EP1032679A2 - Genes for biosynthesis and transfer of 6-deoxy-hexoses in saccharopolyspora erythrea and streptomyces antibioticus and uses thereof - Google Patents

Genes for biosynthesis and transfer of 6-deoxy-hexoses in saccharopolyspora erythrea and streptomyces antibioticus and uses thereof

Info

Publication number
EP1032679A2
EP1032679A2 EP98940290A EP98940290A EP1032679A2 EP 1032679 A2 EP1032679 A2 EP 1032679A2 EP 98940290 A EP98940290 A EP 98940290A EP 98940290 A EP98940290 A EP 98940290A EP 1032679 A2 EP1032679 A2 EP 1032679A2
Authority
EP
European Patent Office
Prior art keywords
sequence
nucleotide
seq
dtdp
deoxyhexose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98940290A
Other languages
German (de)
French (fr)
Inventor
Claude Fromentin
Jean-Marc Michel
Marie-Cécile RAYNAL
Khadidja Salah-Bey
Jesus Cortes
Sabine Gaisser
Peter Leadlay
Carmen Mendez
Jose A. Salas
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharma SA
Original Assignee
Hoechst Marion Roussel
Hoechst Marion Roussel Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from FR9709458A external-priority patent/FR2766496B1/en
Priority claimed from FR9807411A external-priority patent/FR2786200A1/en
Application filed by Hoechst Marion Roussel, Hoechst Marion Roussel Inc filed Critical Hoechst Marion Roussel
Publication of EP1032679A2 publication Critical patent/EP1032679A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
    • C12P19/62—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin the hetero ring having eight or more ring members and only oxygen as ring hetero atoms, e.g. erythromycin, spiramycin, nystatin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes

Definitions

  • the present invention describes genes involved in the biosynthesis and transfer of 6-deoxyhexoses in Saccharopolyspora erythraea and their use in the production of erythromycin analogs by genetic manipulation.
  • Erythromycin A is a clinically important macrolide antibiotic produced by the Gram-positive bacteria Sac. erythraea.
  • the erythromycin biosynthesis genes are organized into an ery gene cluster which also includes the erythromycin self-resistance gene ermE.
  • the ery cluster contains the three major genes eryAI, eryAII and eryAIII (locus eryA) encoding three polypeptides making up polyketide synthetase (called PKS) flanked by two regions comprising the genes involved in the later stages of conversion of the lactone nucleus (6-deoxyerythronolide B) in erythromycin A.
  • eryAI eryAII
  • eryAIII locus eryAIII
  • PKS polyketide synthetase
  • the biosynthesis of 6-deoxyhexoses includes all the enzymatic reactions leading from glucose-1-phosphate to the final activated sugar dTDP-L-mycarose or dTDP-D- desosamine.
  • the dTDP-L-mycarose or the dTDP-D-desosamine thus produced are then used as substrates for the transfer of the two deoxyhexoses onto the lactone nucleus.
  • the formation of erythromycin requires the attachment of the fungus via hydroxyl in position C-3 of the lactone nucleus and the attachment of desosamine via hydroxyl in position C-5.
  • the set of eryB genes involved in the biosynthesis or transfer of mycarosis and the set of eryC genes involved in the biosynthesis or transfer of desosamine have not yet been clearly identified.
  • the 56 kb ery cluster includes 21 open reading frames (ORFs), the numbering of which was established by Haydock et al. (1991) and Donadio et al. (1993).
  • the eryA locus includes ORFs 10, 11 and 12.
  • the eryF gene (ORF4) responsible for C6 hydroxylation has been identified (Weber et al., 1991) and the eryK gene (ORF20) responsible for hydroxylation. in C12 (Stassi et al., 1993).
  • the eryG gene (ORF6) responsible for the O-methylation of mycarosis in cladinose (position 3 "OH) has been identified (Weber et al., 1989). Erythromycin A is thus formed via erythromycin B or erythromycin C from erythromycin D according to the proposed scheme ( Figure 1).
  • the present invention relates to the functional characterization of ten Sac genes.
  • erythraea involved in the biosynthesis or attachment of mycarosis and desosamine (eryBII, eryCIII and eryCII located downstream of the locus eryA and eryBIV, eryBV, eryCVI, eryBVI, eryCIV, eryCV and eryBVII located upstream) in the production of erythromycin analogs and a process for their preparation.
  • the present invention therefore relates to an isolated single or double-stranded DNA sequence, represented in FIG. 2 (direct and complementary sequence of SEQ ID No. 1) corresponding to the eryG-eryAIII region of the gene cluster for biosynthesis of erythromycin and particularly relates to a DNA sequence above comprising: the sequence eryBII corresponding to 1ORF7 (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046) and coding for a dTDP-4-keto -L-6-deoxyhexose 2,3-reductase,
  • sequence eryCIII corresponding to 1ORF8 sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308, and coding for a deosaminyltransferase and
  • sequence eryCII corresponding to 1ORF9 sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404
  • sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404 sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404
  • the above DNA sequence shown in Figure 2 is a genomic DNA sequence which can be obtained for example by subcloning restriction fragments of a Sac genomic DNA fragment. erythraea, according to operating conditions, a detailed description of which is given below.
  • the invention more particularly relates to an isolated DNA sequence represented in FIG. 2 chosen from the sequence eryBII corresponding to 1ORF7 (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046), the sequence eryCIII corresponding to 1ORF8 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308) or the sequence eryCII corresponding to 1ORF9 (sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404) and the sequences which hybridize and / or show homologies significant with this sequence or fragments thereof and having the same function.
  • the eryBII sequence corresponding to 1ORF7 codes for a polypeptide having 333 amino acids (sequence of SEQ ID No. 2)
  • the eryCIII sequence corresponding to 1ORF8 codes for a polypeptide having 421 amino acids (sequence of SEQ ID No. 5)
  • the sequence eryCII corresponding to 1ORF9 codes for a polypeptide having 361 amino acids (sequence of SEQ ID No. 3).
  • sequences which hybridize and having the same function we include the DNA sequences which hybridize with one of the above DNA sequences under standard conditions of high or medium stringency described by Sambrook et al.
  • the high stringency conditions include for example hybridization at 65 ° C for 18 hours in a solution 5 x SSPE, 10 x Denhardt, 100 ⁇ g / ml DNAss, 1% SDS followed by 2 washes for 20 minutes with a solution
  • the conditions of medium stringency include, for example, a final wash for 20 minutes in a 0.2 x SSC, 0.1% SDS solution at 65 ° C.
  • sequences which have significant homologies and having the same function we include the sequences having a nucleotide sequence identity of at least 60% with one of the DNA sequences above and which code for a protein having the same enzymatic function .
  • the invention also relates to a polypeptide encoded by one of the DNA sequences above and especially to a polypeptide corresponding to an ORF represented in FIG. 2, chosen from 1ORF7 (having the sequence of SEQ ID N ° 2), 1ORF8 (having the sequence of SEQ ID No. 5) or 1ORF9 (having the sequence of SEQ ID No. 3) and analogs of this polypeptide.
  • an ORF represented in FIG. 2 chosen from 1ORF7 (having the sequence of SEQ ID N ° 2), 1ORF8 (having the sequence of SEQ ID No. 5) or 1ORF9 (having the sequence of SEQ ID No. 3) and analogs of this polypeptide.
  • analogues we include peptides having an amino acid sequence modified by substitution, deletion or addition of one or more amino acids provided that these products retain the same enzymatic function.
  • the modified sequences can for example be prepared using the site-directed mutagenesis technique known to those skilled in the art.
  • a more specific subject of the invention is the polypeptide corresponding to ORF 8 represented in FIG. 2 (having the sequence of SEQ ID No. 5) and having a deosaminyltransferase activity, called EryCIII.
  • the invention describes a recombinant Sac EryCIII protein. erythraea obtained by expression in a host cell according to known methods of genetic engineering and cell culture.
  • a subject of the invention is also the thymidine 5 '- (tri-hydrogen diphosphate), P' - [3, 4, 6-tridesoxy-3- (dimethylamino) - D-.xylo.-hexopyranosyl] ester (dTDP-D -desosamine) and the addition salts with bases, an example of preparation of which is described later in the experimental part.
  • the subject of the invention is also an isolated DNA sequence represented in FIG. 3 (sequence of SEQ ID No. 6) corresponding to the eryAI-eryK region of the gene cluster for the biosynthesis of erythromycin and particularly relates to a DNA sequence above comprising: - the eryBIV sequence corresponding to 1ORF13 (sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207) and coding for a dTDP-4-keto-L-6-deoxyhexose 4-reductase ,
  • sequence eryBV corresponding to 1ORF14 sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454
  • sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454
  • coding for a mycarosyltransferase
  • sequence eryCVI corresponding to 1ORF15 sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220
  • sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220
  • sequence eryBVI corresponding to 1ORF16 sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837
  • sequence of SEQ ID No. 6 sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837
  • sequence eryBVII corresponding to 1ORF19 sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156
  • sequence of SEQ ID No. 6 sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156
  • coding for a dTDP-4-keto-D-6-deoxyhexose 3.5 epimerase sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156
  • the above DNA sequence shown in Figure 3 is a genomic DNA sequence which can be obtained, for example, by subcloning restriction fragments of cosmids containing a Sac genomic DNA library. erythraea, according to operating conditions, a detailed description of which is given below.
  • the subject of the invention is more particularly an isolated DNA sequence represented in FIG. 3 chosen from the sequence eryBIV corresponding to 1ORF13 (sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207), the sequence eryBV corresponding to 1ORF14 ( sequence of SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), the sequence eryCVI corresponding to 1ORF15 (sequence of SEQ ID No 6 from nucleotide 2510 to nucleotide 3220), the sequence eryBVI corresponding to 1ORF16 (sequence of SEQ ID No 6 from nucleotide 3308 to nucleotide 4837), the eryCIV sequence corresponding to 1ORF17 (sequence of SEQ ID No.
  • the subject of the invention is very particularly the isolated DNA sequence eryBV represented in FIG. 3 corresponding to 1ORF14 (sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454) and coding for a mycarosyltransferase.
  • the eryBIV sequence corresponding to 1ORF13 codes for a polypeptide having 322 amino acids (SEQ ID No. 7)
  • the eryBV sequence corresponding to 1ORF14 codes for a polypeptide having 415 amino acids (SEQ ID No. 8)
  • the corresponding eryCVI sequence to 1ORF15 code for a polypeptide having 237 amino acids (SEQ ID No. 9)
  • the sequence eryBVI corresponding to 1ORF16 code for a polypeptide having 510 amino acids
  • the sequence eryCIV corresponding to 1ORF17 code for a polypeptide having 401 amino acids SEQ ID No.
  • the eryCV sequence corresponding to 1ORF18 codes for a polypeptide having 489 amino acids (SEQ ID No. 11) and the eryBVII sequence corresponding to 1ORF19 codes for a polypeptide having 193 amino acids (SEQ ID N "12).
  • the demonstration of the respective enzymatic activities indicated above was carried out by introduction of an internal deletion to the corresponding gene as illustrated below in the experimental part.
  • the DNA sequences which hybridize as well as the DNA sequences which exhibit significant homologies and having the same function have the same meaning as that indicated above.
  • the invention also relates to a polypeptide encoded by one of the DNA sequences above and especially to a polypeptide corresponding to an ORF represented in FIG.
  • a more specific subject of the invention is the polypeptide corresponding to 1ORF14 represented in FIG. 3 (having the sequence of SEQ ID No. 8) and having a mycarosyltransferase activity, called EryBV.
  • polypeptides of the invention can be obtained by known methods, for example by chemical synthesis or by the methodology of recombinant DNA by expression in a prokaryotic or eukaryotic host cell.
  • Another subject of the invention relates to the use of at least one of the DNA sequences chosen from sequences eryBII (sequence complementary to SEQ ID N ° 1 from nucleotide 48 to nucleotide 1046), eryCIII (sequence complementary to SEQ ID N ° 1 from nucleotide 1046 to nucleotide 2308) or eryCII (sequence complementary to SEQ ID N ° 1 to nucleotide 2322 at nucleotide 3404) shown in FIG.
  • eryBIV sequence of SEQ ID No 6 from nucleotide 242 to nucleotide 1207), eryBV (sequence of SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), eryCVI (sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220), eryBVI (sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837), eryCIV (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039), eryCV (sequence of SEQ ID No.
  • hybrid secondary metabolites is meant either erythromycin analogs, that is to say erythromycin derivatives having one or more modifications relating to the sugar part and having antibiotic activity, or precursors of erythromycin such as 6-deoxyerythronolide B or erythronolide B to which are attached one or more modified or unmodified sugar residues and not having antibiotic activity.
  • the modified sugar residue can be, for example, 4-keto-L-mycarose.
  • the synthesis of hybrid secondary metabolites in Sac. erythraea by using DNA sequences eryB or eryC of the invention can be carried out for example, by the inactivation of one or more genes eryB or eryC above and the introduction of one or more exogenous genes or their derivatives obtained for example by mutagenesis, having nucleotide sequences coding for enzymes having the same function in strains producing other acrolides, for example tylosin, picromycin or methymycin.
  • exogenous genes can be carried out by integration of a DNA sequence obtained according to the methodology of "DNA shuffling" (Stemmer, 1994) or by the construction of a chimeric DNA sequence, by example from an eryB or eryC sequence of the invention involved in the transfer of a sugar residue, for example the eryCIII or eryBV sequence, and of homologous genes isolated from macrolide producing strains, for example Streptomyces fradiae, Streptomyces olivaceus, Streptomyces venezuelae or Streptomyces antibioticus.
  • the invention also relates to the use of at least one of the DNA sequences chosen from the sequences eryBII (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046), eryCIII (sequence complementary to SEQ ID N ° 1 from nucleotide 1046 to nucleotide 2308) or eryCII (sequence complementary to SEQ ID No 1 from nucleotide 2322 to nucleotide 3404) shown in FIG.
  • eryBIV (sequence from SEQ ID No 6 from nucleotide 242 to nucleotide 1207), eryBV (sequence of SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), eryCVI (sequence of SEQ ID No 6 of nucleotide 2510 to nucleotide 3220), eryBVI (sequence of SEQ ID No 6 of nucleotide 3308 to nucleotide 4837) , eryCIV (sequence of SEQ ID No 6 from nucleotide 4837 to nucleotide 6039), eryCV (sequence of SEQ ID No 6 from nucleotide 6080 to nucleotide 7546) or eryBVII (sequence of SEQ ID No 6 from nucleotide 7578 to nucleotide 8156 ) shown in Figure 3 or a fragment of this sequence, co same hybridization probes.
  • the eryB or eryC DNA sequences of the invention can be used to constitute hybridization probes of at least 19 nucleotides, making it possible to isolate homologous genes in macrolide producing strains using the conventional hybridization methods of nucleic acids immobilized on filters or of amplification by PCR, according to the conditions described by Sambrook et al. (1989).
  • the invention relates more particularly to the above use, in which the homologous genes are the genes for the biosynthesis of oleandomycin in S. antibioticus.
  • the invention describes, by way of example, the use of the sequence of the eryCIII gene as a hybridization probe for isolating homologous genes in a strain producing oleandomycin.
  • the eryCIII probe used made it possible to isolate the oleGl and oleG2 genes coding for glycosyltransferases in S. antibioticus involved in the transfer of desosamine and oleandrosis to the lactone nucleus.
  • the functional characterization of the oleGl and oleG2 genes made it possible to define the organization of the right part of the cluster of genes for the biosynthesis of oleandomycin in S. antibioticus.
  • the subject of the invention is therefore an isolated DNA sequence represented in FIG. 22 (sequence of SEQ ID No. 15) corresponding to a region of the gene cluster for the biosynthesis of oleandomycin comprising:
  • the DNA sequence above shown in FIG. 22 is a genomic DNA sequence which can be obtained, for example, from a cosmid covering the right part of the gene cluster.
  • sequence of SEQ ID No. 15 is a genomic DNA sequence which can be obtained, for example, from a cosmid covering the right part of the gene cluster.
  • the subject of the invention is more particularly a isolated DNA sequence represented in FIG. 22 chosen from the sequence corresponding to the ORF oleG1 (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714 coding for glycosyltransferase activity and the sequence corresponding to the ORF oleG2 (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) coding for glycosyltransferase activity.
  • a very particular subject of the invention is a DNA sequence isolated above corresponding to the ORF oleG1 (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) coding for a deosaminyltransferase activity, as well as a sequence of DNA isolated above corresponding to ORF o! EG2 (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) coding for an oleandrosyl transferase activity.
  • sequence corresponding to the ORF oleG1 codes for a polypeptide having 426 amino acids (sequence of SEQ ID No. 17) and the sequence corresponding to the ORF oleG2 codes for a polypeptide having 426 amino acids (sequence of SEQ ID No. 18 ).
  • the demonstration of the respective enzymatic activities indicated above was carried out by alteration of the corresponding gene as illustrated later in the experimental part.
  • the subject of the invention is also the polypeptide coded by the DNA sequence corresponding to the oleG1 ORF and having a deosaminyltransferase activity (sequence of SEQ ID No. 17) and the polypeptide coded by the DNA sequence corresponding to the ORF o! EG2 and having oleandrosyltransferase activity (sequence of SEQ ID No. 18).
  • the invention also relates to a process for the preparation of hybrid secondary metabolites in Sac. erythraea in which:
  • - a DNA sequence is isolated containing at least one eryB sequence or an eryC sequence from the bio- gene cluster synthesis of erythromycin shown in FIG. 2 (sequence complementary to SEQ ID No. 1) or in FIG. 3 (sequence of SEQ ID No. 6),
  • the modified strain is cultivated under conditions allowing the formation of the hybrid secondary metabolite and - the hybrid secondary metabolite is isolated.
