcggcga tggtgtaggg gcgcccgctc 16620 ggcgtcgtcg cccgccgcac ggtcgtgtcc agggtggcga acagggcgtt etecaccagc 16680 acgccggctc cggtgaggcg gttgagcagc gatgacttgc cggcgttggt gtagccggcg 16740 agggcgaccg acagcacctt gttgcgccgt cgctectecc ggttcacgtc ccggccggtc 16800 ttcagctgct ccagctcccg gcggagcctg gccatcttgt cgttgatccg ccgccggtce 16860 gtctcgatct tcgtctcacc gggaccgcgc gtggccatgc caccgccgcc accgecgccc 16920 atctgccggg acagcgactg gccccagccg cgcagccgcg gcagcatgta ctgcatctgc 16980 gccagcgcca cctgcgcctt gccctcccgg gactgggcgt gctgcgcgaa gatgtccagg 17040 atcagggccg tgcggtccac gaccttgacc ccgacgacct cctccaggtg catcagctga 17100 ctggggctca gttccccgtc gcacaccacg gtgtcggcgc cggtctcctc gacgatgtcg 17160 cgcagctgcg acgccttgcc cgagccgatg tacgtcgccg ggtccggctt ctgccggcgc 17220 tgcacgacgc cgtccagcac gagggcgccc gcggtctcgg cgagcgccgc cagctcggcg 17280 agcgaactgt cggcctccgc ggccgttccc gaggtccaga tgccgacgag caccacccgc 17340 tcgagtcgca gctggcggta ctcgacctcg gagacgtcgg tcagttcggt ggagagcccc 17400 gcgacgcggc ggagggaggc ccggtcctcg cggtctaact gatcgccgtc ccattcctcg 17460 gcgtcggcgc cggccatcgt gtcgtccatc agtgcgtcgg ctcgctgcgt gccggcgaag 17520 tcctcgggat gcgtcaaagt acttccaatc tggggggttc gagagcgttc cggggcgggg 17580 cgcgtccggc ctgcggggcc gggcgcgggg ccggggggtc ggggccgacg tgtccgcacc 17640 tcgccgtcgg gggccggtgc cgtggaggtc gctgccggaa ctcacatgcc gtccacccta 17700 gccatgtcgc cggggtgtgc aaggacgtat cggcgatcac ctccccagct gacagagtgt 17760 gcaccgggta ctgcgcccgc gggcgtgaag cgggcgagtg tggatgtcat gcgagtactc 17820 attatcgggg gttcacagtt cgtgggccgg gccttcgccg ccgaggcact ggccgcgggg 17880 caccgggtca ccacgttcaa ccggggtgtc agcggcaccg acctgcccgg cgtcgaggcg 17940 gtcaggggcg accgcgaggt ggccggcgac ctggagcggc tggtgtccgg aaggcactgg 18000 gacgcggtcg tggacacctg cggttacgtg ccccgcacgg tgggggcctc ggccgcggcg 18060 ctgtccgggc acgcggacac ctacctctac gtctccagca tcgcctgcct gcccgactgg 18120 gcgcaggcgg tccgtccggt ggacgacgac tcacctgccc acgactgccc gccggacgcc 18180 J
ggaccggacc acgccgacgg tgactacggc gtcctgaagg ccggctgcga gcgcgccgtg 18240 gaccggcact tcgcgggccg gaccctgcac ctgcgggccg gtgtcatcct cgggccgcac 18300 gacaccatgc gcatgctcga cgcctggctg tggcgcatgc gcgtcgccga gggggagcac 18360 cgccgggtgc tcgccccggg caaccccgag gtgggcatgc gcctgatcga cgtacgcgat 18420 gtcgccgtct tcggcctcga ctgcctcgcg gacggccgta ccggcgcctt catcgtcaac 18480 ccgccggaga agaacaccac cttcggggag ttgctcacgg agtgcgtcaa ggccaccggt 18540 tcggccgcgg agccggtgtg ggtcgacgag gggttcctcg ccgagcacgg cgtgagtccg 18600 tggacggacc tgccgatgtg ggtgcccgac accgcgcggg acaccctcgt gtgggcggcc 18660 ggagcaccgc gcgcccgggc cgcgggtctg gcctgccggc ccttctccga caccgtgcgg 18720 gacgcctggg aggtcgtccg ggaccggccc gtcccggaac tgccgctcgc ggccggctgc 18780 ggcctgtccc tgagccggga gaaggagctg ctcgccgcct gggacgctcg cggcggtgcg 18840 gcggcgggct gacgcggccc ccgaggagtg cgacgccgtt tcccgctcgc ggggagcggc 18900 gctcgcgtgt ccgccccgcg gcccggcggc gcgtcctgtg tcccggcgcc cggggcgcgg 18960 ctacacggtg aaggtctcgg cgcgggccac gatctcgtcg accagccccg cctggcgcag 19020 cgcggcgtac gactcggcgg agacgtcctc ggcccggatc accgcacggc ggaagaccga 19080 caggatgttc acgaagtgcc ggtccacggg caggacgcgc tcctcccggt ggtcctggcg 19140 ggacagccgc agtacggggt ggtggctgtc cggggtcgtg aagacgtggc tcagggcgag 19200 cgagccggtg ctgccgtgca gctcgtacgc cgagcggtag ccgtgttcca tgccgaaggc 19260 gaggtgggcg gccacgccct ggggggcggc gagcaggacg ctgccggaga ccacgacgcc 19320 ccggcggcgg tcacggcgca gcacggcgcc ggtcaggcgc agttcgggtc cgaggaagtg 19380 cagcgcggcc cgcagcgggt agacgccgtt gtcgagcagt gcgccgccgc cgatgtcggg 19440 tcggtagcgc atgtcgtcgt cggcgcgcgg cgggatggtg aaggcggcgg agaaggtgcg 19500 cagctctccg atggcaccgg cctccaacag ggctttgacg gtggcgtgtt gagagtggtg 19560 gaggaacatg aagttctcca tcagtaccag tccgcgctcc cgggccatgg cgaacaggcg 19620 ggccgcgtcg gcgtggttgg cggcggcggg cttctccacg aggacgtgtt tgcccgcccg 19680 cagcgccgcc gcggcccatt cggcgtgcag catgctgggc accgcgatgt agacggcgtc 19740 cacgtcgggg cgttccagca gggcctcgta gggcgcgacc gcctcgcagt cgaagtgcct 19800 gcccagggcc tt Page 11 ggcccggt ccgcgtcgcg gctgccgacg caggtcagca cggtgccggg 19860 ggtggagagc agggcgggca gggtgcgacg gcccgcgatg tcgccgcagc cgatcgctcc 19920 gaagcgcagc accggggacg cttccggccg cggcgggccg ggtgcggcga acggttcagc 19980 agaagtaccc agggcggtca tggatggttc cgtcaatcgg tccggatggt cacggcacag 20040 cgtggtgaac ggccggcgca cacccacgag tcgcttccgg caatgggcgg ccctgaagct 20100 acccggeggc ccgacgcgac ggcaaggccg atctgacaca gtgccgcgcc gagggaccgt 20160 cggtgccccg cgtacccgct gacctgacac tacgccgacc aatctgtgga cggggcggtg 20220 gccgcccggg ttaggtgagc gcggcgcccg cggtgaccgc gacgccggtc cgaagcggcc 20280 ' ctcggggcac gccgttggag agaggagacg cgggtgacgg acgcgatcac gaccgagctg 20340 gccgaccgcg aactggggcg cagactgcac cggatacgcg gcgtccactg gtatttcggc 20400 aaccacggtg acccgtacgc cctcatcctg cgcggtcaga ccgacgaccc gtcggtgtac 20460 gaggagcggg tccgcgaggg cgggccgctg ttccgcagcc gtaccgggac ctgggtgacc 20520 gcggacccgg aggtggccgc ggccgtgctg ggcgactcgc gcttcggtgc gctggaccgc 20580 gceggacggc gcccggagga gtacctccag ccgtcgcccg ccacgtacct ggggctggac 20640 cgcgccgcgt acgcgcgtct gcggcgggtg gccgagcccg tgctgggcgc ggacgccgcc 20700 gccgcgtggc gccggctcgg cgaggacgtc gggcgccggc tgctcgccgg ccgcggttcc 20760 ggcctcgacc tgacggcgga cttcgcccgc cggctgccgg cattggtcct ggccgcgtgg 20820 ctcggggtgc cgggcgaacg gtgcgacgag tgggaggagt cgctgcgggc ggcggggccg 20880 ctgctggacg gtctgctgtg tccgcagacg ctggcggcca cccgtgcggc ggactcggcc 20940 v; ~ a; ~~
gccgaggggc tgcgcgcgct gttggacgag gtggtcgccg cgcgtcccgg cgggtccggc 21000 gagggtgcgg tggeccgcat ggtcggcgcc ggagccgccc ccgacgacgc ggtggccgcc 21060 gccgtgtgcc tggcgctctc ggccgtcgaa ccgacgacga ccctggtgtg cgaagcggtc 21120 cggctgctgc tcgaccgacc cgagtggtgg cggcggttgt gcgactcccc cgctctggcg 21180 ccggccgcgg tccggcacac cctgcggcac gcgcccccgg tgcggctgga gagccgggtg 21240 gcccacgagg acgtgacggt ggcggatcgt ccgctgcccg ccgggagcca cgtggtggtg 21300 ctcgtgggcg cggcacggcg cgcgggcgcc ccggccgcgg agccggcgga cctggcgggc 21360 gcaccggcgg cggagctgcc ggacgacctg tggttcgcgc tgtccgggga gttegtcggc 21420 cgtgccgccg agaccgcgct gggcgtgctg gccgaggccg ccccgggact gcggcgggac 21480 ggcgacatcg tccggcggcg ccgttccccg gtcctcggca ggtacgcgcg gttccccgtc 21540 gcgtactcct gacgggcccg cggccggcgt cccctcagtc ccccacgacg tttcatgaaa 21600 ggagtgccgt gcgcgtcctg gtgacctcca tcccgcacca cacgcactac taccacctgg 21660 taccgctgat ctgggctctg cgtgcctcgg ggcacgaggt ggtggcggcc ggccagccgt 21720 cgctggtcga cgccatcacc gccagcggca tcccggcgtt cgccctggcc gaggaggagt 21780 cgctggcgca gatcttcgag gaggtcgagg gcgatctcca gccgtatcag cacggcatcg 21840 acgagttcga cttcttcggc accctgaagg acgagctgga ctgggagaag ctgctcgccc 21900 agcaggtgat cctgtccggc ctgtggctgg aaccgctcaa cggcgccacg accctcgaca 21960 gcatcgtcga cttcgcccgg gcctggaagc ccgacctggt gctgtgggag ccgttcacct 22020 atgcggggcc ggtggcggcc cgggcgtgcg gggccgcgca cgcccgcgtc ctgtgggggc 22080 cggacacgat cgggctgctg cggacgaagt tccttcaggc ccaggcgcgt cagcccgagg 22140 agcaccggga cgacccggtc gcggagtgga tgacctgggc cctggcgcgc tacgggtgcg 22200 acttccggga ggaggacgtg ctcggtcagt ggagcgtgga cccgatggcg gagggcgtca 22260 gtctgggcct cgacctgccg accgtcccga tgcgctacac cccgtacaac gggtcggcgg 22320 tgatccccga ctggctgacc gâggaaccga aacggcctcg ggtctgcctg accctggggg 22380 tgtcctcgcg ggagcacagt gaggacgagg tcccggtgca gaggtttatc gaggcgctgg 22440 ccgatctcga catcgagctg gtggcgaccc tggacgacgc ccagcgggac ctgctgccga 22500 ggatcccgga caacacgcgc atcgtcgact tcgtgcccat ggacgcgttg ctgccgacgt 22560 gctcggcgat catcaaccac agcggttcgg gcacgtgcaa caccgccgcg ctgcacgggg 22620 tgccgcagat catcctcggc ggcatcctgg acgccgccgt acggcagcac atgttcgcgc 22680 agaactccgc cgccctcacc ttcgctccgg aggaggtgac cggcgcgtcg ctgaggagcg 22740 cgctggtgcg cctgctcgag gagccgcggt tccgcgacgg cgcgcggcgg ctgaaggagc 22800 ggatgcgggc catgcccagc ccggccggga tcgtgccgac cctggagcgc ctcacggccc 22860 agcaccgccg ggcgtgttga accggcgcgc gggcccgtgc cggcggtgac cgcccgaccc 22920 gactctcgcg tgtgatcgat ctcgtcgact cagccgtgga ccggttcgcc tgtccgcgcc 22980 cgacactgga gtgctgatgc gggccctctt cacgaccgcg ccgctcgcgg gccacctgct 23040 tccgctggtg cccatcgcgt gggccctgcg ggcggccggc cacgaggtac tggtggcgae 23100 ccgggaggac ttcgtgccgg tcgccctgcg gtcggggctg ccgtccgcct cgtgcgggcc 23160 gcccgccgcg gacctggcgg gcgcggccga ggcgggggcg ctegcgcggc cccgcggagc 23220 ggcggaggct cggggggtcc tgagcggggc gctggcgcgc gtcgcccggg gcagtctggc 23280 gggggtgcgg cggctggcgg acgcctggcg gccggatctg atcgtcagcg aacgggccga 23340 gttcgccggg ccgctggtcg cggcggccct cggggtcccg tgggtccgct accactggtc 23400 ggtctcgtcc ctggaggagt accggcgagc ggccgaggcc gagttcgcgc ccgagctggc 23460 ggcgctcggc ctcgaccggt tcccggaggc ggcgcgcgtg ctcgatccgt ggccggtgtc 23520 gctgcgccgg ccggacgcgg tcgcccacga cggggtccgg cacgtaccgg cccacgggga 23580 cgcccccgtc cccgactggg cgttcacgcg cggtcgcggg ccgcggatct gcgtgacgct 23640 cggcaccatg ctgccccggt acggcgccgc cgggatggcc gacttcctga cggagctggt 23700 ggcggagacc cgcggagggg actgcgaact gctcgtggcg gtcgacgacg acgtcgtcgc 23760 gcggtggccg tcgctgccct ccgcggtgcg gtacgccggc cggctgccgc tggcggaggt 23820 gctgcccgcg tgcgacgcgg tggtgcacca cggcgggcag ggcacgtccc tgaccgcgct 23880 ggccgcgggt cggccgcagg tcgtcatggc gcggctcgac gaccagttcg acaacgcgcg 23940 ggcactggcg geggcggggg cggccct ct c taccg ec 3tccc g 9 9 g gggcca ctcccgcgge 24000 cgtggccgcg gggtgcgccg aagtgctgga gaacgccetg tatgccaagg cggcagccgg 24060 gctcgcegag gagatggcgc tgctgccgtc gcegtcggcg gcggtcggac tcctggaaca 24120 eccggggecc gggccggaca tgccgcggag ttacccgaac gaggatgcgg tgtgacgtga 24180 atetggaagt aeteaaccgt tcgaacgatc cgcgcgggec ggtgatcacg gtggteggcg 24240 cgtceggctt catcgggtcc gccctggtcg ccgagctggc gcgcatgccg gtgeggctgc 24300 gggeggtggc ccggcgcgag acccccgttc ccgcgggggc acgggccgcc gtcgaggtcc 24360 , gccgggcgga cctcgcccgg ccggacgagg tcggggccgc cgtcgagggg gcggacgccg 24420 tc t cacct c cc cccac atc cccc tc t gggg 99 99 9 9 99 gg gcgcgcggec gacgagcggt 24480 egctgcgggt gaacgtcggt ctgetgcgcg acgtggccga cgcgttccgg gaccgctcgg 24540 ggcccgcccc ggccgtggtc ctggccagta ccctccaggc cggcgtcgag ctgtcceggc 24600 agggcccgta cgcccggcag aagtcggcgg ccgaggaggt cctgctgcgg gccgcctccg 24660 aggaggtggt ccgcggcgtc gtgctgcggc tgccgaccgt ctacgggcgc agcecgctga 24720 ccgggtggac gggccgcggg gtggtcgcgt cggtggcacg gcaggccgtc tcgggcgagc 24780 cggtcacgat gtggcacgac ggcacggtcg ggcgcgatct gctccacgtg gaggacgcgg 24840 cccgcgcctt cgcggeggcg ctcggtcacg tggagcggct ggacggcggc acgtggtccg 24900 tcggtacggg ccggctggag cccttgggag aggtgttctc ggccctcgec gggctggtgg 24960 ccgagcggac ggggaggccc cccgtaccgg tggtctccac ggagecgccc gaccatgccg 25020 aggcgggcga ettcgagagc gcggtctgtg aeccetccgc gttccgcgcg gtgacegggt 25080 '"
ggtctcccct cgttccgttg cgggcggggc tcggcgccgt ggtggagacg atggtggccg 25140 ' acggagegag gggtgggate egaaegtgag cacggacegg gagcaggecg egcacacgeg 25200 gctcggtcgc agcgcgaccc tggtgagccg gctctggctg ggcaccgtga acttcagcgg 25260 ecgggtegag gacggtgacg cgatgcagct gatggaggcg gcggtcgacc gcggcatcaa 25320 ctgcatcgac accgcggaca tctacggctg gcggatccac aagggccaca ccgaggaact 25380 ggtgggccgg tggctggcca agagcgccgc gcggcgggag gacgtcctgc tggccaccaa 25440 ggtcggcggg gacatgagcg aacggctcaa cgacggcggc ctgtcggcgc ggcacatcgt 25500 cacggcctgc gagcagtcgc tgcggcgcct gggcgtggac cacatcgacc tgtaccagat 25560 gcaccgcgtc gaccacgccg cgccgtggga cgagatctgg caggcgatgg accgtctggt 25620 ggcgagcggc aaggtgacct acgtggggtc gtcgaacttc gccggctgga acgtcgcegc 25680 egcgcaggac gcggcccggc ggcgccagtc cctcggtctg gtgtccgagc agtgcetgta 25740 caacctggcg gtgcgccacg ccgagctgga actgctgccg gccgcccagg cgtacggact 25800 gggegtgtte gcetggtcge cgctgcacgg cgggetgctc ageggggtgc tgcgcaagct 25860 egcggeggge gtegeggtga agtcggcaca ggggegggec eagctgctgc tgcccgagct 25920 gcgcgcgacg atcgaggcgt acgaggggtt ctgcggccgg atcggcgcgg atccggccga 25980 ggtcggtctg gcctgggtgc tgtcccggcc ggggatcagc ggcgcggtga tcggtccgcg 26040 cacggtggac cagctggact cggcgctgcg gtccctggac ctggtcctcg gggaggccga 26100 actggccgag ctggacgcca tcttcccgcc cctgggcaag ggcggccggg cgccggacgc 26160 gtggatcagc tgaagggggt gcatcggccg acgtcacgcc ggccgatgcc gccggtcaca 26220 cgacgtcgag cgcgggcagc gggaagacca gtcggccgcc gccgtcgagg aactcccgct 26280 cccgttcgac gaacccgtcc cggtagatcc agggcaggac cagcaactgg tccggcttct 26340 gcgccttcgc gtcctcctcg gacacgatgg ggatgcccgt cccgggggtg aaacgccccg 26400 ccttctcctc gctcacctcg ccgatgcacg gcaggtcccg ttcggtgatc ccgcagtact 26460 ggaggatgac gttgcccttg gtggaggcgc cgtacccgag ggtcagcagg ccctcttggc 26520 gggagcggtc caggaagccg cgcagggcgt cccgctggtc ggcgacgcgg cgggcgaagg 26580 cctcgaacgg tgccatgccg tccagtcccg cggcggcctc ggcggcccgg atgcgggcca 26640 ggcccgcctc gtccctcggg tgccgggaac cggtcctggc gagcgtgacg cacaggctgc 26700 cgccgtacac ctcggtgagc tcggcccgga tgacggtgag gccgacgcgt tccgccatcc 26760 actcgatctg gcgcagcgcg tagtactcca ggtgctcgtg gcagacgatg tcgtacgcgt 26820 cggcttcgag catggcgggc aggtagctct gctccatcat ccagacgccg tcctcggcga 26880 ggacgtcgcg gacgtcgctc atgaagcgca gcgggtccgg caggtcgtag aacatcgcga 26940 tggaggtgac ggccttcgcc cgccgcgccc cgaagcggtt ctcgaaggtc gcgcgggtga 27000 agtagtccac gaccaactcg gcgttcggcg ggtacaggtc gcggaacttg ccgccggtcg 27060 ggtcgatgcc gaccagtcgc gggccgtcgg cggggtagcc cttgaggagc gtggcgtcgt 27120 tgctgccgat gtcgaggacc aggtcgtccg ggccgaggtc caccagccgg cggacggcgg 27180 cgaccttgcc atgcaggtgg tcgaccatga agggccggat gcccgagcgg tagccgtagc 27240 cctcgccgta catgaggtcc gggtcggggg tgtggcgcag ttgcacgagg ccgcatccgg 27300 ccggggaaca cgcgacgagt tccagcggga ccgacggcac gacctcgtcg cggtcggccg 27360 ggaacacccc ggtgagcgcc tgttcgccca ggtcgagtac ggagagcagc tccttgttgc 27420 cgcagacgcg gcacgcggtg gcaatcatgg ggtcctttcg ggatcctggc cggggcgccg 27480 ccggcccgtg gccaggtcgg gagcttccag acggagggtg tcgggggcgg gccgggggga 27540 cggcaccagg tgcaggcggc cgatcgcgcc ggtggcggcg gaggcgtcct ggcacgggca 27600 gggatcgtcg gtgaatccgg cgaagcggta ggccacttcc atcatccggt tgcgttcggt 27660 ggcccggaag tcggctccga ggtgcacccc ggcccggtgc gcctggtccg tcagccagcg 27720 caggatcacc gtgccggccc ccagcgacac cacccggcac gaggtggcca gcagcttgat 27780 ccgccaggcc tcggggccgc gccgcagcag cacgacgccg accgcgccgt agggaccgaa 27840 gcgatcggtg acggtggtga ccagcacctc gtggtcgggg tcgtcgatga gggcgcgcag 27900 ctcgtcctcg gagtagtgca ctccggtggc gttcatctgg ctggtgcgca gggtcagttc 27960 ctcgacccgc gacagctcca ggggcgtggc gcggctgatc cgcatccgga tgtccagcga 28020 gcgcaggaag tccgcgtcgg gtccggtgaa gtcggaccgc tcggcgtccc ggcggaagga 28080 cgcctggtac atggagcggc ggcgggtcga gtcgacggtg acggtgcccg ggctgaactc 28140 cgggaggccg gtcagccggg tcgcctgctc ggcggcgtag gtgcggacct ccggcagttc 28200 gtgggtgacc tcggcccgtt cgaagggctg gtcgtcgatg aaggcgaggg tgctcggcgc 28260 gaagttcagc cggtcggcga tctcgcggac cgacttcgac ttcgggcccc agccgatcct 28320 cgggagcacg aagtactcgg cgacgccgag ctgttcgagc ttcgcccagg cgtgatcgtg 28380 gtcgttcttg ctggccaccg cctgcaggat gccgcgcgcg tccagctcgg tgatggtccg 28440 caggacgtcc ggggcgagcc ggacctcgtc ctcctcgagg agggtgccct gccagagggt 28500 gttgtccagg ~ tcccagacca ggcatttgac caacggctcg gcggcgttgt cccggtgcac 28560 gtcgttccct tctctcgata cggcggttgc gaccgcgact cctcgacagg gcgtacgcgg 28620 cccgcggccg gcggggacac gggccggttc acccggccgc ggacatcacg tgccgggcca 28680 ggaccagttc gcagatctcg ttgctgccct cgatgatctc catgagcttg gcgtcgcggt 28740 gcgcccgtge gacgacgtgt ccctcccgcg ccccggccga cgccagcacc tgcacggccc 28800 gttcggcccc gcgtgcggcg ccggtggccg cgacgtgctt ggccaggacg gcggcgacca 28860 ccatgteggg gctgccctcg tcccactggg cgctggcgtg ctcgcacgcc cgggcggcgt 28920 gctgttcggc gacgaacagt tcggcgaggt gccgggcgac gagctggtgg tccgagagcc 28980 gcgtgccgaa ctgctcccgt ccgccggcgt gacgtgcggc ggcggccagg caggcgcgca 29040 ggatgcccag ggagccccag gccaccgaca tccggccgta gctcagcgcg gtggtgacca 29100 gcagggcggg ggtgcggtcg tggccctgga gcagggcgtc tgccggcagc cggaccccgt 29160 ccaggtggat gtcggcgtgt ccggccgcgc ggcagccgtg cgcgtcggtg atgcgctcga 29220 ...:
cgcgtacgcc gggggccgag gcgggcacca cgacggcgcc cgcgccctgc tccgtgcggc 29280 '~
cgaagaccac cagcaggtcc gcgtacgcgg cgttggtcgc ccacaccttg acgccgtcga 29340 cgacgacttc gtcgccgtcg gaggtgatgc gggtgcgcag ggcggacagg tcgctgccgg 29400 cgccggcctc ggtgaacgcc acggcggcca gttcgccgcc ggtcaaccgg ggcaccaggg 29460 aggcctgctg gtccgctççg gcgagcçggc gcagcgtcca ggcggccatg ccctgcgagg 29520 tcatgacgct ccgcaacgag ctgcagaggg cgccgacgtg cgcggtgagt tcgccgttgc 29580 gccggctggt ccagccgagg ccgccgtgga ccgcgggcgc ctgtgcgcac agcaggcccc 29640 gggagccgag gtcgtgcagc aggccgaggg gcagctcgcc cgtccggtcc cactcggccg 29700 cccggtcgcc gaccagcgcg gtgaacagct cctcggcctc ggtgccgtcg gcgtgggagg 29760 tgtcagccac ctgcgtgccc ggtcgcctcg ccgggcgcgg ccagccgtcc gaccagccgg 29820 accatcgcgt cgacggtgcg gaagttgtcg agcatcaggt cggcgccgct gatgacgatg 29880 ccgtaggtct tctccaggtg cacgacgagc tgcatggcga acagcgagga catcccgccg 29940 acggcgaaca ggtcctggtc gcgctcccag gtggtcttgg tgcggtcctc gaggaacccg 30000 agcagttccc cggcgacctc gtcggcggtg ggggtcgtgc cggtggggtc gggccgaccg 30060 gacgtcgtgg tcatcgcgtg gcctcctggt agtcgtagaa tccccggccg ctcttgcggc 30120 cgagcaggcc ctggcggacc ttgtccagca gcagctcgct cgggcggagc gccggatcgc 30180 cggtccgttc gtgcatcacc cgcagcgagt cggccaggtt gtccagtccg atcaggtcgg 30240 ccgtggccag gggtccggtg cggtggccga tgcagtcgcg catcagcgcg tccacggtct 30300 ccggggtggc ccggccctcg tgcaccaccg cgatggcgtc gttcagcatc cggtgcagca 30360 ggcggctggt cacgaagccg gcgccgtcgc cgacgacgat gccccggcgg cccaggccgg 30420 acagcaggtc ccgggtggcc cgggcggccg cctctccgct gcgcggtccg aggaccacct 30480 cgaccgtggg gatcacgtac gcggggttca tgaagtgcac gccgacgagg tcctcggggc 30540 gggggacggc gtcggccagc tcgtcgatgg ggacgcccga ggtgttgctg acgagcagcg 30600 at tccccgggcg cgccacggac gccaggtccg ccagcacctc ggccttccgc tcggggtcct 30660 cggtgacggc ctcgatcacg gcggtcgcgg tggcgacggc ggccggcgcc tcctcgacgg 30720 tcagctcccc gggcgggcgg tcgtggggca gcgcgcccat cagccgggcc gtccgcagat 30780 gcagcgcgac cgcgtcgggg gcggccgcgc gcgccccggc ggaggtgtcg accagtgtga 30840 ccgggtgccc gtgtccgacg gcgagtgccg cgatggccgt gcccatgacg cccgcgccga 30900 gcacgacgag cggagaattt tccttggaat cgggcacgga tcc 30943 <210> 2 <211> 11171 <212> DNA
<213> Streptomyces ambofaciens <400> 2 ctgcaggcgc gcgggctgct cgggcaggag gcgcccgccg agagcctcga cgcgatgatc 60 gacgactact gcgcgcagat ccgcgaggtc cagcccgagg gcccgtaccg gctgctcggc 120 tggtccatgg gcgggctgct cgcgcaccgg gtcgccaccc gcctccagcg ggcggggcag 180 cgcgtcgacc tgctcgcgatcgtcgacgcctatccgcccgcctcggtgcgggccgactgg240 gacgcggcgg agatggtggcgcggatcggtgaggaactgggcttcgacgtggaccgggtc300 ggccccggcc aggaggaggcgctgctcgcggatctgcgggcgaaggggcatcccctgggg360 catctgccgg gcggtgacatcggcgcggcggtccgcgtgtacgtcaacagctcgcgcctg420 acgaggaacc tgcggcccgaggcgttcgacggggacgtcctcttcttcgcctccgggacc480 tcgttcgccg aggacgaccaggttcacgacgtcgccgcctggcggccgtacgtcaccggg540 cagatcaccg agcacgtgatcgaccacctccacgaggacctcttgatcgaaccggccgcg600 gtcacggcca tctccgacgtgctcgtcgggcatctgcccgcggacgacacaccccgcgcg660 tccggcgcac cccgcgcacctcgcgcatcccgatgaggaaggaaacatcatgagcaaccc720 gttcgaggac acggaagccacctacgtcgtgctggtcaacgacgaggggcagcactcgct780 gtggccgtcg ttcgcggaggtcccggcgggctggtccgtcgtggtgccggagacggaccg840 gcagtcgtgc ctggactacatcaacgagaactggaccgacatgcgccccaagagcctcgt900 cgaggcgatg gcgacggccgggcaggacgccccttgagccaggacgccatgatccgggcg960 gtcggcgtcc gcaagagcttgcggcgacgtccacgccctcgacggcgtggacatcgaggt1020 cgaacggggc cgggtgctcgggctgctgggtcacaacggggccggcaagacgaccttggt1080 gaacatccttgccacggtctccccggcgtccgcgggcacggtgaccgtcgccggtttcga1140 cgtcgcgacgcagggcgccgagatccgcgcgcgcatcggggtgaccggccagttcgcgtc1200 ggtggacgagtacctgagcggattccgcaacctcgtcctgatcggccgcctcctcggggc1260 gggacggcgtgaggcggcggcccgggccaccgagctcctggagctgttcgagctgaccgg1320 ggcggcccaccagccctcccgcacctactcgggcgggatgcgccgacggctcgacctcgc1380 cgccagcctggtcggccggccggacgtgctgttcctcgacgagccgacgaccgggctgga1440 cccggcgacccggatcgccctgtgggagacggtggagaagctggtggcgggcggcacgac1500 AT

cgtcctgctgaccacccagt ~ acctggacga ggcggaccggctggccgactggatcaccgt1560 ~

cctgtcgaagggccgggtggtggcctcggacaccaccgaccggctcaaggccgacctggg1620 ccaccggtcggtgcgggtggtccttccgcccgccgccgacctgacggccgccgccgccgc1680 gctcaccgccggcgggttccgtccgcggtccgacgccggggagcacgcgctgaccacgcc1740 cgtggacacctcggccggtatcgcgggcgtcatccgcgcgctggacaccgtcggaacgca1800 ggccgtcgagctgaccgtcaaggagccgtccctggacgacgtctacctggcgctcaccca1860 tccctcacccgccgccgacgcggcctgatccccaggagttccgttggccatccaggagcg1920 cgccgtgaaggaggtggcggtcgacaccggtaccccggccggccccgtgtggcgtggtgc1980 cggcctcggcacccagctgtgggtactgaccgcgcggcagatccgttccatgtacggcga2040 ccgccgcctggcgctgttcagcctgatgcaaccggtgatcatgctgttgctgctgagcga2100 gatcttcggcagcatggccgacccggacgacttcccgcagggcgtgcgctacatcgacta2160 cgtggtgcccgcgctgctggtcaccaccggcatcggctcggcccagggcgcgggggtggg2220 cctggtcagggacatggacaacgggatggtggcgcgcttccgcgtcctgccggcccggct2280 gttcctggtgctggtcgcccggtcgctggccgatctggtccgtgtgttcaccgagttggt2340 cgtcctcgtggccgtcggtgtgatcctgctgggcttccgtccggccgggggtttgtgggg2400 cacgtccgccgccctgttgctcaccctgttcgtcatctggtcgctgatctgggggttcat2460 cgccctcgcggcgtggctgcgcagcgtggaggtgatgtccagcctcgcggttctggtgat2520 gttcccgctcatgttcgcctccagtgcgttcgtcccgctggacgccctcccggagtggct2580 gcgctcggtggcgcacctcaaccccgtgacgtacgcggtcgacagcgcccgccgcctggc2640 gctggactgggacccggggtggagcgtgcccggcgcgctgctgaccagcaccgcgctcat2700 ggcggtggggatgtacgtcgccgggcgttccttcaagaggcccccgaacg ~ aatgattccg2760 gcgaacgggtccgtcgcctgcccctccgggctcgcccgggggaggcgggcgcggtctcag2820 cggtcggccgtccgcccgtaggcgcggaagagtgcggtccactccgggaccgtgaggtcc2880 ttgacccggtcggccggcctcacgcccgccccgcgcacgaactgggcgtgtccgcggcgc2940 agcaccttccgcgcggcgtcgcccaccgtcatctggccggtgtcgaagacccgttggacg3000 aaccgctggtaggcggccttctcacgccagggcacggacggcctgcggtgcggggcgacc3060 atcagggtctgggtgtccgcgcgcggtacgggggtgaagtcctggcgtgagaaggccagg3120 ccccggtcga acgagtacca cggctcccac t Page 18 gggcgttga agaggtttcc gccccaggct 3180 ccggtccgct ttcccacgta ctcccgctgc aacaggaaca cgccctgccg catgcgcgcc 3240 ggacccatgt cgaggcagcg cctcagcatt ctggtgccgg tgacgaaggg aagattcccg 3300 atgagtctga ccggctgccc gggcagttgc agggtcagga aatcctcgtt caccaccgtg 3360 acgtccggca gcgattcggc ggccagccgc cgagcccagc ggggatctat ttccaccgcg 3420 agtaaaggcg tcccgggtga ggcgagcact ttggtcaccc gccctgatcc cgcgcctatt 3480 tcgacggtca tcaggtcatt cggagaatcg ggcggaatgg tgtccgaacc gtccagctga 3540 gcggagaaac gacaggccgc ggcggctgta cgaaagaagt tctgacccca; ttctctccgc 3600 gcggtgctgc gtgaatcagc gggtgcggag acggattgcg gtggcagtgg ~ ggatttcaat 3660 gtcacctcgg cgacattacc aagtcttgac ccaacggtcc atcaaccacc ggtatacccc 3720 atgcaattca gccaccgtcc ggcccgatcc cgacgttcgg ccgcgggcct ttcgggcccg 3780 accggtgacc agcgcgcgaa ccggagttcc cggcgatatt tccggctcct ggcgactcgc 3840 cacagtctcg tcgggggcgg ccggcgccat gactccgacg ggggcgattc ccggccgact 3900 tcgtcaggtc cggagggtcc cccgggcggc gcgggccgat ggccgctgac tgtgtcatct 3960 gcgggttgtc ggccgaacac accgcgcccc aggatgactc agccgttcct gcggtcgtcc 4020 cgaccccggt cccacccccg aaaagaggag cgagaatcca gtgctccagc gcgtcgatct 4080 gtcgtcactc accggcctcc gctggtatgc ggcgctgacg gtattcgcct gtcacatcgc 4140 ccagcagggc ttcttcgccg accagcaggt gggcagcgca ctgctgcaca tcaccccgct 4200 cggttccatg gcggtctcga tcttcttcat actgagtgga ttcgtcctcg cctggtcggc 4260 ccgcgacgag gactccgtgc cgactttctg gcggcgccgc atcgcgaaga tctatccgct 4320 gcatctcgcg acgttcggca tcgcggctct catcattttc tccctgtcgg agccggtact 4380 tcccggcggt tccgtatggg acgggctggt gcccaatgtt ctgctcgtgc agtcctggct 4440 tcccgacgcg accctcacgg ccagtttcaa cacgcccagc tggtcgctct cctgtgagat 4500 cgccttctat ctgtcgttcc cgctgtggta ccggctggtg cgcaggattc ccgcacggcg 4560 gctgtggtgg tgcgccgcgg ggatcgccgt ggccgtgacg tgtgtgcccc tgctggcggg 4620 cctgctcccg gcgagcgagg aggtggcccc cgggatgtcg ctcaacgagg tctggttcgc 4680 gtactggctt ccgccggtgc gcatgctgga gttcgtcctc ggcatcgtga tggcgctgat 4740 cctgcgcgcg gggatctgga agggccccgg tccggcggtc tgcacggcgc tcctcgccgc 4800 gagttacggc ctcacccaga tggtgccccc gatcttcacc ctcgtcgcct gctccgtcgt 4860 accggccgcg ctgctgatca cggcgctggc cgacgccgac gtgcacggcc ggcgcacggg 4920 gctgcgttcg gcgacgctgg tgcggctggg ccagtggtcc ttcgccttct acctggtcca 4980 cttcctgatc atccgctacg gacaccggct gatgggcggc gatctgggct acgagcggca 5040 gtggagcacc ccggccgcga tcgcgctgtc cctggggatg ctgggggtgg cggtcctggc 5100 cggcggtctg ctgcacaccg tcgtcgaaca gccctgcatg cgcctgttcg gcagccgcag 5160 gtccgcctcc cgtccgaagc ccggcgccac cgcggctccc cggaactcac ccgcggccga 5220 cgcggccggcgtgcccctgctcccgggcgtacccgggcccgcgcacacccccgcagcgac 5280 gaacgaacccaccccgagaggatgatgagcgtggcagaccagacggctctcagccccgcg 5340 ctgctggagtacgcccggagcgtcgcgctgcgggacgacggcctgctgcgcgaactgcac 5400 gaggtgaccgccgggctccccggcggccgggccatgcagatcatgcccgaggaggcgcag 5460 ttcctcgccctgctgatccggctcgtcggtgcccggcgggtgctggagatcggcaccttc 5520 acggggtacagcacgctgtgcatggcgcgggcactgcccgccgacggcaccgtcgtcacc 5580 tgcgacatcagcgacaggtggcccggcgtcggcgcaccgtactggcgccgggccggggtg 5640 gagtcccggatcgacctgcgcgtcggcga ~ gccgtccggaccctcgccgagctccgcgag 5700 cacgaggggg acggctcgtt cgacctggtc ttcgtcgacg ccgacaagac cgggtacccg 5760 cactactacg agcaggcgct ggccctggta cgccccggcg gactggtggc ggtcgacaac 5820 accctgttct tcggccgggt ggccgacccg gccgtcgagg acgccgacac cgtcgccgtg 5880 cgcgçgctca acgagctgct gcgcgacgac gaacgcgtgg acatcgccct gctgacggtc 5940 gccgacggga tcactctggc ccgccggcgg gagtgagtcc gcacggggtg cggagcacct 6000 ggtgccgtca ccggcccgca cacgtccgcc gccgacctgc ccgggcaggt cgccgagctg 6060 ctgccctggc gtggccggcc ctcgtcgagg gccgcgcggt cagcggaacc ggttgatcgc 6120 gtcgatgtgc cgcgcccgct tctcctcgtc gcgcacgccc agcccctccg tgggcgccag 6180 gcagagcacg ccgaccttgc cctggtgctg gttgccgtgc acgtcgtgca cggcaaccgc 6240 cgtgtcggcc agcgggtagg tgcgcgagag ggtggggtgg atcctcccct tggcgacgag 6300 ccggttcgcc tcccacgcct cgcggtagtt ggcgaagtgg gtgccgacga tacgcttgag 6360 gtgcatccag aggtagcggt tgtcgaactc gtggcggaag cccgaggtgg aggcgcaggt 6420 gacgatcgtg ccgcccctgc gggtgacgta gacggacgcc ccgaaggtct cccggccggg 6480 gtgctcgaag acgatgtcga cgtcctcgcc cccggtgacc tcgcggatgc gcttgccgaa 6540 gcgcttccac tcccgcgggt cctgggtgtc ctcgtcgctc cagaagcggt agtcctcggc 6600 ggagcggtcg atgatggcct ccgcgcccat ggcccggcac acctcggcct tgcgcgcgct 6660 ggagaccacg cagacggggt gggccccgcc ggcgagggcc agctgggtgg cgtacgagcc 6720 caggccgccg ctggcgcccc agatcagcac gttgtcgccc tgcttcatgc cggcgccgtt 6780 gcgggagacc agctggcggt aggcggtgga gttgaccaga ccgggcgcgg cggcctcctc 6840 ccaggtcaga tgggccgcct tgggcatcag ctggttggac ttgacgaggg ccacctcggc 6900 caggcccccg aagttggtct cgaagcccca gatgcgctgg gccgggtcga gcatggtgtc 6960 gtcgtgcccg tcggggctct ccagctccac cgacagacag tgcgcgacga cctcgtcacc 7020 gggtttccag acgttcacgc cgggtcccgt gcgcagcacc acgccggaca ggtcggaacc 7080 gaggatgtgg tacggcaggt cgtggcgcgc ggccagcggc gaggtgcgcc cgtagcgctc 7140 caggaagccg aacgtcggga ggggctcgaa gatggaggac cagaccgtgt tgtagttgac 7200 ggagctggcc atcaccgcga ccagcgcctc cccgggcccc acttcgggca gcggcacctc 7260 gtcgacgtgc agggactt c Page 20 g gcgggtcctt gtccgcgctc ggcatcccgc ggaacatgtc 7320 ggtgtcctct ttgcggacgg tcacggcgcg gaaggactcg ggcaggggca gcgccgcgat 7380 gtcctcgggg gtgcggtccg cggcggtgat cgcggcgagc agcgcgctct gcgcatggct 7440 ttcgggcatg gaacggtctc cgatcgctcg tgtcgtcagg tggcccggtg cagggcggtg 7500 aggcgctcca gggtggggat gatcccggcg ggcgtggggt cggcgagcat ctcctcgctc 7560 agccgccgcg cgcccgccct gatcgcgggg tcgtgcacgg ccgtgtgcac cgcgtcggcc 7620 agaccgcgcg ccgtgagcgt cgccgcgggc aggtcgaacc cggcggacag gcgctggagt 7680 tgctgcgcct tgagcggcgc gtcccacagg gagggcagca ggatctgcgg cactccgtgg ~ 7740 cgcagggcgg tggaccaggt gcccgctccg ccgtggtgga tgatcgcggc gcagctcggc ~ 7800 agcagcgcgt cgagcggtac gaagtccacg ggcacgacgt tgtcggggag ggtgcccagg 7860 cggtcgagct gggaggtgtc cagggtggcc accacctcga tgtccagccg gccgagcgcc 7920 tecagcagtt cggagtagga gaccgcgtcg cggccgtagg tctcgcgggc ggacacgccg 7980 agggtgaggc agacgcgggg gcggtcgggc ttcttgccga gccagggttc gatcacggag 8040 cgcccgttgt agggcacgta gcacatgggc accgtggtct ggcccaggtc gaggcgggtg 8100 ctgcgcgggc ccgggtcgat cacccagtgg ccgagcacgt cgcgttcgtc gaaggcgagc 8160 ccgtaccggt ccagcgtcca gccgagccat tcggcgatgg ggtcctcgcg cagttcctcc 8220 ggcatcccgt cgagggcggc gaggaagcgc aggcgggagc gtccgatggc gtcggggccc 8280 cacaggatgc gcgcgtgggc ggcaccgcag gcgcgggccg cgaccggccc cgcgtaggtc 8340 cagggttccc acacgaccag gtcgggccgc cagccacggg cgaagtcgac gatctcgtcc 8400 atcgtggcgg cgccgttgaa cggggcgaag cacagggcgg ccatcatgct ctgctggccg 8460 agcaggtact cccaggtggt ctcctcctcg ctctccacct caccgaactc gaagccccgc 8520 tggtagggga cgaggtcgct gcccatctcg gcgagcagct ccgcggccgg tcggtcgtcg 8580 cccaccggta cggcggtcag gccggtggag gtgatgacgt cggtgaggga gggcgggctc 8640 gccacccgta- cctcgtgccc ggcggcgcgc agcgcccagg cgaggggcac cagactgtag 8700 tagtgggtgt tgtgggcgag ggatgtcagc aggacgcgca cagcggctcc ggtctgggag 8760 ggggcgtacg gacggcgggg tcatcccggg tggacccgga ggcgggcgca ggcgcccagg 8820 accggtgacc gcggccgggt caggggcggt ccctcggccc gcaggccggg caggcggccg 8880 gccgtgacct ggaccgcggt ggtggcggcc aggcggatca gcgggagggc gagcgccagg 8940 tgcggtccgt cggcgccccc gagcggctcc ggcccgggga tctcccgtcc ggcggcggcc 9000 agcaccacga cgtgctcgtc ggcggtgatc cggcggccgc cgagttcgag gccggtgtgc 9060 gcgacccggt tctccagccg ggccgggggg cgctcgcgca gcacctggtc gacggcgttc 9120 gccgcggccg gcgtccggcg ggccctctcc cactcccccg gccggccgag cagccggtgg 9180 accgtgtgcg cgacggcggt gacgacgggt tcgggtgcgc cgaccgcgag gagcagcgcg 9240 atgcgctcga cgtcgccggg ggcgacgccg tcgtgcagga ggagggcgag cacgtcgtcg 9300 ggccggggct cggcgttccc gaggccccgg gacttctccg cgacgagctc ggggaccagg 9360 tcggccagtg tgcggacggc gtcggcggac tcccgggcca cggtcagcag ttgcggggcc 9420 atccgggcgt cgagctgggg gccgcaggcg gcgagtgccc gcgcggcggt ggcgcggtcg 9480 cggeccggca ctccgaggag cctgagcatc agctcgacgg cgtagggccg ggcgacctcg 9540 ccgacaaggt cgaacccggc gtcaccggtg ggcagcaggc ggccgagcac tctgcgggcg 9600 gtggtgcgcg ccgcgcaggg cgcctgggcc ggggcgtacc ggctgagcac cggggcggcc 9660 agcgcccgca ggcgtacgag ctccgcgcgt tcgtggtggg ggaacgcctc ggcgaggggc 9720 agcagttcct cgtccgggcg gcgtccggcc cggtccagcg tgccgaagcg cgggtcggcc 9780 aggacggccg ccgccacctc ggggtccgcg gtcacccagg cgtccagctg ttcgctgcgg 9840 aaccacggtc cgcgggcccg gatctcccgt tcgaacggct cggggtcggc gacggcgcge 9900 aggatcagcg cgtacgggtc gccctggttg ccggcgcacc agtgtgcggc ccgggtcagc 9960 tggagccgac ggccgagcgc acggacgccc gtgctcgtgt ccgcgctcgt gctcgtgctc 10020 gcgggggccg tttccgtggc aagggtgggc atggctgccc tgcctttctt ctcgggtcga 10080 tgggggcgct cgcacgatcg ggggacccgg gtgtgccggg tgggtcgggg caacccgcct 10140 ccgggccgcg gcggtccgcg tcggcaccgg gtcagcggcg ggtgccgatg aacagcccgc 10200 gaccggacgg gccgccttcc tggtagacca cgtcgcagcc ggcgcgctcg aaggccgcct 10260 cgtagtcggc gcgcgggaac agggtgatgg tgtggtcctc ggtcaggtga cggacgccgc 10320 cgggtccggc gaggaggtag tgcacctcga tgcgggtggc gttcccctcc cgtacggagt 10380 gcgagacccg gcagacggtg cgctcgcccg cctccgtgat gctggcgccg acgtaaccgg 10440,.
gggtgaagga ctcggggaac caccagggtt cgacgacgat gacgccggac ggttcgaggt 10500 ggtcggtgaa ggcccgcagc gtgctgtcga gttcgtcggt ggtccgcagg tggcctatgg 10560 agctgaacat gcaggtcacc gcgtcgaacc ggcgtcccag ggagaacgag cgcatgtccc 10620 cttggtggaa ggtgacaccg gggttccggc cggtcgcgag ggccagcatg tcggcggaga 10680 gttccaggcc ctcgacgtgg tcgaagaggc cgtccaggtg gtgcaggtgc tggccggtgc 10740 cgcaggccac gtcgagcagg gtccgggcgc ccggccggtg gacgcgcacg agtgcggcga 10800 tctcctcggc ctcctgccgg tagtccttcc ccttcccctc gtggaccagg tcgtagacgg 10860 ccgcgatgtc gtcggcgtac atcagtgttt ccctccggtg agcggggcgg gaccgggctg 10920 gtgcgggagg ctgtccagcc attcgtgcac cagggacgcg gtgtgccggg cgtgttcggt 10980 gagcatggtg aagtggttgc cgggcacgtc ggcgacggtc cgtgcgaacg ggacctggga 11040 ccgccagtcg ccccgcgccc cgcccgcggg cggccacgcg cacaggggtt cggacgcccg 11100 ggccagcagg acgggggctt cgagggcggt gagccgggtt ccgagcacca gccgctgata 11160 gccggccatg g <210> 3 <211> 711 <212> DNA
<213> ambofacial streptomyces <220>