  • the modification of the DNA sequence can be carried out for example by an addition and / or by deletion of DNA sequences of at least one nucleotide, in an eryB or eryC sequence of the invention which codes for one corresponding enzymes indicated above.
  • the integration of the altered sequence into the host strain can be carried out for example by the methodology of homologous recombination which can be carried out according to the scheme shown in FIG. 4 and leads to the generation of chromosomal mutants of Sac strains. erythraea which is then cultivated according to the general known methods of cell culture.
  • the invention particularly relates to the above method in which the DNA sequence codes for one of the enzymes chosen from a
  • the invention more particularly relates to the above method in which the alteration of the sequence results in the inactivation of at least one of the enzymes indicated above.
  • the inactivation of at least one of the enzymes is demonstrated, on the one hand by the absence of production of erythromycin, on the other hand by the accumulation of precursors of erythromycin such as 6-deoxyerythronolide B, erythronolide B or 3- ⁇ -mycarosyl erythronolide B and / or the accumulation of hybrid secondary metabolites as defined above in the culture supernatants of the corresponding modified strains.
  • the invention relates more particularly to the above method in which the inactivated enzyme is a dTDP-4-keto-L-6-deoxyhexose 4-reductase or in which the inactivated enzyme is a dTDP-D-6-deoxyhexose 3 , 4-dehydratase or in which the inactivated enzyme is mycarosyltransferase or in which the inactivated enzyme is dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase.
  • the invention also relates to the above method in which the isolated hybrid secondary metabolite is an erythromycin analog chosen from 4 "-keto-erythromycin, 4'-hydroxy-erythromycin or 3" -C-desmethyl-2 ", 3" -ene- erythromycin or in which the isolated hybrid secondary metabolite is desosa inyl erythronolide B.
  • the invention also relates to a Sac strain. modified erythraea in which at least one of the enzymes chosen from a - dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase,
  • the invention particularly relates to the Sac strain. modified BII92 erythraea in which a dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase is inactivated and producing 3 "-C desmethyl-2", 3 "-ene-erythromycin C, the Sac strain. erythraea modified BIV87 in which a dTDP-4-keto-L-6-deoxyhexose 4-reductase is inactivated and producing 4 "- keto-erythromycin, the Sac strain.
  • modified CIV89 erythraea in which a dTDP-D-6-deoxyhexose 3, 4-dehydratase is inactivated and producing 4'-hydroxyerythromycin D as well as the Sac strain.
  • modified erythraea BV88 in which a mycarosyltransferase is inactivated and producing desoaminyl erythronolide B. Detailed constructions of the above strains are given later in the experimental part.
  • the invention also relates to a process for the preparation of oleandomycin precursors in S. antibioticus in which
  • an alteration is created of the gene sequence chosen from the DNA sequence corresponding to the oleG1 ORF (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) and the DNA sequence corresponding to the oleG2 ORF (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) in the chromosome of a host strain and obtains a modified strain,
  • the modified strain is cultivated under conditions allowing the accumulation of the oleandomycin precursors and
  • the alteration of the DNA sequence can be carried out for example by interruption of the target gene in the strain S. antibioticus, for example by integration of a plasmid by the methodology of homologous recombination and leads to the generation of chromosomal mutants of the wild strain.
  • the invention particularly relates to a process above in which the alteration is created in the DNA sequence corresponding to the ORF oleGl (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) and from which it results at least the elimination of the deoaminyltransferase activity and the accumulation of the precursor of oleandomycin 8, 8a-deoxyoleandolide.
  • the Sac strain. erythraea used for carrying out the invention is a spontaneous phenotypic variant called "red variant" (Hessler et al., 1997) of the wild strain Sac. erythraea NRRL 2338, the growth of which is carried out routinely either on solid R2T2 medium (R2T medium described by Weber et al., 1985 without peptone), R2T20 (Yamamoto et al., 1986) or Ml-102 on agar (Kaneda et al. , 1962), or in TSB (Oxoid) liquid medium at 30 ° C.
  • R2T2 medium described by Weber et al., 1985 without peptone
  • R2T20 Yamamoto et al., 1986
  • Ml-102 on agar
  • TSB Oxoid
  • the strain E. coli XLl-blue is used for routine cloning.
  • the JM10O strain is used for cloning where restriction sites such as Bell are used.
  • the DH5 ⁇ .MCR strain is used for the preparation of plasmids intended to be introduced to Sac. erythraea for optimal transformation.
  • the plasmids Litmus28, pUCl ⁇ and pUC19 were used routinely for subcloning.
  • the vector pIJ702 (Katz et al., 1983) was obtained from the John Inocc Institute.
  • the vector pIJ486 (Ward et al., 1986) was obtained from C.J. Thompson (University of Basel, Switzerland).
  • the phagmid pTZl ⁇ R was obtained from Pharmacia Biotech.
  • the coli-streptomyces shuttle vector pUWL218 (Wehmeier, 1995) used for chromosomal integration in Sac. erythraea was obtained from W. Piepersberg (University of Wuppertal, Germany).
  • DNA ligation System kit (Amersham) was used to perform the ligations and the Plasmid Midi kit (Quiagen) or RPM kit (BiolOl Inc.) to purify the plasmid DNA.
  • the preparation of the bacteriophage ⁇ DNA was carried out according to Ausubel et al. (1995) and the isolation of chromosomal DNA from Sac. erythraea according to Hopwood et al. (1985).
  • the transformation of S. lividans and the isolation of the plasmids were carried out according to Hopwood et al. (1985).
  • Erythronolide B and 3- ⁇ -mycarosyl erythronolide B were purified from culture extracts of the eryCI mutant (clone WHB2221 described by Dhillon et al., 1989) by chromatography on aminopropyl gel (LichroprepNH2 25-40 ⁇ , Merck) with an elution gradient by successive butyl chloride / methylene chloride mixtures (100: 0, 80:20, 50:50 and 20:80) followed by a linear elution gradient with the chloride mixture butyl / methanol ranging from 99: 1 to 90:10.
  • the solution is sterilized by autoclaving for 30 minutes at 120 ° C.
  • the following sterile solutions are added: 20 ml of 50% glucose; 25 ml of 1M Tris-HCl, pH 7.0; 5 ml of 0.5% KH 2 P0 4 ; 2.5 ml of NaOH IN; 50 ml of 1M CaCl 2 ; 50 ml of MgCl 2 , 6H 2 0 1M and 2 ml of "trace element" solution (Hopwood et al., 1985).
  • aqueous solution glucose 5 g; commercial brown sugar 10 g; tryptone 5 g; yeast extract 2.5 g; Versene 36 mg; running water 1000 ml; final pH adjusted to 7.0 to 7.2 with KOH.
  • the solution is sterilized by autoclaving for 30 minutes at 120 ° C.
  • the solution is sterilized by autoclaving for 30 minutes at 120 ° C.
  • the following sterile solutions are added: 10 ml of 0.5% KH 2 P0 4 ; 20 ml of 1M CaCl 2 ; 15 ml of 20% L-proline; 20 ml of 50% glucose and 1 ml of 2 lOmM CuCl.
  • the solution is sterilized by autoclaving for 30 minutes at 120 ° C.
  • the following sterile solutions are added: 5 ml of CaCl 2 and 20 ml of 5.3% TES.
  • FIG. 1 shows the biosynthetic pathway of
  • FIG. 2 shows the nucleotide sequence
  • FIG. 3 shows the nucleotide sequence
  • sequence of SEQ ID No. 6 of the eryAI-eryK region of the erythromycin biosynthesis gene cluster comprising the
  • Figure 4 shows the gene substitution scheme by homologous recombination.
  • FIG. 5A represents the organization of the left part of the cluster of genes for the biosynthesis of erythromycin in Sac. erythraea whose ORFs 1 to 9 are indicated by arrows as well as a restriction map of the plasmids pK62, pBCKl, pKB22, pBK44, pBIISB, pEco2 and pK23, generated from the XSE5.5 genomic clone.
  • restriction enzymes B, BajnHI; Bc, Bell; Bg, BgrlII; E, EcoRI; K, Kpnl; M, MluI; P, PstI; S, Sacl; Sa, Sali.
  • FIG. 5B represents the organization of the right part of the cluster of genes for the biosynthesis of erythromycin in Sac. erythraea whose ORFs 13 to 21 are indicated by arrows as well as a restriction map of the plasmids pBK6-12, pCN9, pNC028, pNB49, pNC062, pPSP4, pNC062X and pBABl ⁇ .
  • restriction enzymes B, BamKI; Ba, Bail; Bc, Bell; C, Clal; E, EcoRI; K, Kpnl; N, Ncol; Ns, Nsil; P, PstI; Pv, PvuII; S, Sacl ; Se, Seal; Sh, SphI; Sp, Spel; X, Xjal; Xh, Xhol).
  • FIG. 6A represents the construction diagram of the plasmid pBH ⁇ .
  • Figure 6B shows a restriction map of plasmid pUWL218.
  • FIG. 6C represents a restriction map of the plasmid pBIl ⁇ .
  • FIG. 7A represents the construction diagram of the plasmid pdel88.
  • FIG. 7B represents the construction diagram of the plasmid pdel88A.
  • FIG. 7C represents the construction diagram of the plasmid pOBB.
  • FIG. 7D represents the construction diagram and a restriction map of the plasmid pCIU ⁇ .
  • FIG. 8A represents the construction diagram of the plasmid pCIl ⁇ .
  • Figure 8B shows a restriction map of plasmid pORTl.
  • FIG. 8C represents a restriction map of the plasmid pCH ⁇ .
  • FIG. 9A represents the construction diagram of the plasmid pBIV ⁇ .
  • FIG. 9B represents a restriction map of the plasmid pBIV ⁇ .
  • FIG. 10A represents the construction diagram of the plasmid pBV ⁇ .
  • FIG. 10B represents a restriction map of the plasmid pBV ⁇ .
  • FIG. 11A represents the construction diagram of the plasmid pPSTI.
  • Figure 11B shows a restriction map of the plasmid pPSTI.
  • FIG. 12A represents the construction diagram of the plasmid pXhol.
  • Figure 12B shows a restriction map of the plasmid pXhol.
  • FIG. 13A represents the construction diagram of the plasmid pCIV ⁇ .
  • FIG. 13B represents a restriction map of the plasmid pCIV ⁇ .
  • FIG. 14A represents the construction diagram of the plasmid pCV ⁇ .
  • FIG. 14B represents a restriction map of the plasmid pCV ⁇ .
  • FIG. 15 represents the analysis by Southern blot of the mutant strains BII92, CIII68, CII62, BIV87, BV88, CIV89 and CV90, compared to the wild strain "red variant" noted Wt.
  • the restriction enzyme used is indicated below each blot and the size of the bands detected in front of each blot is estimated relative to the molecular weight markers ⁇ -HindlII and ⁇ -BstEII (not detectable by auto-radiography ).
  • FIG. 16 represents the analysis by PCR of the mutant strains BII91, CIII68, CII62, BIV87, BV88, CIV89 and CV90, compared with the wild strain "red variant" denoted Wt and with the plasmids pBH ⁇ , pCIU ⁇ , pCH ⁇ , pBIV ⁇ , pBV ⁇ , PCIV ⁇ and pCV ⁇ used respectively to obtain the mutant by homologous recombination.
  • the band sizes detected by staining with ethydium bromide are estimated relative to the molecular weight markers X174-HaeIII or ⁇ -BstEII.
  • 17 represents the TLC analysis of the metabolites produced by the mutant strains BII92, CIII68, CII62, BIV87, BV88, CIV89 and CV90, compared to the standard products erythromycin A (Er A), erythronolide B and 3- ⁇ -mycarosyl erythronolide B (SEM).
  • Er A erythromycin A
  • SEM 3- ⁇ -mycarosyl erythronolide B
  • FIG. 18 represents the analysis by SDS-PAGE of the purification of the protein EryCIII successively after extraction with urea 7M (line 2), Q Sepharose chromatography (line 3), Superdex chromatography (line 4), Q source chromatography ( lane 6) with standard molecular weight markers (lanes 1 and 5);
  • FIG. 19 represents the analysis by CMM of the test of biological activity of the protein EryCIII, by incubation with d-TDP-D-desosamine (lane 2) or with d-TDP-D-desosamine and 3- ⁇ -mycarosyl erythronolide B (SEM) (line 3) compared to SEM control (line 1) and erythromycin A control (line 4).
  • SEM 3- ⁇ -mycarosyl erythronolide B
  • FIG. 20 represents the location of the six cosmids (cosAB35, cosAB76, COSAB87, COSAB67, cosAB63 and cosABôl) covering the entire cluster of genes for oleanomomycin biosynthesis.
  • the BaraHI restriction fragments (denoted B) hybridizing with the probes denoted str M, D, E and the BamHI fragments (3.5 kb and 2.7 kb) hybridizing with the eryCIII probe are shown.
  • FIG. 21 represents the organization of the right part of the cluster of genes for the biosynthesis of oleandromycin in S. antibioticus whose different ORFs (noted olePl, oleGl, oleG2, oleM, oleY, oleP and oleB) are indicated by arrows as well as a restriction map of plasmid pC035-S and the insert of plasmid pC03 generated from pC035 -S.
  • the double arrow indicates the insert corresponding to the sequence of FIG. 22 (abbreviations of restriction enzymes: B, BamHI; Bg, Bgl I; K, Kpn; S, Sacl; Sh, SphI; the star indicates that it is not a single site).
  • FIG. 22 represents the nucleotide sequence (sequence of SEQ ID No. 15) of the region covering the oleP1, oleG1, oleG2, oleM and oleY genes of oleanomomycin biosynthesis and their deduced protein sequences.
  • EXAMPLE 1 Cloning and sequencing of the eryG-eryAIII region of the gene cluster for the biosynthesis of erythromycin. A fragment of genomic DNA from Sac.
  • erythraea NRRL 2338 having> 20 kb downstream of the ermE gene covering in particular ORFs 3 to 9 and corresponding to the clone XSE5.5 as well as the nucleotide sequence of a 4.5 kb fragment corresponding to the region of the ery cluster between 3 , 7 kb and 8.0 kb from the 3 'end of the erm ⁇ gene and comprising ORFs 3, 4, 5 and 6 were described by Haydock et al. (1991).
  • the plasmids pK62 and pK66 were directly constructed by subcloning the 5.8 kb Kpnl fragment into pUC19, the plasmid pK66 corresponding to the same Kpnl fragment subcloned with an inverted orientation of the insert relative to the vector.
  • the plasmid pKB22 containing an insert of 2.9 kb was then derived from the plasmid pK66 by excision of the BamHI-Bg II fragment (2.9 kb) covering 1ORF8 as well as part of ORFs 7 and 9 by digestion with the enzymes of BamHI and Bgl II restriction.
  • the plasmid pKB44 containing a 2.9 kb insert was obtained from the plasmid pK62 by excision of the BajnHI-BglII fragment (2.9 kb) covering the eryG gene corresponding to ORFs 5 and 6 and the gene eryF corresponding to 1 '0RF4.
  • Plasmid pBIISB was derived from plasmid pBK44 by subcloning into pUC19 the 600 bp SalI fragment obtained from plasmid pBK44 digested with the restriction enzyme Sali (FIG. 5A).
  • the plasmid pEco2 was directly constructed by subcloning the BcoRI fragment (2.2 kb) in pUC19.
  • the subclones pKB22, pBK44, pBIISB and pEco2 thus obtained were then sequenced.
  • the analysis was carried out on plasmid DNA samples, previously purified on a column of Quiagen 100 (Quiagen), on the sequencer automatic ABI prism 377.
  • nucleotide sequences obtained made it possible to establish the nucleotide sequence of 3412 bp of FIG. 2 (direct and complementary sequence of SEQ ID No. 1) in which three ORFs (7, 8 and 9) were identified respectively from nucleotide 8957 to nucleotide 7959, from nucleotide 10219 to nucleotide 8957 and from nucleotide 11315 to nucleotide 10233 (numbered in FIG.
  • EXAMPLE 2 Construction of the plasmid pBH ⁇ .
  • the 598 bp fragment Bc I-BamHI was deleted in the plasmid pK62 obtained in Example 1 by digestion with the enzymes Bell and BamHI.
  • the resulting plasmid pBCKl was then digested with the restriction enzymes M uI and Bg / III so as to delete a fragment having 853 bp inside 1ORF7 from nucleotide 8011 to nucleotide 8863 of the sequence of FIG. 2. After filling ends using the Klenow fragment of DNA polymerase I, the plasmid containing the deletion, was religated and transformed into E. coli XLl-blue.
  • the plasmid pBH ⁇ was then transferred to the strain
  • E. coli DH ⁇ MRC then used to transform Sac. erythraea.
  • EXAMPLE 3 Construction of a Sac strain. erythraea ery BII ⁇ (BII92).
  • the protoplast preparation was carried out according to the method described by Weber and Losick (1988), using PEG 3350 (Sigma) instead of PEG 1000 and a modified P buffer. (called PT) containing MgCl 2 , 6H 2 0 28 M and without P0 4 H 2 K instead of the buffers P, L or T described, according to the following operating conditions:
  • Sac cells (at least 10 8 spores).
  • erythraea "red variant” (a sample of which was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Dondel Roux 75724 PARIS CEDEX 15 FRANCE, July 16, 1997 under the number 1-1902) were grown in 50 ml of TBS medium for 3 to 5 days at 30 ° C, then washed in 10.3% sucrose.
  • the cells were resuspended in 50 ml of PT buffer containing 2 to 5 mg / ml of lysozyme (Sigma), then incubated at 30 ° C for 1 to 2 hours by disaggregating the mycelium clusters every 15 minutes until conversion of at least 50% of the mycelium into protoplasts.
  • the protoplasts were washed with 50 ml of PT buffer, resuspended in 12.5 to 25 ml of the same buffer, frozen slowly and then stored at -80 ° C in 200 l aliquots.
  • plasmid DNA pBH ⁇ prepared in Example 2 from the strain E. coli DH5 ⁇ MRC were dissolved in 5 to 10 ⁇ l of TE buffer (Tris HC1 10 mM pH 7.5, EDTA 1 mM) then deposited on the wall of the inclined tube to which was then added 0.5 ml of a solution of PEG 3350 in the PT buffer prepared extemporaneously from a 50% aqueous solution which is diluted to half in the 2 x PT buffer.
  • TE buffer Tris HC1 10 mM pH 7.5, EDTA 1 mM
  • the selection of the integrants corresponding to the first recombination event was carried out by replicating the sporulated dishes using velvet or by spreading a suspension of the spores on R2T2 dishes containing thiostrepton then incubation at 32 ° C. , which allows the growth of clones of potential integrants.
  • protoplasts were prepared from the cells as indicated above, so as to drive out the plasmid. The protoplasts were then spread on R2T2 dishes so as to obtain individualized colonies whose sensitivity to thiostrepton was determined by replication on R2T2 dishes containing thiostrepton.
  • the phenotype of the thiostrepton-sensitive colonies is of the wild type or of the mutated type carrying the deletion.
  • the selection of the mutants having the phenotype ery ⁇ was carried out by antibiogram on the strain B. pumilu ⁇ ATCC 14884 sensitive to erythromycin.
  • the B. pumilus strain was used as an indicator strain to evaluate the production of erythromycin in bioassays by antibiogram. The colonies were spread with a platinum loop on R2T2 dishes, then incubated for 3 to 4 days at 30 ° C.
  • Agar zones where the mutant has grown to confluence have then taken with a cookie cutter and then placed on A-Merck boxes covered with a 4 ml overlay of 0.5 x A Merck (Antibiotic agar No. 1 Merck) inoculated with a suspension of B. pumilus spores , then incubated overnight at 37 ° C.
  • a Merck Antibiotic agar No. 1 Merck
  • PCR analysis a 100 ⁇ l sample of a 3-day culture in TSB medium was centrifuged. The pellet obtained was resuspended in 10 ⁇ l of TSB medium, then used for amplification in the genA p PCR System 9600 device (Perkin El er Cetus). After heating of the sample for 3 min at 94 ° C, the following amplification conditions were used: 94 ° C, 1 min; 55 ° C, 1 min; 72 ° C, 3 min; 30 cycles; Ampli Taq polymerase (Perkin Elmer) in the presence of 10% dimethylsulfoxide (v / v) followed by an elongation of 3 min at 72 ° C.
  • genA p PCR System 9600 device Perkin El er Cetus
  • the amplification was carried out using the oligonucleotide B2S above and the oligonucleotide having the following sequence B2-R GCCGCTCGGCACGGTGAACTTCA (SEQ ID No. 31) corresponding to the sequence of the complementary strand of the DNA region located in the position 8873 at position 8892 of the sequence of FIG. 2 to which three nucleotides have been added at the 5 ′ end and making it possible to frame, by PCR amplification, the region carrying the internal deletion at 1 ORF7.
  • the recombinant strain thus obtained designated BII92, was then cultured to identify the metabolites produced by the strain.
  • EXAMPLE 4 Fermentation of the BII92 strain and identification of the secondary metabolites produced.
  • Extracts of culture broth of the strain were analyzed by thin layer chromatography (cmc) with erythromycin A, erythronolide B and 3- ⁇ -mycarosyl erythronolide B as standards.
  • PPE medium Solulys L-Corn steep liquor (Ro
  • the culture supernatant was then extracted at pH 9-10 with ethyl acetate.
  • the organic phases were dried over SO 4 Mg, brought to dryness under reduced pressure and then analyzed by ccm on silica gel 60 F254 (Merck) [dichloroethane / methanol (90:10, v / v) or isopropyl ether / methanol / 25% NH 4 OH (75: 35: 2, v / v)].
  • the analysis was carried out by ccm on grafted silica gel plates of NH 2 F254 type (Merk) [butyl chloride / methanol (90:10, v / v)].
  • the chemical development of the plates was carried out by spraying with a solution of p-anisaldehyde-sulfuric acid 98% -ethanol (1: 1: 9, v / v), followed by heating for a few minutes at 80 ° C.
  • the potential antibiotic activities were analyzed by direct bioautography of the ccm plates on agar seeded with B. pumilus ATCC 14884.
  • the results obtained by chemical revelation show that the strain BII92 preferentially accumulates erythronolide B as expected from a mutant eryB.
  • RP-HPLC reverse-phase high performance liquid chromatography
  • the RP-HPLC was carried out on a column (250 x 4.6 mm) of Kro asil C18 5 ⁇ using the acetonitrile / methanol / 0.065 M ammonium acetate pH 6.7 mixture as the mobile phase (350: 150: 500, v / v) on a Waters chromatograph equipped with a Finningan TSQ 7000 mass spectrometer.
  • Ml gives a parent peak at m / z 704 and fragmentation products at m / z 576 and m / z 158.
  • deaminerythronolide A indicates that the difference in m / z of 30 compared to erythromycin A (m / z 734) or 16 compared to erythromycin C (m / z 576) z 720) is carried by the sugar residue neutral.
  • the proposed structure for Ml is 3 "-C desmethyl- 2", 3 "-ene-erythromycin C.
  • - M2 gives a parent peak at m / z 706 and fragmentation products at m / z 576 and m / z 158.
  • the presence of deaminerythronolide A indicates that the difference in m / z of 28 compared to 1 erythromycin A (m / z 734) or 14 compared to 1 erythromycin C (m / z 720) is carried by the neutral sugar residue.
  • the proposed structure for M2 is 3 "-C ethyl ethyl erythromycin C.
  • - M3 gives a parent peak at m / z 690 and fragmentation products at m / z 560 and m / z 158.
  • deaminyl erythronolide B (m / z 560) indicates that the difference in m / z of 28 compared to erythromycin B (m / z 718) or of 14 compared to erythromycin D (m / z 704) is carried by the sugar residue neutral.
  • the proposed structure for M3 is 3 "-C desmethyl- erythromycin D.
  • M4 gives a parent peak at m / z 720 and fragmentation products at m / z 576 and m / z 158.
  • the profile is identical to that of erythromycin C (m / z 720) with the presence of desosaminylerythronolide A (m / z 576) and the loss of the amino sugar residue (m / z 158), but the metabolite M4 does not have the same retention time in RP-HPLC as erythromycin.
  • the proposed structure for M4 is 3 "-C desmethyl- erythromycin A.
  • SM-SM minor metabolite Ml having an unsaturated neutral sugar (3" -C desmethyl-2 ", 3" -ene-erythromycin C) indicates that the eryBII gene codes for dTDP-4-keto-L-6-deoxyhexose 2,3-reductase in the biosynthetic pathway for dTDP-mycarose.
  • the BII92 strain was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Dondel Roux 75724 PARIS CEDEX 15 FRANCE, on July 16, 1997 under the number 1-1903.
  • a Sali deletion of 663 bp was introduced into 1ORF8 from nucleotide 9384 to nucleotide 10046 of the sequence of FIG. 2 by subcloning in the plasmid pUC19 the two SalI fragments (a: 794 bp and b: 631 bp shown in FIG. 5A) isolated from the plasmid pBK44 obtained in Example 1 to generate the plasmid pdel88 (FIG. 7A). The presence of the 663 bp deletion was confirmed by sequencing. The plasmid pdel88 was then subjected to two additional subcloning so as to widen the chromosomal regions which can be used for homologous recombination on both sides of the deletion site.
  • the SacI fragment (450 bp) of the plasmid pdel88 was first replaced by the SacI fragment (1.1 kb) of the plasmid pEco2 obtained in Example 1 to generate the plasmid pdel88A (FIG. 7B). Then the EcoRI fragment (1.5 kb) carrying the deletion in 1ORF8 was isolated from the plasmid pdel ⁇ A and used to replace the BcoRI fragment (1.66 kb) carrying the intact ORF in the plasmid pOBB.
  • the plasmid pOBB represented in FIG.
  • a strain in which the eryCIII gene carries an internal deletion such as that introduced into the plasmid pCIU ⁇ obtained in Example 5 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCIU ⁇ .
  • the protoplast preparation, the integration process and the selection of the mutants having the ery ⁇ phenotype were carried out as in Example 3.
  • the presence of the expected deletion in the chromosome (663 bp deletion from nucleotide 9384 to nucleotide 10046 of the sequence of FIG. 2) was confirmed by genomic analysis by Southern blot as well as by PCR amplification according to the conditions described in Example 3.
  • the PCR amplification was carried out using the oligonucleotide C3-S above and the oligonucleotide having the following sequence
  • the recombinant strain thus obtained designated CIII68, was then cultured to identify the metabolites produced by the strain.
  • EXAMPLE 7 Fermentation of the CIII68 strain and identification of the secondary metabolites produced.
  • the ccm results show that the CII68 strain preferentially accumulates 3- ⁇ -mycarosyl erythronolide B as well as small amounts of erythronolide B as expected from an eryC mutant.
  • the eryCIII sequence has strong homology with other putative glycosyltransferases such as DauH (43% identity at the protein level) and DnrS (47% identity) involved in the biosynthesis of daunorubicin in S. peucetiu ⁇ (Otten et al ., 1995) and in Streptomyces sp C5 (Dickens et al., 1996) as well as TylM2 (50% identity) involved in the transfer of mycaminosis to tylactone in the pathway of tylosin biosynthesis in S. fradiae (Gandecha et al., 1997).
  • DauH 33% identity at the protein level
  • DnrS 47% identity
  • TylM2 50% identity
  • Plasmid pK23 (FIG. 5A) was obtained by subcloning into pUC19 the 10 kb Kpn fragment isolated from the DNA of clone XSE5.5 digested with the restriction enzyme Kpn1.
  • the shuttle vector pORT1 shown in FIG. 8B, was obtained by subcloning the PstI fragment of 4kb isolated by digestion of the plasmid pIJ486 with the restriction enzyme PstI including the thiostrepton resistance gene and the replicon Streptomyces, in the PstI site of pUC19.
  • erythraea eryCIl ⁇ (CII62).
  • a strain in which the eryCII gene carries an internal deletion such as that introduced into the plasmid pCH ⁇ obtained in Example 8 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCIl ⁇ . The preparation of the protoplasts, the integration process and the selection of the mutants having the ery ⁇ phenotype were carried out as in Example 3.
  • PCR amplification analysis detected a band of approximately 760 bp in the wild strain and a band of approximately 460 bp in the mutant CII62 in an identical manner to the signal obtained with pCIl ⁇ .
  • the results shown in FIG. 16 confirm that the deletion of approximately 400 bp detected by the Southern analysis is identical to that carried by the plasmid pCH ⁇ (304 bp).
  • the recombinant strain thus obtained designated CII62, was then cultured to identify the metabolites produced by the strain.
  • EXAMPLE 10 Fermentation of the CII62 strain and identification of the secondary metabolites produced.
  • the ccm results show that the CII62 strain preferentially accumulates 3- ⁇ -mycarosyl erythronolide B as well as small amounts of erythronolide B as expected from an eryC mutant.
  • the eryCII sequence has a strong homology with genes involved in the biosynthesis pathways of daunosamine (DnrQ, 38% identity at protein level, Otten et al., 1995) and mycaminose (protein encoded by ORFl *, 40% identity at the protein level, Gandecha et al., 1997) which also need to transfer a keto group in position 3 from an adjacent carbon.
  • EXAMPLE 11 Cloning and Sequencing of the eryAI-eryK Region of the Gene Cluster for Erythromycin Biosynthesis.
  • Cosmids containing the eryAI-eryK region of the ery gene cluster such as the cosmid Cos6B, were isolated by screening of a Sac genomic DNA library.
  • erythraea in the cosmid vector pWE15 (Stratagene) using as probe a DNA fragment of 13.2 kb comprising the entire eryAI gene and corresponding to the region of DNA between the Wcol site located at position 44382 of the sequence in Figure 3 and the Wcol site located at position 392 of the sequence X62569 (Bevitt et al., 1992).
  • the probe was prepared as follows: First, the 13.2 kb Ncol fragment was isolated from the plasmid pBK25 described by Bevitt et al., 1992 and subcloned into the Smal site of pUC18 after filling the Ncol ends with the Klenow fragment. From the plasmid pNC012 thus generated, the 13.2 kb fragment was isolated by digestion with the restriction enzyme Ncol.
  • the cosmid cos6B thus obtained was digested with the restriction enzyme Ncol and the resulting fragments of 2.8 kb and 6.1 kb were cloned into the Ncol site of the vector Litmus28 generating the plasmids pNC028 and pNC062 respectively shown in the figure. 5B.
  • Plasmid pNC028 was sequenced by generation of subclones using exonuclease III according to the protocol of the supplier of the Erase-a-Base Kit (Promega) by digesting with the restriction enzymes Sac / Xba and Nsil / BamBI respectively for the reverse direction. The sequence was completed using as primers the synthetic oligonucleotides having the following sequences 644 GATCACGCTCTTCGAGCGGCAG (SEQ ID N ° 36)
  • templates were generated by sonication of the DNA according to Bankier et al. (1987) using pUC18 as a vector.
  • the sequence was completed using as primers the synthetic oligonucleotides having the following sequences:
  • the Ncol junctions were sequenced using as DNA the cosmid cos6B DNA obtained above, the regions covering the Ncol sites were sequenced using the primers having the sequences 644 and 645 indicated above.
  • plasmid pBK6-12 shown in FIG. 5B was first generated by subcloning into phagmide pTZ18R the 4.5 kb Kpn1 fragment isolated from the plasmid pBK25 described by Bevitt et al., 1992.
  • the subclone pCN9 was then generated by subcloning the 0.9 kb Clal-Ncol fragment isolated from the plasmid pBK6-12 in the Smal site of pUC19, after filling the ends with using the Klenow fragment.
  • the plasmid pCN9 thus obtained (FIG. 5B) was sequenced. Arrays were generated by DNA sonication according to Bankier et al. (1987) using pUC18 as a vector. The sequence was completed using as an primer the oligonucleotide having the following sequence: 675 CGACGAGGTCGTGCATCAG (SEQ ID No. 44).
  • DNA sequencing is carried out by Sanger's method (1977) using an automated sequencer on double stranded DNA templates with the Applied Biosystem 373 A sequencer.
  • the assembly of the sequence data was carried out with the software SAP (Staden, 19 ⁇ 4).
  • the sequences were analyzed using GCG software (Devereux, 1984).
  • nucleotide sequences obtained made it possible to establish the nucleotide sequence of ⁇ 160 bp of FIG. 3 (sequence of SEQ ID No. 6) in which seven ORFs (13-19) were identified respectively from nucleotide 43641 to nucleotide 44806, from nucleotide 44809 at nucleotide 46053, from nucleotide 46109 to nucleotide 46819, from nucleotide 46907 to nucleotide 48436, from nucleotide 48436 to nucleotide 4963 ⁇ , from nucleotide 49679 to nucleotide 51145 and from nucleotide 51177 to nucleotide 51755 (numbered in Figure 3 from the site BamHI located at the 5 'end of the erraE gene) (respectively sequence of SEQ ID No.
  • the plasmid pNC062 comprising the coding sequence for ORFs 17, l ⁇ and 19 as well as for part of 1ORF16 under the number 1-1900.
  • EXAMPLE 12 Construction of the plasmid pBIV ⁇ .
  • LORF13 being translationally coupled to 1ORF14 located downstream, a phase deletion had to be introduced.
  • the plasmid pPSP4 (FIG. 5B) was first constructed by subcloning the PvuII-Spel fragment (2.7 kb) isolated from the plasmid pBK6-12 obtained in Example 11 and the Spel-PstI fragment (1 , 6 kb) isolated from the plasmid pNC02 ⁇ obtained in Example 11 in the vector pUC19 previously digested using the restriction enzymes SmaI and PstI.
  • the plasmid pl9BIV ⁇ was generated by deleting the BclI-Ncol fragment of 510 bp internal to 1ORF13 and by replacing it with 45 bp coming from a synthetic adapter of 54 bp.
  • This adapter was generated by pairing the 2 complementary oligonucleotides having the following sequences SEQ A
  • the two oligonucleotides were brought to a final concentration of ⁇ ⁇ M in the 50 mM NaCl hybridization buffer, Tris, 20 mM HCl pH 7.4, MgCl 2 , 6H 2 0 2 mM, heated for 5 min at 100 ° C then slowly cooled to room temperature. After digestion with the restriction enzymes Ncol and Bell, a ligation was carried out in the plasmid pPSP4 from which the BclI-Ncol fragment of 510 bp had previously been eliminated.
  • a strain in which the eryBIV gene carries an internal deletion such as that introduced into the plasmid pBIV ⁇ obtained in Example 12 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pBIV ⁇ . The protoplast preparation, the integration process and the selection of the mutants having the ery ⁇ phenotype were carried out as in Example 3.