<221> CDS

<222> (1) .. (711) <400> 3 atgtacgcc gacgac atcgcggcc gtctacgac ctggtccac gagggg 48 ietTyrAla Asp5sp IleAlaAla ValTyrAsp LeuValHis GluGly aaggggaag gactac cggcaggag gccgaggag atcgccgca ctctg 96 LysGlyLys AspTyr ArgGlnGlu AlaGluGlu IleAlaAla LeuVal cgcgtccac cggccg ggcgcccgg accctgctc gacgtggcc tgcggc 144 ArgValHis ArgPro GlyAlaArg ThrLeuLeu AspVa ~ IAla CysGly accg9ccag cacctg caccacctg gacg9cctc ttcgaccac gtcgag 192 ThrGlyGln HisLeu HisHisLeu AspGlyLeu PheAspHis ValGlu ggcctggaa ctctcc gccgacatg ctggccctc gcgaccggc cggaac 240 G1yLeuGlu LeuSer AlaAspMet LeuAlaLeu AlaThrGly ArgAsn cccggtgtc accttc caccaaggg gacatgcgc tcgttctcc ctggga 288 ProGl V Th h l y ar P HisGlnGly AspMetArg SerPheSer LeuGly e cgccggttc gacgcg gt9acctgc atgttcagc tccatag9c cacctg 336 Ar A Ph g rg e AspAla ValThrCys MetPheSer SerIleGly HisLeu cggaccacc gacgaa ctcgacagc acgctgcgg gccttcacc gaccac 384 ArgThrThr AspGlu LeuAspSer ThrLeuArg AlaPheThr AspHis ctcgaaccg tccggc gtcatcgtc ~ gtcgaaccc tggtggttc cccgag 432 ~ v -LeuGluPro SerGly ValIleVal ValGluPro TrpTrpPhe ProGlu tccttcacc cccggt tacgtcggc gccagcatc acggaggcg ggcgag 480 SerPh Th er ProGly TyrValGly AlaSerIle ThrGluAla GlyGlu cgcaccgtc tgccgg gtctcgcac tccgtacgg gaggggaac gccacc 528 ArgThrVal CysArg ValSerHis SerValArg GluGlyAsn AlaThr cgcatcgag gtgcac tacctcctc gccggaccc ggcggcgtc cgtcac 576 ArgIleGlu ValHis TyrLeuLeu AlaGlyPro GlyGlyVal ArgHis ctgaccgag gaccac accatcacc ctgttcccg cgcgccgac tacgag 624 LeuThrGlu AspHis ThrIleThr LeuPhePro ArgAlaAsp TyrGlu gcggccttc gagcgc gccg9ctgc gacgt9gtc taccaggaa g g9c 672 vs AlaAlaPhe GluArg AlaGlyCys AspValVal TyrGlnGlu G ~ yGly ccgtccg9t cgcg9g ctgttcatc g acccgc cgctga 711 ProSerGl Ar Gl L hc ~

ygy eu P Ile G ThrArg Arg ey <210> 4 <211> 236 <212> PRT
<213> Streptomyces ambofaciens <400> 4 Met Tyr Ala Asp Asp Ile Ala Ala Val Tyr Asp Leu Val His Glu Gly Lys Gly Lys Asp Tyr Arg Gln Glu Ala Glu Glu Ile Ala Ala Leu Val Arg Val His Arg Pro Gly Ala Arg Thr Leu Leu Asp Val Ala Cys Gly 35 40 45 s Thr Gly Gln His Leu His His Leu Asp Gly Leu Phe Asp His Val Glu Gly Leu Glu Leu Ser Ala Asp Met Leu Ala Leu Ala Thr Gly Arg Asn Pro Gly Val Thr Phe His Gln Gly Asp Met Arg Ser Phe Ser Leu Gly Arg Arg Phe Asp Ala Val Thr Cys Met Phe Ser Ser Ile Gly His Leu Arg Thr Thr Asp Glu Leu Asp Ser Thr Leu Arg Ala Phe Thr Asp His Leu Glu Pro Ser Gly Val Ile Val Val GIu Pro T ~ p ~ Trp Phe Pro Glu 130 135 '140 Ser Phe Thr Pro Gly Tyr Val Gly Ala Ser ile Thr Glu Ala Gly Glu Arg Thr Val Cys Arg Val Ser His Ser Val Arg Glu Gly Asn Ala Thr 165 ~ 170 175 Arg Ile Glu Val His Tyr Leu Leu Ala Gly Pro Gly Gly Val Arg His Leu Thr Glu Asp His Thr Ile Thr Leu Phe Pro Arg Ala Asp Tyr Glu Ala Ala Phe Glu Arg Ala Gly Cys Asp Val Val Tyr Gln Glu Gly Gly Pro Ser Gly Arg Gly Leu Phe Ile Gly Thr Arg Arg <210> 5 <211> 1272 <212> DNA
<213> Streptomyces ambofaciens <220>

<221> CDS

<222> (1) .. (1272) <400> 5 atg cccacc cttgcc gaaacg gcc acgagc acgagc 48 Met ProTh L acg ccc l gcg aGC

r eu A GluThr Ala ThrSer ThrSer 1 a Pro Thr ala Ser gcg gacacg agcacgg9c gtccgt gcgctcggccgt cggctc cagctg 96 Ala AspThr SerTh Gl l ry Va Arg AlaLeuGlyArg ArgLeu GlnLeu s . cgggcc gcacactgg tgcgcc ggcaaccagggc gacccg tacgcg 144 acc to l Thr rg A AlaHisTrp CysAla GlyAsnGlnGly AspPro TyrAla at ctg atcctg cgcgccgtc gccgac cccgagccgttc gaacgg gagatc 192 L he eu e Leu ArgAlaVal AlaAsp ProGluProPhe GluArg GluIle cgg gcccgc ggaccgtgg ttccgc agcgaacagctg gacgcc tgggtg 240 l ga Arg GlyProTrp PheArg SerGluGlnLeu AspAla TrpVal AT

acc gcggae cccgaggtg gcggcg gccgtcctggcc gacccg cgcttc 288 Thr al a Asp ProGluVal AlaAla AlaValLeuAla AspPro ArgPhe ggc acgctg gaccgggcc ggacgc cgcccggacgag gaactg ctgccc 336 G1y ThrLeu A l i rg A GlyArg ArgProAspGlu GluLeu LeuPro at ctc gccgag gcgttcccc caccac gaacgcgcggag ctcgta cgcctg 384 Leu AlaGl lh u AP Pro HisHis GluArgAlaGlu LeuVal ArgLeu ae ~
~

115 120 125, cgg gcgctg gccgccccg gt9ctc agccggtacgcc ccggcc caggcg 432 At l rg A Leu AlaAlaPro ValLeu SerArgTyrAla ProAla GlnAla at ccc tgcgcg gcgcgcacc accgcc cgcagagt9ctc ggccgc ctgctg 480 Pro CysAla AlaArgThr ThrAla ArgArgValLeu GlyArg LeuLeu Pro ThrGly s la G1 ~ hgg G ~ GV gg 528 p P, Leual yl al la A Pro e 4sp tac gccgtc gagctgatg ctcagg ctcctcggagtg ccgg cgcgac 576 T Al c yr a Val GluLeuMet LeuArg LeuLeuGlyVal Pro9 ArgAsp there 180 185 i cgc gccacc gccgcgcgg gcactc gccgcc ~ tgcggc ccccag ctcgac 624 Arg AlaTh Al l ra A Arg AlaLeu AlaAlaCysGly ProGln LeuAsp at gcc cggatg gccccgcaa ctgctg accgt gcccgg gagtcc gccgac 672 Al ~

a ArgMet AlaProGln LeuLeu ThrVa AlaArg GluSer AlaAsp gcc gtccgc acactggcc gacctg gtccccgagctc gtcgcg gagaag 720 Al V
l aa Arg ThrLeuAla AspLeu ValProGluLeu ValAla GluLys tcc cggggc ctcgggaac gccgag ccccggcccgac gacgtg ctcgcc 76g Ser ArgGly LeuGlyAsn AlaGlu ProArgProAsp Val LeuAla Asp ctcctcctg cacgacggc gtcgccccc ggcgacgtc gagcgcatc gcg816 LeuLeuLeu Hi l s AspG ValAlaPro GlyAspVal GluArgIle Ala there ctgctcctc gcggtcggc gcacccgaa cccgtcgtc accgccgtc gcg864 LeuLeuLeu AlaValGly AlaProGlu ProValVal ThrAlaVal Ala cacacggtc caccggctg ctcggccgg ccgggggag tgggagagg gcc912 ih ~

HT Val HisArgLeu LeuG1yArg ProG Glu TrpGluArg Ala sr ly gg gccgcg gcgaacgcc gtcgaccag gtgctgcgc gag960 g gg AA Thr ProAlaAla AlaAsnAla ValAspGln ValLeuArg Glu g cgccccccg gcccggctg gagaaccgg gtcgcgcac accggcctc gaa1008 ArgProPro AlaArgLeu GluAsnArg ValAlaHis ThrGlyLeu Glu ctcggcggc cgccggatc accgccgac gagcacgtc gtggtgct LeuG1yG1y ArgArgIle ThrAlaAsp GluHisVal ValValLe la gccgcc gagatc cccgg ~ ccg gagccgctc gggggcgcc gac1104 AlaAlaGl Ar GluIle P G1 3 g g ro Pro GluProLeu GlyG1yAla Asp ggaccgcac ctggcgctc gccctcccg ctgatccgc ctggccgcc acc1152 ~

ly 3 ~~ His LeuAlaLeu AlaLeuPro LeuIleArg LeuAlaAla Thr G

375,380 accgcggtc caggtcacg gccggccgc ctgcccggc ctgcgggcc gag1200 ThrAl V l l aa G ValThr AlaG1yArg LeuProG1y LeuArgAla Glu not ggaccgccc ctgacccgg ccgcggtca ccggtcctg ggcgcctgc gcc1248 G ~ lP

y ro Pro LeuThrArg ProArgSer ProValLeu GlyAlaCys Ala cgcctccgg gtccacccg ggatga 1272 ArgLeuArg ValHisPro Gly <210>

<211> 23 <212> RT
P

<213> treptomyces ambofaci ens s <400> 6 Met Pro Thr Leu Ala Thr Glu Thr Ala Pro Ala Ser Thr Ser Thr Thr Ser Ala Asp Thr Ser Thr Gly Val Arg Ala Leu Gly Arg Arg Leu Gln Leu Thr Arg Ala Ala His Trp Cys Ala Gly Asn Gln Gly Asp Pro Tyr Ala Leu Ile Leu Arg Ala Val Ala Asp Pro Glu Pro Phe Glu Arg Glu Ile Arg Ala Arg Gly Pro Trp Phe Arg Ser Glu Gln Leu Asp Ala Trp Val Thr Ala Asp Pro Glu Val Ala Ala Ala Val Leu Ala Asp Pro Arg Phe Gly Thr Leu Asp Arg Ala Gly Arg Arg Pro Asp Glu Glu Leu Leu Pro Leu Ala Glu Ala Phe Pro His His Glu Arg Ala Glu Leu Val Arg Leu 1,, 1.5 120 12 5 Arg Ala Léu Ala Ala Pro Val Leu Ser Arg Tyr Ala Pro Ala Gln Ala Pro Cys Ala Ala Arg Thr Thr Ala Arg Arg Val Leu Gly Arg Leu Leu Pro Thr Gly Asp Ala Gly Phe Asp Leu Val Gly Glu Val Ala Arg Pro Tyr Ala Val Glu Leu Met Leu Arg Leu Leu Gly Val Pro Gly Arg Asp Arg Ala Thr Ala Ala Arg Ala Leu Ala Ala Cys Gly Pro Gln Leu Asp Ala Arg Met Ala Pro Gln Leu Leu Thr Val Ala Arg Glu Ser Ala Asp Ala Val Arg Thr Leu Ala Asp Leu Val Pro Glu Leu Val Ala Glu Lys Ser Arg Gly Leu Gly Asn Ala Glu Pro Arg Pro Asp Asp Val Leu Ala Leu Leu Leu His Asp Gly Val Ala Pro Gly Asp Val Glu Arg Ile Ala Leu Leu Leu Ala Val Gly Ala Pro Glu Pro Val Val Thr Ala Val Ala His Thr Val His Arg Leu Leu Gly Arg Pro Gly Glu Trp Glu Arg Ala Arg Arg Thr Pro Ala Ala Ala Asn Ala Val Asp Gln Val Leu Arg Glu Arg Pro Pro Ala Arg Leu Glu Asn Arg Val Ala His Thr Gly Leu Glu Leu Gly Gly Arg Arg Ile Thr Ala Asp Glu His Val Val Val Leu Ala Ala Ala Gly Arg Glu Ile Pro Gly Pro Glu Pro Leu Gly Gly Ala Asp Gly Pro His Leu Ala Leu Ala Leu Pro Leu Ile Arg Leu Ala Ala Thr Thr Ala Val Gln Val Thr Ala Gly Arg Leu Pro Gly Leu Arg Ala Glu Gly Pro Pro Leu Thr Arg Pro Arg Ser Pro Val Leu Gly Ala Cys Ala Arg Leu Arg Val His Pro Gly <210> 7 <211> 1266 <212> DNA
<213> Streptomyces ambofaciens <220>
<221> CDS
<222> (1) .. (1266) <400> 7 gtgcgcgtc ctgctgaca tccctcgcc cacaacacc cactactac agt 48 ValArgVal LeuLeuThr SerLeuAla HisAsnThr HisTyrTyr Ser 1 5 10 15 ~, ~:
.

ctggt9ccc ctcgcctgg gcgctgcgc gcccc 9 LeuValPro LeuAlaTrp AlaLeuArg Alala G1 ~ HisGl Val Agg gt9gcgagc ccgccctcc ctcaccgac gtcatcacc tccaccg9c ctg 144 ValAlaSer ProProSer LeuThrAsp ValileThr SerThrGly Leu accgccgta ccggtgggc gacgaccga ccggccgcg gagctgctc gcc 192 ThrAlaVal ProValGly AspAspArg ProAlaAla GluLeuLeu Ala gagatgg9c agcgacctc gtcccctac cagcggggc ttcgagttc ggt 240 GluMetGly SerAspLeu ValProTyr GlnArgGly PheGluPhe G1y gaggtggag agcgaggag gagaccacc tgggagtac ctgctcggc ca 288 GluValGlu SerGluGlu GluThrThr TrpGluTyr LeuLeuGly Gln cagagcatg atggccgcc ctgtgcttc gccccgttc aacggcgcc gcc 336 GlnSerMet MetAlaAla LeuCysPhe AlaProPhe AsnGlyAla Ala acgatggac gagatcgtc gacttcgcc cgtggctgg cggcccgac ctg 384 ThrMetAsp GluIleVal AspPheAla ArgGlyTrp ArgProAsp Leu gtcgtgtgg gaaccctgg acctacgcg gggccggtc gcggcccgc gcc 432 ~

Val1 Trp GluProTrp ThrTyrAla GlyProVal AlaAlaArg Ala Go Page tgcggt gccgeccac gcgcgcatc ctgtggggc cccgacgccatc gga 480 CysGly AlaAlaHis AlaArgIle LeuTrpG ~ IyProAspAlaIle G1y cgctcc cgcctgcgc ttcctcgcc gccctcgac g atgccggag gaa 528 g ArgSer ArgLeuArg PheLeuAla AlaLeuAsp G ~ yMetProGlu Glu gc G gcgcg 576 vs Le A ls Pro Ilela Glu Tr LeuGl Tg ThgLe s Ag gyppg tacggg ctcgccttc, gac gaacgc gacgtgctc ggccactgggtg atc 624 TyrGly LeuAlaPhe vAspGluArg AspVa ~ ILeu G ~ lyHisTrpVal Ile 195, 200 205 gacccg ggcccgcgc agcacccgc ctcgacctg ggccagaccacg gtg 672 AP Gl P h sp ro y ro Arg SerT Arg LeuAspLeu GlyGlnThrThr Val r cccatg tgctacgtg ccctacaac gggcgctcc gtgatcgaaccc tgg 720 ~

ProMet CysTyrVa ProTyrAsn G1yArgSer ValIleGluPro Trp I

ctcggc aagaagccc gaccgcccc cgcgtctgc ctcaccctcggc gt9 768 LeuGly LysLysPro AspArgPro ArgValCys LeuThrLeuGly Val tccgcc cgcgagacc tacggccgc gacgcggtc tcctactccgaa ctg 816 SerAla ArgGluThr TyrGlyArg AspAlaVal SerTyrSerGlu Leu ctggag gcgctcggc cggctggac atcgaggtg gtggccaccctg gac 864 L Gl ll eu u A LeuG ArgLeuAsp IleGluVal ValAlaThrLeu Asp ay acctcc cagctcgac cgcctgggc accctcccc gacaacgtcgtg ccc 912 ThrSer GlnLeuAsp ArgLeuG1y ThrLeuPro AspAsnValVa ~ 1Pro gtggac ttcgtaccg ctcgacgcg ctgctgccg agctgcgccgcg atc 960 ~

Va Asp PheValPro LeuAspAla LeuLeuPro SerCysAlaAla Ile I

atccac cacggcgga gcgggcacc tggtccacc gccctgcgccac gga 1008 IleHis HisGlyGly AlaGlyThr TrpSerThr AlaLeuArgHis Gly gtgccg cagatcctg ctgccctcc ctgtgggac gcgccgctcaag gcg 1056 ValPro GlnIleLeu LeuProSer LeuTrpAsp AlaProLeuLys Ala cagcaa ctccagcgc ctgtccgcc gggttcgac ctgcccgcggcg acg 1104 GlnGln LeuGlnArg LeuSerAla GlyPheAsp LeuProAlaAla Thr ctcacg gcgcgcggt ctggccgac gcggtgcac acggccgtgcac gac 1152 LeuThr AlaArgGly LeuAlaAsp AlaVa ~ IHis ThrAlaVa1His Asp cccgcg atcagggcg ggcgcgcgg cggctgagc gaggagatgctc gcc 1200 ProAla IleArgAla GlyAlaArg ArgLeuSer GluGluMetLeu Ala gacccc acgcccgcc gggatcatc cccaccctg gagcgcctcacc gcc 1248 AspPro ThrProAla GlyIleIle ProThrLeu GluArgLeuThr Ala ctg cac cgg gcc acc tga 1266 Leu His Arg Ala Thr <210> 8 <211> 421 <212> PRT
<213> Streptomyces ambofaciens <400> 8 Val Arg Val Leu Leu Thr Ser Leu Ala His Asn Thr His Tyr Tyr Ser Leu Val Pro Leu Ala Trp Ala Leu Arg Ala Ala Gly His Glu Val Arg Val Ala Ser Pro Pro Ser Leu Thr Asp Val Ile Thr Ser Thr Gly Leu Thr Ala Val Pro Val Gly Asp Asp Arg Pro Ala Ala Glu Leu Leu Ala Glu Met Gly Ser Asp Leu Val Pro Tyr Gln Arg Gly Phe Glu Phe Gly Glu Val Glu Ser Glu Glu Glu Thr Thr Trp Glu Tyr Leu Leu Gly Gln Gln Ser Met Met Ala Ala Leu Cys Phe Ala Pro Phe Asn Gly AIa Ala 100 105 110 .., Thr Met Asp Glu Ile Val Asp Phe Ala Arg Gly Trp Arg Pro Asp Leu Val Val Trp Glu Pro Trp Thr Tyr Ala Gly Pro Val Ala Ala Arg Ala Cys Gly Ala Ala His Ala Arg Ile Leu Trp Gly Pro Asp Ala Ile Gly Arg Ser Arg Leu Arg Phe Leu Ala Ala Leu Asp Gly Met Pro Glu Glu Leu Arg Glu Asp Pro Ile Ala Glu Trp Leu Gly Trp Thr Leu Asp Arg Tyr Gly Leu Ala Phe Asp Glu Arg Asp Val Leu Gly His Trp Val Ile Asp Pro Gly Pro Arg Ser Thr Arg Leu Asp Leu Gly Gln Thr Thr Val Pro Met Cys Tyr Val Pro Tyr Asn Gly Arg Ser Val Ile Glu Pro Trp Leu Gly Lys Lys Pro Asp Arg Pro Arg Val Cys Leu Thr Leu Gly Val Ser Ala Arg Glu Thr Tyr Gly Arg Asp Ala Val Ser Tyr Ser Glu Leu Leu Glu Ala Leu Gly Arg Leu Asp Ile Glu Val Val Ala Thr Leu Asp Thr Ser Gln Leu Asp Arg Leu Gly Thr Leu Pro Asp Asn Val Val Pro Val Asp Phe Val Pro Leu Asp Ala Leu Leu Pro Ser Cys Ala Ala ile Ile His His Gly Gly Ala Gly Thr Trp Ser Thr Ala Leu Arg His Gly Val Pro Gln Ile Leu Leu Pro Ser Leu Trp Asp Ala Pro Leu Lys Ala Gln Gln Leu Gln Arg Leu Ser Ala Gly Phe Asp Leu Pro Ala Ala Thr Leu Thr Ala Arg Gly Leu Ala Asp Ala Val His Thr Ala Val His Asp 370 375 ~ 380 Pro Ala Ile Arg Ala Gly Ala Arg Arg Leu Ser Glu Glu Met Leu Ala Asp Pro Thr Pro Ala Gly Ile Ile Pro Thr Leu Glu Arg Leu Thr Ala Leu His Arg Ala Thr <210> 9 <211> 1350 <212> DNA

<213> Streptomyces ambofaciens <220>

<221> CDS

<222> (1) .. (1350) <400> 9 atg ccc gaa agc cat gcg cag agc gcg ctg ctc gcc gcg atc acc gcc 48 Met Pro Glu Ser His Ala Gln Ser Ala Leu Leu Ala Ala Ile Thr Ala gcg gac cgc acc ccc gag gac atc gcg gcg ctg ccc ctg ccc gag tcc 96 Ala Asp Arg Thr Pro Glu Asp Ile Ala Ala Leu Pro Leu Pro Glu Ser ttccgc gccgt9acc gtccgc aaagaggacacc gacatgttc cgcg g 144 PheArg AlaValThr ValArg LysGluAspThr AspMetPhe ArgG ~ y atgccg agcgcggac aaggac ccgcgcaagtcc ctgcacgtc gacgag 192 MetPro SerAlaAsp LysAsp ProArgLysSer LeuHisVal AspGlu gtgccg ctgcccgaa gtgggg cccggggaggcg ctggtcgcg gtgatg 240 Va1Pro LeuProGlu Va1Gly ProG1yGluAla LeuValAla ValMet gccagc, tccgtcaac tacaac acggtctggtcc tccatcttc gagccc 288 AlaSer, Ser ValAsn TyrAsn ThrValTrpSer SerIlePhe GluPro ctcccg acgttcggc ttcctg gagcgctacggg cgcacctcg ccgctg 336 LeuPro Th Ph lh re GP Leu GluArgTyrGly ArgThrSer ProLeu ye gccgcg cgccacgac ctgccg taccacatcctc ggttccgae ctgtcc 384 AlaAla ArgHisAsp LeuPro TyrHisIleLeu GlySerAsp LeuSer Ggcgtg gtgctgcgc acggga cccggcgtgaac gtctggaaa cccggt 432 ~

Iy 1 va LeuArg Thri ProG1yValAsn TrpLys ProGly 13 3 i40 gacgag gtcgtcgcg cactgt ctgtcggtggag ctggagagc cccgac 480 AspGlu ValValAla HisCys LeuSerValGlu LeuGluSer ProAsp 145 150 '155 160 g9gcac gacgacacc atgctc gacccggcccag cgcatctgg g9cttc 528 l y His AspAspThr MetLeu AspProAlaGln ArgIleTrp GlyPhe G

gagacc aacttcggg ggcctg gccgaggtggcc ctcgtcaag tccaac ~ I.
GluThr A Ph 1 ~ 576 sn e GG Leu AlaGluVa1Ala LeuValLys SerAsn y Iy cagctg atgcccaag gcggcc catctgacctgg gaggaggcc gccgcg 624 GlnLeu MetProLys AlaAla HisLeuhr Trp GluGluAla AlaAla T

cccggt ctggtcaac tccacc gcctaccgccag ctggtctcc cgcaac 672 ProGly LeuValAsn SerThr AlaTyrArgGln LeuVl Ser ArgAsn Ggcgcc ggcatgaag cagggc gacaacgtgctg atctggggc gccagc 720 1 Ala G1 M l y and Lys G G1y AspAsnValLeu IleTrpG1y AlaSer not 2,230,235,240 Ggcggc ctgggctcg tacgcc acccagctggcc ctcgccggc ggggcc 768 1y Gly LeuG ~ lSe T lh yr yr A T GlnLeuAla LeuAlaGly GlyAla ar cacccc gtctgcgtg gtctcc agcgcgcgcaag gccgaggtg tgccgg 816 HisPro ValCysVal ValSer SerAlaArgLys AlaGluVal CysArg gccatg g9cgcggag gccatc atcgaccgctcc gccgaggac taccgc 864 AlaMet GlyAlaGlu AlaIle IleAspArgSer AlaGluAsp TyrArg ttctgg agcgacgag gacacc caggacccgcgg gagtggaag cgcttc 912 Phe29p SerAspGlu AspThr GlnAspProArg GluTrpLys ArgPhe ggc aagcgcatccgc gaggtc accgggggc gaggacgtc gacatcgtc 960 G ~ IyLysArgIleAr Gl l gu Va ThrG1yG1y GluAspVal AspIleVal 310,315 ttc gagcaccccggc cgggag accttcggg gcgtccgtc tacgtcacc 1008 Phe GluHisProGl Ar Gl h ygu T PheGly AlaSerVal TyrValThr r cgc aggg g9cacg atcgtc acctgcgcc tccacctcg g ttccgc 1056 Arg Ar c Gl hc G ~

gyy T IleVal ThrCysAla SerThrSer G ~ yPheArg r cac gagttcgacaac cgctac ctctggatg cacctcaag cgtatcgtc 1104 His GluPh e AspAsn ArgTyr LeuTrpMet blisLeuLys ArgIleVal ggc acccacttcgcc aactac cgcgaggcg tgggaggcg aaccggctc 1152 G HisPheAl there 3 ~ a Asn3 ~ 5 ArgGluAla TrpGluAla AsnArgLeu gtc gccaagg9gagg atccac cccaccctc tcgcgcacc tacccgctg 1200 Val Al L l a ys G Arg IleHis ProThrLeu SerArgThr TyrProLeu 385 y 390,395,400 gcc gacacggcggtt gccgtg cacgacgtg caeggcaac cagcaccag 1248 Ala AspThrAlaVal Al a Val HisAspVal HisGlyAsn GlnHisGln Ggc aaggtcggcgtg ctctgc ctggcgccc acggagggg ct gg ~ 1 LV 1 1296 sl yya ~ Va1 LeuCys LeuAlaPro ThrGluGly Le Gl Val 2 425 430y cgc gac gag gag aag cgg gcg cgg cac atc gac gcg atc aac cgg ttc 1344 Arg Asp Glu Glu Lys Arg Ala Arg His Ile Asp Ala Ile Asn Arg Phe ägc tga 1350. ~, g <210> 10 <211> 449 <212> PRT