  • the PCR amplification was carried out using the oligonucleotide having the following sequence B4-S CAATATAGGAAGGATCAAGAGGTTGAC (SEQ ID No. 48) corresponding to the DNA region located from position 43652 to position 43678 of the sequence of the figure 3 and the oligonucleotide B4-R having the sequence indicated above, making it possible to frame by PCR amplification the region carrying the internal deletion at 1ORF13.
  • Analysis by PCR amplification made it possible to detect a band of approximately 1 kb in the wild-type strain and a band of approximately 500 bp in the mutant BIV87 in an identical manner to the signal obtained with the plasmid pBIV ⁇ 7 (FIG. 16).
  • the recombinant strain thus obtained designated BIV67, was then cultured to identify the metabolites produced by the strain.
  • EXAMPLE 14 Fermentation of the BIV87 strain and identification of the secondary metabolites produced.
  • the culture of the BIV87 strain and the ccm analyzes were carried out according to the conditions indicated in Example 4.
  • the ccm results show that the BIV87 strain preferentially accumulates erythronolide B as expected from a mutant eryB.
  • Mass spectrum results indicate that modified forms of erythromycin A, B, C and D have been produced. One major metabolite and 3 minor metabolites were detected.
  • the major metabolite M5 gives a parent peak at m / z 702 with dehydration and fragmentation products at m / z 684, m / z 560 and m / z 158 and corresponds to the elimination of 2 hydrogen atoms in l erythromycin D (m / z 704, m / z 686).
  • the presence of desosaminyl erythronolide B fragment m / z at 560 indicates that the difference in mass is carried by the neutral sugar.
  • the proposed structure for this metabolite is 4 "-keto erythromycin D.
  • the minor metabolites also give a profile with a difference of 2 in the m / z values respectively:
  • the proposed structures are respectively 4 "-keto erythromycin C for M6, 4" -keto erythromycin A for M7 and 4 "-keto erythromycin B for M8.
  • a 726 bp deletion was generated in 1ORF14 of nucleotide 44963 to nucleotide 45688 of the sequence of FIG. 3 by ligation of the Bcll-Kpnl fragment (1.1 kb) isolated from the plasmid pBK6-12, obtained in Example 11, to the Kpnl-BamHI fragment (1.1 kb) isolated from the plasmid pNC028, obtained in Example 11, in the plasmid pUWL218 previously digested with the restriction enzyme BamHI.
  • the integration plasmid pBV ⁇ thus obtained (FIG. 10B) was then transferred to the E. coli strain DH ⁇ MRC, then used to transform Sac. erythraea.
  • EXAMPLE 16 Construction of a Sac strain. erythraea eryBV A (BV88).
  • a strain in which the eryBV gene carries an internal deletion such as that introduced into the plasmid pBV ⁇ obtained in Example 15 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pBV ⁇ . The protoplast preparation, the integration process and the selection of the mutants having the ery ⁇ phenotype were carried out as in Example 3.
  • B5-R TCCGGAGGTGTGCTGTCGGACGGACTTGTCGGTCGGAAA (SEQ ID No. 49) corresponding to the complementary strand of the DNA region located from position 46060 to position 46098 of the sequence of FIG. 3, a band of 2.7 kb from the strain wild and a 2.0 kb band from the mutant BV88 were detected.
  • the results shown in FIG. 15 indicate in the mutant the presence of a deletion of approximately 700 bp in this region of the chromosome.
  • the PCR amplification was carried out using the oligonucleotide having the following sequence: B5-S AGGAGCACTAGTGCGGGTACTGCTGACGTCCTT (SEQ ID No.
  • the recombinant strain thus obtained designated BV88, was then cultured to identify the metabolites produced by the strain.
  • the culture of the BV88 strain and the ccm analyzes were carried out according to the conditions indicated in Example 4.
  • the ccm results show that the BV88 strain preferentially accumulates erythronolide B as expected from an eryB mutant.
  • EXAMPLE 18 Construction of a plasmid pCVl ⁇ (pPSTI).
  • An integration plasmid called pPSTI and carrying a deletion in the eryCVI gene coding for 1ORF15, was constructed according to the diagram of FIG. 11A as follows:
  • the plasmid pNB49 was generated by treatment with exonuclease III of the plasmid pNC028 obtained in Example 11 previously digested with the restriction enzymes Nsil and BamHI.
  • the plasmid pNB49 (FIG. 5B) containing the nucleotides 44382 to 46562 of the sequence of FIG. 3, was then digested using the restriction enzyme PstI then treated with the Mung Bean nuclease (NE Biolabs) as described by Sambrook et al. (1989). After religion and transformation in E. coli XLl-Blue, ampicillin resistant colonies were selected by restriction analysis with the enzyme PstI.
  • the loss of the PstI site was confirmed by sequencing a clone using the reverse M13 primer and the deletion of nucleotide 46364 from the sequence of FIG. 3 was observed creating a phase change in 1ORF15 in the plasmid pNB49 ⁇ Pst thus generated .
  • the plasmid pIJ702 digested with the restriction enzyme Bg II was then ligated to the BglII site of the plasmid pNB49 ⁇ Pst generating the plasmid pPSTI.
  • the orientation of pIJ702 in pPSTI was confirmed by the presence of a DNA fragment having 0.9 kb after digestion with the restriction enzyme Sphl.
  • the integration plasmid pPSTI (FIG. 11B) thus obtained was transferred to the strain E. coli DH5 ⁇ MRC, then used to transform Sac. erythraea.
  • EXAMPLE 19 Construction of a Sac strain. erythraea eryCVlA (PstlO).
  • a strain in which the eryCVI gene carries an internal deletion such as that introduced into the plasmid pPSTI obtained in Example 18 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pPSTI.
  • B. subtilis sensitive to erythromycin instead of a B. pumilus strain as an indicator strain.
  • B. subtilis ATCC 6633 was used to assess production of erythromycin in biological tests on agar dishes in Ml-102 medium inoculated with the mutant to be analyzed and incubated for 3 days at 30 ° C. Agar areas covered with bacteria were then taken with a cookie cutter and then placed on 2 x TY dishes covered with an overlay of 5 ml of agar in TY medium containing 200 ⁇ l of a B. subtilis culture. ATCC 6633, then incubated overnight at 37 ° C.
  • the oligonucleotide 14-1 was designed so as to introduce a BamHI site and an NdeI site upstream of the sequence corresponding to the DNA region located from position 44811 to position 44833 of the sequence of FIG. 3.
  • the oligonucleotide 14-2 was designed to introduce a BglII site downstream of the sequence corresponding to the complementary strand of the DNA region located from position 46027 to position 46053 of the sequence of FIG. 3. Chromosomal DNA previously digested with restriction enzymes Clal and PstI showed the expected bands of 4 kb and 7 kb from the integrant while the wild strain presented the expected 3 kb band.
  • the recombinant strain thus obtained designated Pst10, was then cultured to identify the metabolites produced.
  • EXAMPLE 20 Fermentation of the Pst10 strain and identification of the secondary metabolites produced.
  • the Pst10 strain was cultivated in the sucrose-succinate medium described by Caffrey et al. (1992) for 3 days at 30 ° C. The culture supernatant was then extracted at pH 9 with ethyl acetate. The organic phases obtained were dried over SO 4 Mg 2 and then brought to dryness under reduced pressure. The residue was dissolved in acetonitrile-water (1: 1, v / v), then was analyzed by mass spectrometry on a BioQ (Micromass, Manchester, UK) or Finningan LCQ (Finningag, CA) spectrometer.
  • BioQ Micromass, Manchester, UK
  • Finningan LCQ Finningan LCQ
  • erythomycin A (m / z 734 and m / z 716) was not observed but the presence of erythronolide B (MK +: m / z 441 and MNa +: m / z 425) as well as 3- ⁇ -mycarosyl Erythronolide B (MK +: m / z 585 and MNa +: m / z 569) demonstrated characterizes the Pst10 strain as an eryC mutant.
  • the eryCVI sequence has strong homology with other methyltransferases such as SnoX involved in the biosynthesis of nogalamycin in S.
  • EXAMPLE 21 Construction of a plasmid pBVl ⁇ (pXhol).
  • FIG. 12A An integration plasmid, called pXhol and carrying a deletion in the eryBVI gene coding for 1ORF16, was constructed according to the diagram of FIG. 12A as follows:
  • the Ncol-Xhol fragment (3.1 kb) of the plasmid pNC062 obtained in Example 11 and containing the nucleotides 47142 to 50254 of the sequence of FIG. 3 was subcloned in the Ncol and Xhol sites of the plasmid Litmus 28.
  • the plasmid pNC062X (FIG. 5B) thus generated was digested with the restriction enzyme PstI and then treated with DNA polymerase T4 (Boehringer Mannheim). After religion and transformation in E. coli XLl-Blue, the loss of the PstI site at nucleotide 47397 of the sequence of FIG.
  • a strain in which the eryBVI gene carries an internal deletion such as that introduced into the plasmid pXhol obtained in example 21 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pXhol.
  • the recombinant strain thus obtained and designated Xho91 was then cultured to identify the metabolites produced.
  • the culture of the Xho91 strain and the analysis of the culture supernatant by mass spectrometry were carried out according to the conditions described in Example 20.
  • erythomycin A (m / z 734 and m / z 716) was not observed but the presence of a majority amount of erythronolide B (MK + : m / z 441; MNa + : m / z 425; MH 2 0 H + : m / z 385) as well as the presence of desosaminyl erythronolide B (m / z 560) demonstrated characterize the strain Pst10 as a mutant eryB.
  • the mass spectrometry results were confirmed by high resolution mass spectrometry on a Brucker FT-ICR spectrometer (Brucker, FRG).
  • the eryBVI sequence has a strong homology with DnmT involved in the biosynthesis of daunorubicin in S. peucetius (accession number EMBL U77891) (43.9% identity at the protein level).
  • EXAMPLE 24 construction of the plasmid pCIV ⁇ .
  • the plasmid pNC062 obtained in Example 11 was digested with using the restriction enzymes Bail and BcII so as to eliminate a fragment having 949 bp inside 1ORF17 from nucleotide 48650 to nucleotide 49598 of the sequence of FIG. 3. After filling the ends with the Klenow fragment of DNA polymerase I, the plasmid was religated and transformed into E. coli XLl-blue. From the plasmid pBCB17 thus generated, the 2.68 kb fragment carrying the deletion was isolated by digestion using the enzymes Xbal and SphI, then subcloned into the corresponding sites of the plasmid pUWL218.
  • EXAMPLE 25 Construction of a Sac strain. erythraea eryCIV A (CIV89).
  • the PCR amplification was carried out using the oligonucleotide having the following sequence:
  • the recombinant strain thus obtained designated CIV89, was then cultured to identify the metabolites produced by the strain.
  • the CIV89 strain was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Dondel Roux 75724 PARIS CEDEX 15 FRANCE, on July 16, 1997 under the number 1-1905.
  • EXAMPLE 27 Construction of the plasmid pCV ⁇ .
  • FIG. 14A An integration plasmid, called pCV ⁇ and carrying a deletion in the eryCV gene coding for 1ORF18, was constructed according to the diagram of FIG. 14A as follows:
  • a strain in which the eryCV gene carries an internal deletion such as that introduced into the plasmid pCV ⁇ obtained in Example 27 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCV ⁇ . The protoplast preparation, the integration process and the selection of the mutants having the ery ⁇ phenotype were carried out as in Example 3.
  • the PCR amplification was carried out using the oligonucleotide having the following sequence: C5-S TTCGCTCCCCGATGAACACAACTCGTA (SEQ ID No. 56) corresponding to the DNA region located at position 49668 at position 49694 of the sequence of the FIG. 3 and the oligonucleotide C5-R having the sequence indicated above, making it possible to frame by PCR amplification the region carrying the internal deletion at 1ORF18.
  • Analysis by PCR amplification made it possible to detect a band of approximately 1.6 kb in the wild-type strain and a band of approximately 500 bp in the mutant CV90 in an identical manner to the signal obtained with the plasmid pCV ⁇ .
  • the results shown in FIG. 16 confirm that the deletion of approximately 1.1 kb detected by the Southern analysis is identical to that carried by the plasmid PCV ⁇ (1044 bp).
  • the recombinant strain thus obtained designated CV90, was then cultured to identify the metabolites produced by the strain.
  • EXAMPLE 29 Fermentation of the CV90 strain and identification of the secondary metabolites produced.
  • the culture of the CV90 strain and the analyzes by ccm were carried out according to the conditions indicated in Example 4.
  • the results of ccm show that the CV90 strain preferentially accumulates 3- ⁇ -mycarosyl erythronolide B as well as Erythronolide B as expected from an eryC mutant.
  • sequence of residues 38-50 Val Thr Gly Ala Gly Asp Gly Asp Ala Asp Val Gin Ala (SEQ ID No 61) of the protein coded by eryCV (sequence of SEQ ID No 11) is close to the sequence NAD + binding consensus described by Wierenga et al., 1985 and by Scrutton et al., 1990.
  • EXAMPLE 30 Overexpression of the eryCIII gene product in E. coli.
  • the heterologous expression of the Sac eryCIII gene product. erythraea corresponding to 1ORF8 described in Example 1 and coding for the deosaminyltransferase activity identified in Example 7 was carried out using E. coli as the host strain. The protein thus produced in the form of inclusion bodies was then purified and its enzymatic activity determined in vitro. 1) Expression of the EryCIII protein in E. coli
  • Expression was achieved using the pET11a vector (Stratagene) for cloning and expression of recombinant proteins in E. coli under the control of the promoter of RNA polymerase of bacteriophage T7.
  • the eryCIII gene was amplified from the plasmid pK62 described in Example 1 in the manner next :
  • the PCR amplification was carried out using the Native Pfu polymerase (Stratagene) and as primers the oligonucleotide A homologous to the strand coding for the eryCIII gene having the sequence
  • a GAAGGAGATATACATATGCGCGTCGTCTTCTCCTC (SEQ ID N ° 57) making it possible to introduce an NdeI site upstream of the ATG initiating eryCIII and the oligonucleotide B homologous to the complementary strand of the eryCIII gene having the sequence B CGGGATCCTCATCGTGGTTCTCTCCTTCCTGC) to introduce a BamHI site downstream of the stop codon of the eryCIII gene.
  • the amplified DNA was then digested with the restriction enzymes Ndel and BamHI, then the 1.2 kb Ndel-BamHI fragment obtained containing the entire eryCIII gene was ligated into the expression vector pETlla (Stratagene) which contains the ampicillin resistance ⁇ -lactamase gene, the origin of ColEl replication and the promoter of the T7 RNA polymerase gene located upstream of the Ndel cloning site, previously digested with the restriction enzymes Ndel and BamHI. After ligation and transformation in E. coli XLl-blue, the plasmid pCEIII thus obtained was confirmed by restriction card and sequencing.
  • pETlla Stratagene
  • IPTG isopropyl- -D- thiogalactopyranoside
  • the overexpression of a protein having an apparent molecular weight of approximately 46 Kd corresponding to the expected PM for the EryCIII protein was observed compared to the total proteins of a control strain transformed by the plasmid pET11a.
  • the induction of the EryCIII protein was monitored by SDS-PAGE (polyacrylamide gradient: 10 to 20%) and with Comassie blue staining after lysis on an aliquot in the 1% SDS buffer, at 100 ° C. for 5 min, either directly on the broth harvested, or on the bacterial pellet after a first lysis by sonication in a phosphate buffer.
  • the pellet thus washed was then suspended in 2.5 volumes of a 7M urea solution in 50 mM tris buffer pH 7.5 (buffer A) so as to dissolve the EryCIII protein. After centrifugation under the same conditions, the collected supernatant obtained contains 2.1 g of total proteins determined by the Bradford method using 5 ⁇ a commercial kit (Pierce).
  • the extract in 7M urea was then loaded at the speed of 0.5 meters / h and at 4-8 ° C. on a 180 ml (5 cm ⁇ 9 cm) column of Q sepharose (Pharmacia) previously balanced. with buffer A above and with detection at 280 nm.
  • the EryCIII protein was then eluted with buffer A containing 0.3M NaCl.
  • the combined fractions, containing the EryCIII protein demonstrated by SDS-PAGE (polyacrylamide gradient: 10 to 20%) revealed by staining with Comassie blue and 835 mg of total proteins, were then loaded onto a column of 5, 5 liters (10 cm x 70 cm) of Superdex 200 Prep grade (Pharmacia) previously balanced with buffer A above.
  • FIG. 1 ⁇ shows the evolution of the purity of the EryCIII protein followed by SDS-PAGE (polyacrylamide gradient: 10 to 15%) for a deposit of 500 ng of total proteins and a revelation with silver nitrate successively after extraction with 7M urea (line 2), Q sepharose chromatography (line 3), chromatography
  • the EryCIII protein was then renatured by diluting the homogeneous eluate with a solution of buffer A containing 10 mM DTT to obtain a final protein concentration of 0.1 mg / ml.
  • the diluted solution was then dialyzed against 50 mM Tris buffer; 0.15 M NaCl; 0.3% n-octyl- ⁇ -D-glucopyranosyl (NOG); DTT 10 mM, pH ⁇ , 3 then concentrated to 4 mg / ml by ultrafiltration on a PLGC04310 membrane (Millipore) having a cutoff threshold of 10,000.
  • the purified EryCIII protein was then stored frozen at -20 ° C in 500 ⁇ l aliquots. 3) Characterization of the EryCIII protein
  • Electrophoresis by SDS-PAGE polyacrylamide gradient: 10 to 15%
  • Phast System device Phast System device
  • revelation with silver nitrate shows a purity greater than 99% for a deposit of 2000 ng.
  • N-terminal amino acid sequence The N-terminal sequence was determined by microsequencing on a Model A492 protein microsequencer coupled to an HPLC PTH-amino acid analyzer (Applied Biosystems). No secondary sequence was detected for the first 10 residues which is in agreement with the amino acid sequence described in FIG. 2 (sequence of SEQ ID No. 5).
  • the desosaminyl transferase activity of the EryCIII protein was determined in vitro by demonstrating the formation of erythromycin D from dTDP-D-desosamine, the preparation of which is described below and from 3- ⁇ -mycarosyl erythronolide B (SEM) whose preparation is described above in General Materials and Methods.
  • the reaction medium contains 150 nmol of dTDP-D-desosamine, 137.4 nmol of SEM and 1 mg of EryCIII protein using the following operating conditions:
  • the stoppered tube is placed for 5 h in a bath thermostatically controlled at 30 ° C., then the pH is adjusted to 9-10 with 32% NaOH and then the reaction mixture is extracted 3 times with 5 ml of acetate. ethyl.
  • the extract obtained, brought to dryness under reduced pressure, then taken up in 100 ⁇ l of methylene chloride is then analyzed by ccm under the conditions indicated in Example 4 using as eluent the methylene chloride / methanol mixture (90:10 , v / v).
  • the sequence of the Sac eryCIII gene. erythraea corresponding to the ORF ⁇ described in example 1 coding for the deosaminyltransferase activity was used to prepare a hybridization probe and made it possible to isolate homologous genes in the strain S. oleandomycin-producing ATCC 11691 antibioticus by Southern hybridization.
  • the entire eryCIII gene was amplified by PCR from 6 ng of the plasmid pK62 obtained in Example 1 by following the operating conditions described in Example 3 using the native polymerase pfu (Stratagene) and as primers.
  • oligonucleotide having the following sequence: eryCIII-1 CGGGTACCATGCGCGTCGTCTTCTCCTCCATG (SEQ ID No.
  • oligonucleotide eryCIII2 having the following sequence: eryCIII-2 CGGGTACCTCATCGTGGTTCTCTCCTTCC (SEQ ID No. 60) comprising a KpnI site in its 5 'region and whose part 3' corresponds to the region of DNA located from position 6954 to position 8974 of the sequence of Figure 2.
  • the approximately 1.2 kb band obtained by amplification was then digested with the restriction enzyme Kpnl and cloned into the plasmid pUC19 previously digested with the enzyme Kpnl.
  • the plasmid pCIIIPCRl thus obtained was then used to re-isolate the 1.2 kb Kpnl fragment corresponding to the entire eryCIII gene shown in FIG. 2.
  • the fragment thus isolated was then labeled with 32 P by the "random priming" technique "described by Sambrook et al., 1989 and used as an eryCIII probe to analyze by Southern hybridization cosmid clones obtained from a genomic DNA library of S. antibioticus ATCC 11691 and prepared as follows (FIG. 20):
  • a series of six cosmids (cosAB35, cosAB76, cosAB87, cosAB67, cosAB63 and cosAB61) overlapping and covering approximately 100 kb of the region corresponding to the olandomycin biosynthesis gene cluster was isolated using the method described by Swan et al., 1994 using as probes the 2 kb Smal fragment internal to the third subunit of the polyketide synthase of Sac. erythraea in the erythromycin biosynthesis gene cluster (Cortes et al., 1990) followed by a walk on the chromosome.
  • cosmid cosAB35 Swan et al., 1994
  • Subcloning and subsequent sequencing show that these two fragments are separated by a 0.6 kb BamHI fragment not detected by hybridization.
  • the clone pC035-S thus obtained was used to generate single-stranded templates by subcloning of different DNA fragments in the bacteriophages M13mpl ⁇ and MP13mpl9 (New England Biolabs), then the nucleotide sequence of these fragments was determined according to the method of Sanger et al. (1977) using a modified T7 polymerase (Sequenase version 2.0; US Biochemicals) in the presence of ⁇ [ 35 S] dCTP (Amersham) and 7-deaza-dGTP, according to the supplier's recommendations in order to limit compression problems of bands.
  • the conventional primers supplied with the Sequenase kit as well as the internal synthetic primers (17 mer) were used.
  • the assembly of the sequence data was carried out using the Fragment Assembly program (Genetic Computer Group, University of Wisconsin) and the identification of the open reading phases using the CODONPREFERENCE program (Devereux et al., 1984).
  • the nucleotide sequences obtained made it possible to establish the nucleotide sequence of 6093 bp represented in FIG. 22 (sequence of SEQ ID No. 15), comprised between the SphI and Kpnl sites shown in FIG.
  • the oleGl gene codes for a polypeptide having 426 amino acids (sequence of SEQ ID No. 17). However, the presence 0 of a CGC codon coding for an arginine very conserved in this class of glycosyltransferase in Streptomycetes located immediately upstream of the GTG codon, would indicate that the initiating codon could be the CTG codon at position 1431 of the sequence SEQ ID N ° 17.
  • the o! EG2 gene codes for a polypeptide having 426 amino acids (sequence of SEQ ID NO: 18).
  • a strain in which the oleG1 gene is interrupted was prepared by integration of a plasmid pC03 into the homologous regions of the chromosomal DNA of the strain of S. antibioticus ATCC 11891 producing oleandomycin.
  • the 0.6 kb BamHI fragment internal to the oleGl gene obtained by digestion of the pC035-S plamide prepared above, with the restriction enzyme BamHI (FIG. 21), was subcloned into the BamHI site of plasmid pOJ260 NRRL B-14785.
  • the plasmid pC03 thus generated was then transferred into the strain E. coli TG1 rec01504:: Tn5 (Kolodner et al., 1965), then used to transform the protoplasts of S. antibioticus.
  • the selection of transformants was carried out by resistance to apramycin (Apramycin for injection, Rhône Mérieux).
  • the protoplasts were prepared from the strain S. antibioticus ATCC ll ⁇ 91 following the conditions described by Hopwood et al., 1985.
  • the transformation was carried out using 50 ⁇ l of aliquot of protoplasts, 5 ⁇ g of plasmid DNA pC03 and replacing the thiostrepton with apramycin at the final concentration of 25 ⁇ g / ml.
  • the selection of integrants carried out by resistance to apramycin made it possible to isolate a clone called A35G1.
  • the expected alteration in the corresponding region of the chromosome of S. antibioticus was confirmed by genomic analysis by Southern blot.
  • the chromosomal DNA isolated and then digested with the restriction enzyme PstI from the strain S. antibioticus wild or from the mutant A35G1 was analyzed by Southern using, as hybridization probe, the 0.6 kb BamHI fragment indicated above. above.
  • the replacement of the 4.7 kb PstI fragment thus detected in the wild-type strain by two PstI fragments of 2.4 and 6.5 kb in the mutant A35G1 confirms the integration of the plasmid pC03 into the chromosome of the strain A35G1 at the level of the oleGl ORF.
  • the recombinant strain A35G1 thus obtained was then cultivated to identify the precursors produced by the strain.
  • the strain A35G1 was cultured for 72 h in 50 ml Erlenmeyer flask in EP2 medium from a 48 h preculture in PPE medium under the conditions described in Example 4.
  • the culture was diluted to 1/100 in medium containing 50% (w / v) of glycerol, then the cell suspension obtained was kept. at -20 ° C before use.
  • the biological test was then carried out by introducing 150 ⁇ l of the thawed cell suspension into 100 ml of TSB medium containing 1% agar and maintained at 55 ° C. The mixture was then poured into petri dishes. After cooling, oxford cylinders containing 50 to 200 ⁇ l of ethyl acetate extracts were placed on the agar dishes, kept for 2 h at 4 ° C., then incubated overnight at 37 ° C.
  • the ccm analysis shows that the strain A35G1 does not produce oleandomycin but preferentially accumulates a purple product having greater mobility than erythronolide B and close to 6-deoxyerythronolide B and which can be expected from the aglycone part 8.8a-deoxy-oleandolide.
  • c) Analysis by RP-HPLC chromatography coupled to Mass spectrometry was carried out according to the conditions described in Example 4. Two major metabolites, called M9 and MIO, were detected (elution at 6.12 min and 17.23 min respectively). The two products give a parent peak m / z 373 and similar fragmentation profiles which may be in agreement with the structure [8, 8a-deoxyoleandolide] H + . However, only the retention time of the metabolite MIO is in agreement with the proposed structure whereas the metabolite M9 could correspond to an isomer structure or to the open lactone nucleus.
  • a mixture containing 18.6 g of the product from stage B and 50 cm 3 of DMF is brought to 50 ° C. and 6.62 g of hydrazine acetate NH 2 NH 2 , ACOH are added.
  • the reaction mixture is stirred and poured onto a saturated solution of sodium hydrogen carbonate.
  • the aqueous phase is extracted with ethyl acetate.
  • the organic phases are combined, dried, filtered and concentrated. Distillation is carried out under reduced pressure to remove the DMF by azeotrophic entrainment with toluene.
  • 11.28 g of product are obtained which is chromatographed on silica eluting with an ethyl acetate-triethylamine mixture (90-10).
  • 6.5 g of sought product is obtained which is used as it is in the following stage.
  • STAGE D 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylo-hexopyra-nose, 2-acetate bis (phenylmethyl) phosphate 5.7 cm 3 of a solution are added at -70 ° C of n-butyl lithium in hexane in a solution containing 1.738 g of the product of the previous stage and 40 cm 3 of THF. 10 g of extemporaneously prepared dibenzylphosphochloride are added at -70-75 ° C. (J. Chem. Soc. 1958, p. 1957),
  • STAGE E 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylohexopyranose, l- (dihydrogen phosphate), N, N-diethylethanamine Is placed under stirring and under a stream of hydrogen for 30 minutes at at room temperature, a mixture containing 1.070 g of the product of the preceding stage, 20 cm 3 of ethyl acetate, 10 cm 3 of methanol, 0.622 cm 3 of triethylamine and 200 mg of palladium on carbon. It is filtered, washed with methanol and ethyl acetate and the filtrate is concentrated. 1 g of an oil is obtained to which 10 cm 3 of methanol are added.
  • STAGE G Thymidine 5'- (trihydrogen diphosphate), P '- [3, 4, 6- trideoxy-3- (dimethylamino) -D-xylo-hexopyranosy1] ester, N, N- diethylethanamine 228 mg of the product is mixed preparation 1, 6 cm J of pyridine and 544 mg of thymidine 5 '-monophosphate morpholi- date-4-morpholine-NN'-dicyclohexylcarboxamidine.
  • the pyridine is removed under reduced pressure on the rotor-vapor while maintaining the temperature at 30 ° C. or below. 6 cm 3 of pyridine are added, which is removed under reduced pressure. The operation is repeated 2 times.
  • Hopwood DA, Kieser T, Wright HM an Bibb MJ Journal of General Microbiology (1983), 129, 2257-2269.
  • SEQ ID NO: 15 / gene ⁇ "olePl” / function ⁇ "glycosylation of 8, 8a-desoxyoleandolide” / gene ⁇ "oleGl”
  • transl_except (pos: 1437 .. 1439, aa: Met) / function ⁇ "glycosylation of 8,8a-desoxyoleandolide” / gene ⁇ "oleG2" / gene ⁇ "oleY”

Landscapes

  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Saccharide Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention concerns the isolated DNA sequence represented in figure 2 (SEQ ID No. 1) corresponding to the eryG-eryAIII region of the cluster of the erythromycin biosynthesis genes and the isolated DNA sequence represented in figure 3 (SEQ ID No. 6) corresponding to the eryAI-eryK region of the cluster of the erythromycin biosynthesis genes. The invention also concerns the isolated DNA sequence represented in figure 22 (SEQ ID No. 15 sequence) corresponding to a region of the oleandomycin biosynthesis genes (SEQ ID No. 15 sequence).

Description

Gènes de biosvnthèse et de transfert des 6-désoxγhexoses chez Saccharopolγspora erythraea et chez Streptomγces antibioticus et leur utilisation.Genes for biosynthesis and transfer of 6-deoxγhexoses in Saccharopolγspora erythraea and in Streptomγces antibioticus and their use.
La présente invention décrit des gènes impliqués dans la biosynthèse et le transfert des 6-désoxyhexoses chez Saccharopolyspora erythraea et leur utilisation dans la production d'analogues de l' érythromycine par manipulation génétique. L' érythromycine A est un antibiotique macrolide cliniquement important produit par la bactérie gram-positive Sac . erythraea . Les gènes de la biosynthèse de l' érythromycine sont organisés en un cluster de gènes ery qui inclut aussi le gène d'auto-résistance à l' érythromycine ermE. Le cluster ery contient les trois grands gènes eryAI, eryAII et eryAIII (locus eryA) codant pour trois polypeptides composant la polykétide synthétase (dénommée PKS) flanqués par deux régions comprenant les gènes impliqués dans les stades ultérieurs de conversion du noyau lactone (6-désoxyérythronolide B) en érythromycine A.The present invention describes genes involved in the biosynthesis and transfer of 6-deoxyhexoses in Saccharopolyspora erythraea and their use in the production of erythromycin analogs by genetic manipulation. Erythromycin A is a clinically important macrolide antibiotic produced by the Gram-positive bacteria Sac. erythraea. The erythromycin biosynthesis genes are organized into an ery gene cluster which also includes the erythromycin self-resistance gene ermE. The ery cluster contains the three major genes eryAI, eryAII and eryAIII (locus eryA) encoding three polypeptides making up polyketide synthetase (called PKS) flanked by two regions comprising the genes involved in the later stages of conversion of the lactone nucleus (6-deoxyerythronolide B) in erythromycin A.
Pendant le processus de biosynthèse de l' érythromycine A représenté à la figure 1, la biosynthèse des 6-désoxyhexoses comprend l'ensemble des réactions enzymatiques conduisant du glucose-1-phosphate au sucre activé final dTDP-L-mycarose ou dTDP-D-désosamine. Le dTDP-L-mycarose ou la dTDP-D-désosamine ainsi produits sont ensuite utilisés comme substrats pour le transfert des deux désoxyhexoses sur le noyau lactone. La formation de l' érythromycine requiert l'attachement du myca- rose via l'hydroxyle en position C-3 du noyau lactone et l'attachement de la désosamine via l'hydroxyle en position C-5. L'ensemble des gènes eryB impliqués dans la biosynthèse ou le transfert du mycarose et l'ensemble des gènes eryC impliqués dans la biosynthèse ou le transfert de la désosamine n'ont pas encore été clairement identifiés. Le cluster ery d'une longueur de 56 kb comprend 21 phases ouvertes de lecture ou "open reading frames" (ORFs) dont la numérotation a été établie par Haydock et al. (1991) et Donadio et al. (1993) . Le locus eryA comprend les ORFs 10, 11 et 12.During the biosynthesis process of erythromycin A represented in FIG. 1, the biosynthesis of 6-deoxyhexoses includes all the enzymatic reactions leading from glucose-1-phosphate to the final activated sugar dTDP-L-mycarose or dTDP-D- desosamine. The dTDP-L-mycarose or the dTDP-D-desosamine thus produced are then used as substrates for the transfer of the two deoxyhexoses onto the lactone nucleus. The formation of erythromycin requires the attachment of the fungus via hydroxyl in position C-3 of the lactone nucleus and the attachment of desosamine via hydroxyl in position C-5. The set of eryB genes involved in the biosynthesis or transfer of mycarosis and the set of eryC genes involved in the biosynthesis or transfer of desosamine have not yet been clearly identified. The 56 kb ery cluster includes 21 open reading frames (ORFs), the numbering of which was established by Haydock et al. (1991) and Donadio et al. (1993). The eryA locus includes ORFs 10, 11 and 12.
Des travaux précoces d'interruption ou de remplacement de gène dans la partie gauche du cluster ery a permis une première identification du gène eryCI (ORF1) (Dhillon et al., 1989), puis du gène eryBI (ORF2) , du locus eryH (ORFs 3 , 4 et 5) dont l'inactivation conduit à la production de 6-désoxyérythronolide B, d'un locus eryBII (ORFs 7 et 8) et le gène eryCII (Weber et al., 1990).Early work on gene interruption or replacement on the left side of the ery cluster allowed a first identification of the eryCI gene (ORF1) (Dhillon et al., 1989), then of the eryBI gene (ORF2), of the eryH locus ( ORFs 3, 4 and 5) whose inactivation leads to the production of 6-deoxyerythronolide B, an eryBII locus (ORFs 7 and 8) and the eryCII gene (Weber et al., 1990).
Parmi les activités enzymatiques impliquées dans les modifications ultérieures du noyau lactone ont été identifiées le gène eryF (ORF4) responsable de l'hydroxyla- tion en C6 (Weber et al., 1991) et le gène eryK (ORF20) responsable de l'hydroxylation en C12 (Stassi et al., 1993). D'autre part, le gène eryG (ORF6) responsable de la O-méthylation du mycarose en cladinose (position 3"OH) a été identifié (Weber et al., 1989). L' érythromycine A est ainsi formée via l' érythromycine B ou l' érythromycine C à partir de 1' érythromycine D selon le schéma proposé (figure 1) .Among the enzymatic activities involved in subsequent modifications to the lactone nucleus, the eryF gene (ORF4) responsible for C6 hydroxylation has been identified (Weber et al., 1991) and the eryK gene (ORF20) responsible for hydroxylation. in C12 (Stassi et al., 1993). On the other hand, the eryG gene (ORF6) responsible for the O-methylation of mycarosis in cladinose (position 3 "OH) has been identified (Weber et al., 1989). Erythromycin A is thus formed via erythromycin B or erythromycin C from erythromycin D according to the proposed scheme (Figure 1).