<213> Streptomyces ambofaciens <400> 10 -Met Glu SerHis Ala Gln Ala Leu Leu AlaIle Thr Pro Ser Ala Ala Ala Arg ThrPro Glu Asp Ala Ala Leu LeuPro Glu Asp Ile Pro Ser Phe Ala ValThr Val Arg Glu Asp Thr MetPhe Arg Arg Lys Asp Gly Met Pro Ser Ala Asp Lys Asp Pro Arg Lys Ser Leu His Val Asp Glu Val Pro Leu Pro Glu Val Gly Pro Gly Glu Ala Leu Val Ala Val Met Ala Ser Ser Val Asn Tyr Asn Thr Val Trp Ser Ser Ile Phe Glu Pro Leu Pro Thr Phe Gly Phe Leu Glu Arg Tyr Gly Arg Thr Ser Pro Leu Ala Ala Arg His Asp Leu Pro Tyr His Ile Leu Gly Ser Asp Leu Ser Gly Val Val Leu Arg Thr Gly Pro Gly Val Asn Val Trp Lys Pro Gly 130 135 140, Asp Glu Val Val Ala His Cys Leu Ser Val Glu Leu Glu Ser Pro Asp 145 '150 155 160 Gly His Asp Asp Thr Met Leu Asp Pro Ala Gln Arg Ile Trp Gly Phe Glu Thr Asn Phe Gly Gly Leu Ala Glu Val Ala Leu Val Lys Ser Asn Gln Leu Met Pro Lys Ala Ala His Leu Thr Trp Glu Glu Ala Ala Ala Pro Gly Leu Val Asn Ser Thr Ala Tyr Arg Gln Leu Val Ser Arg Asn Gly Ala Gly Met Lys Gln Gly Asp Asn Val Leu Ile Trp Gly Ala Ser '225. ~. 230 235 240 Gly Gly Leu Gly Ser Tyr Ala Thr Gln Leu Ala Leu Ala Gly Gly Ala His Pro Val Cys Val Val Ser Ser Ala Arg Lys Ala Glu Val Cys Arg Ala Met Gly Ala Glu Ala Ile Asp Arg Ser Ala Glu Asp Tyr Arg Phe Trp Ser Asp Glu Asp Thr Gln Asp Pro Arg Glu Trp Lys Arg Phe Gly Lys Arg Ile Arg Glu Val Thr Gly Gly Glu Asp Val Asp Ile Val Phe Glu His Pro Gly Arg Glu Thr Phe Gly Ala Ser Val Tyr Val Thr Arg Arg Gly Gly Thr Ile Val Thr Cys Ala Ser Thr Ser Gly Phe Arg His Glu Phe Asp Asn Arg Tyr Leu Trp Met His Leu Lys Arg Ile Val Gly Thr His Phe Ala Asn Tyr Arg Glu Ala Trp Glu Ala Asn Arg Leu Val Ala Lys Gly Arg Ile His Pro Thr Leu ser Arg Thr Tyr Pro Leu Ala Asp Thr Ala Val Ala Val His Asp Val His Gly Asn Gln His Gln Gly Lys Val Gly Val Leu Cys Leu Ala Pro Thr Glu Gly.Leu Gly Val 420 425 .430 Arg Asp Glu Glu Lys Arg Ala Arg His Ile Asp Ala Ile Asn Arg Phe Arg <210> 11 <211> 675 <212> DNA
<213> 5treptomyces ambofaciens <220>
<221> CDS
<222> (1) .. (675) <400> 11 atgatgagc gt9gcagac cagacggct ctcagcccc gcgctgctg gag 48 MetMetSer ValAlaAsp GlnThrAla LeuSerPro AlaLeuLeu Glu tacgcccgg agcgtcgcg ctgcgggac gacggcctg ctgcgcgaa ctg 96 TyrAlaArg SerValAla LeuArgAsp AspGlyLeu LeuArgGlu Leu cacgaggt9 accgccggg ctccccggc g9ccgggcc atgcagatc atg 144 i ~

H GluVal ThrAlaG LeuProGly GlyArgAla MetGTnIle Met sy cccgaggag gcgcagttc ctcgccctg ctgatccgg ctctc gt ProGluGlu AlaGlnPhe LeuAlaLeu LeuIlerg LeuValGly la cggcgggtg ctggagatc ggcaccttc acggggtac agcacgctg tgc 240 ArgArgVal LeuGl It l ue G ThrPhe ThrGlyTyr serThrLeu Cys there atggcgcgg gcactgccc gccgacggc accgtcgtc acctgcgac atc 288 MetAlaArg AlaLeuPro AlaAspGly ThrValVal ThrCysAsp Ile Sr sp Agg TgpProGl g Glc a gg gc gg g 336 l G

y ay la Pr TTAA la l RPGY
there gtggagtcc cggatcgac ctgcgcgtc ggcgacgcc gtccggacc ctc 384 ValGluser ArgIleAsp LeuArgVal GlyAspAla ValArgThr Leu gccgag ctccgcgag cacgag ggggacg9c tcgttcgac ctggtcttc 432 AlaGl u LeuArgGlu HisGlu GlyAspGly SerPheAsp LeuValPhe gtcgac gccgacaag accg9g tacccgcac tactacgag caggcgctg 480 ValAs Al pa AspLys ThrGly TyrProHis TyrTyrGlu GlnAlaLeu gccctg gtacgcccc ggcgga ctggtggcg gtcgacaac accctgttc 528 l A Leu ValArgPro G1yG1y LeuVa1Ala ValAspAsn ThrLeuPhe at 9 gacccg gccgtcgag gacgccgac accgtcgcc 576 Ph G rg V
~

e ly A a la AspPro A7aValGlu AspAlaAsp ThrValAla 180 to 185 190 gtgcgc gcgctcaac gagctg ctgcgcgac gacgaacge gt9gacatc 624 ValArg AlaLeuAsn GluLeu LeuArgAsp AspGluArg ValAspIle gcc ctg ctg acg gtc gcc gac ggg atc act ctg gcc cgc cgg cgg gag 672 Ala Leu Leu Thr Val Ala Asp Gly Ile Thr Leu Ala Arg Arg Arg Glu tga 675 <210> 12 <211> 224 <212> PRT
<213> Streptomyces ambofaciens <400> 12 Met Met Ser Val Ala Asp Gln Thr Ala Leu Ser Pro Ala Leu Leu Glu Tyr Ala Arg ~ e0r Val Ala Leu Arg Asp Asp Gly Leu Leu Arg Glu Leu His Glu Val Thr Ala Gly Leu Pro Gly Gly Arg Ala Met Gln Ile Met Pro-Glu Glu Ala Gln Phe Leu Ala Leu Leu Ile 60rg Leu Val Gly, 41a 65g Arg Val Leu Glu Ile Gly Thr Phe Thr Gly Tyr Ser Thr Leu Cys Met Ala Arg Ala Leu Pro Ala Asp Gly Thr Val Val Thr Cys Asp Ile Ser Asp Arg Trp Pro Gly Val Gly Ala Pro Tyr Trp Arg Arg Ala Gly Val Glu Ser Arg Ile Asp Leu Arg Val Gly Asp Ala Val Arg Thr Leu Ala Glu Leu Arg Glu His Glu Gly Asp Gly Ser Phe Asp Leu Val Phe Val Asp Ala Asp Lys Thr Gly Tyr Pro His Tyr Tyr Glu Gln Ala Leu Ala Leu Val Arg Pro Gly Gly Leu Val Ala Val Asp Asn Thr Leu Phe Phe Gly Arg Val Ala Asp Pro Ala Val Glu Asp Ala Asp Thr Val Ala Val Arg Ala Leu Asn Glu Leu Leu Arg Asp Asp Glu Arg Val Asp Ile Ala Leu Leu Thr Val Ala Asp Gly Ile Thr Leu Ala Arg Arg Arg Glu <210> 13 <211> 1245 <212> DNA
<213> Streptomyces ambofaciens <220>
<221> CDs <222> (1) .. (1245) <400> 13 gtgctccag cgcgtcgat ctgtcgtca ctcaccggc ctccgctgg tat 48 ia LeuGln Arg5a1Asp LeuSerSer LeuThrGly LeuArgTrp Tyr gcggcgctg acggtattc gcctgtcac atcgcccag cagg, 9ttc ttc 96 vs AlaAlaLeu ThrValPhe AlaCysHis IheA1aGln GlnGlyPhe Phe gccgaccag caggtgggc agcgcactg ctgcacatc accccgctc ggt 144 AlaAspGln GlnValGly SerAlaLeu LeuHisIle ThrProLeu Gly tccatggcg gtctcgatc ttcttcata ctgagtg9a ttcgtcctc gcc 192 SerMetAla ValSerIle PhePheIle LeuSerGly PheValLeu Ala 50 55 60 _ tggtcggcc cgcgacgag gactccgtg ccgactttc tggcggcgc cgc 240 TrpSerAla ArgAspGlu AspSerVa1 ProThrPhe TrpArgArg Arg atcgcgaag atctatccg ctgcatctc gcgacgttc ggcatcgcg gct 288 IleAlaLys IleTyrPro LeuHisLeu AlaThrPhe GlyIleAla Ala ctcatcatt ttctccctg tcggagccg gtacttccc ggcggttcc gta 336 LeuIleIle PheSerLeu SerGluPro ValLeuPro GlyGlySer Val tgggacggg ctggtgccc aatgttctg ctcgtgcag tcctggctt ccc 384 TrpAspGly LeuVa1Pro AsnValLeu LeuValGln SerTrpLeu Pro gacgcgacc ctcacggcc agtttcaac acgcccagc tggtcgctc tcc 432 AspAlaThr LeuThrAla SerPheAsn ThrProSer TrpSerLeu Ser Page tgtgag atcgccttc tatctgtcg ttcccgctgtgg taccggctg gt9 480 4 Glu IleAlaPhe i5 LeuSer PheProLeuTrp TyrArgLeu Val cgcagg attcccgca cggcggctg tggtggtgcgcc gcggggatc gcc 528 ArgArg IleProAla ArgArgLeu TrpTrpCysAla AlaGlyIle Ala gtggcc gtgacgtgt gtgcccctg ctggcgggcctg ctcccggcg agc 576 ValAla Va1ThrCys ValProLeu LeuAlaGlyLeu LeuProAla Ser gaggag gtggccccc gggatgtcg ctcaacgaggtc tggttcgcg tac 624 GluGlu ValAlaPro GlyMetSer LeuAsnGluVal TrpPheAla Tyr 195 200, 205 tggctt ccgccggtg cgcatgctg gagttcgtcctc ggcatcgtg atg 672 TrpLeu ProProVal ArgMetLeu GluPheValLeu GlyIleVal Met gcgctg atcctgcgc gcggggatc tggaagggcccc ggtccggcg gtc 720 AlaLeu IleLeuArg AlaG1yIle TrpLysGlyPro GlyProAla Val tgcacg gcgctcctc gccgcgagt tacggcctcacc cagatggtg ccc 768 CysThr AlaLeuLeu AlaAlaSer TyrG ~ lyLeuThr GlnMetVa ~ IPro ccgatc ttcaccctc gtcgcctgc tccgtcgtaccg gccgcgctg ctg 816 ProIle PheThrLeu ValAlaCys SerValValPro AlaAlaLeu Leu atcacg gcgctggcc gacgccgac gtgcacggccgg cgcacgggg ctg 864 IleThr AlaL Al l had a AspA Asp Va1HisG1yArg ArgThrG1y Leu at cgttcg gcgacgctg gtgcggctg ggccagtggtcc ttcgccttc tac 912 Ar S lh ~

ger A T Leu ValArgLeu G GlnTrpSer PheAlaPhe Tire ary :
290 295 ~ 300 ctggtc cacttcctg atcatccgc tacg9acaccgg ctgatgg9c g9c 960 LeuVal HisPheLeu IleIleA li rg TyrG H Arg LeuMetGly Gly ys gatctg ggctacgag cggcagtgg agcaccccggcc gcgatcgcg ctg 1008 AspLeu GlyTyrGlu ArgGlnTrp SerThrProAla AlaIleAla Leu tccctg gggatgctg ggggtggcg gtcctggccggc ggtctgctg cac 1056 ~

SerLeu G1yMetLeu G ValAla ValLeuAlaGly GlyLeuLeu His ly accgtc gtcgaacag ccctgcatg cgcctgttcggc agccgcagg tcc 1104 ThrVal ValGluGln ProCysMet ArgLeuPheGly SerArgArg Ser gcctcc cgtccgaag cccggcgcc accgcggctccc cggaactca ccc 1152 AlaSer ArgProLys ProGlyAla ThrAlaAlaPro ArgAsnSer Pro gcggcc gapgcggcc gg gtgccc ctgctcccgggc gtacccggg ccc 1200 AlaAla As AlaAla ~ Va1Pro LeuLeuProGly ValProG1y Pro G ~ I

gcgcac acccccgca gcgacgaac gaacccaccccg agaggatga 1245 AlaHis ThrProAla AlaThrAsn GluProThrPro ArgGly 405,410 <210> 14 <211> 414 <212> PRT
<213> Streptomyces ambofaciens <400> 14 Val Leu Gln Arg Val Asp Leu Ser Ser Leu Thr Gly Leu Arg Trp Tyr Ala Ala Leu Thr Val Phe Ala Cys His Ile Ala Gln Gln Gly Phe Phe Ala Asp Gln Gln Val Gly Ser Ala Leu Leu His Ile Thr Pro Leu Gly Ser Met Ala Val Ser Ile Phe Phe Ile Leu Ser Gly Phe Val Leu Ala 65p Ser Ala Arg Asp Glu Asp Ser Val Pro Thr Phe Trp Arg Arg Arg Ile Ala Lys Ile Tyr Pro Leu His Leu Ala Thr Phe Gly Ile Ala Ala Leu ile 'Ile Phe Ser Leu Ser Glu Pro Val Leu Pro Gly Gly Ser Val Trp Asp Gly Leu Val Pro Asn Val Leu Leu Val Gln Ser Trp Leu Pro Asp Ala Thr Leu Thr Ala Ser Phe Asn Thr Pro Ser Trp Ser Leu Ser CysGlu IleAla PheTyrLeu SerPheProLeu Trp Arg LeuVal 145 Tire ArgArg Ile-ProAlaArgArg LeuTrpTrpCys Ala Gly IleAla To the ValAla ValThr CysValPro LeuLeuAlaGly Leu Pro AlaSer Leu GluGlu ValAla ProGlyMet SerLeuAsnGlu Val Phe AlaTyr Trp Trp Leu Pro Pro Val Arg Met Leu Glu Phe Val Leu Gly Ile Val Met Ala Leu Ile Leu Arg Ala Gly Ile Trp Lys Gly Pro Gly Pro Ala Val Cys Thr Ala Leu 2 ~ 5 Ala Ala Ser Tyr Gly Leu Thr Gln Met Val Pro Pro Ile Phe Thr Leu Val Ala Cys Ser Val Val Pro Ala Ala Leu Leu Ile Thr Ala Leu Ala Asp Ala Asp Val His Gly Arg Arg Thr Gly Leu Arg Ser Ala Thr Leu Val Arg Leu Gly Gln Trp Ser Phe Ala Phe Tyr Leu Val His Phe Leu Ile Arg Arg Gly His Arg Leu, Met Gly Gly 305 310 315. 320 Asp Leu Gly Tyr Glu Arg Gln Trp Ser Thr Pro Ala Ala Ile Ala Leu Ser Leu Gly Met Leu Gly Val Ala Val Leu Ala Gly Gly Leu Leu His Thr Val Val Glu Gln Pro Cys Met Arg Leu Phe Gly Ser Arg Arg Ser Ala Ser Arg Pro Lys Pro Gly Ala Thr Ala Ala Pro Arg Asn Ser Pro Ala Ala Asp Ala Ala Gly Val Pro Leu Leu Pro Gly Val Pro Gly Pro Ala His Thr Pro AIa Ala Thr Asn Glu Pro Thr Prti Arg Gly 405,410 <210> 15 <211> 849 <212> DNA
<213> ambofacial streptomyces <220>
<221> CDS
<222> (1) .. (849) <400> 15 gtg acattgaaa tccccactg ccaccgcaa tccgtctcc gcacccgct 48 Val ThrLeuLys SerProLeu ProProGln SerValSer AlaProAla gat tcacgcagc accgcgcgg agagaatgg ggtcagaac ttctttcgt 96 Asp SerArgSer ThrAlaArg ArgGluTrp GlyGlnAsn PhePheArg aca gccgccgcg gcctgtcgt ttctccgct cagctggac ggttcggac 144 Thr AlaAlaAla AlaCysArg PheSerAla GlnLeuAsp GlySerAsp acc attccgccc gattctccg aatgacctg atgaccgtc gaaataggc 192 Thr IleProPro AspSerPro AsnAspLeu MetThrVal GluIleGly Page gcggga tcagggcgg gt9acc aaagt9ctcgcc tcacccggg acgcct 240 AlaGly SerGlyArg ValThr LysValLeuAla SerProGly ThrPro ttactc gcggtggaa atagat ccccgctgggct cggcggctg gccgcc 288 LeuLeu AlaValGlu IleAsp ProArgTrpAla ArgArgLeu AlaAla gaatcg ctgccggac gtcacg gtggtgaacgag gatttcctg accctg 336 GluSer LeuProAsp ValThr ValvalAsnGlu AspPheLeu ThrLeu caactg cccgggcag ccggtc a ctcatc t tt at g ggg aa c ccc ttcgtc 384 GlnL P ll eu ro GG ProVal ArgLeuIleGly AsnLeuPro PheVal yn accg accagaatg ctgagg cgctgcctcgac atgg ccg gcgcgc 432 ct ~

ThrG ThrArgMet LeuArg ArgCysLeuAsp MetG ~ yPro AlaArg there atgcgg cagg9cgt9 ttcctg ttgcagcgggag tacgt g9a aa c 480 MetArg GlnGlyVal PheLeu LeuGlnArgGlu TyrVa ~ Gly LysArg accgga gcctggggc ggaaac ctcttcaacgcc cagtgggag ccgtgg 528 ThrGly AlaTrpGly GlyAsn LeuPheAsnAla GlnTrpGlu ProTrp tactcg ttegaccgg ggcctg gccttctcacgc caggacttc accccc 576 TyrSer PheAspArg GlyLeu AlaPheSerArg GlnAspPhe ThrPro gtaccg cgcgcggac acccag accctgatggtc gccccgcac cgcagg 624 ValPro ArgAlaAsp ThrGln ThrLeuMetVal AlaProHis ArgArg ccgtcc gtgccctgg cgtgag aaggccgcctac cagcggttc gtccaa 672 ProSer ValProTrp ArgGlu LysAlaAlaTyr, GlnArgPhe ValGln 210 215 220, , cgggtc ttcgacacc g9ccag atgacggt g9c gacgccgcg cggaag 720 ArgVal PheAspThr GlyGln MetThrVa ~ Gly AspAlaAla ArgLys gtgctg cgccgcgga cacgcc cagttcgtgcgc ggggcgggc gtgagg 768 Va1Leu ArgArgG1y HisAla GlnPheValArg G1yAlaG ~ lyVa1Arg ccggcc gaccgggtc aaggac ctcacggtcccg gagtggacc gcactc 816 ProAla AspArgVal LysAsp LeuThrValPro GluTrpThr AlaLeu ttccgc gcctacg cggacg gccgaccgctga g4g g PheArg AlaTyrG ~ y ArgThr AlaAspArg 275,280 <210> 16 <211> 282 <212> PRT
<213> ambofacial streptomyces <400> 16 Val Thr Leu Lys Ser Pro Leu Pro Pro Gln Ser Val Ser Ala Pro Ala Asp Ser Arg Ser Thr Ala Arg Arg Glu Trp Gly Gln Asn Phe Phe Arg Thr Ala Ala Ala Ala Cys Arg Phe Ser Ala Gln Leu Asp Gly Ser Asp Thr Ile Pro Pro Asp Ser Pro Asn Asp Leu Met Thr Val Glu Ile Gly Ala Gly Ser Gly Arg Val Thr Lys Val Leu Ala Ser Pro Gly Thr Pro Leu Leu Ala Val Glu Ile Asp Pro Arg Trp Ala Arg Arg Leu Ala Ala Glu Ser Leu Pro Asp Val Thr Val Val Asn Glu Asp Phe Leu Thr Leu Gln Leu Pro Gly Gln Pro Val Arg Leu Ile Gly Asn Leu Pro Phe Val Thr Gly Thr Arg Met Leu Arg Arg Cys Leu Asp Met Gly Pro Ala Arg Met Arg Gln Gly Val Phe Leu Leu Gln Arg Glu Tyr Val Gly Lys Arg Thr Gly Ala Trp Gly Gly Asn Leu Phe Asn Ala Gln Trp Glu Pro Trp . - ..,. . . . ~. . ,, _,. ..;
Tyr Ser Phe Asp Arg Gly Leu Ala Phe Ser Arg Gln ASp Phe Thr Pro Val Pro Arg Ala Asp Thr Gln Thr Leu Met Val Ala Pro His Arg Arg Pro Ser Val Pro Trp Arg Glu Lys Ala Ala Tyr Gln Arg Phe Val Gln Arg Val Phe Asp Thr Gly Gln Met Thr Val Gly Asp Ala Ala Arg Lys Val Leu Arg Arg Gly His Ala Gln Phe Val Arg Gly Ala Gly Val Arg Pro Ala Asp Arg Val Lys Asp Leu Thr Val Pro Glu Trp Thr Ala Leu Phe Arg Ala Tyr Gly Arg Thr Ala Asp Arg 275,280 <210> 17 <211> 831 <212> DNA
<213> Streptomyces ambofaciens <220>
<221> CDS
<222> (1) .. (831) i <400>

gtg aaggag gtggcggtcgac accggt accccggcc ggccccgtg tgg 48 ia LysGlu Va151aValAsp ThrGly ThrProAla G1yProVal Trp cgt ggtgcc g9cctcggcacc cagctg tgggtactg accgcgcgg cag 96 A Gl ll rg y AG LeuGlyThr GlnLeu TrpValLeu ThrAlaArg Gln ay atc c tcc at tacc t 9 g9 gac cgccgc ctggcgctg ttcagcctg atg 144 Ile ArgSer MetTyrGlyAsp ArgArg LeuAlaLeu PheSerLeu Met caa ccggtg atcatgctgttg ctgctg agcgagatc ttcggcagc atg 192 Gln ProVal IleMetLeuLeu LeuLeu SerGluIle PheGlySer Met gcc gacccg gacgacttcccg cagggc gtgcgctac atcgactac gtg 240 Ala AspPro AspAspPhePro GlnG1y ValArgTyr IleAspTyr V
1a gtg cccgcg ctgctggtcacc accggc atcggctcg gcccagggc gcg 288 l ~