La caractérisâtion fonctionnelle des gènes eryB et eryC situés sur la partie droite de cluster ery (ORFs 13 à 19) n'a pas encore été établie de façon précise, malgré les informations parcellaires communiquées dans différents articles de revues (Donadio et al., 1993 ; Liu et Thorson, 1994 ; Katz et Donadio, 1995) . En raison de l'intérêt commercial des antibiotiques macrolides, l'obtention de nouveaux dérivés, notamment l'obtention d'analogues de l' érythromycine ayant des propriétés avantageuses, est intensivement recherchée. Les modifications peuvent être désirées dans la partie aglycone (macrolactone) ou/et dans son hydroxylation secondaire ainsi que dans la partie sucre (cladinose et/ou désosamine) de 1 ' érythromycine.The functional characterization of the eryB and eryC genes located on the right side of the ery cluster (ORFs 13 to 19) has not yet been precisely established, despite the fragmented information communicated in various journal articles (Donadio et al., 1993 ; Liu and Thorson, 1994; Katz and Donadio, 1995). Due to the commercial interest of macrolide antibiotics, the obtaining of new derivatives, in particular the obtaining of erythromycin analogs having advantageous properties, is intensively sought. The modifications may be desired in the aglycone part (macrolactone) or / and in its secondary hydroxylation as well as in the sugar part (cladinose and / or desosamine) of erythromycin.
Les méthodes courantes telles que les modifications chimiques sont difficiles et limitées vis-à-vis du type de produit que l'on peut obtenir à partir de l' érythromycine. Par exemple, Sakakibara et al. (1984) passent en revue des modifications chimiques réalisées à partir de l' érythromycine A ou B, aussi bien dans la partie sucre que dans la macro- lactone .Current methods such as chemical modifications are difficult and limited vis-à-vis the type of product that can be obtained from erythromycin. For example, Sakakibara et al. (1984) review chemical modifications made from erythromycin A or B, both in the sugar part and in the macro- lactone.
Des modifications de la macrolactone de 1 ' érythromycine A par manipulation génétique du microorganisme Sac . erythraea ont été décrites dans la demande de brevet internationale WO 93/13663 ainsi que l'obtention de nouvelles molécules polykétides par altérations génétiques spécifiques du locus eryA du chromosome codant pour la PKS. Par exemple la 7-hydroxyérythromycine A, la 6-désoxy-7-hydroxyérythromycine A ou le 3-oxo-3-désoxy-5-désoaminyl-érythronolide A ont été ainsi obtenus.Changes in the macrolactone of erythromycin A by genetic manipulation of the microorganism Sac. erythraea have been described in international patent application WO 93/13663 as well as the obtaining of new polyketide molecules by specific genetic alterations of the eryA locus of the chromosome coding for PKS. For example, 7-hydroxyerythromycin A, 6-deoxy-7-hydroxyerythromycin A or 3-oxo-3-deoxy-5-deoaminyl-erythronolide A were thus obtained.
La présente invention concerne la caractérisation fonctionnelle de dix gènes de Sac . erythraea impliqués dans la biosynthèse ou l'attachement du mycarose et de la désosa- mine (eryBII, eryCIII et eryCII situés en aval du locus eryA et eryBIV, eryBV, eryCVI, eryBVI, eryCIV, eryCV et eryBVII situés en amont) , leur utilisation dans la production d'analogues de l' érythromycine ainsi qu'un procédé de préparation de ceux-ci.The present invention relates to the functional characterization of ten Sac genes. erythraea involved in the biosynthesis or attachment of mycarosis and desosamine (eryBII, eryCIII and eryCII located downstream of the locus eryA and eryBIV, eryBV, eryCVI, eryBVI, eryCIV, eryCV and eryBVII located upstream) in the production of erythromycin analogs and a process for their preparation.
La présente invention a donc pour objet une séquence d'ADN simple ou double brin isolée, représentée à la figure 2 (séquence directe et complémentaire de SEQ ID N° 1) correspondant à la région eryG-eryAIII du cluster de gènes de la biosynthèse de l' érythromycine et a particulièrement pour objet une séquence d'ADN ci-dessus comprenant : - la séquence eryBII correspondant à 1ORF7 (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046) et codant pour une dTDP-4-céto-L-6-désoxyhexose 2,3-réduc- tase,The present invention therefore relates to an isolated single or double-stranded DNA sequence, represented in FIG. 2 (direct and complementary sequence of SEQ ID No. 1) corresponding to the eryG-eryAIII region of the gene cluster for biosynthesis of erythromycin and particularly relates to a DNA sequence above comprising: the sequence eryBII corresponding to 1ORF7 (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046) and coding for a dTDP-4-keto -L-6-deoxyhexose 2,3-reductase,
- la séquence eryCIII correspondant à 1ORF8 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) et codant pour une désosaminyltransférase etthe sequence eryCIII corresponding to 1ORF8 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308) and coding for a deosaminyltransferase and
- la séquence eryCII correspondant à 1ORF9 (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) et codant pour une dTDP-4-céto-D-6-désoxyhexose 3 ,4-isomérase.the sequence eryCII corresponding to 1ORF9 (sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404) and coding for a dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase.
La séquence d'ADN ci-dessus montrée à la figure 2 est une séquence d'ADN génomique qui peut être obtenue par exemple par sous-clonage de fragments de restriction d'un fragment d'ADN génomique de Sac. erythraea , selon des conditions opératoires dont une description détaillée est donnée plus loin.The above DNA sequence shown in Figure 2 is a genomic DNA sequence which can be obtained for example by subcloning restriction fragments of a Sac genomic DNA fragment. erythraea, according to operating conditions, a detailed description of which is given below.
L'invention a plus particulièrement pour objet une séquence d'ADN isolée représentée à la figure 2 choisie parmi la séquence eryBII correspondant à 1ORF7 (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046) , la séquence eryCIII correspondant à 1ORF8 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) ou la séquence eryCII correspondant à 1ORF9 (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) et les séquences qui hybrident et/ou présentent des homologies significatives avec cette séquence ou des fragments de celle-ci et ayant la même fonction. L'invention a tout particulièrement pour objet la séquence d'ADN isolée eryCIII représentée à la figure 2 correspondant à 1ORF8 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308 = séquence complémentaire de SEQ ID N° 4) et codant pour une désosaminyl- transférase.The invention more particularly relates to an isolated DNA sequence represented in FIG. 2 chosen from the sequence eryBII corresponding to 1ORF7 (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046), the sequence eryCIII corresponding to 1ORF8 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308) or the sequence eryCII corresponding to 1ORF9 (sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404) and the sequences which hybridize and / or show homologies significant with this sequence or fragments thereof and having the same function. A particular subject of the invention is the isolated DNA sequence eryCIII represented in FIG. 2 corresponding to 1ORF8 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308 = sequence complementary to SEQ ID No. 4) and coding for a desosaminyl transferase.
La séquence eryBII correspondant à 1ORF7 code pour un polypeptide ayant 333 acides aminés (séquence de SEQ ID N° 2) , la séquence eryCIII correspondant à 1ORF8 code pour un polypeptide ayant 421 acides aminés (séquence de SEQ ID N° 5) et la séquence eryCII correspondant à 1ORF9 code pour un polypeptide ayant 361 acides aminés (séquence de SEQ ID N° 3) .The eryBII sequence corresponding to 1ORF7 codes for a polypeptide having 333 amino acids (sequence of SEQ ID No. 2), the eryCIII sequence corresponding to 1ORF8 codes for a polypeptide having 421 amino acids (sequence of SEQ ID No. 5) and the sequence eryCII corresponding to 1ORF9 codes for a polypeptide having 361 amino acids (sequence of SEQ ID No. 3).
La mise en évidence des activités enzymatiques respectives indiquées ci-dessus a été réalisée par introduction d'une délétion interne au gène correspondant telle qu'illustrée plus loin dans la partie expérimentale.The demonstration of the respective enzymatic activities indicated above was carried out by introduction of an internal deletion to the corresponding gene as illustrated below in the experimental part.
Par séquences qui hybrident et ayant la même fonction, on inclut les séquences d'ADN qui hybrident avec l'une des séquences d'ADN ci-dessus sous des conditions standards de stringence élevée ou moyenne décrites par Sambrook et al.By sequences which hybridize and having the same function, we include the DNA sequences which hybridize with one of the above DNA sequences under standard conditions of high or medium stringency described by Sambrook et al.
(1989) et qui codent pour une protéine ayant la même fonction enzymatique. Par même fonction enzymatique, on entend une activité enzymatique donnée sur des substrats de même nature, par exemple un dTDP-6-désoxyhexose ou une macrolactone nue ou glycosylée. Les conditions de forte stringence comprennent par exemple une hybridation à 65 °C pendant 18 heures dans une solution 5 x SSPE, 10 x Denhardt, 100 μg/ml DNAss, l % SDS suivie de 2 lavages pendant 20 minutes avec une solution(1989) and which code for a protein having the same enzymatic function. By the same enzymatic function is meant an enzymatic activity given on substrates of the same nature, for example a dTDP-6-deoxyhexose or a naked or glycosylated macrolactone. The high stringency conditions include for example hybridization at 65 ° C for 18 hours in a solution 5 x SSPE, 10 x Denhardt, 100 μg / ml DNAss, 1% SDS followed by 2 washes for 20 minutes with a solution
2 x SSC, 0,05 % SDS à 65°C suivis d'un dernier lavage pendant 45 minutes dans une solution 0,1 x SSC, 0,1 % SDS à 65°C. Les conditions de stringence moyenne comprennent par exemple un dernier lavage pendant 20 minutes dans une solution 0,2 x SSC, 0,1 % SDS à 65°C.2 x SSC, 0.05% SDS at 65 ° C followed by a last wash for 45 minutes in a solution 0.1 x SSC, 0.1% SDS at 65 ° C. The conditions of medium stringency include, for example, a final wash for 20 minutes in a 0.2 x SSC, 0.1% SDS solution at 65 ° C.
Par séquences qui présentent des homologies significatives et ayant la même fonction, on inclut les séquences ayant une identité de séquence nucléotidique d'au moins 60 % avec l'une des séquences ADN ci-dessus et qui codent pour une protéine ayant la même fonction enzymatique.By sequences which have significant homologies and having the same function, we include the sequences having a nucleotide sequence identity of at least 60% with one of the DNA sequences above and which code for a protein having the same enzymatic function .
L'invention a aussi pour objet un polypeptide codé par l'une des séquences d'ADN ci-dessus et a spécialement pour objet un polypeptide correspondant à une ORF représentée à la figure 2, choisie parmi 1ORF7 (ayant la séquence de SEQ ID N° 2), 1ORF8 (ayant la séquence de SEQ ID N° 5) ou 1ORF9 (ayant la séquence de SEQ ID N° 3) et les analogues de ce polypeptide.The invention also relates to a polypeptide encoded by one of the DNA sequences above and especially to a polypeptide corresponding to an ORF represented in FIG. 2, chosen from 1ORF7 (having the sequence of SEQ ID N ° 2), 1ORF8 (having the sequence of SEQ ID No. 5) or 1ORF9 (having the sequence of SEQ ID No. 3) and analogs of this polypeptide.
Par analogues, on inclut les peptides ayant une séquence en acides aminés modifiée par substitution, délétion ou addition d'un ou plusieurs acides aminés pour autant que ces produits conservent la même fonction enzymatique. Les séquences modifiées peuvent être par exemple préparées en utilisant la technique de mutagénèse dirigée connue de l'homme du métier. L'invention a plus spécialement pour objet le polypeptide correspondant à l'ORF 8 représentée à la figure 2 (ayant la séquence de SEQ ID N° 5) et ayant une activité désosaminyltransférase, dénommé EryCIII.By analogues, we include peptides having an amino acid sequence modified by substitution, deletion or addition of one or more amino acids provided that these products retain the same enzymatic function. The modified sequences can for example be prepared using the site-directed mutagenesis technique known to those skilled in the art. A more specific subject of the invention is the polypeptide corresponding to ORF 8 represented in FIG. 2 (having the sequence of SEQ ID No. 5) and having a deosaminyltransferase activity, called EryCIII.
L'invention décrit une protéine recombinante EryCIII de Sac . erythraea obtenue par expression dans une cellule hôte selon les méthodes connues de génie génétique et de culture cellulaire.The invention describes a recombinant Sac EryCIII protein. erythraea obtained by expression in a host cell according to known methods of genetic engineering and cell culture.
L'obtention de la protéine recombinante purifiée a permis de confirmer la caractérisation de la fonction glycosyltranférase associée au produit du gène eryCIII dans un test in vitro qui met en évidence le transfert du sucre activé dTDP-D-désosamine sur le noyau lactone. L'invention a aussi pour objet la thymidine 5' -(tri- hydrogène diphosphate) ,P'-[3 ,4, 6-tridésoxy-3- (diméthylamino) - D-.xylo.-hexopyranosyl] ester (dTDP-D-désosamine) et les sels d'addition avec les bases, dont un exemple de préparation est décrit plus loin dans la partie expérimentale. L'invention a aussi pour objet une séquence d'ADN isolée représentée à la figure 3 (séquence de SEQ ID N° 6) correspondant à la région eryAI-eryK du cluster de gènes de la biosynthèse de l' érythromycine et a particulièrement pour objet une séquence d'ADN ci-dessus comprenant : - la séquence eryBIV correspondant à 1ORF13 (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) et codant pour une dTDP-4-céto-L-6-désoxyhexose 4-réductase,Obtaining the purified recombinant protein a allowed to confirm the characterization of the glycosyltranferase function associated with the eryCIII gene product in an in vitro test which demonstrates the transfer of activated sugar dTDP-D-desosamine to the lactone nucleus. A subject of the invention is also the thymidine 5 '- (tri-hydrogen diphosphate), P' - [3, 4, 6-tridesoxy-3- (dimethylamino) - D-.xylo.-hexopyranosyl] ester (dTDP-D -desosamine) and the addition salts with bases, an example of preparation of which is described later in the experimental part. The subject of the invention is also an isolated DNA sequence represented in FIG. 3 (sequence of SEQ ID No. 6) corresponding to the eryAI-eryK region of the gene cluster for the biosynthesis of erythromycin and particularly relates to a DNA sequence above comprising: - the eryBIV sequence corresponding to 1ORF13 (sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207) and coding for a dTDP-4-keto-L-6-deoxyhexose 4-reductase ,
- la séquence eryBV correspondant à 1ORF14 (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) et codant pour une mycarosyltransférase,the sequence eryBV corresponding to 1ORF14 (sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454) and coding for a mycarosyltransferase,
- la séquence eryCVI correspondant à 1ORF15 (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) et codant pour une dTDP-D-6-désoxyhexose 3-N-méthyltransférase,the sequence eryCVI corresponding to 1ORF15 (sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220) and coding for a dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- la séquence eryBVI correspondant à 1ORF16 (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) et codant pour une dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase,the sequence eryBVI corresponding to 1ORF16 (sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837) and coding for a dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase,
- la séquence eryCIV correspondant à 1ORF17 (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) et codant pour une dTDP-D-6-désoxyhexose 3 , 4-déshydratase, - la séquence eryCV correspondant à 1ORF18 (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) et codant pour une dTDP-D-4 , 6-didésoxyhexose 3 , 4-réductase et- the eryCIV sequence corresponding to 1ORF17 (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039) and coding for a dTDP-D-6-deoxyhexose 3, 4-dehydratase, - the eryCV sequence corresponding to 1ORF18 (sequence of SEQ ID No. 6 from nucleotide 6080 to nucleotide 7546) and coding for a dTDP-D-4, 6-dideoxyhexose 3, 4-reductase and
- la séquence eryBVII correspondant à 1ORF19 (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) et codant pour une dTDP-4-céto-D-6-désoxyhexose 3,5 êpimérase.the sequence eryBVII corresponding to 1ORF19 (sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156) and coding for a dTDP-4-keto-D-6-deoxyhexose 3.5 epimerase.
La séquence d'ADN ci-dessus montrée à la figure 3 est une séquence d'ADN génomique qui peut être obtenue, par exemple, par sous-clonage de fragments de restriction de cosmides contenant une banque d'ADN génomique de Sac . erythraea , selon des conditions opératoires dont une description détaillée est donnée plus loin.The above DNA sequence shown in Figure 3 is a genomic DNA sequence which can be obtained, for example, by subcloning restriction fragments of cosmids containing a Sac genomic DNA library. erythraea, according to operating conditions, a detailed description of which is given below.
L'invention a plus particulièrement pour objet une séquence d'ADN isolée représentée à la figure 3 choisie parmi la séquence eryBIV correspondant à 1ORF13 (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) , la séquence eryBV correspondant à 1ORF14 (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) , la séquence eryCVI correspondant à 1ORF15 (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) , la séquence eryBVI correspondant à 1ORF16 (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) , la séquence eryCIV correspondant à 1ORF17 (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) , la séquence eryCV correspondant à 1ORF18 (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) ou la séquence eryBVII correspondant à 1ORF19 (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) et les séquences qui hybrident et/ou présentent des homologies significatives avec cette séquence ou des fragments de celle-ci et ayant la même fonction.The subject of the invention is more particularly an isolated DNA sequence represented in FIG. 3 chosen from the sequence eryBIV corresponding to 1ORF13 (sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207), the sequence eryBV corresponding to 1ORF14 ( sequence of SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), the sequence eryCVI corresponding to 1ORF15 (sequence of SEQ ID No 6 from nucleotide 2510 to nucleotide 3220), the sequence eryBVI corresponding to 1ORF16 (sequence of SEQ ID No 6 from nucleotide 3308 to nucleotide 4837), the eryCIV sequence corresponding to 1ORF17 (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039), the eryCV sequence corresponding to 1ORF18 (sequence of SEQ ID No. 6 from nucleotide 6080 to nucleotide 7546) or the sequence eryBVII corresponding to 1ORF19 (sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156) and the sequences which hybridize and / or show significant homologies with this sequence or fragments thereof and having the same function.
L'invention a tout particulièrement pour objet la séquence d'ADN isolée eryBV représentée à la figure 3 correspondant à 1ORF14 (séquence de SEQ ID N° 6 du nucléo- tide 1210 au nucleotide 2454) et codant pour une mycarosyl- transférase.The subject of the invention is very particularly the isolated DNA sequence eryBV represented in FIG. 3 corresponding to 1ORF14 (sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454) and coding for a mycarosyltransferase.
La séquence eryBIV correspondant à 1ORF13 code pour un polypeptide ayant 322 acides aminés (SEQ ID N° 7) , la séquence eryBV correspondant à 1ORF14 code pour un polypep- tide ayant 415 acides aminés (SEQ ID N° 8) , la séquence eryCVI correspondant à 1ORF15 code pour un polypeptide ayant 237 acides aminés (SEQ ID N° 9) , la séquence eryBVI correspondant à 1ORF16 code pour un polypeptide ayant 510 acides aminés (SEQ ID N° 10) , la séquence eryCIV correspondant à 1ORF17 code pour un polypeptide ayant 401 acides aminés (SEQ ID N° 14) , la séquence eryCV correspondant à 1ORF18 code pour un polypeptide ayant 489 acides aminés (SEQ ID N° 11) et la séquence eryBVII correspondant à 1ORF19 code pour un polypeptide ayant 193 acides aminés (SEQ ID N" 12) .The eryBIV sequence corresponding to 1ORF13 codes for a polypeptide having 322 amino acids (SEQ ID No. 7), the eryBV sequence corresponding to 1ORF14 codes for a polypeptide having 415 amino acids (SEQ ID No. 8), the corresponding eryCVI sequence to 1ORF15 code for a polypeptide having 237 amino acids (SEQ ID No. 9), the sequence eryBVI corresponding to 1ORF16 code for a polypeptide having 510 amino acids (SEQ ID No. 10), the sequence eryCIV corresponding to 1ORF17 code for a polypeptide having 401 amino acids (SEQ ID No. 14), the eryCV sequence corresponding to 1ORF18 codes for a polypeptide having 489 amino acids (SEQ ID No. 11) and the eryBVII sequence corresponding to 1ORF19 codes for a polypeptide having 193 amino acids (SEQ ID N "12).
La mise en évidence des activités enzymatiques respectives indiquées ci-dessus a été réalisée par introduction d'une délétion interne au gène correspondant telle qu'illustrée plus loin dans la partie expérimentale. Les séquences d'ADN qui hybrident ainsi que les séquences d'ADN qui présentent des homologies significatives et ayant la même fonction ont la même signification que celle indiquée précédemment. L'invention a aussi pour objet un polypeptide codé par l'une des séquences d'ADN ci-dessus et a spécialement pour objet un polypeptide correspondant à une ORF représentée à la figure 3, choisie parmi 1ORF13 (ayant la séquence de SEQ ID N° 7), 1ORF14 (ayant la séquence de SEQ ID N° 8), 1ORF15 (ayant la séquence de SEQ ID N° 9) , 1ORF16 (ayant la séquence de SEQ ID N° 10) , 1ORF17 (ayant la séquence de SEQ ID N° 14), 1ORF18 (ayant la séquence de SEQ ID N° 11) ou 1ORF19 (ayant la séquence de SEQ ID N° 12) et les analogues de ce peptide. Les analogues du polypeptide ont la même signification que celle indiquée précédemment.The demonstration of the respective enzymatic activities indicated above was carried out by introduction of an internal deletion to the corresponding gene as illustrated below in the experimental part. The DNA sequences which hybridize as well as the DNA sequences which exhibit significant homologies and having the same function have the same meaning as that indicated above. The invention also relates to a polypeptide encoded by one of the DNA sequences above and especially to a polypeptide corresponding to an ORF represented in FIG. 3, chosen from 1ORF13 (having the sequence of SEQ ID N ° 7), 1ORF14 (having the sequence of SEQ ID No.8), 1ORF15 (having the sequence of SEQ ID No.9), 1ORF16 (having the sequence of SEQ ID No.10), 1ORF17 (having the sequence of SEQ ID No. 14), 1ORF18 (having the sequence of SEQ ID No. 11) or 1ORF19 (having the sequence of SEQ ID No. 12) and analogs of this peptide. The analogs of the polypeptide have the same meaning as that indicated above.
L'invention a plus spécialement pour objet le polypeptide correspondant à 1ORF14 représentée à la figure 3 (ayant la séquence de SEQ ID N° 8) et ayant une activité mycarosyltransférase, dénommé EryBV.A more specific subject of the invention is the polypeptide corresponding to 1ORF14 represented in FIG. 3 (having the sequence of SEQ ID No. 8) and having a mycarosyltransferase activity, called EryBV.
La connaissance de chaque séquence d'ADN eryB ou eryC de l'invention indiquée ci-dessus et montrée à la figure 2 ou à la figure 3 permet de reproduire la présente invention par exemple par des méthodes connues de synthèse chimique ou par criblage d'une banque génomique à l'aide de sondes d'oligonucléotides de synthèse par les techniques connues d'hybridation ou par amplification par PCR.Knowledge of each eryB or eryC DNA sequence of the invention indicated above and shown in FIG. 2 or in FIG. 3 makes it possible to reproduce the present invention for example by known methods of chemical synthesis or by screening for a genomic library using probes of synthetic oligonucleotides by known techniques of hybridization or by PCR amplification.
Les polypeptides de l'invention peuvent être obtenus par les méthodes connues, par exemple par synthèse chimique ou par la méthodologie de l'ADN recombinant par expression dans une cellule hôte procaryote ou eucaryote.The polypeptides of the invention can be obtained by known methods, for example by chemical synthesis or by the methodology of recombinant DNA by expression in a prokaryotic or eukaryotic host cell.
Un autre objet de l'invention concerne l'utilisation d'au moins l'une des séquences d'ADN choisie parmi les séquences eryBII (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046) , eryCIII (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) ou eryCII (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) représentées à la figure 2, eryBIV (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) , eryBV (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) , eryCVI (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) , eryBVI (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) , eryCIV (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) , eryCV (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) ou eryBVII (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) représentées à la figure 3, pour synthétiser des métabolites secondaires hybrides chez Sac . erythraea .Another subject of the invention relates to the use of at least one of the DNA sequences chosen from sequences eryBII (sequence complementary to SEQ ID N ° 1 from nucleotide 48 to nucleotide 1046), eryCIII (sequence complementary to SEQ ID N ° 1 from nucleotide 1046 to nucleotide 2308) or eryCII (sequence complementary to SEQ ID N ° 1 to nucleotide 2322 at nucleotide 3404) shown in FIG. 2, eryBIV (sequence of SEQ ID No 6 from nucleotide 242 to nucleotide 1207), eryBV (sequence of SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), eryCVI (sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220), eryBVI (sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837), eryCIV (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039), eryCV (sequence of SEQ ID No. 6 from nucleotide 6080 to nucleotide 7546) or eryBVII (sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156) shown in FIG. 3, for synthesizing hybrid secondary metabolites in Sac. erythraea.
Par métabolites secondaires hybrides, on entend soit des analogues de l' érythromycine, c'est-à-dire des dérivés de l'érythromycine ayant une ou plusieurs modifications portant sur la partie sucre et possédant une activité antibiotique, soit des précurseurs de l' érythromycine tels que le 6- désoxyérythronolide B ou l'érythronolide B auxquels sont attachés un ou plusieurs résidus sucre modifiés ou non et ne possédant pas d'activité antibiotique. Le résidu sucre modifié peut être par exemple, le 4-céto-L-mycarose.By hybrid secondary metabolites is meant either erythromycin analogs, that is to say erythromycin derivatives having one or more modifications relating to the sugar part and having antibiotic activity, or precursors of erythromycin such as 6-deoxyerythronolide B or erythronolide B to which are attached one or more modified or unmodified sugar residues and not having antibiotic activity. The modified sugar residue can be, for example, 4-keto-L-mycarose.
La synthèse de métabolites secondaires hybrides chez Sac . erythraea par utilisation de séquences d'ADN eryB ou eryC de l'invention peut être réalisée par exemple, par l'inactivation d'un ou plusieurs gènes eryB ou eryC ci-dessus et l'introduction d'un ou plusieurs gènes exogènes ou de leurs dérivés obtenus par exemple par mutagénèse, ayant des séquences nucléotidiques codant pour des enzymes ayant la même fonction chez des souches productrices d'autres acrolides, par exemple la tylosine, la picromycine ou la méthymycine. En particulier, l'introduction de gènes exogènes peut être effectuée par intégration d'une séquence d'ADN obtenue selon la méthodologie du "DNA shuffling" (Stemmer, 1994) ou par la construction d'une séquence d'ADN chimère, par exemple à partir d'une séquence eryB ou eryC de l'invention intervenant dans le transfert d'un résidu sucre, par exemple la séquence eryCIII ou eryBV, et de gènes homologues isolés à partir de souches productrices de macrolides, par exemple Streptomyces fradiae, Streptomyces olivaceus, Streptomyces venezuelae ou Streptomyces antibioticus .The synthesis of hybrid secondary metabolites in Sac. erythraea by using DNA sequences eryB or eryC of the invention can be carried out for example, by the inactivation of one or more genes eryB or eryC above and the introduction of one or more exogenous genes or their derivatives obtained for example by mutagenesis, having nucleotide sequences coding for enzymes having the same function in strains producing other acrolides, for example tylosin, picromycin or methymycin. In particular, the introduction of exogenous genes can be carried out by integration of a DNA sequence obtained according to the methodology of "DNA shuffling" (Stemmer, 1994) or by the construction of a chimeric DNA sequence, by example from an eryB or eryC sequence of the invention involved in the transfer of a sugar residue, for example the eryCIII or eryBV sequence, and of homologous genes isolated from macrolide producing strains, for example Streptomyces fradiae, Streptomyces olivaceus, Streptomyces venezuelae or Streptomyces antibioticus.
L'invention concerne aussi l'utilisation d'au moins l'une des séquences d'ADN choisie parmi les séquences eryBII (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046) , eryCIII (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) ou eryCII (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) représentées à la figure 2, eryBIV (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) , eryBV (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) , eryCVI (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) , eryBVI (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) , eryCIV (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) , eryCV (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) ou eryBVII (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) représentée à la figure 3 ou d'un fragment de cette séquence, comme sondes d'hybridation.The invention also relates to the use of at least one of the DNA sequences chosen from the sequences eryBII (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046), eryCIII (sequence complementary to SEQ ID N ° 1 from nucleotide 1046 to nucleotide 2308) or eryCII (sequence complementary to SEQ ID No 1 from nucleotide 2322 to nucleotide 3404) shown in FIG. 2, eryBIV (sequence from SEQ ID No 6 from nucleotide 242 to nucleotide 1207), eryBV (sequence of SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), eryCVI (sequence of SEQ ID No 6 of nucleotide 2510 to nucleotide 3220), eryBVI (sequence of SEQ ID No 6 of nucleotide 3308 to nucleotide 4837) , eryCIV (sequence of SEQ ID No 6 from nucleotide 4837 to nucleotide 6039), eryCV (sequence of SEQ ID No 6 from nucleotide 6080 to nucleotide 7546) or eryBVII (sequence of SEQ ID No 6 from nucleotide 7578 to nucleotide 8156 ) shown in Figure 3 or a fragment of this sequence, co same hybridization probes.
Les séquences d'ADN eryB ou eryC de l'invention peuvent être utilisées pour constituer des sondes d'hybridation d'au moins 19 nucléotides, permettant d'isoler des gènes homologues dans des souches productrices de macrolides en utilisant les méthodes classiques d'hybridation d'acides nucléiques immobilisées sur des filtres ou d'amplification par PCR, selon les conditions décrites par Sambrook et al. (1989) .The eryB or eryC DNA sequences of the invention can be used to constitute hybridization probes of at least 19 nucleotides, making it possible to isolate homologous genes in macrolide producing strains using the conventional hybridization methods of nucleic acids immobilized on filters or of amplification by PCR, according to the conditions described by Sambrook et al. (1989).
L'invention concerne particulièrement l'utilisation de la séquence d'ADN eryCIII représentée à la figure 2 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucléo- tide 2308 = séquence complémentaire de SEQ ID N° 4) comme sonde d'hybridation pour isoler des gènes homologues responsables de la glycosylation de la macrolactone chez une souche productrice de macrolide. L'invention concerne plus particulièrement l'utilisation ci-dessus, dans laquelle les gènes homologues sont les gènes de la biosynthèse de l'oléandomycine chez S . antibioticus .The invention relates in particular to the use of the DNA sequence eryCIII represented in FIG. 2 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308 = sequence complementary to SEQ ID No. 4) as probe d hybridization to isolate homologous genes responsible for the glycosylation of macrolactone in a macrolide producing strain. The invention relates more particularly to the above use, in which the homologous genes are the genes for the biosynthesis of oleandomycin in S. antibioticus.
L'invention décrit, à titre d'exemple, l'utilisation de la séquence du gène eryCIII comme sonde d'hybridation pour isoler des gènes homologues dans une souche productrice d'oléandomycine. La sonde eryCIII utilisée a permis d'isoler les gènes oleGl et oleG2 codant pour des glycosyltransferases chez S . antibioticus impliquées dans le transfert de la désosamine et de l'oléandrose sur le noyau lactone.The invention describes, by way of example, the use of the sequence of the eryCIII gene as a hybridization probe for isolating homologous genes in a strain producing oleandomycin. The eryCIII probe used made it possible to isolate the oleGl and oleG2 genes coding for glycosyltransferases in S. antibioticus involved in the transfer of desosamine and oleandrosis to the lactone nucleus.
La caractérisation fonctionnelle des gènes oleGl et oleG2 a permis de définir l'organisation de la partie droite du cluster des gènes de la biosynthèse de l'oléandomycine chez S . antibioticus . L'invention a donc pour objet une séquence d'ADN isolée représentée à la figure 22 (séquence de SEQ ID N° 15) correspondant à une région du cluster de gènes de la biosynthèse de l'oléandomycine comprenant :The functional characterization of the oleGl and oleG2 genes made it possible to define the organization of the right part of the cluster of genes for the biosynthesis of oleandomycin in S. antibioticus. The subject of the invention is therefore an isolated DNA sequence represented in FIG. 22 (sequence of SEQ ID No. 15) corresponding to a region of the gene cluster for the biosynthesis of oleandomycin comprising:
- la séquence correspondant à l'ORF olePl du nucleotide 184 au nucleotide 1386,the sequence corresponding to the oleP1 ORF from nucleotide 184 to nucleotide 1386,
- la séquence correspondant à l'ORF oleGl du nucleotide 1437 au nucleotide 2714 codant pour une activité glycosyltrans- férase,the sequence corresponding to the ORF oleGl from nucleotide 1437 to nucleotide 2714 coding for a glycosyltransferase activity,
- la séquence correspondant à l'ORF oleG2 du nucleotide 2722 au nucleotide 3999 codant pour une activité glycosyltrans- férase,the sequence corresponding to the oleG2 ORF from nucleotide 2722 to nucleotide 3999 encoding a glycosyltransferase activity,
- la séquence correspondant à l'ORF oleM du nucleotide 3992 au nucleotide 4720 (= séquence de SEQ ID N° 20) etthe sequence corresponding to the oleM ORF from nucleotide 3992 to nucleotide 4720 (= sequence of SEQ ID No. 20) and
- la séquence correspondant à l'ORF oleY du nucleotide 4810 au nucleotide 5967.the sequence corresponding to the oleY ORF from nucleotide 4810 to nucleotide 5967.
La séquence d'ADN ci-dessus montrée à la figure 22 (séquence de SEQ ID N° 15) est une séquence d'ADN génomique qui peut être obtenue par exemple à partir d'un cosmide couvrant la partie droite du cluster de gènes de la biosyn- thèse de l'oléandomycine par hybridation avec une sonde eryCIII, selon les conditions opératoires dont une description détaillée est donnée plus loin.The DNA sequence above shown in FIG. 22 (sequence of SEQ ID No. 15) is a genomic DNA sequence which can be obtained, for example, from a cosmid covering the right part of the gene cluster. the biosynthesis of oleandomycin by hybridization with an eryCIII probe, according to the operating conditions, a detailed description of which is given below.
L'invention a plus particulièrement pour objet une séquence d'ADN isolée représentée à la figure 22 choisie parmi la séquence correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714 codant pour une activité glycosyltransférase et la séquence correspondant à l'ORF oleG2 (séquence de SEQ ID N° 15 du nucleotide 2722 au nucleotide 3999) codant pour une activité glycosyltransférase.The subject of the invention is more particularly a isolated DNA sequence represented in FIG. 22 chosen from the sequence corresponding to the ORF oleG1 (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714 coding for glycosyltransferase activity and the sequence corresponding to the ORF oleG2 (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) coding for glycosyltransferase activity.