Va ProAla LeuLeuValThr ThrG IleGlySer AlaGlnG1y Ala iy 9 9 9 g gtcagggac atggac aac9 9 G1 ~ V Gl G t V g 336 l ~

ay LeuValArgAsp MetAsp Asn1 Me al l A Phe g cg ~ gtcctg ccggcccggctg ttcctg gtgctggtc gcccggtcg ctg 384 Arg ValLeu ProAlaArgLeu PheLeu ValLeuVal AlaArgSer Leu gcc gat ctg gtc cgt gt9 ttc acc gag ttg gtc gtc ctc gt9 gcc gtc 432 Ala Asp Leu Val Arg Val Phe Thr Glu Leu Val Val Leu Val Ala Val Ggt gtg atc ctg ctg ggc ttc cgt ccg gcc ggg ggt ttg tgg ggc ac 480 1y Va1 Ile Leu Leu G1y Phe Arg Pro Ala G1y G1y Leu Trp G1y Thr tcc gcc gcc ctg ttg ctc acc ctg ttc gtc atc tgg tcg ctg atc tgg 528 Ser Ala Ala Leu Leu Leu Thr Leu Phe Val Ile Trp Ser Leu Ile Trp gggttc atcgcc ctcgcggcg tggctgcgc agcgtggag gtgatgtcc 576 G1yPhe IleAla LeuAlaAla TrpLeuArg SerValGlu ValMetSer agcctc gcggtt ctggtgatg ttcccgctc atgttcgcc tccagtgcg 624 SerLeu AlaVal LeuValMet PheProLeu MetPheAla SerSerAla ttcgtc ccgctg gacgccctc ccggagtgg ctgcgctcg gtggcgcac 672 PheVal ProLeu AspAlaLeu ProGluTrp LeuArgSer ValAlaHis ctcaac cccgt9 acgtacgcg gtcgacagc gcccgccgc ctggcgctg 720 LeuAsn ProVal ThrTyrAla ValAspSer AlaArgArg LeuAlaLeu gac tgg gac ccg ggg tgg agc gtg ccc gg cg g3ctg ctg acc agc acc 768 Asp Trp Asp Pro G ~ ly Trp Ser Val Pro G1y Ala Leu Leu Thr Ser Thr gcg ctc atg gcg gt g9g atg tac gtc gcc g9g cgt tcc ttc aag agg 816 Ala Leu Met Ala Va ~ Gly Met Tyr Val Ala Gly Arg Ser Phe Lys Arg ccc ccg aac gaa tga 831 Pro Pro Asn Glu <210> 18 <211> 276 <212> PRT ' <213> Streptomyces ambofaciens <400> 18 Val Lys Glu Val Ala Val Asp Thr Gly Thr Pro Ala Gly Pro Val Trp Arg Gly Ala Gly Leu Gly Thr Gln Leu Trp Val Leu Thr Ala Arg Gln Ile Arg Ser Met Tyr Gly Asp Arg Arg Leu Ala Leu Phe Ser Leu Met Gln Pro Val Ile Met Leu Leu Leu Leu Ser Glu Ile Phe Gly Ser Met Ala Asp Pro Asp Asp Phe Pro Gln Gly Val Arg Tyr Ile Asp Tyr Val 65 70 75 '80 Val Pro Ala Leu Leu Val Thr Thr Gly Ile Gly Ser Ala Gln Gly Ala Gly Val Gly Leu Val Arg Asp Met Asp Asn Gly Met Val Ala Arg Phe Arg Val Leu Pro Ala Arg Leu Phe Leu Val Leu Val Ala Arg Ser Leu Ala Asp Leu Val Arg Val Phe Thr Glu Leu Val Val Leu Val Ala Val Gly Val Ile Leu Leu Gly Phe Arg Pro Ala Gly Gly Leu Trp Gly Thr Ser Ala Ala Leu Leu Leu Thr Leu Phe Val Ile Trp Ser Leu Ile Trp Gly Phe Ile Ala Leu Ala Ala Trp Leu Arg Ser Val Glu Val Met Ser Ser Leu Ala Val Leu Val Met Phe Pro Leu Met Phe Ala Ser Ser Ala Phe Val Pro Leu Asp Ala Leu Pro Glu Trp Leu Arg Ser Val Ala His Leu Asn Pro Val Thr Tyr Ala Val Asp Ser Ala Arg Arg Leu Ala Leu Asp Trp Asp Pro Gly Trp Ser Val Pro Gly Ala Leu Leu Thr Ser Thr s Ala Leu Met Ala Val Gly Met Tyr Val Ala Gly Arg Ser Phe Lys Arg 260 ~ 265 270 Pro Pro Asn Glu <210> 19 <211> 882 <212> DNA
<213> Streptomyces ambofaciens <220>

<221> CDS

<222> (1) .. (882) <400> 19 gtggacatcgag gtcaa c 9 9 9 9 G g G 48 Va1AspIleGlu Vallu A ly ArgVal LeuG1 ~ Le Le Gly His g aacg ~ ggccggc aagacgacc ttggt9aac atccttgcc acggtc tcc 96 AsnG ~ lAl G ~ l y ay LysThrThr LeuValAsn IleLeuAla ThrVal Ser ccggcgtccgcg ggcacggtg accgtcgcc ggtttcgac gtcgcg acg 144 ProAlaSerAla GlyThrVal ThrValAla GlyPheAsp ValAla Thr cagg gccgag atccgcgcg cgcatcg9g -gt9acc lc 192 ~

GG AlaGlu IleArgAla ArgIleGly ValThrG ~ y GlnPhe l ny tcggtggacgag tacctgagc ggattccgc aacctcgtc ctgatc ggc 240 SerValAspGlu TyrLeuSer GlyPheArg AsnLeuVal LeuIle Gly cgcctcctcggg gcgggacgg cgtgaggcg gcggcccgg gccacc gag 288 ArgLeuLeuGly AlaGlyArg ArgGluAla AlaAlaArg AlaThr Glu ctcctggagctg ttcgagctg accggggcg gcccaccag ccctcc cgc 336 LeuLeuGluLeu PheGluLeu ThrGlyAla AlaHisGln ProSer Arg acctactcgggc gggatgcgc cgacggctc gacctcgcc gccagc ctg 384 ThrTyrSerGly GlyMetArg ArgArgLeu AspLeuAla AlaSer Leu ValGl AggPr VG r ~ 432 l G

y sp a Le PheLeusp l Pr Th Thr1 Le gac ccg gcg acc cgg atc gcc ctg tgg gag acg gtg gag aag ctg gtg 480 Asp Pro Ala Thr Arg Ile Ala Leu Trp Glu Thr Val Glu Lys Leu V 1a gcg ggc ggc acg acc gtc ctg ctg acc acc cag tac ctg gac gag gcg 528 Ala Gly Gly Thr Thr Val Leu Leu Thr Thr Gln Tyr Leu Asp Glu Ala gac cgg ctg gcc gac tgg atc acc gtc ctg tcg aag ggc c Asp Arg Leu Ala Asp Trp Ile Thr Val Leu Ser Lys Gly Agg Va ~ Va ~ 576 gcc tcg gac acc acc gac cgg ctc aag gcc gac ctg ggc cac cgg tcg 624 'Ala Ser i95 Thr Thr Asp Arg Leu Lys Ala Asp Leu Gly His Arg Ser '200 205 g gg gtggtcctt ccgccc gccgccgac ctgacggcc gccgccgcc 672 g ValArg ValValLeu ProPro AlaAlaAsp LeuThrAla AlaAlaAla gcgctc accgccggc gggttc cgtccgcgg tccgacgcc ggggagcac 720 AlaLeu ThrAlaGl Gl h yy P ArgProArg SerAspAla GlyGluHis e gcgctg accacgccc gtggac acctcggcc ggtatcgcg ggcgtcatc 768 AlaLeu ThrThrPro Va ~ IAsp ThrSerAla GlyIleAla GlyValIle cgcgcg ctggacacc gtcgga acgcaggcc gtcgagctg accgtcaag 816 ArgAla LeuAspThr ValGly ThrGlnAla ValGluLeu ThrValLys gagccg tccctggac gacgtc tacctggcg ctcacccat ccctcaccc 864 Gl P

u ro SerLeuAsp AspVal TyrLeuAla LeuThrHis ProSerPro cc cc ac cg 882 t at la la sp l la <210> 20 <211> 293 <212> PRT
<213> Streptomyces ambofaciens <400> 20 Val Asp Ile Glu Val Glu Arg Gly Arg Val Leu Gly Leu Leu Gly His Asn Gly Ala Gly Lys Thr Thr Leu Val Asn Ile Leu Ala Thr Val Ser Pro Ala Ser Ala Gly Thr Val Thr Val Ala Gly Phe Asp Val Ala Thr Gln Gly Ala Glu Ile Arg Ala Arg Ile Gly Val Thr Gly Gln Phe Ala Ser Val Asp Glu Tyr Leu Ser Gly Phe Arg Asn Leu Val Leu Ile Gly Arg Leu Leu Gly Ala Gly Arg Arg Glu Ala Ala Ala Arg Ala Thr Glu Leu Leu Glu Leu Phe Glu Leu Thr Gly Ala Ala His Gln Pro Ser Arg Thr Tyr Ser Gly Gly Met Arg Arg Arg Leu Asp Leu Ala Ala Ser Leu Val Gly Arg Pro Asp Val Leu Phe Leu Asp Glu Pro Thr Thr Gly Leu Asp Pro Ala Thr Arg Ile Ala Leu Trp Glu Thr Val Glu Lys Leu Val Ala Gly Gly Thr Thr Val Leu Leu Thr Thr Gln Tyr Leu Asp Glu Ala Asp Arg Leu Ala Asp Trp Ile Thr Val Leu Ser Lys Gly Arg Val Val Ala Ser Asp Thr Thr Asp Arg Leu Lys Ala Asp Leu Gly His Arg Ser Val Arg Val Val Leu Pro Pro Ala Ala Asp Leu Thr Ala Ala Ala Ala Ala Leu Thr Ala Gly Gly Phe Arg Pro Arg Ser Asp Ala Gly Glu His 225. 230 235 ~ 240 Ala Leu Thr Thr Pro Val Asp Thr Ser Ala Gly Ile Ala Gly Val Ile Arg Ala Leu Asp Thr Val Gly Thr Gln Ala Val Glu Leu Thr Val Lys Glu Pro Ser Leu Asp Asp Val Tyr Leu Ala Leu Thr His Pro Ser Pro Ala Ala Asp Ala Ala <210> 21 <211> 228 <212> DNA
<213> Streptomyces ambofaciens <220>
<221> CDS
<222> (1) .. (228) <400> 21 atg agc aac ccg ttc gag gac acg gaa gcc acc tac gtc gtg ctg gtc 4g Met Ser Asn Pro Phe Glu Asp Thr Glu Ala Thr Tyr Val Val Leu Val 1 5 Page aacgac g9gcag cactcgctg tggccgtcg ttcgcggag gtcccg 96 gag AsnAsp GlyGln HisSerLeu TrpProSer PheAlaGlu ValPro Glue gcgggc tccgtc gtggtgccg gagacggac cggcagtcg tgcctg 144 Al tgg gl ay Trp SerVal ValValPro GluThrAsp ArgGlnSer CysLeu gactac aacgag aactggacc gacatgcgc cccaagagc ctcgtc 192 atc AspTyr AsnGlu Asn5 Thr AspMetArg ProLysSer LeuVal Island p gaggcgatg gcgacg gccg9gcag gacgcccct tga 228 GluAlaMet AlaThr AlaGlyGln AspAlaPro 65 ~ 70 75 <210> 22 <211> 75 <212> PRT
<213> Streptomyces ambofaciens <400> 22 Met Ser Asn Pro Phe Glu Asp Thr Glu Ala Thr Tyr Val Val Leu Val Asn Asp Glu Gly Gln His Ser Leu Trp Pro Ser Phe Ala Glu Val Pro 20 25, 30 Ala Gly Trp Ser Val Val Val Pro Glu Thr Asp Arg Gln Ser Cys Leu Asp Tyr Ile Asn Glu Asn 55p Thr Asp Met Arg Pro Lys Ser Leu Val Glu Ala Met Ala Thr Ala Gly Gln Asp Ala Pro <210> 23 <211> 1212-<212> DNA
<213> Streptomyces ambofaciens <220>
<221> eDs <222> (1) .. (1212) <400> 23 atg gt gag gcc gt9 acg ga ccg atg gag ctg agc aag gac c Met G ~ y Glu Ala Val Thr G ~ y Pro Met Glu Leu Ser Lys Asp älâ äsp 4 $

gcc cgg ggg ctg ctt gag tgg ttc gcg tac aac agg acg cgt cat ccg g6 Ala Arg Gly Leu Leu Glu Trp Phe Ala Tyr Asn Arg Thr Arg His Pro gt9 ttc tgg gac gag acc cga cag gcg tgg cag gtc ttc gc tac gac 144 Val Phe 35p Asp Glu Thr Arg Gln Ala Trp Gln Val Phe G ~ y Tyr Asp Page gac acggtgtcg 48 tcggac ttc 192 tac aac gt9 aac ccg cag ttc ttc cc Asp Val ThrValSer Asn Pro PhePhe SerAsp Phe Tyr Asn Gln Ser aac gtg atgccgacg ccgcccgaa gagatg atcggt ccg 240 atg ctg atc Asn Val MetProThr ProProGlu LeuGluMet IleIleGly Pro Met Ggc atc ggcgcgctg gacccgccc gcgcacgga ccgatgcgc aag 288 acg It 1 Thr ye G AlaLeu AspProPro AlaHisGly ProMetArg Lys there ctggtgagc caggcgttc accccccga cggatcgcc cggctggag ccc 336 LeuValSer GlnAlaPhe ThrProArg ArgIleAla ArgLeuGlu Pro 100 105: 110 agggtgcgc gcgatcacc gaggagctc ctggacaag gtggggcag cag 384 ArgValArg AlaIleThr Gl l u G Leu LeuAspLys ValGlyGln Gln u gacgtcgtc gacgccgtg ggtgacctg tcctacgeg ctgccggtc atc 432 As vv It paa AspAlaVal i1 AspLeu SerTyrAla LeuProVal Ile gt9atcgcc gaactgctg ggcataccc gccggcgac cgtgacctg ttc 480 ValIleAla Gl L ~

u eu Leu G IlePro AlaGlyAsp ArgAspLeu Phe ly cgggagtgg gtcgacacc ctgctgacg aacgagggc ctggagtac ccg 528 At l rg G Trp ValAspThr LeuLeuThr AsnGluGly LeuGluTyr Pro u aacctcccg gacaacttc accgagacg atcgcgccc gcgctcaag gag 576 AsnLeuPro AspAsnPhe ThrGl, .uThr IleAlaPro AlaLeuLys Glu atgaccgac tacctcctg aagcagatc cacgccaag cgggacgcg cc 624: ~~
M Th ~
t er i95 TyrLeuLeu LysGlnIle HisAlaLys r AspAla Pro ~

gccgacgac ctggtcagc gggctggtc caggcggag caggacgc c 672 Al c a AspAsp LeuValSer GlyLeuVal GlnAlaGlu GlnAspGly Agg cggctgacc gacgtcgag atcgtcaac atcgtcgcg ctgctcctg acg 720 ArgLeuThr AspValGlu IleValAsn IleValAla LeuLeuLeu Thr 225 230 _ 235 240 gcggggcac gtctcctcc agcaccctg ctcagcaac ctgttcctg gtc 768 Al 1 a G His ValSerSer SerThrLeu LeuSerAsn LeuPheLeu Val there ctggaggag aacccgcag gcgctggag gacctgcgg gccgatcgc tcc 816 LeuGl l u G AsnProGln AlaLeuGlu AspLeuArg AlaAspArg Ser u ctggtgccc ggcgcgatc gaggagacg ctgcgctac cgcagcccc ttc 864 LeuValPro GlyAlaIle GluGluThr LeuArgTyr ArgSerPro Phe aacaacatc ttccggttc gtcaaggag gacaccacc gtcctcggt ccg 912 AsnAsnIle PheArgPhe ValLysGlu Asp Thr ValLeuGly Pro Thr ctcatggag aagg9ccag atggtgatc gcc agc cagtccgcc aac 960 tgg LeuMetGlu LysGlyGln MetValIle Ala Ser GlnSer Asn Trp Ala cgggacccc cggcacttc ccggacccg gac ttc gac cgc cgc 1008 acc atc Page ArgAspProArg HisPhe ProAspPro AspThrPhe AspIleArgArg tcggacg9cacc cggcac atggccttc g cac g ggc atccaccactgc 1056 g SerAspGlyThr ArgHis MetAlaPhe GlyHisGly IleHisHisCys ctgggtgccgcc ctcgcc cgcctggag ggcaaggtc atgctcgaactc 1104 LeuGlyAlaAla LeuAla ArgLeuGlu GlyLysVal MetLeuGluLeu ctcctggaccgg gtccaa ggcttccgc atcgaccac gagcacaccgtg 1152 LeuLeuAspArg ValGln GlyPheArg IleAspHis GluHisThrVal ttctacgaggcc gaCcag ctcactccg aagtacctg cccgtccgggtc 1200 PheTyrGluAla AspGln LeuThrPro LysTyrLeu ProValArgVal gactggaactga 1212 AspTrpAsn <210> 24 <211> 403 <212> PRT
<213> Streptomyces ambofaciens <400> 24 let Gly Glu Ala 5a1 Thr Gly Pro Met Glu Leu Ser Lys Asp Ala Asp Ala Arg Gly Leu Leu Glu Trp Phe Ala Tyr Asn Arg Thr Arg His Pro ~ o. , z5 .v. , 30 .
Val Phe Trp Asp Glu Thr Arg Gln Ala Trp Gln Val Phe Gly Tyr Asp Asp Tyr Val Thr Val Ser Asn Asn Pro Gln Phe Phe Ser Ser Asp Phe Asn Met Val Met Pro Thr Pro Pro Glu Leu Glu Met Ile Ile Gly Pro Gly Thr Ile Gly Ala Leu Asp Pro Pro Ala His Gly Pro Met Arg Lys Leu Val Ser Gln Ala Phe Thr Pro Arg Arg Ile Ala Arg Leu Glu Pro Arg Val Arg Ala Ile Thr Glu Glu Leu Leu Asp Lys Val Gly Gln Gln Asp Val Val Asp Ala Val Gly Asp Leu Ser Tyr Ala Leu Pro Val Ile Val Ile Ala Glu Leu Leu Gly Ile Pro Ala Gly Asp Arg Asp Leu Phe Arg Glu Trp Val Asp Thr Leu Leu Thr Asn Glu Gly Leu Glu Tyr Pro Asn Leu Pro Asp Asn Phe Thr Glu Thr Ile Ala Pro Ala Leu Lys Glu Met Thr 195 Tyr Leu Leu Lys Gln Ile His Ala Lys Arg Asp Ala Pro Ala Asp Asp Leu Val Ser Gly Leu Val Gln Ala Glu Gln "Asp Gly Arg 210 215 220 ' Arg Leu Thr Asp Val Glu Ile Val Asn Ile Val Ala Leu Leu Leu Thr Ala Gly His Val Ser Ser Ser Thr Leu Leu Ser Asn Leu Phe Leu Val Leu Glu Glu Asn Pro Gln Ala Leu Glu Asp Leu Arg Ala Asp Arg Ser Leu Val Pro Gly Ala Ile Glu Glu Thr Leu Arg Tyr Arg Ser Pro Phe 275 280, 285 Asn Asn Ile Phe Arg Phe Val Lys Glu Asp Thr Thr Val Leu Gly Pro .., Leu Met Glu Lys Gly Gln Met Val Ile Ala Trp Ser Gln 5er Ala Asn Arg Asp Pro Arg His Phe Pro Asp Pro Asp Thr Phe Asp Ile Arg Arg Ser Asp Gly Thr Arg His Met Ala Phe Gly His Gly Ile His His Cys '340 345 350 Leu Gly Ala Ala Leu Ala Arg Leu Glu Gly Lys Val Met Leu Glu Leu Leu Leu Asp Arg Val Gln Gly Phe Arg Ile Asp His Glu His Thr Val Phe Tyr Glu Ala Asp Gln Leu Thr Pro Lys Tyr Leu Pro Val Arg Val Asp Trp Asn <210> 25 <211> 540 <212> DNA

<213> Streptomyces ambofaciens <220>

<221> CDS

<222> (1) .. (540) <220>

<221> CDS2 <222> (190) .. (540) <400> 25 ctg ccg agggtc tcgtcccgg agtccaggg ccgtcccgagcc gc 48 aac Leu Pro Arg5a1 SerSerArg Serro G1y ProSerArgAla G ~ Iy Asn 1 i0, 15 cct cct cacgac cgcccgata aggagcgcc gccatcgccgag aac 96 gga Pro Pro HisAsp ArgProIle ArgSerAla AlaIleAlaGlu Asn Gly 20 ~ 25 30 aca gag ctccct gcccggcgg gtcggcagg atcaagccgtgc cgg 144 gcc Thr Glu LeuPro AlaArgArg ValGlyArg IleLysProCys Arg To the ctg agg ctcgag cagcacatc gacccgcgc ggcagcctctcc gtg 192 atc Leu Arg LeuGlu GlnHisIle AspProArg G1ySerLeuSer V
Island 1a atc tcc g9cgt9 accgt9gac ttccccgtc cgacgcgtctac tac 240 gag Ile Ser GlyVal ThrValAsp PheProVal ArgArgValTyr Tyr Glue atg ggc cagacc cagtcctct cccccgcgc ggcctgcacgcg cac 288 cat Met Gly GlnThr GlnSerSer ProProArg GlyLeuHisAla His His cgc ctg gaacaa ctcgtcatc gccgtccac g9cgccttctcc atc 336 access Arg Leu GluGln LeuVal = the AlaValHis G ~ yAlaPheSer Ile Thr acc gac gacg9c ttccagcac gccacctac cgtctggacgaa ccc 384 ctc Thr Asp AspGly PheGlnHis AlaThrTyr ArgLeuAspGlu Pro Leu Gga gga ctctgc atcggcccc atggtctgg cgcgtcctgaag gac 432 gcc Gl al yy LeuCys IleGlyPro MetValTrp ArgValLeuLys Asp at ttc ccc gacacc gtggccctg gtcctcgcc tcgcagcactac gag 480 gac Phe Pro AspThr ValAlaLeu ValLeuAla SerGlnHisTyr Glu Asp gag gac tactac cgcgactac gacaccttc ctgcatgacgca cgg 528 cc Glu Asp TyrTyr ArgAspTyr AspThrPhe LeuHisAspAla Arg Ser agc aca tga 540 ctc Ser Thr Leu <210>

<211>

<2l2>
PRT

<213> ambofaci ens Streptomyces <400> 26 Leu Asn Pro Arg Val Ser Ser Arg Ser Pro Gly Pro Ser Arg Ala Gly Pro Gly Pro His Asp Arg Pro Ile Arg Ser Ala Ala Ile Ala Glu Asn Thr Ala Glu Leu Pro Ala Arg Arg Val Gly Arg Ile Lys Pro Cys Arg Leu Ile Arg Leu Glu Gln His Ile Asp Pro Arg Gly Ser Leu Ser Val at Ile Glu Ser Gly Val Thr Val Asp Phe Pro Val Arg Arg Val Tyr Tyr 65 70. 75 g0 Met His Gly Gln Thr Gln Ser Ser Pro Pro Arg Gly Leu His Ala His Arg Thr Leu Glu Gln Leu Val Ile Ala Val His Gly Ala Phe Ser Ile Thr Leu Asp Asp Gly Phe Gln His Ala Thr Tyr Arg Leu Asp Glu Pro Gly 130 Gly Leu Cys Ile i35 Pro Met Val Trp i4g Val Leu Lys Asp Phe Asp Pro Asp Thr Val Ala Leu Val Leu Ala Ser Gln His Tyr Glu Glu Ser Asp Tyr Tyr Arg Asp Tyr Asp Thr Phe Leu His Asp Ala Arg Ser Leu Thr <210> 27 <211> 116 <212> PRT
<213> Streptomyces ambofaciens <400> 27 ial Ile Glu Ser 51y Val Thr Val Asp Phe Pro Val Arg Arg Val Tyr Tyr Met His Gly Gln Thr Gln Ser Ser Pro Pro Arg Gly Leu His Ala His Arg Thr Leu Glu Gln Leu Val Ile Ala Val His Gly Ala Phe Ser Ile Thr Leu Asp Asp Gly Phe Gln His Ala Thr Tyr Arg Leu Asp Glu Pro Gly Ala Gly Leu Cys Ile Gly Pro Met Val Trp Arg Val Leu Lys Asp Phe Asp Pro Asp Thr Val Ala Leu Val Leu Ala Ser Gln His Tyr Glu Glu Ser Asp Tyr Tyr Arg Asp Tyr Asp Thr Phe Leu His Asp Ala Arg Ser Leu Thr <210> 28 <211> 1167 <212> DNA
<213> Streptomyces ambofaciens <220>

<221> CDS

<222> (1),. (1167) <400> 28 atgaccatc cccttcctc gacgcgggc gccggctac cgggagttg cga 48 MetThrIle P h ro P Leu AspAlaG1y AlaG1yTyr ArgGluLeu Arg e gccgagatc gacgcggcc ctgcagcgg gtgtccgcc tccggecgc tat 96 AlaGluIle A AlaAla LeuGln25g Va ~ 1SerAla SerG1yArg Tyr s p O

ctgctcgac gcggaactc gcggccttc gaggaggag ttcgccgcg tc 144 LeuLeuAs AlaGluLeu AlaAlaPhe p GluGlu PheAlaAla Tire Glue tgcgacaac gaccactgt gtggcggtg ggcagtggc tgcgacgcg ctg 192 Cys5p Asn AspHisCys 55 AlaVa1 G1ySery CysAspAla Leu gagctgtcc ctgcgggcg ctggacatc ggtcccggg gacgaggtg gtg 240 GluLeuS L

er eu ArgAla LeuAspIle GlyProGly AspGluVal Val 65 70 75 g0 gtgcccgcg cacaccttc atcgggacc tggctggcc gtgtccgct acc 288 ValProAla HisThrPhe IleGlyThr TrpLeuAla ValSerAla Thr ggg cggccg gtggcc gtcgacccgacg ccggacggg ctctccctc 336 gca Ar PV l G1y 1 To the g ro a A ValAspProThr ProAspGly LeuSerLeu at gacccggcgctg gtggag gcggcgctcacc cctcggacc agagccctg 384 AspProAlaLeu ValGlu AlaAlaLeuThr ProArgThr ArgAlaLeu atgccggtgcac ctgcac gggcacccggcc gacctcgac ccgctactg 432 MetProValHis LeuHis G1yHisProAla AspLeuAsp ProLeuLeu gcgatcgccgga cggcac ggcctggccgtg gtcgaggac gccgcgcag 480 ~

AlaIleAlaIy ArgHis GlyLeuAlaVa1 ValGluAsp AlaAlaGln G

gcc cac ggc gcc cgt tac cgg ggc cgc agg atc ggc tcg ggc cac gtg 528 Page Ala Gly AlaArgTyr ArgGlyArg 54 SerGlyHis Val His Arg Isle Gly gtcgcgttc agcttctac cccggcaag aacctcggc cc at g ValAlaPhe SerPheTyr ProGl L t G 576 ~

y ys AsnLeuGly la Me l sp Gl Gl l VV g GGVG 624 l yya al Th ly sp Ser ly al la l AggIle Agg ttgctgcgc aactgcg9c tcgcgggag aagtaccgg cacgaggtg cgc 672 LeuLeuArg AsnC Gl S l s yy er ArgG LysTyrArg HisGluVal Arg u s tcgacccac tcccggctc gacgagttc caggcggcc gtgctgcgg gec 720 S h er T His SerArgLeu AspGluPhe GlnAlaAla ValLeuArg Ala r aaactgccg eggctcgac gcgtggaac gcccgccgg gccggcacg gcc 768 LysLeuPro Arg2 Asp AlaTrpAsn AlaArgArg AlaGlyThr Ala gaacggtac gggcgggcc ctgggtccg gtaccgcag atcgccgtc ccg 816 GluAr TG ~ IA l r gyy rg A LeuGlyPro ValProGln IleAlaVal Pro at gtcaccgct ccctgggcc gacccggtg tggcacctg tacgtgatc cgc 864 ValThrAla ProTr Al pa AspProVa1 TrpHisLeu TyrValIle Arg tgcgcggag cgcgacgag ctgcgccgc cggctggaa cgagccggg gtc 912 C ll ys AG ArgAspGlu LeuArgArg ArgLeuGlu ArgAlaGly Val at cagaccctg atccactac cccgtgccc ccgcaccgg tccccggcc tac 960 Th ~

r Leu IleHisTyr ProVa Pro ProHisArg SerProAla Tyr I

gccgacgac ccggccggc gcaccggcg gggacccac ccgctcagt gag 1008 AlaAspAs ProAl Gl l pay A ProAla GlyThrHis ProLeuSer Glu at cgcctggcg gcgcagagc ctcagcctt cccctggga ccgcacctc ggg 1056 ArgLeuAla AlaGlnSer LeuSerLeu ProLeuG1y ProHisLeu G ~ Iy gaggacgag gcccgcgcc gtcgtggcg gcggtccgg gcggcgtcc gca 1104 Glu ll sp GA ArgAla ValValAla AlaValArg AlaAlaSer Ala ua gggctggcg gcgtacccg acgccggac ggccagcgt tttcctcta gtg 1152 G Ala Al T
there 37 yr Pro ThrProAsp GlyGlnArg PheProLeu Val 375,380 acggagaaa cgatga 1167 ThrGluLys Arg <210> 9 <211> 88 <212> RT
P

<213> treptomycesambofaciens S

<400> 29 Met Thr Ile Pro Phe Leu Asp Ala Gly Ala Gly Tyr Arg Glu Leu Arg Ala Glu Ile Asp Ala Ala Leu Gln Z5g Val ser Ala Ser Gly Arg Tyr Leu Leu Asp Ala Glu Leu Ala Ala Phe Glu Glu Glu Phe Ala Ala Tyr Cys Asp Asn Asp His Cys Val Ala Val Gly Ser Gly Cys Asp Ala Leu Glu Leu Ser Leu Arg Ala Leu Asp Ile Gly Pro Gly Asp Glu Val Val 65 70 75 80, Val Pro Ala His Thr Phe Ile Gly Thr Trp Leu Ala Val Ser Ala Thr Gly Ala Arg Pro Val Ala Val Asp Pro Thr Pro Asp Gly Leu Ser Leu Asp Pro Ala Leu Val Glu Ala Ala Leu Thr Pro Arg Thr Arg Ala Leu Met Pro Val His Leu His Gly His Pro Ala Asp Leu Asp Pro Leu Leu Ala Ile Ala Gly Arg His Gly Leu Ala Val Val Glu Asp Ala Ala Gln Ala His Gly Ala Arg Tyr Arg Gly Arg Arg Ile Gly Ser Gly His Val ' Val Ala Phe Ser Phe Tyr Pro Gly Lys Asn Leu Gly Ala Met Gly Asp Gly Gly Ala Val Val Thr Gly Asp Ser Gly Va1 Ala Glu Arg Ile Arg Leu Leu Arg Asn Cys Gly Ser Arg Glu Lys Tyr Arg His Glu Val Arg Ser Thr His Ser Arg Leu Asp Glu Phe Gln Ala Ala Val Leu Arg Ala Lys Leu Pro Arg Leu Asp Ala Trp Asn Ala Arg Arg Ala Gly Thr Ala Glu Arg Tyr Gly Arg Ala Leu Gly Pro Val Pro Gln Ile Ala Val Pro Val Thr Ala Pro Trp Ala Asp Pro Val Trp His Leu Tyr Val Ile Arg Cys Ala Glu Arg Asp Glu Leu Arg Arg Arg Leu Glu Arg Ala Gly Val Gln Thr Leu Ile His Tyr Pro Val Pro Pro His Arg Ser Pro Ala Tyr Ala Asp Asp Pro Ala Gly Ala Pro Ala Gly Thr His Pro Leu Ser Glu Arg Leu Ala Ala Gln Ser Leu Ser Leu Pro Leu Gly Pro His Leu Gly Glu Asp Glu Ala Arg Ala Val Val Ala Ala Val Arg Ala Ala Ser Ala Gly Leu Ala Ala Tyr Pro Thr Pro Asp Gly Gln Arg Phe Pro Leu Val Thr Glu Lys Arg <210> 30 <211> 909 <212> DNA
<213> Streptomyces ambofaciens <220>

<22 ~.> CDS

<222> (1) .. (909) <220>

<221> CDS2 <222> (10) .. (909) <220>

<221> CDS3 <222> (28) .. (909) <400> 30 atg gag gtc atgtcag9g cgtcccgga atgaaag9gatc atcctc 48 access Met Glu Val MetSerGly ArgProGly MetLysGlyIle IleLeu Thr gca ggc gga gggacccgc ctacgcccc ttgaccggcacg ctgtcc 96 ggc Ala Gly Gly GlyThrArg LeuArgPro LeuThrGlyThr LeuSer Gly aag ctg ctg cccgtctac gacaagccg atgatctactac ccgctg 144 caa Lys Leu Leu ProValTyr AspLysPro MetIleTyrTyr ProLeu Gln tcc ctg atg ctgggcggc atccgcgag atcctcgtcgtc tcctcc 192 gtc Ser Leu Met LeuGlyGly IleArgGlu IleLeuValVal SerSer Val acc cac atc gagctgttc cagcggctg ctgggcgacggc tcccgc 240 cag Thr His Ile GluLeuPhe GlnArgLeu LeuGlyAspGly SerArg Gl.n ctc ggc ctc gac atc acc tac gcc gaa cag gcc gag ccc gag ggc ata 288 Page Leu GlyLeu AspIleThr TyrAla GluGlnAla GluProGluGly Ile gcg caggcc atcaccatc ggcacc gaccacatc ggcgactcaccg gtc 336 Ala GlnAla IleThrIle GlyThr AspHisIle GlyAspSerPro Val gcg ctcatc ctgggcgac aacatc ttccacggc cccggcttctcg gcc 384 Ala LeuIle LeuGlyAsp AsnIle PheHisG1y ProG1yPheSer Ala gtg ctccag ggcageatc cgccac ctcgacggc tgtgtgctgttc ggc 432 Va1 LeuGln G1ySerIle ArgHis LeuAspG1y CysVa ~ ILeuPhe G ~ Iy s tac ccggtc agcgacccg aagcgc tacg9cgtc g9cgagatcgac gac 480 Tyr ProVal SerAspPro LysArg TyrGlyVal GlyGluIleAsp Asp cagggc gtactgctg tccctg gaggagaaaccg gcccggccc cgctcc 528 GlnGly ValLeuLeu SerLeu GluGluLysPro AlaArgPro ArgSer aacctc gccgtcacc ggcctc tacctctacgac aacgacgtg gtcgac 576 AL llh 1 sn eu A Va TG Leu TyrLeuTyrAsp AsnAspVal ValAsp ary atcgcc aagaacatc cggccc tcggcgcgcg9c gaactcgag atcacg 624 IleAla LysAsnIle ArgPro SerAlaArgGly GluLeuGlu IleThr gacgtc aacaggacc tacctg gagcagaaacgc gcccggctc atcgaa 672 .

AspVal AsnArgThr TyrLeu GluGlnLysArg AlaArgLeu IleGlu ctgggc cacggcttc gcctgg ctcgacatgggc acccacgac tccctc 720 L Gl Hi lhl eu ys GPA Trp LeuAspMetGly ThrHisAsp SenLeu yea 225, 230 235 240 ctccag ggcggccag tacgtc cagctcatcgag cagcgccag gga gtg 768 LeuGln GlyGlyGln Tyrval GlnLeuIleGlu GlnArgGln Gly Val cggatc gcctgcatc gaggag atcgccctgcgc atgg9cttc atc gac 816 ArgIle AlaCysIle GluGlu IleAlaLeuArg MetGlyPhe Ile Asp gccgac accctecac cggctc ggccgcgaactg ggcacctcc gga tac 864 AlaAsp ThrLeuHis ArgLeu GlyArgGluLeu GlyThrSer Gly Tyr ggcgcg tacctgatg gaggtg gccacccgtgca ggcaccgaa tga 909 ~

G Ala TyrLeuMet GluVal AlaThrArgAla G1yThrGlu iy <210> 31 <211> 302 <212> PRT
<213> Streptomyces ambofaciens <400> 31 Met Thr Glu Val Met Ser Gly Arg Pro Gly Met Lys Gly Ile Ile Leu Ala Gly Gly Gly Gly Thr Arg Leu Arg Pro Leu Thr Gly Thr Leu Ser Lys Gln Leu Leu Pro Val Tyr Asp Lys Pro Met Ile 45r Tyr Pro Leu Ser Val Leu Met Leu Gly Gly Ile Arg Glu Ile Leu Val Val Ser Ser Thr Gln His Ile Glu Leu Phe Gln Arg Leu Leu Gly Asp Gly Ser Arg Leu Gly Leu Asp Ile Thr Tyr Ala Glu Gln Ala Glu Pro Glu 95y Ile;

Ala Gln Ala Ile Thr Ile Gly Thr Asp His Ile Gly Asp Ser Pro Val Ala Leu Ile Leu Gly Asp Asn Ile Phe His Gly Pro Gly Phe Ser Ala Val Leu Gln Gly Ser Ile Arg His Leu Asp Gly Cys Val Leu Phe Gly Tyr Pro Val Ser Asp Pro Lys Arg Tyr Gly Val Gly Glu Ile Asp Asp Gln Gly Val Leu Leu Ser Leu Glu Glu i70 Pro Ala Arg Pro Arg Ser Asn Leu Ala Val Thr Gly Leu Tyr Leu Tyr Asp Asn Asp Val Val Asp Ile Ala Lys Asn Ile Arg Pro Ser Ala Arg Gly Glu Leu Glu Ile Thr Asp Val Asn Arg Thr Tyr Leu G1_u Gln Lys Arg Ala Arg Leu Ile Glu Leu Gly His Gly Phe Ala Trp Leu Asp Met Gly Thr His Asp Ser Leu Leu Gln Gly Gly Gln Tyr Val Gln Leu Ile Glu Gln Arg Gln Gly Val Arg Ile Ala Cys Ile Glu Glu Ile Ala Leu Arg Met Gly Phe Ile Asp Ala Asp Thr Leu His Arg Leu Gly Arg Glu Leu Gly Thr Ser Gly Tyr Gly Ala Tyr Leu Met Glu Val Ala Thr Arg Ala Gly Thr Glu <210> 32 <211> 299 <212> PRT
<213> Streptomyces ambofaciens <400> 32 lal Met Ser Gly 5rg Pro Gly Met Lys Gly Ile Ile Leu Ala Gly Gly Gly Gly Thr Arg Leu Arg Pro Leu Thr Gly Thr Leu Ser Lys Gln Leu ., Leu Pro Val Tyr Asp Lys Pro Met Ile Tyr Tyr Pro Leu Ser Val Leu Met Leu Gly Gly Ile Arg Glu Ile Leu Val Val Ser Ser Thr Gln His Ile Glu Leu Phe Gln Arg Leu Leu Gly Asp Gly Ser Arg Leu Gly Leu Asp Ile Thr Tyr Ala Glu Gln Ala Glu Pro Glu Gly Ile Ala Gln Ala Ile Thr Ile Gly Thr Asp His Ile Gly Asp Ser Pro Val Ala Leu Ile Leu Gly Asp Asn Ile Phe His Gly Pro Gly Phe Ser Ala Val Leu Gln Gly Ser Ile Arg His Leu Asp Gly Cys Val Leu Phe Gly Tyr Pro Val Ser Asp Pro Lys Arg Tyr Gly Val Gly Glu Ile Asp Asp Gln Gly Val Leu Leu Ser Leu Glu Glu Lys Pro Ala Arg Pro Arg Ser Asn Leu Ala Val Thr Gly Leu Tyr Leu Tyr Asp Asn Asp Val Val Asp Ile Ala Lys Asn Ile Arg Pro Ser Ala Arg Gly Glu Leu Glu Ile Thr Asp Val Asn Arg Thr Tyr Leu Glu Gln Lys Arg Ala Arg Leu Ile Glu Leu Gly His Gly Phe Ala Trp Leu Asp Met Gly Thr His Asp Ser Leu Leu Gln Gly Gly Gln Tyr Val Gln Leu Ile Glu Gln Arg Gln Gly Val Arg Ile Ala Cys Ile Glu Glu Ile Ala Leu Arg Met Gly Phe Ile Asp Ala Asp Thr Leu His 2 ~ 5 Leu Gly Arg Glu Leu Gly Thr Ser Gly Tyr Gly Ala Tyr 280,285 Leu Met Glu Val Ala Thr Arg Ala Gly Thr Glu 290,295 <210> 33 <211> 293 <212> PRT
<213> Streptomyces ambofaciens <400> 33 ily Met Lys Gly 51e Ile Leu Ala Gly Gly Gly Gly Gly Thr Arg Leu Arg Pro Leu Thr ~ ôy Thr Leu Ser Lys Gln Leu Leu Pro Val Tyr Asp Lys Pro Met Ile Tyr Tyr Pro Leu Ser Val Leu Met Leu Gly Gly Ile Arg Glu Ile Leu Val Val Ser Ser Thr Gln His Ile Glu Leu Phe Gln Arg 50 55 60, Leu Leu Gly Asp Gly Ser Arg Leu Gly Leu Asp Ile Thr Tyr Ala Glu Gln Ala Glu Pro Glu Gly Ile Ala Gln Ala Ile Thr Ile Gly Thr Asp His Ile Gly Asp Ser Pro Val Ala Leu Ile Leu Gly Asp Asn Ile Phe His Gly Pro Gly Phe Ser Ala Val Leu Gln Gly Ser Ile Arg His Leu Asp Gly Cys Val Leu Phe i35 Tyr Pro Val Ser i4Ö Pro Lys Arg Tyr Gly Val Gly Glu Ile Asp Asp Gln Gly Val Leu Leu Ser Leu Glu Glu Lys Pro Ala Arg 165 Arg Ser Asn Leu Ala Val Thr Gly Leu Tyr Leu Tyr Asp Asn Asp Val Val Asp Ile Ala Lys Asn Ile Arg Pro Ser Ala Arg Gly Glu Leu Glu Ile Thr Asp Val Asn Arg Thr Tyr Leu Glu Gln Lys Arg Ala Arg Leu Ile Glu Leu Gly His Gly Phe Ala Trp Leu Asp Met Gly Thr His Asp Ser Leu Leu Gln Gly Gly Gln Tyr Val Gln Leu Ile Glu Gln Arg Gln Gly Val Arg Ile Ala Cys Ile Glu Glu Ile Ala 245 ~ 250 255 Leu Arg Met Gly Phe Ile Asp Ala Asp Thr Leu His Arg Leu Gly Arg Glu Leu 2 ~ 5 Thr Ser Gly Tyr Gly Ala Tyr Leu Met Glu Val Ala Thr 280,285 Arg Ala Gly Thr Glu <210> 34 <211> 1038 <212> DNA
<213> ambofacial streptomyces <220>
<221> CDS
<222> (1) .. (1038) <400> 34 gtgcaggcaccg aatgagacg ccgcgccgg cccgcccgc tccgccg9c 48 ValGl l n A Pro AsnGluThr ProArgArg ProAlaArg SerAlaGly at cgacggccgccg gcccggatc ctcgtcacc gggggcgcc ggcttcatc 96 ArgArgProPro AlaArgIle LeuValThr GlyGlyAla GlyPheIle ggctcgcgcttc gtgaacgcg ctgctggac ggctccctg ccggagttc 144 G ~ lySerAr Phe V
l ga AsnAla LeuLeuAsp GlySerLeu ProGluPhe ggcaaacccgag gtgagggtg ctcgacgcg ctcacctac gcgggcaac 192 G1y5y ProGlu Va1Arg55 LeuAspAla LeuThrTyr AlaGlyAsn s ctggccaatctg gccccggtg ggcgactgt ccccggctg cggatcttc 240 LeuAlaAsnLeu AlaProVal GlyAspCys ProArgLeu ArgIlePhe ccgg9ggacatc cgcgaccgc g9cgcggtc acccaggcg atggcgg9g 288 ProGlyAspIle Ar As A l gp rg G AlaVal ThrGlnAla MetAlaGly there gtcgacctggtg gtgcacttc gcggccgag tcgcacgtg gaccgctcg 336 GO
l a sp LeuVal ValHisPhe AlaAlaGlu SerHisVal AspArgSer atc gac gac gcc gac gcc ttc gtg cgc acc aac gtg ctg ggc acc cag 384 Ile Asp Asp Ala Asp Ala Phe Val Arg Thr Asn Val Leu Gly Thr Gln gtc ctc ctc cag gag gca ctg gcc gta cgc ccc ggg ctg ttc gt9 cac 432 Val Leu Leu Gln Glu Ala Leu Ala Val Arg Pro Gly Leu Phe Val His gtc tcg acg gac gag gtg tac ggc tcc atc gag gag ggg tcc tgg ccc 480 Val Ser Thr Asp Glu Val Tyr Gly Ser Ile Glu Glu Gly Ser Trp Pro gag gag cac ccg ctg aac ccc aac tcg ccc tac gcc gcc tcg aag gcg 528 Glu Glu His Pro Leu Asn Pro Asn Ser Pro Tyr Ala Ala Ser Lys Ala ~ tcc tcc gac ctg ctg gcg ctg gcc cac cac cgc acg cac gga ctg ccg 576 . Ser Ser Asp Leu Leu Ala Leu Ala His His Arg Thr His Gly Leu Pro gtgtgc gtcacccgc tgctccaac aactacg9g ccctaccag tacccg 624 Va1Cys ValThrArg CysSerAsn AsnTyrGly ProTyrGln TyrPro gagaag atcatcccg ctgttcacc agcagcctc ctcgacggc gggacc 672 GluLys IleIlePro LeuPheThr SerSerLeu LeuAspGly GlyThr gtcccg ctctacggg gacggcggc aaccggcgc gactggctg cacgtg 720 ValPro LeuTyrGly AspG1yG1y AsnArgArg AspTrpLeu HisVal gacgac cactgccgg ggcatcgcc ctggtggcc cggggcggc cggccc 768 AspAsp HisCysArg G1yIleAla LeuValAla ArgGlyG1y ArgPro ggcgag gtctacaac atcggcggc ggcaccgag ctgagcaae gtcgag 816 Gl Gl l yu Va TyrAsn IleGlyGly GlyThrGlu LeuSerAsn ValGlu 260 265 270: f ..:

ctcacg gagcgtctg ctgaaactg tgcggagcc gactggtcg gcggtg 864 LeuThr GluArgLeu LeuLysLeu CysGlyAla AspTrpSer AlaVal cggcgg gtgcccgac cgcaagggc cacgaccgg cgctactcc gtcgac 912 Arg29g Va1ProAsp Arg295G1y HisAspArg TyrSer ValAsp tacacc aagatcgcg gacgagctg ggttacgcg ccgcggatc accatc 960 TyrThr LysIleAla AspGluLeu GlyTyrAla ProArgIle ThrIle gacgaa gggctggag cggaccgtg cactggtac cgggagaac cgcgcg 1008 AspGlu GlyLeuGlu ArgThrVal HisTrpTyr ArgGluAsn ArgAla tggtgg gcgcccgcg aagaggg9g cgatga 1038 TrpTrp AlaProAla LysArgGly Arg 340,345 <210> 35 <211> 345 <212> PRT
<213> Streptomyces ambofaciens <400> 35 Val Gln Ala Pro Asn Glu Thr Pro Arg Arg Pro Ala Arg Ser Ala Gly Arg Arg Pro Pro Ala Arg Ile Leu Val Thr Gly Gly Ala Gly Phe Ile Gly Ser Arg Phe Val Asn Ala Leu Leu Asp Gly Ser Leu Pro Glu Phe Gly Lys Pro Glu Val Arg Val Leu Asp Ala Leu Thr Tyr Ala Gly Asn Leu Ala Asn Leu Ala Pro Val GlysASp Cys Pro Arg Leu Arg Ile Phe 65 70 ~ 75 80 Pro Gly Asp Ile Arg Asp Arg Gly Ala Val Thr Gln Ala Met Ala Gly Val Asp Leu Val Val His Phe Ala Ala Glu Ser His Val Asp Arg Ser Ile Asp Asp Ala Asp Ala Phe Val Arg Thr Asn Val Leu Gly Thr Gln Val Leu Leu Gln Glu Ala Leu Ala Val Arg Pro Gly Leu Phe Val His Val Ser Thr Asp Glu Val Tyr Gly Ser Ile Glu Glu Gly Ser Trp Pro Glu Glu His Pro Leu Asn Pro Asn Ser Pro Tyr Ala Ala Ser Lys Ala Ser Ser Asp Leu Leu Ala Leu Ala His His Arg Thr His Gly Leu Pro Val Cys Val Thr Arg Cys Ser Asn Asn Tyr Gly Pro Tyr Gln.Tyr Pro Glu Lys Ile Ile Pro Leu Phe Thr Ser Ser Leu Leu Asp Gly Gly Thr Val Pro Leu Tyr Gly Asp Gly Gly Asn Arg Arg Asp Trp Leu His Val Asp Asp His Cys Arg Gly Ile Ala Leu Val Ala Arg Gly Gly Arg Pro Gly Glu Val Tyr Asn Ile Gly Gly Gly Gly Thr Glu Leu Ser Asn Val Glu Leu Thr Glu Arg Leu Leu Lys Leu Cys Gly Ala Asp Trp Ser Ala Val Arg Arg Val Pro Asp Arg Lys Gly His Asp Arg Arg Tyr Ser Val Asp Tyr Thr Lys Ile Ala 31Ö Glu Leu Gly Tyr Ala Pro Arg Ile Thr Ile Asp Glu Gly Leu Glu Arg Thr Val His Trp Tyr Arg Glu Asn Arg Ala Trp Trp Ala Pro Ala Lys Arg Gly Arg 340,345 <210> 36 <211> 804 <212> DNA
<213> Streptomyces ambofaciens <220>

<221> CDS.

<222> (1) .. (804) <220>

<221> CD52 <222> (7) .. (804) <220>

<221> CDS3 <222> (22) .. (804) <400> 36 atg gt9acg accgca tccgt9gacccg ctcgacctg tggctccgc 48 acg ValTh h Met Thr r T Ala SerValAspPro LeuAspLeu TrpLeuArg r.

cgg cagccg tccgcg tcacccgccgtc cggctggt9 tgcttcccg 96 tock Arg GlnPro SerAla SerProAlaVal ArgLeuVal CysPhePro Tire cac g9cg9c tcggcg agttcgttcctg ccgttcacc cggcagctg 144 gcg 1 l His al a 3 G SerAla SerSerPheLeu ProPheThr ArgGlnLeu yy ccg cggatc gaggtc gtggccgtccag taccccggg cgccaggac 192 gac Pro ArgIle GluVal ValAlaValGln TyrProGly ArgGlnAsp p cgc agcgaa ccgctg gtcgacaccatc gagggactg gccgagccc 240 agg g Arg SerGlu ProLeu ValAspThrIle GluGlyLeu AlaGluPro ctg ggcctg ctggag gcgcaggccggc cccccggtg gtgctgttc 288 gcc l The l eu G Leu LeuGlu AlaGlnAlaGly ProProVal ValLeuPhe See y at Ggg agcatg ggcgcg ctggtggcctac gaggtcgcc cgcgcgctc 336 cac S
~ I
Hi y er i G1yAla LeuVa1AlaTyr GluValAla ArgAlaLeu s cag cgggga gcggct ccggtgcgcctg gtggtctcc gggcgccgg 384 cgg ArgGl AlaAl P ~
Gln Arg ya ro ValArgLeu Va ValSer G1yArgArg I

gcc gccgtc gaccgg ccgatgaccgtg cacctctac gacgacgac 432 ccc Ala Pro Ala Val Asp Arg Pro Met Thr Val His Leu Tyr Asp Asp Asp cgg ctggtcgag gaactccgc aagctcgac g9caccgac agccag gtg 480 Arg LeuValGlu Gl u LeuArg LysLeuAsp GlyThrAsp SerGln Val ttc gccgatccg gagctgctc cggctggtg ctgcccgtg atccgc aac 528 Phe Al a AspPro GluLeuLeu ArgLeuVal LeuProVal IleArg Asn gac taccgggcc gtggcggcc taccc cac c cc gcg ggg gcgccg ctg 576 Asp TyrAr Ala V l 9 l ga A Ala TyrAlaHis ArgProGly AlaPro Leu at gac tgccccctc acctg ttc accggcgcc gacgacccc accgtg acc 624 Asp CysProL hg eu T al Phe ThrGlyAla AspAspPro ThrVal Thr 195 r gcg gccgaggcg gcggcctgg cacgaggcg gcggcgtcc gacgtc gag 672 Ala AlaGluAla AlaAl a Trp HisGluAla AlaAlaSer AspVal Glu acg cgcaecttc cccggtggc cacttcttc ccgtaccag cggacc gcg 720 Thr ArgThrPhe ProGl l y G HisPhePhe ProTyrGln ArgThr Ala 225 y 230,235 gag gtgtgcggg gccctggtc gacacgctc gagccgctg ctgtcg gcc 768 Glu VC ~
~ I

a ys G AlaLeuVal AspThrLeu GluProLeu LeuSer Ala iy ggg cgcg gtccggcgg gtccgcccg gggtga 804 acg A t G
Thr y rg 2 ValArgArg ValArgPro Gly 6,265 <210> 37 <211> 267 <212> PRT
<213> Streptomyces ambofaciens <400> 37 Met ValThrThr Ser Val ProLeu Asp Trp Leu Thr Ala Asp Leu Arg Arg GlnProSer-AlaSer Pro ValArg Leu Cys Phe Tyr Ala Val Pro His 35yGlySer Ser Ser LeuPro Phe Ar Gln Ala Ala Phe Thr Le gu Pro SsOp Arg Ile Glu Val Val Ala Val Gln Tyr Pro Gly Arg Gln Asp 65g Arg Ser Glu Pro Leu Val Asp Thr Ile Glu Gly Leu Ala Glu Pro Leu Ala Gly Leu Leu Glu Ala Gln Ala Gly Pro Pro Val Val Leu Phe Gly His Ser Met Gly Ala Leu Val Ala Tyr Glu Val Ala Arg Ala Leu Gln ArgArg GlyAla AlaProVal ArgLeuValVal SerGly Arg Arg Ala ProAla ValAsp ArgProMet ThrValHisLeu TyrAspAsp Asp Arg LeuVal GluGlu LeuArgLys LeuAspGlyThr AspSerGln Val Phe AlaAsp ProGl.uLeuLeuArg LeuValLeuPro ValIleArg Asn 16 ~ 170 175 Asp TyrArg AlaVal AlaAlaTyr AlaHisArgPro GlyAlaPro Leu Asp CysPro LeuThr ValPheThr GlyAlaAspAsp ProThrVal Thr Ala AlaGlu AlaAla AlaTrpHis GluAlaAlaAla SerAspVal Glu Thr ArgThr PhePro GlyGlyHis PhePheProTyr GlnArgThr Ala 230,235 Glu ValCys Gly LeuValAsp ThrLeuGluPro LeuLeuSer Ala To the ~ GlyThr Gly ArgArgVal ArgProGly Arg Val 260,265 <210> 38 <211> 265 <212> PRT

<213> Streptomyces ambofaciens <400> 38 -Val ThrAlaSer ValAsp ProLeuAsp LeuTrpLeu ArgArgTyr Thr Gln SerAlaSer ProAla Valg Leu ValCysPhe ProHisAla Pro Gly SerAlaSer SerPhe LeuProPhe ThrArgGln LeuProAsp Gly Arg GluValVal AlaVal GlnTyrPro GlyArgGln AspArgArg Isle Ser ProLeuVal AspThr IleGluGly LeuAlaGlu ProLeuAla Glue Gly Leu Leu Glu Ala Gln Ala Gly Pro Pro Val Val Leu Phe Gly His Ser Met Gly Ala Leu Val Ala Tyr Glu Val Ala Arg Ala Leu Gln Arg 100 105 110 ' Arg Gly Ala Ala Pro Val Arg Leu Val Val Ser Gly Arg Arg Ala Pro Ala Val Asp Arg Pro Met Thr Val His Leu Tyr Asp Asp Asp Arg Leu at Val Glu Glu Leu Arg Lys Leu Asp Gly Thr Asp Ser Gln Val Phe Ala Asp Pro Glu Leu Leu Arg Leu Val Leu Pro Val Ile Arg Asn Asp Tyr Arg Ala Val Ala Ala Tyr Ala His Arg Pro Gly Ala Pro Leu Asp Cys Pro Leu Thr Val Phe Thr Gly Ala Asp Asp Pro Thr Val Thr Ala Ala Glu Ala Ala Ala Trp His Glu Ala Ala Ala Ser Asp Val Glu Thr Arg Thr Phe Pro Gly Gly His Phe Phe Pro Tyr Gln Arg Thr Ala Glu Val 225 230, 235 240,, Cys Gly Ala Leu Val Asp Thr Leu Glu Pro Leu Leu Ser Ala Gly Thr Arg Gly Val Arg Arg Val Arg Pro Gly 260,265 <210> 39 <211> 260 <212> PRT
<213> Streptomyces ambofaciens <400> 39 ial Asp Pro Leu 5sp Leu Trp Leu Arg Arg Tyr Gln Pro Ser Ala Ser Pro Ala Val Arg Leu Val Cys Phe Pro His Ala Gly Gly Ser Ala Ser Ser Phe Leu Pro Phe Thr Arg Gln Leu Pro Asp Arg Ile Glu Val Val Ala Val Gln Tyr Pro Gly Arg Gln Asp Arg Arg Ser Glu Pro Leu Val Asp Thr Ile Glu Gly Leu Ala Glu Pro Leu Ala Gly Leu Leu Glu Ala Gln Ala Gly Pro Pro Val Val Leu Phe Gly His Ser Met Gly Ala Leu Val Ala Tyr Glu Val Ala Arg Ala Leu Gln Arg Arg Gly Ala Ala Pro Val Arg Leu Val Val Ser Gly A ~ rg Arg Ala Pro Ala Val Asp Arg Pro 115 1 ~ Z0 12 5 Met Thr Val His Leu Tyr Asp Asp Asp Arg Leu Val Glu Glu Leu Arg Lys Leu Asp Gly Thr Asp Ser Gln Val Phe Ala Asp Pro Glu Leu Leu Arg Leu Val Leu Pro Val Ile Arg Asn Asp Tyr Arg Ala Val Ala Ala Tyr Ala His i8 ~ Pro Gly Ala Pro Leu Asp Cys Pro Leu Thr Val Phe Thr Gly Ala Asp Asp Pro Thr Val Thr Ala Ala Glu Ala Ala Ala Trp His Glu Ala Ala Ala Ser Asp Val Glu Thr Arg Thr Phe Pro Gly Gly His Phe Phe Pro Tyr Gln Arg Thr Ala Glu Val Cys Gly Ala Leu Val Asp Thr Leu Glu Pro Leu Leu Ser Ala Gly Thr Arg Gly Val Arg Arg 245 250 _ 255 Val Arg Pro Gly <210> 40 <211> 1410 <212> DNA
<213> Streptomyces ambofaciens <220>
<221> CDS
<222> (1) .. (1410) <220>
<221> CDS2 <222> (46) .. (1410) <400> 40 g 9 g9cacg gtc a tac Page g gccgtccac 69 gcggaac tg 48 g cgg cGT
access Val GlyThr Val GluTyr AlaValHis ArgArgThr AlaGluAgg Val agg gtctcc gcc gacacc ctggacagc ccggtcacc gcgctggcg gag 96 Ar V
l ga Ser Ala AspThr LeuAspSer ProValThr AlaLeuAla Glu gtg ccccgc tgg ctggag gaataccac cgggcgcac cgcttccac gtc 144 Val Pro35g Trp LeuGlu GluTyrHis ArgAlaHis ArgPheHis Val gag ccgatc ccc ttcgac cggctccgg cggtgg ~ tccttcgagccg ggc 192 l G ProIle Pro PheAsp ArgLeuArg ArgTrpSer PheGluPro Gly u acc ggcgac ctg cggcac gagacgggc cgcttcttc tccgtggag ggg 240 Thr GlyAsp Leu Ar His Gl Th l gur G ArgPhePhe SerValGlu Gly there ctg cgcacc agc tcggac gccgatccg gtcgcccgt gtccagccg atc 288 Leu ArgThr Ser SerAsp AlaAspPro ValAlaArg ValGlnPro Ile atc gtgcag ccc gaggtg gggctgctc ggcatcctg gcccgggag ttc 336 He l e Va Gln Pro GluVal GlyLeuLeu GlyIleLeu AlaArgGlu Phe gac g9ggt9 ctg cacttc ctgatgcag gccaaaccc gagcccg9c aac 384 As gl l py Va Leu HisPhe LeuMetGln AlaLysPro GluProGly Asn gtc aacggg ctg cagatc tcccccacg gtgcaggcc acgcgcagc aac 432 Val AsnGl Leu Gl l yn I SerProThr ValGlnAla ThrArgSer Asn e ttc gacgag gtg caccac ggccggtcc acc ~ ccgttc ctcgaccac ttc 480 Phe As Gl 1 i pu Va H His G1yArgSer ThrProPhe LeuAspHis Phe s 145 150 l55 160 atc caccgc ccc g9ccgc cgggtcctg atcgacagc atccagtcc gaa 528 Hi Island s Arg Pro GlyArg ArgValLeu IleAspSer IleGlnSer Glu cag ggcgac tgg ttcctg cacaagcgc aaccgcaac atggtcgtc gag 576 Gl Gl ny Asp TrpPheLeu HisLysArg AsnArgAsn MetValVal Glu atc gacacc gac atcgag gccgacgcc gcgttccgc tggctgacc ctc 624 l I AspThr Asp IleGlu AlaAspAla AlaPheArg TrpLeuThr Leu e gggcagatc cgccgg ctgatgctc caggacgac ctcgtcaac atggac 672 GlyGlnIle ArgArg LeuMetLeu GlnAspAsp LeuValAsn MetAsp acccgcagt gtgctg gcctgtctg cccacegcg cacggcacg cccgac 720 Th a r rg Ser ValLeu AlaCysLeu ProThrAla HisGlyThr ProAsp gacggtgac gactcc ttcccggcg gcgctgcgc cgctccctc tacggg 768 AspGlyAsp AspSer PheP l ro A AlaLeuArg ArgSerLeu TyrGly at gagaccgcg ccgttg cacgatctg cacgccatc accagctgc ctcacc 816 GluThrAla ProLeu HisAspLeu HisAlaIle ThrSerCys LeuThr gac gtc cgg gcg ctg cgg gtg ctg cgc cag cag agc gtg ccg ctc gac 864 Page AspVal ArgAla LeuArgVal LeuArg70 ValPro LeuAsp Gln Gln Ser gacgcc cggcgg gacggctgg gagcggaccggg agcgcgatc cggcat 912 AspAla ArgAr As Gl gpy Trp GluArgThrGly SerAlaIle ArgHis cgcagc ggcagg catttcgag atcatggcggtg gaggtgacc gcggag 960 Ser GlyArg HisPheGlu IleMetAlaVal GluValThr AlaGlu cgccgt gaagtg gcctcgtgg acccagccgttg ctgcgcccg tgctcg 1008 ArgArg GluVal AlaSerTrp ThrGlnProLeu LeuArgPro CysSer d caggga ctggcg gccctgatc acccggcggaatc aacggggtg ctgcac 1056 Gl l n G LeuAla AlaLeuIle Thr3 Arg.IleAsnGlyVal LeuHis there gccctg gtggcg gcgcggtcg gaggtcggcacg ctcaacgtc gccgag 1104 Al ~

a Leu ValAla AlaArgSer GluValG Thr LeuAsnVal AlaGlu iy ttcg9a ccgacc gtccagtgc cggcccgacgag gcggacggc cagtcg 1152 Ph Gl ey ProThr ValGln3 ~ 5 ArgProAspGlu AlaAspGly GlnSer cccccg tacctg gaccgggtg ctgacggccgga gccgaccgc gtccgc 1200 ProPro TyrLeu AspArgVa1 LeuThrAlaGly AlaAspArg ValArg tacgac gtggtg cagtcggag gagggcgggcgc ttctaccac gcgcgc 1248 TA l yr sp Va Val GlnSerGlu GluGlyGlyArg PheTyrHis AlaArg aacegc tatctg gtggtcgag gcggggccggag ctcgacacg ggctgc 1296 AsnArg T Leu V ll r 1 ya Va G AlaG1yProGlu LeuAspThr GlyCys u ccgccc g9cttc tgctgggct accttcg9ccag ctcaccgaa ctgctc 1344 Pr P ~

o ro ~ Phe CysTrpAla ThrPheGlyGln LeuThrGlu LeuLeu S

440,445 gcgcac ggcaac tatctcaac gtcgaactccgc accctcatg gcgtgc 1392 AlaHis Gl y Asn TyrLeuAsn ValGluLeuArg ThrLeuMet AlaCys gcacac gcctcc tactga 1410 AlaHis AlaSer Tyr <210> 1 <211> 69 <212> RT
P

<213> treptomycesambofaciens S

<400> 41 Val Gly Thr Val Glu Tyr Ala Val His Arg Arg Thr Ala Glu Arg Val Arg Val Ser Ala Asp Thr Leu Asp Ser Pro Val Thr Ala Leu Ala Glu Val Pro 35g Trp Leu Glu Glu Tyr His Arg Ala His Arg Phe His Val Glu Pro Ile Pro Phe Asp Arg Leu Arg Arg Trp Ser Phe Glu Pro Gly Thr Gly Asp Leu Arg His Glu Thr Gly Arg Phe Phe Ser Val Glu Gly Leu Arg Thr Ser Ser Asp Ala Asp Pro Val Ala Arg Val Gln Pro Ile Val Gln Pro Glu Val Gly Leu Leu Gly Ile Leu Ala Arg Glu Phe 100 105 110, Asp Gly Val Leu His Phe Leu Met Gln Ala Lys Pro Glu Pro Gly Asn Val Asn Gly Leu Gln Ile Ser Pro Thr Val Gln Ala Thr Arg Ser Asn Phe Asp Glu Val His His Gly Arg Ser Thr Pro Phe Leu Asp His Phe Ile His Arg Pro Gly Arg Arg Leu Leu Island Asp Ser ile Gln Ser Glu Gln Gly Asp Trp Phe Leu His Lys Arg Asn Arg Asn Met Val Val Glu Ile Asp Thr Asp Tle Glu Ala Asp Ala Ala Phe Arg Trp Leu Thr Leu Gly Gln Ile Arg Arg Leu Met Leu Gln Asp Asp Leu Val Asn Met Asp Thr Arg Ser Val Leu Ala Cys Leu Pro Thr Ala His Gly Thr Pro Asp Asp Gly Asp Asp Ser Phe Pro Ala Ala Leu Arg Arg Ser Leu Tyr Gly Glu Thr Ala Pro Leu His Asp Leu His Ala Ile Thr Ser Cys Leu Thr Asp Val Arg Ala Leu Arg Val Leu Arg Gln Gln Ser Val Pro Leu Asp Asp Ala Arg Arg Asp Gly Trp Glu Arg Thr Gly Ser Ala Ile Arg His Arg Ser Gly Arg His Phe Glu Ile Met Ala Val Glu Val Thr Ala Glu Arg Arg Glu Val Ala Ser Trp Thr Gln Pro Leu Leu Arg Pro Cys Ser Gln Gly Leu Ala Ala Leu Ile Thr Arg Arg Ile Asn Gly Val Leu His Ala Leu Val Ala Ala Arg Ser Glu Val Gly Thr Leu Asn Val Ala Glu Phe 3 ~ ô Pro Thr Val Gln Cys Arg Pro Asp Glu Ala Asp Gly Gln Ser 375,380 Pro Pro Tyr Leu Asp Arg Val Leu Thr Ala Gly Ala Asp Arg Val Arg Tyr Asp Val Val Gln Ser Glu Glu Gly Gly Arg Phe Tyr His Ala Arg Asn Arg Tyr Leu Val Val Glu Ala Gly Pro Glu Leu Asp Thr Gly Cys Pro Pro Gly Phe Cys Trp Ala Thr Phe Gly Gln Leu Thr Glu Leu Leu Ala His Gly Asn Tyr Leu Asn Val Glu Leu Arg Thr Leu Met Ala Cys Ala His Ala Ser Tyr <210> 42 <211> 454 <212> PRT
<213> Streptomyces ambofaciens <400> 42 ial Arg Val Ser 51a Asp Thr Leu Asp Ser Pro Val Thr Ala Leu Ala Glu Val Pro Arg Trp Leu Glu Glu Tyr His Arg Ala His Arg Phe His Val Glu Pro Ile Pro Phe Asp Arg Leu Arg Arg Trp Ser Phe Glu Pro Gly Thr Gly Asp Leu Arg His Glu Thr Gly Arg Phe Phe Ser Val Glu Gly Leu Arg Thr Ser Ser Asp Ala Asp Pro Val Ala Arg Val Gln Pro Ile Ile Val Gln Pro Glu Val Gly Leu Leu Gly Ile Leu Ala Arg Glu Phe Asp Gly Val Leu His Phe Leu Met Gln Ala Lys Pro Glu Pro Gly Asn Val Asn Gly Leu Gln Ile Ser Pro Thr Val Gln Ala Thr Arg Ser Asn Phe Asp Glu Val His His Gly Arg Ser Thr Pro Phe Leu Asp His .
Phe Ile His Arg Pro Gly Arg Arg Val Leu Ile Asp Ser Ile Gln Ser Glu Gln Gly Asp Trp Phe Leu His Lys Arg Asn Arg Asn Met Val Val Glu Ile Asp Thr Asp Ile Glu Ala Asp Ala Ala Phe Arg Trp Leu Thr Leu Gly Gln Ile Arg Arg Leu Met Leu Gln Asp Asp Leu Val Asn Met Asp Thr Arg Ser Val Leu Ala Cys Leu Pro Thr Ala His Gly Thr Pro Asp Asp Gly Asp Asp Ser Phe Pro Ala Ala Leu Arg Arg Ser Leu Tyr 225 230 235 240 't'; ,, ~ v ~ _. "! ~"
; .kr n9 Gly Glu Thr Ala Pro Leu His Asp Leu His Ala Ile Thr Ser Cys Leu Thr Asp Val Arg Ala Leu Arg Val Leu Arg Gln Gln Ser Val Pro Leu Asp Asp AIa Arg Arg Asp Gly Trp Glu Arg Thr Gly Ser Ala Ile Arg His Arg Ser Gly Arg His Phe Glu Ile Met Ala Val Glu Val Thr Ala Glu Arg Arg Glu Val Ala Ser Trp Thr Gln Pro Leu Leu Arg Pro Cys Ser Gln Gly Leu Ala Ala Leu Ile Thr Arg Arg Ile Asn Gly Val Leu His Ala Leu Val Ala Ala Arg Ser Glu Val Gly Thr Leu Asn Val Ala Glu Phe Gly Pro Thr Val Gln Cys Arg Pro Asp Glu Ala Asp Gly Gln Ser Pro Pro Tyr Leu Asp Arg Val Leu Thr Ala 38ô Ala Asp Arg Val 370,375 Arg Tyr Asp Val Val Gln Ser Glu Glu Gly Gly Arg Phe Tyr His Ala Arg Asn Arg Tyr Leu Val Val Glu Ala Gly Pro Glu Leu Asp Thr Gly Cys Pro Pro Gly Phe Cys Trp Ala Thr Phe Gly Gln Leu Thr Glu Leu ~

Leu Ala His Gly Asn Tyr Leu Asn Val Glu Leu Arg Thr Leu Met Ala Cys 450 H ~ s Ala Ser Tyr <210> 43 <211> 1248 <212> DNA
<213> Streptomyces ambofaciens <220>
<221> CDS
<222> (1) .. (1248) <400> 43 atgccgggc gggacggac ggcgactgc gcgcggacg gcggcccgg cgt 48 MetProG1 G1 h yy T Asp G1yAspCys AlaArgThr AlaAlaArg Arg r cgaacgcac ctgcccgag tccggacga gacagcgcg acgcgagag gcg 96 ArgThrHis LeuProGlu SerGlyArg AspSerAla ThrArgGlu Ala aaaatgatc aatctcttc cagccccag atgggggcc gaggaactg gcg 144 LysMetIle AsnLeuPhe GlnProGln MetGlyAla GluGluLeu Ala gcggt tcc gaggtcttc gacgaccaa tggctcg9t cacg ccc cgg 192 ~ a AlaVa Ser GluValPhe AspAspGln TrpLeuGly HisG ~ yPro Arg accgcggcg ttcgagtcc gcgttcgcc gagcacctc ggggtcggc ccc 240 ThrAlaAla PheGluSer AlaPheAla GluHisLeu GlyValGly Pro gagcacgtc gtcttcctc aactcgggc accgccggc ctcttcctg gcc 288 GluHisVal ValPheLeu AsnSerGly ThrAlaGly LeuPheLeu Ala ctggagtcg ctcggcctg cggcccggc gacgaggtc gtgctcccc tcg 336 LeuGluSer LeuG1yLeu ArgProGly AspGluVal ValLeuPro Ser cccagcttc ctcgccgcg gcgaacgcc gtacagctc tcgggagcg cgc 384 ProSerPhe LeuAlaAla AlaAsnAla ValGlnLeu SerGlyAla Arg Page ccggtg ttctgcgac accgac ccgcggacgctg aaccccgcc ctggag 432 ProVal PheCysAsp ThrAsp ProArgThrLeu AsnProAla LeuGlu cacatc gaggcggcc gtcacc ccgcgcaccagg gccgtcatc gcgctc 480 HisIle GluAlaAla ValThr ProArgThrArg AlaValIle AlaLeu cactac ggcggccac cccggc gacatcgtgcgc atcgccgag cgctgc 528 HisTyr GlyGlyHis ProG ~ IyAspIleVa1Arg IleAlaGlu ArgCys cgggag cggggcatc accctg atcgaggacgcc gcgtgctcc gtggcc 576 ArgGlu ArgGlyIle ThrLeu IleGluAspAla AlaCysSer ValAla tcccgc gtcgacg cgaccg gtcg9caccttc g gacctc gccatg 624 CC
~

SerArg ValAspG ArgPro ValGlyThrPhe G ~ yAspLeu AlaMet there TggSr Ph lt as VVGGGM 672 cccagt pesa Me L al Le al Thr lslle ppyy atctac gtcaaggac cccggg gcggccgcccgg atccggcgc ctcgcc 720 IleTyr ValLysAsp ProGly AlaAlaAlaArg IleArgArg LeuAla taccac ggcctcacg cggtcc agcggcctggga tacgccagg gtctcg 768 ~

TyrHis G LeuThr ArgSer SerG1yLeuG1y TyrAlaArg ValSer ly gcg cgc tgg tgg gag atg gac gtc ccc gaa ccg ggc cgc cgc gtc atc 816 Ala Arg Trp Trp Glu Met Asp Val Pro Glu Pro Gly Arg Arg Val Ile ggg aac gac ctc acc gcg gcc atc ggc gcg gtc cag ttg cgc cgg ctt 864 G y Asn Asp Leu Thr Ala Ala Ile G1y Ala Val Gln Leu Arg Arg Leu ': -w ~,' 3 275 280 285.;.; _ ,.: ~, w :, ccc gc ttc gtg gcc cgc cgc agg gag atc gtc gcc ctg tac gac agc 912 Pro G29y0 Phe Val Ala Arg Arg Arg Glu Ile Val Ala Leu Tyr Asp Ser 295,300 gaa ctg agc tcg ctg gag ggc gtg ctg aca ccg ccc gcg cca ccc gcg 960 Glu Leu Ser Ser Leu Glu Gly Val Leu Thr Pro Pro Ala Pro Pro Ala gggcac gagtccacg cactac ttctactggatc cagctggcc cccggc 1008 G1yHis GluSerThr HisTyr PheTyrTrpIle GlnLeuAla ProGly gtccgg gaccgggtg gcacgc gacctgctcacc gacggcatc tacacc 1056 ValArg AspArgVa1 AlaArg AspLeuLeuThr AspG1yIle TyrThr accttc cgctacgca cctctg cacaaggtgccc gcctacggc cacacc 1104 ThrPhe ArgTyrAla ProLeu HisLysValPro AlaTyrGly HisThr Ggaggc gaactgccc ggcgtg gagcgggcgtcc gaacggacc ctgtgc 1152 ~

ly G1y GluLeuPro G1yVa1 GluArgAlaSer GluArgThr LeuCys ctgccc ctgcacccc ggcctg tcggacgccgac gtccgcacc gtcgtg 1200 LeuPro LeuHisPro GlyLeu SerAspAlaAsp ValArgThr ValV
1a tcc tcc ctg cgc aga gcc ctg agc gcc gcg gat ccg gcc ccc gcc tga 1248 Ser Ser Leu Arg Arg Ala Leu Ser Ala Ala Asp Pro Ala Pro Ala <210> 44 <211> 415 <212> PRT
<213> Streptomyces ambofaciens <400> 44 iet Pro Gly Gly 5hr Asp Gly Asp Cys Ala Arg Thr Ala Ala Arg Arg .
Arg Thr His Leu Pro Glu Ser Gly Arg Asp Ser Ala Thr Arg Glu Ala ' Lys Met Ile Asn Leu Phe Gln Pro Gln Met Gly Ala Glu Glu Leu Ala Ala Val Ser Glu Val Phe Asp Asp Gln Trp Leu Gly His Gly Pro Arg Thr Ala Ala Phe Glu Ser Ala Phe Ala Glu His Leu Gly Val Gly Pro 65 70 75 gp Glu His Val Val Phe Leu Asn Ser Gly Thr Ala Gly Leu Phe Leu Ala Leu Glu Ser Leu Gly Leu Arg Pro Gly Asp Glu Val Val Leu Pro Ser 100 105 110 r ~.
Pro Ser Phe Leu Ala Ala Ala Asn Ala Val Gln Leu Ser Gly Ala Arg Pro Val Phe Cys Asp Thr Asp Pro Arg Thr Leu Asn Pro Ala Leu Glu His Ile Glu Ala Ala Val Thr Pro Arg Thr Arg Ala Val Ile AIa Leu His Tyr Gly Gly His Pro Gly Asp Ile Val Arg Ile Ala Glu Arg Cys Arg Glu Arg Gly Ile Thr Leu Ile Glu Asp Ala Ala Cys Ser Val Ala Ser Arg Val Asp Gly Arg Pro Val Gly Thr Phe Gly Asp Leu Ala Met Trp Ser Phe Asp Ala Met Lys Val Leu Val Thr Gly Asp Gly Gly Met Ile Tyr Val Lys Asp Pro Gly Ala Ala Ala Arg Ile Arg Arg Leu Ala Tyr His Gly Leu Thr Arg Ser Ser Gly Leu Gly Tyr Ala Arg Val Ser Ala Arg Trp Trp Glu Met Asp Val Pro Glu Pro Gly Arg Arg Val Ile Gly Asn Asp Leu Thr Ala Ala Ile Gly Ala Val Gln Leu Arg Arg Leu Pro 29y0 Phe Val AI ~, Arg Arg Arg Glu Ile Val Ala Leu Tyr Asp Ser ~ 295,300 Glu Leu Ser Ser Leu Glu Gly Val Leu Thr Pro Pro Ala Pro Pro Ala Gly His Glu Ser Thr His Tyr Phe Tyr Trp Ile Gln Leu Ala Pro Gly Val Arg Asp Arg Val Ala Arg Asp Leu Leu Thr Asp Gly Ile Tyr Thr Thr Phe Arg Tyr Ala Pro Leu His Lys Val Pro Ala Tyr Gly His Thr Gly Gly Glu Leu Pro Gly Val Glu Arg Ala Ser Glu Arg Thr Leu Cys Leu Pro Leu His Pro 390y Leu Ser Asp Ala Asp Val Arg Thr Val Val Ser Ser Leu Arg Arg Ala Leu Ser Ala Ala Asp Pro Ala Pro Ala <210> 45 <211> 720 <212> DNA
<213> ambofacial streptomyces <220>
<221> CDS
<222> (1) .. (720) <400> 45 atg tac gag aac gac agt gcc gcc gag gtc tac gac ctg ctc tac cag 48 Met Tyr Glu Asn Asp Ser Ala Ala Glu Val Tyr Asp Leu Leu Tyr Gln gac cgc aag gac tac gcg ggt gag gcc gcc cgg gtc acc gac ctg atc 96 Asp Arg Lys Asp Tyr Ala Gly Glu Ala Ala Arg Val Thr Asp Leu Ile cgg gaa cgt acg ccg gac gcg gcc agc ctg ctc gac atc gcg tgc ggc 144 Arg Glu Arg Thr Pro Asp Ala Ala Ser Leu Leu Asp Ile Ala Cys Gly LARGE APPLICATION OR PATENT
THIS PART OF THIS APPLICATION OR THIS PATENT INCLUDES
MORE THAN A TOME.

CONTAINING PAGES 1 Ä 291 NOTE: For additional volumes, please contact the Canadian Bureau of patents JUMBO APPLICATIONS / PATENTS

VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office FILE NAME / FILE NAME
NOTE FOR TOME / VOLUME NOTE:

Claims (93)

1. Polynucleotide encoding a polypeptide involved in the biosynthesis of spiramycins characterized in that the sequence of said polynucleotide is:

(a) one of the sequences SEQ ID No 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, (b) one of the sequences constituted by the variants of the sequences (a), (c) one of the sequences derived from the sequences (a) and (b) due to the degeneration of the genetic code. 2. Polynucleotide hybridizing under strong hybridization conditions stringency to at least one of the polynucleotides according to claim 1. 3. Polynucleotide with at least 70%, 80%, 85%, 90%, 95% or 98%
identity in nucleotides with a polynucleotide comprising at least 10, 12, 15, 18, 20 to 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850 or 1900 consecutive nucleotides of a polynucleotide according to claim 1. 4. Polynucleotide according to claim 2 or 3 characterized in that it is isolated from a bacteria of the genus Streptomyces. 5. Polynucleotide according to claim 2, 3 or 4 characterized in that it coded a protein involved in the biosynthesis of a macrolide. 6. Polynucleotide according to claim 2, 3, 4 or 5 characterized in that it encodes a protein with activity similar to the protein encoded by the polynucleotide with which it hybridizes or it presents identity. 7. Polypeptide resulting from the expression of a polynucleotide according to the claim 1, 2, 3, 4, 5 or 6. 8. Polypeptide involved in the biosynthesis of spiramycins characterized in what the sequence of said polypeptide is:
(a) one of the sequences SEQ ID N o 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 27, 29, 31, 32, 33, 35, 37, 38, 39, 41, 42, 44, 46, 48, 50, 51, 52, 54, 55, 56, 57, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 108, 110, 112, 114, 116, 117, 119, 121, 142, 144, 146, 148 and 150, (b) one of the sequences as defined in (a) except that throughout said sequence one or more amino acids have been substituted, inserted or deleted without affecting its functional properties, (c) one of the sequences constituted by the variants of the sequences (a) and (b). 9. Polypeptide having at least 70%, 80%, 85%, 90%, 95% or 98%
amino acid identity with a polypeptide comprising at least 10, 15, 20, 30 to 40, 50, 60, 70, 80, 90,100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 or 640 acids consecutive amines of a polypeptide according to claim 8. 10. Polypeptide according to claim 9 characterized in that it is isolated from go of a bacteria of the genus Streptomyces. 11. Polypeptide according to claim 9 or 10 characterized in that it codes a protein involved in the biosynthesis of a macrolide. 12. Polypeptide according to claim 9, 10 or 11 characterized in that it has a activity similar to that of the polypeptide with which it shares identity. 13. Recombinant DNA characterized in that it comprises at least one polynucleotide according to one of claims 1, 2, 3, 4, 5 or 6. 14. Recombinant DNA according to claim 13 characterized in that the said Recombinant DNA is included in a vector. 15. Recombinant DNA according to claim 14 characterized in that said vector is chosen from bacteriophages, plasmids, phagemids, the integrative vectors, the fosmids, the cosmids, the shuttle vectors, the BAC or CAP. 16. Recombinant DNA according to claim 15 characterized in that it is chosen from pOS49.1, pOS49.11, pOSC49.12, pOS49.14, pOS49.16, pOS49.28, pOS44.1, pOS44.2, pOS44.4, pSPMS, pSPM7, pOS49.67, pOS49.88, pOS49.106, pOS49.120, pOS49.107, pOS49.32, pOS49.43, pOS49.44, pOS49.50, pOS49.99, pSPMl7, pSPM21, pSPM502, pSPM504, pSPM507, pSPM508, pSPM509, pSPM1, pBXL1111, pBXL1112, pBXL1113, pSPM520, pSPM521, pSPM522, pSPM523, pSPM524, pSPM525, pSPM527, pSPM528, pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM41, pSPM42, pSPM43, pSPM44, pSPM45, pSPM47, pSPM48, pSPM50, pSPM51, pSPM52, pSPM53, pSPM55, pSPM56, pSPM58, pSPM72, pSPM73, pSPM515, pSPM519, pSPM74, pSPM75, -pSPM79 pSPM83, pSPM107, pSPM543 and pSPM106. 17. Expression vector characterized in that it comprises at least one nucleic acid sequence encoding a polypeptide according to claim 7, 8, 9, 10, 11 or 12. 18. Expression system comprising an appropriate expression vector and a host cell allowing the expression of one or more polypeptides according to the claim 7, 8, 9, 10, 11 or 12. 19. Expression system according to claim 18 characterized in that it is chosen from prokaryotic expression systems or systems expression eukaryotes. 20. Expression system according to claim 19 characterized in that it is chosen from expression systems in E. coli bacteria, systems baculovirus expression allowing expression in cells insects, the expression systems allowing expression in yeast cells, the expression systems allowing expression in cells of mammals. 21. Host cell into which at least one polynucleotide has been introduced and or at least one recombinant DNA and / or at least one expression vector according to one of the Claims 1, 2, 3, 4, 5, 6, 13, 14, 15, 16 or 17. 22. Method for producing a polypeptide according to claim 7, 8, 9, 10, 11 or 12 characterized in that said method comprises the following steps:
a) inserting at least one nucleic acid encoding said polypeptide into a appropriate vector;
b) cultivating, in an appropriate culture medium, a host cell beforehand transformed or transfected with the vector from step a);
c) recovering the conditioned culture medium or a cell extract;
d) separate and purify from said culture medium or from the cell extract obtained in step c), said polypeptide;
e) where appropriate, characterize the recombinant polypeptide produced. 23. Microorganism blocked in a stage of the biosynthetic pathway of minus a macrolide. 24. Microorganism according to claim 23 characterized in that it is got by inactivating the function of at least one protein involved in the biosynthesis of this or these macrolides in a microorganism producing this or these macrolide. 25. Microorganism according to claim 24 characterized in that the inactivation of this protein (s) is carried out by mutagenesis in the genes encoding said protein (s) or by expression of one or more several NRAs anti-sense complementary to the RNA or messenger RNAs encoding said or said proteins. 26. Microorganism according to claim 25 characterized in that the inactivation of this or these proteins is carried out by mutagenesis by irradiation, by the action of a mutagenic chemical agent, by site-directed mutagenesis or by replacement of gene. 27. Microorganism according to claim 25 or 26 characterized in that the or mutagenesis is carried out in vitro or in situ, by suppression, substitution, deletion and / or addition of one or more bases in the gene (s) considered or by gene inactivation. 28. Microorganism according to claim 23, 24, 25, 26 or 27 characterized in that said microorganism is a bacterium of the genus Streptomyces. 29. Microorganism according to claim 23, 24, 25, 26, 27 or 28 characterized in that the macrolide is spiramycin. 30. Microorganism according to claim 23, 24, 25, 26, 27, 28 or 29 characterized in that said microorganism is a strain of S. ambofaciens. 31. Microorganism according to claim 23, 24, 25, 26, 27, 28, 29 or 30 characterized in that the mutagenesis is carried out in at least one gene comprising a sequence according to one of claims 1, 2, 3, 4, 5 or 6. 32. Microorganism according to claim 25, 26, 27, 28, 29, 30 or 3.1 characterized in that the mutagenesis is carried out in one or more genes comprising one of the sequences corresponding to one or more of the sequences SEQ
ID No. 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149. 33. Microorganism according to claim 25, 26, 27, 28, 29, 30, 31 or 32 characterized in that mutagenesis consists in the gene inactivation of a uncomfortable comprising a sequence corresponding to the sequence SEQ ID No. 13. 34. Strain of Streptomyces ambofaciens characterized in that it is a strain chosen from:
- one of the strains deposited with the National Collection of Cultures of Microorganisms (CNCM) on July 10, 2002 under the registration number I-I-2911, I-2912, I-2913, I-2914, I-2915, I-2916 or I-2917 - the strain SPM510. 35. Process for the preparation of a macrolide biosynthesis intermediate characterized in that it comprises the following stages:
a) cultivate, in an appropriate culture medium, a microorganism according to Moon claims 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34, b) recovering the conditioned culture medium or a cell extract, c) separate and purify from said culture medium or from the cell extract obtained in step b), said biosynthesis intermediate. 36. Process for the preparation of a molecule derived from a characterized macrolide in that a biosynthesis intermediate is prepared according to the process of claim 35 and that the intermediate thus produced is modified. 37. Preparation process according to claim 36 characterized in that one modifies said intermediate by chemical, biochemical, enzymatic and / or Microbiological. 38. Preparation process according to claim 36 or 37 characterized in that that one or more genes encoding proteins capable of modifying the intermediary by using it as substrate. 39. Preparation process according to claim 36, 37 or 38 characterized in what the macrolide is spiramycin. 40. Preparation process according to claim 36, 37, 38 or 39 characterized in that the microorganism used is a strain of S. ambofaciens. 41. Microorganism producing spiramycin I but not producing spiramycin II and III. 42. Microorganism according to claim 41 characterized in that it comprises the set of genes necessary for the biosynthesis of spiramycin I but that the gene comprising the sequence SEQ ID No. 13 or one of its variants or one of the sequences derived from these due to the degeneracy of the genetic code and coding a polypeptide of sequence SEQ ID No. 14 or one of its variants is not expressed or a been made inactive. 43. Microorganism according to claim 42 characterized in that the said inactivation is carried out by mutagenesis in the gene encoding said protein or by the expression of an antisense RNA complementary to the messenger RNA encoding said protein. 44. Microorganism according to claim 43 characterized in that said mutagenesis is carried out in the promoter of this gene, in the sequence coding or in a non-coded sequence so as to make the coded protein inactive or in prevent its expression or translation. 45. Microorganism according to claim 43 or 44 characterized in that the mutagenesis is carried out by irradiation, by action of chemical agent mutagenic, by site-directed or gene replacement mutagenesis. 46. Microorganism according to claim 43, 44 or 45 characterized in that mutagenesis is carried out in vitro or in situ, by suppression, substitution, deletion and / or addition of one or more bases in the gene considered or by inactivation gene. 47. Microorganism according to claim 41 or 42 characterized in that said microorganism is obtained by expressing genes for the biosynthetic pathway of the spiramycin without these understanding the gene comprising the sequence corresponding to SEQ ID N ° 13 or one of its variants or one of the derived sequences of these due to the degeneration of the genetic code and encoding a polypeptide SEQ ID NO: 14 or one of its variants. 48. Microorganism according to claim 41, 42, 43, 44, 45, 46 or 47 characterized in that said microorganism is a bacterium of the genus Streptomyces. 49. Microorganism according to claim 41, 42, 43, 44, 45, 46, 47 or 48 characterized in that said microorganism is obtained from a strain of departure producing spiramycins I, II and III. 50. Microorganism according to claim 41, 42, 43, 44, 45, 46, 47, 48 or 49 characterized in that it is obtained by mutagenesis in a gene comprising the sequence corresponding to SEQ ID N ° 13 or one of its variants or one of the sequences derived therefrom due to degeneracy of the code genetics and encoding a polypeptide of sequence SEQ ID No. 14 or one of its variants having the same function. 51. Microorganism according to claim 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 characterized in that said microorganism is obtained from a strain from S
ambofaciens producing spiramycins I, II and III, in which is performed a gene inactivation of the gene comprising the sequences corresponding to SEQ ID
N ° 13 or one of the sequences derived from it due to the degeneration of the coded genetic. 52. Strain of S. ambafaciens characterized in that it is the strain deposited with the National Collection of Cultures of Microorganisms (CNCM) July 10, 2002 under registration number I-2910. 53. Process for the production of spiramycin I, characterized in that it comprises the following steps:

(a) cultivate, in an appropriate culture medium, a microorganism according to one of claims 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 or 52, (b) recovering the conditioned culture medium or a cell extract, (c) separating and purifying from said culture medium or from the cell extract obtained in step b), spiramycin I. 54. Use of a polynucleotide according to one of claims 1, 2, 3, 4, or 6 to improve the macrolide production of a microorganism. 55. Mutant macrolide-producing microorganism characterized in that it has a genetic modification in at least one gene comprising a sequence according to one of claims 1, 2, 3, 4, 5 or 6 and / or that it overexpressed at minus one gene comprising a sequence according to one of claims 1, 2, 3, 4, 5 or 6. 56. Mutant microorganism according to claim 55 characterized in that the genetic modification consists of a deletion, a substitution, a deletion and / or an addition of one or more bases in the gene (s) considered in order to to express one or more proteins having a higher activity or to express a higher level of this protein (s). 57. Mutant microorganism according to claim 55 characterized in that the overexpression of the considered gene is obtained by increasing the number of copies of this gene and / or by placing a promoter more active than the wild-type promoter. 58. Mutant microorganism. according to claim 55 or 57 characterized in that that the overexpression of the gene under consideration is obtained by transforming a macrolide producing microorganism by a recombinant DNA construct according to claim 13, 14 or 17, allowing the overexpression of this gene. 59. Mutant microorganism according to claim 55, 56, 57 or 58 characterized in that the genetic modification is carried out in one or more genes comprising one of the sequences corresponding to one or more of the sequences SEQ
ID N ° 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of the sequences derived from these due to the degeneration of the genetic code.

60. Mutant microorganism according to claim 55, 56, 57, 58 or 59 characterized the microorganism overexpresses one or more genes comprising a of the sequences corresponding to one or more of the sequences SEQ ID N o 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 and 149, or one of its variants or one of the sequences derived therefrom Reason to the degeneration of the genetic code. 61. Mutant microorganism according to claim 55, 56, 57, 58, 59 or 60 characterized in that said microorganism is a bacteria of the genus Streptomyces. 62. Mutant microorganism according to claim 55, 56, 57, 58, 59, 60 or 61 characterized in that the macrolide is spiramycin. 63. Mutant microorganism according to claim 55, 56, 57, 58, 59, 60, 61 or 62 characterized in that said microorganism is a strain of S.
ambofaciens. 64. Process for the production of macrolides, characterized in that it comprises the following steps:
(a) cultivate, in an appropriate culture medium, a microorganism according to one of claims 55, 56, 57, 58, 59, 60, 61, 62, 63 or 64, (b) recovering the conditioned culture medium or a cell extract, (c) separating and purifying from said culture medium or from the cell extract obtained in step b), the said macrolide (s) produced. 65. Use of a sequence and / or a recombinant DNA and / or a vector according to one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 for the preparation of hybrid antibiotics. 66. Use of at least one polynucleotide and / or at least one DNA
recombinant and / or at least one expression vector and / or at least one polypeptide and / or at least one host cell according to one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17 or 21 to carry out one or more bioconversion. 67. Polynucleotide characterized in that it is a polynucleotide complementary to one of the polynucleotides according to claim 1, 2, 3, 4, 5, or 6. 68. Microorganism producing at least one spiramycin, characterized in what he overexpressed -a gene capable of being obtained by chain amplification by polymerase (PCR) using the pair of primers with the following sequence: 5 ' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID No. 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N o 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, -or a gene derived therefrom due to the degeneracy of the code genetic. 69. Microorganism according to claim 68 or 90 characterized in that it it is a bacterium of the genus Streptomyces. 70. Microorganism according to claim 68, 69 or 90 characterized in that that it is a bacterium of the species Streptomyces ambofaciens. 71. Microorganism according to claim 68, 69, 70 or 90 characterized in that the overexpression of said gene is obtained by transformation of said microorganism by an expression vector. 72. Streptomyces ambofaciens strain characterized in that it is the OSC2 / pSPM75 (1) strain or OSC2 / pSPM75 (2) strain deposited with the National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, rue du Docteur Roux 75724 Paris Cedex 15, France, October 6, 2003 under the registration number I-3101. 73. Recombinant DNA characterized in that it comprises:

- a polynucleotide capable of being obtained by chain amplification by polymerase using the pair of primers with the following sequence: 5 ′
AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID No. 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N o 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, - or, a fragment of at least 10, 12, 15, 18, 20 to 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1460, 1470, 1480, 1490 or 1500 consecutive nucleotides of this polynucleotide. 74. Recombinant DNA according to claim 73 or 91, characterized in that that it is a vector. 75. Recombinant DNA according to claim 73, 74 or 91 characterized in that that it is an expression vector. 76. Host cell into which at least one recombinant DNA has been introduced according to one of claims 73, 74, 75 or 91. 77. Process for the production of a polypeptide characterized in that said process includes the following steps:
a) transforming a host cell with at least one expression vector according to the claim 75;
b) cultivating, in an appropriate culture medium, said host cell;
c) recovering the conditioned culture medium or a cell extract;
d) separate and purify from said culture medium or from the cell extract obtained in step c), said polypeptide;
e) where appropriate, characterize the recombinant polypeptide produced. 78. Microorganism according to claim 51 characterized in that gene inactivation is carried out by deletion in phase of the gene or of a part of the gene comprising the sequence corresponding to SEQ ID No. 13 or one of the sequences derived from it due to degeneracy of the code genetic. 79. Microorganism according to one of claims 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 or 78 characterized in that it also overexpresses:
- a gene capable of being obtained by chain amplification by polymerase using the pair of primers with the following sequence: 5 ′
AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID No. 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N o 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, - or a gene derived therefrom due to the degeneracy of the code genetic. 80. Expression vector characterized in that the polynucleotide of sequence SEQ ID No. 47 or a polynucleotide derived therefrom due to the .
degeneration of the genetic code is placed under the control of a promoter allowing expression of the protein encoded by said polynucleotide in Ambofacial streptomyces. 81. Expression vector according to claim 80, characterized in that it it is the plasmid pSPM524 or pSPM525. 82. Strain of Streptomyces ambofaciens transformed by a vector according to claim 80 or 81. 83. Microorganism according to one of claims 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 78, 79 or 92 characterized in that it also overexpresses the gene of coding sequence SEQ ID No. 47 or of a coding sequence derived therefrom this due to the degeneracy of the genetic code. 84. Microorganism according to claim 83 characterized in that it is of the strain SPM502 pSPM525 deposited with the National Collection of Cultures of Microorganisms (CNCM) Institut Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, France, on February 26, 2003 under the number Registration I-2977. 85. Process for the production of spiramycin (s), characterized in that it includes the following steps:
(a) cultivate, in an appropriate culture medium, a microorganism according to one of claims 68, 69, 70, 71,72, 78, 79, 82, 83, 84, 90 or 92, (b) recovering the conditioned culture medium or a cell extract, (c) separating and purifying from said culture medium or from the cell extract obtained in step b), the spiramycins. 86. Polypeptide characterized in that its sequence comprises the sequence SEQ
117 No. 112 or the sequence SEQ ID No. 142. 87. Polypeptide characterized in that its sequence corresponds to the sequence translated from the coding sequence:
- a gene capable of being obtained by chain amplification by polymerase (PCR) using the pair of primers with the following sequence: 5 ' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3 '(SEQ ID No. 138) and 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3 '(SEQ ID N o 139) and as matrix the cosmid pSPM36 or the total DNA of Streptomyces ambofaciens, -or a gene derived therefrom due to the degeneracy of the code genetic. 88. Expression vector allowing the expression of a polypeptide according to the claim 86, 87 or 93 in Streptomyces ambofaciens. 89. Expression vector according to claim 88, characterized in that it it is the plasmid pSPM75. 90) Microorganism according to claim 68 characterized in that the gene likely to be obtained by polymerase chain reaction is the gene coding sequence SEQ ID No. 141 or a gene derived therefrom due to the degeneration of the genetic code. 91) recombinant DNA according to claim 73 characterized in that the polynucleotide capable of being obtained by chain amplification by polymerase is a polynucleotide of sequence SEQ ID No. 141. 92) Microorganism according to claim 79 characterized in that the gene likely to be obtained by polymerase chain reaction is the gene coding sequence SEQ ID No. 141 or a gene derived therefrom due to the degeneration of the genetic code. 93) Polypeptide characterized in that its sequence is SEQ ID No. 142.