L'invention a tout particulièrement pour objet une séquence d'ADN isolée ci-dessus correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714) codant pour une activité désosaminyltransférase, ainsi qu'une séquence d'ADN isolée ci-dessus correspondant à l'ORF o!eG2 (séquence de SEQ ID N° 15 du nucleotide 2722 au nucleotide 3999) codant pour une activité oléandrosyl- transférase.A very particular subject of the invention is a DNA sequence isolated above corresponding to the ORF oleG1 (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) coding for a deosaminyltransferase activity, as well as a sequence of DNA isolated above corresponding to ORF o! EG2 (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) coding for an oleandrosyl transferase activity.
La séquence correspondant à l'ORF oleGl code pour un polypeptide ayant 426 acides aminés (séquence de SEQ ID N° 17) et la séquence correspondant à l'ORF oleG2 code pour un polypeptide ayant 426 acides aminés (séquence de SEQ ID N° 18) .The sequence corresponding to the ORF oleG1 codes for a polypeptide having 426 amino acids (sequence of SEQ ID No. 17) and the sequence corresponding to the ORF oleG2 codes for a polypeptide having 426 amino acids (sequence of SEQ ID No. 18 ).
La mise en évidence des activités enzymatiques respectives indiquées ci-dessus a été réalisée par altération du gène correspondant telle qu'illustrée plus loin dans la partie expérimentale. L'invention a aussi pour objet le polypeptide codé par la séquence d'ADN correspondant à l'ORF oleGl et ayant une activité désosaminyltransférase (séquence de SEQ ID N° 17) et le polypeptide codé par la séquence d'ADN correspondant à l'ORF o!eG2 et ayant une activité oléandrosyltransférase (séquence de SEQ ID N° 18) .The demonstration of the respective enzymatic activities indicated above was carried out by alteration of the corresponding gene as illustrated later in the experimental part. The subject of the invention is also the polypeptide coded by the DNA sequence corresponding to the oleG1 ORF and having a deosaminyltransferase activity (sequence of SEQ ID No. 17) and the polypeptide coded by the DNA sequence corresponding to the ORF o! EG2 and having oleandrosyltransferase activity (sequence of SEQ ID No. 18).
Les polypeptides ci-dessus dénommés respectivement OleGl et 0leG2 peuvent être obtenus par les méthodes connues indiquées ci-dessus.The above polypeptides called respectively OleGl and OleG2 can be obtained by the known methods indicated above.
L'invention a aussi pour objet un procédé de préparation de métabolites secondaires hybrides chez Sac . erythraea dans lequel :The invention also relates to a process for the preparation of hybrid secondary metabolites in Sac. erythraea in which:
- on isole une séquence ADN contenant au moins une séquence eryB ou une séquence eryC du cluster de gènes de la bio- synthèse de l' érythromycine représentée à la figure 2 (séquence complémentaire de SEQ ID N° 1) ou à la figure 3 (séquence de SEQ ID N°6) ,- a DNA sequence is isolated containing at least one eryB sequence or an eryC sequence from the bio- gene cluster synthesis of erythromycin shown in FIG. 2 (sequence complementary to SEQ ID No. 1) or in FIG. 3 (sequence of SEQ ID No. 6),
- on crée une modification dans la dite séquence et on obtient une séquence altérée,- we create a modification in the said sequence and we obtain an altered sequence,
- on intègre la séquence altérée dans le chromosome de la souche hôte et on obtient une souche modifiée,- the altered sequence is integrated into the chromosome of the host strain and a modified strain is obtained,
- on cultive la souche modifiée dans des conditions permettant la formation du métabolite secondaire hybride et - on isole le métabolite secondaire hybride.- the modified strain is cultivated under conditions allowing the formation of the hybrid secondary metabolite and - the hybrid secondary metabolite is isolated.
La modification de la séquence d'ADN peut être réalisée par exemple par une addition et/ou par une délétion de séquences d'ADN d'au moins un nucleotide, dans une séquence eryB ou eryC de l'invention qui code pour l'une des enzymes correspondantes indiquées ci-dessus.The modification of the DNA sequence can be carried out for example by an addition and / or by deletion of DNA sequences of at least one nucleotide, in an eryB or eryC sequence of the invention which codes for one corresponding enzymes indicated above.
L'intégration de la séquence altérée dans la souche hôte peut être réalisée par exemple par la méthodologie de la recombinaison homologue qui peut être effectuée selon le schéma montré à la figure 4 et conduit à la génération de mutants chromosomiques de souches Sac . erythraea que l'on cultive ensuite selon les méthodes générales connues de culture cellulaire.The integration of the altered sequence into the host strain can be carried out for example by the methodology of homologous recombination which can be carried out according to the scheme shown in FIG. 4 and leads to the generation of chromosomal mutants of Sac strains. erythraea which is then cultivated according to the general known methods of cell culture.
L'invention a particulièrement pour objet le procédé ci- dessus dans lequel la séquence ADN code pour l'une des enzymes choisie parmi uneThe invention particularly relates to the above method in which the DNA sequence codes for one of the enzymes chosen from a
- dTDP-4-céto-D-6-désoxyhexose 2 , 3-réductase,- dTDP-4-keto-D-6-deoxyhexose 2, 3-reductase,
- désosaminyltransférase,- desosaminyltransferase,
- dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase,- dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase,
- dTDP-4-céto-L-6-désoxyhexose 4-réductase, - mycarosyltransférase,- dTDP-4-keto-L-6-deoxyhexose 4-reductase, - mycarosyltransferase,
- dTDP-D-6-désoxyhexose 3-N-méthyltransférase,- dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase,
- dTDP-D-6-désoxyhexose 3 , 4-déshydratase,- dTDP-D-6-deoxyhexose 3, 4-dehydratase,
- dTDP-D-4 , 6-didésoxyhexose 3 , 4-réductase ou - dTDP-4-céto-D-6-désoxyhexose 3,5 épimérase.- dTDP-D-4, 6-dideoxyhexose 3, 4-reductase or - dTDP-4-keto-D-6-deoxyhexose 3,5 epimerase.
L'invention a plus particulièrement pour objet le procédé ci-dessus dans lequel l'altération de la séquence résulte dans l'inactivation d'au moins l'une des enzymes indiquées ci-dessus.The invention more particularly relates to the above method in which the alteration of the sequence results in the inactivation of at least one of the enzymes indicated above.
L'inactivation d'au moins l'une des enzymes est mise en évidence, d'une part par l'absence de production d' érythromycine, d'autre part par l'accumulation de précur- seurs de l' érythromycine tels que le 6-désoxyérythronolide B, l'érythronolide B ou le 3-α-mycarosyl érythronolide B et/ou l'accumulation de métabolites secondaires hybrides tels que définis précédemment dans les surnageants de cultures des souches modifiées correspondantes. L'invention concerne tout particulièrement le procédé ci-dessus dans lequel l'enzyme inactivée est une dTDP-4-céto- L-6-désoxyhexose 4-réductase ou dans lequel l'enzyme inactivée est une dTDP-D-6-désoxyhexose 3 , 4-déshydratase ou dans lequel l'enzyme inactivée est une mycarosyltransférase ou dans lequel l'enzyme inactivée est une dTDP-4-céto-L-6- désoxyhexose 2 , 3-réductase.The inactivation of at least one of the enzymes is demonstrated, on the one hand by the absence of production of erythromycin, on the other hand by the accumulation of precursors of erythromycin such as 6-deoxyerythronolide B, erythronolide B or 3-α-mycarosyl erythronolide B and / or the accumulation of hybrid secondary metabolites as defined above in the culture supernatants of the corresponding modified strains. The invention relates more particularly to the above method in which the inactivated enzyme is a dTDP-4-keto-L-6-deoxyhexose 4-reductase or in which the inactivated enzyme is a dTDP-D-6-deoxyhexose 3 , 4-dehydratase or in which the inactivated enzyme is mycarosyltransferase or in which the inactivated enzyme is dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase.
L'invention concerne aussi le procédé ci-dessus dans lequel le métabolite secondaire hybride isolé est un analogue de l' érythromycine choisi parmi la 4"-céto-érythromycine, la 4'-hydroxy-érythromycine ou la 3"-C désméthyl-2" , 3"-ène- érythromycine ou dans lequel le métabolite secondaire hybride isolé est le désosa inyl érythronolide B.The invention also relates to the above method in which the isolated hybrid secondary metabolite is an erythromycin analog chosen from 4 "-keto-erythromycin, 4'-hydroxy-erythromycin or 3" -C-desmethyl-2 ", 3" -ene- erythromycin or in which the isolated hybrid secondary metabolite is desosa inyl erythronolide B.
Des exemples de mise en oeuvre du procédé de l'invention sont donnés dans la partie expérimentale. L'accumulation de métabolites secondaires hybrides dans des souches deExamples of implementation of the method of the invention are given in the experimental part. The accumulation of hybrid secondary metabolites in strains of
Sac . erythraea modifiées est également décrite plus loin.Bag . modified erythraea is also described below.
L'invention concerne aussi une souche de Sac . erythraea modifiée dans laquelle au moins l'une des enzymes choisie parmi une - dTDP-4-céto-L-6-désoxyhexose 2 , 3-réductase,The invention also relates to a Sac strain. modified erythraea in which at least one of the enzymes chosen from a - dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase,
- désosaminyltransférase,- desosaminyltransferase,
- dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase,- dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase,
- dTDP-4-céto-L-6-désoxyhexose 4-réductase,- dTDP-4-keto-L-6-deoxyhexose 4-reductase,
- mycarosyltransférase, - dTDP-D-6-désoxyhexose 3-N-méthyltransférase,- mycarosyltransferase, - dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase,
- dTDP-D-6-désoxyhexose 3 , 4-déshydratase,- dTDP-D-6-deoxyhexose 3, 4-dehydratase,
- dTDP-D-4 , 6-didésoxyhexose 3 , 4-réductase ou - dTDP-4-céto-D-6-désoxyhexose 3,5 épimérase est inactivée et produisant au moins un métabolite secondaire hybride.- dTDP-D-4, 6-dideoxyhexose 3, 4-reductase or - dTDP-4-keto-D-6-deoxyhexose 3,5 epimerase is inactivated and produces at least one secondary hybrid metabolite.
L'invention concerne particulièrement la souche de Sac . erythraea modifiée BII92 dans laquelle une dTDP-4-céto-L-6- désoxyhexose 2 , 3-réductase est inactivée et produisant la 3"-C désméthyl-2", 3"-ène-érythromycine C, la souche de Sac . erythraea modifiée BIV87 dans laquelle une dTDP-4-céto-L-6- désoxyhexose 4-réductase est inactivée et produisant la 4"- céto-érythromycine, la souche de Sac . erythraea modifiée CIV89 dans laquelle une dTDP-D-6-désoxyhexose 3 , 4-déshydratase est inactivée et produisant la 4'-hydroxyérythromycine D ainsi que la souche de Sac . erythraea modifiée BV88 dans laquelle une mycarosyltransférase est inactivée et produisant du desoaminyl érythronolide B. Des constructions détaillées des souches ci-dessus sont données plus loin dans la partie expérimentale .The invention particularly relates to the Sac strain. modified BII92 erythraea in which a dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase is inactivated and producing 3 "-C desmethyl-2", 3 "-ene-erythromycin C, the Sac strain. erythraea modified BIV87 in which a dTDP-4-keto-L-6-deoxyhexose 4-reductase is inactivated and producing 4 "- keto-erythromycin, the Sac strain. modified CIV89 erythraea in which a dTDP-D-6-deoxyhexose 3, 4-dehydratase is inactivated and producing 4'-hydroxyerythromycin D as well as the Sac strain. modified erythraea BV88 in which a mycarosyltransferase is inactivated and producing desoaminyl erythronolide B. Detailed constructions of the above strains are given later in the experimental part.
L'invention concerne aussi un procédé de préparation de précurseurs de l'oléandomycine chez S . antibioticus dans lequelThe invention also relates to a process for the preparation of oleandomycin precursors in S. antibioticus in which
- on crée une altération de la séquence du gène choisie parmi la séquence d'ADN correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714) et la séquence d'ADN correspondant à l'ORF oleG2 (séquence de SEQ ID N° 15 du nucleotide 2722 au nucleotide 3999) dans le chromosome d'une souche hôte et obtient une souche modifiée,- an alteration is created of the gene sequence chosen from the DNA sequence corresponding to the oleG1 ORF (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) and the DNA sequence corresponding to the oleG2 ORF (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) in the chromosome of a host strain and obtains a modified strain,
- on cultive la souche modifiée dans des conditions permettant l'accumulation des précurseurs de l'oléandomycine etthe modified strain is cultivated under conditions allowing the accumulation of the oleandomycin precursors and
- on isole ces précurseurs.- these precursors are isolated.
L'altération de la séquence d'ADN peut être réalisée par exemple par interruption du gène cible dans la souche S . antibioticus , par exemple par intégration d'un plasmide par la méthodologie de la recombinaison homologue et conduit à la génération de mutants chromosomiques de la souche sauvage .The alteration of the DNA sequence can be carried out for example by interruption of the target gene in the strain S. antibioticus, for example by integration of a plasmid by the methodology of homologous recombination and leads to the generation of chromosomal mutants of the wild strain.
L'invention concerne particulièrement un procédé ci- dessus dans lequel l'altération est créée dans la séquence d'ADN correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714) et dont il résulte au moins l'élimination de l'activité désoaminyltransférase et l'accumulation du précurseur de l'oléandomycine 8 , 8a-désoxyoléandolide.The invention particularly relates to a process above in which the alteration is created in the DNA sequence corresponding to the ORF oleGl (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) and from which it results at least the elimination of the deoaminyltransferase activity and the accumulation of the precursor of oleandomycin 8, 8a-deoxyoleandolide.
L'accumulation d'un précurseur non glycosylé de l'oléandomycine 8,8a-désoxyoléandolide observée par interruption du gène oleGl est due à un effet polaire transcription- nel inactivant le gène oleG2.The accumulation of an unglycosylated precursor of oleandomycin 8,8a-deoxyoleandolide observed by interruption of the oleG1 gene is due to a polar transcriptional effect inactivating the oleG2 gene.
Un exemple de mise en oeuvre du procédé ci-dessus est donné plus loin dans la partie expérimentale.An example of implementation of the above method is given later in the experimental part.
Matériels et méthodes générales. 1. Souches bactériennes, plasmides et conditions de croissance.General materials and methods. 1. Bacterial strains, plasmids and growth conditions.
La souche Sac . erythraea utilisée pour la réalisation de l'invention est un variant phénotypique spontané dit "red variant" (Hessler et al., 1997) de la souche sauvage Sac . erythraea NRRL 2338 dont la croissance est effectuée en routine soit sur milieu solide R2T2 (milieu R2T décrit par Weber et al., 1985 sans peptone) , R2T20 (Yamamoto et al., 1986) ou Ml-102 sur agar (Kaneda et al., 1962), soit en milieu liquide TSB (Oxoid) à 30°C La souche Streptomyces lividanε 1326 (John Innés Culture Collection) décrite par Hopwood et al. (1983) , utilisée pour la préparation de plasmides dépourvus d'origine de réplica- tion d' Escherichia coli tels que pIJ702 et pIJ486, a été maintenue sur milieu solide R2YE(R5) (Hopwood et al., 1985). La croissance des souches E . coli XLl-blue (Stratagene) , JMllO (Stratagene) et DH5α.MCR (GibcoBRL) , utilisées pour les préparations de plasmides, a été effectuée en routine en milieu liquide 2 x YT ou LB ou en milieu solide LB sur agar, tels que décrits par Sambrook et al. (1989). La souche E . coli XLl-blue est utilisée pour les clonages en routine. La souche JMllO est utilisée pour des clonages où l'on utilise des sites de restriction tels que Bell. La souche DH5α.MCR est utilisée pour la préparation de plasmides destinés à être introduits chez Sac . erythraea pour une transformation optimale.The Sac strain. erythraea used for carrying out the invention is a spontaneous phenotypic variant called "red variant" (Hessler et al., 1997) of the wild strain Sac. erythraea NRRL 2338, the growth of which is carried out routinely either on solid R2T2 medium (R2T medium described by Weber et al., 1985 without peptone), R2T20 (Yamamoto et al., 1986) or Ml-102 on agar (Kaneda et al. , 1962), or in TSB (Oxoid) liquid medium at 30 ° C. The Streptomyces lividanε 1326 (John Innés Culture Collection) strain described by Hopwood et al. (1983), used for the preparation of plasmids devoid of Escherichia coli replication origin such as pIJ702 and pIJ486, was maintained on solid R2YE (R5) medium (Hopwood et al., 1985). The growth of E strains. coli XLl-blue (Stratagene), JMllO (Stratagene) and DH5α.MCR (GibcoBRL), used for the preparation of plasmids, was carried out routinely in liquid medium 2 x YT or LB or in solid medium LB on agar, such as described by Sambrook et al. (1989). The strain E. coli XLl-blue is used for routine cloning. The JM10O strain is used for cloning where restriction sites such as Bell are used. The DH5α.MCR strain is used for the preparation of plasmids intended to be introduced to Sac. erythraea for optimal transformation.
La sélection des plasmides dans E . coli a été effectuée sur ampicilline (Sigma) à 100 μg/ml. Les souches Bacillus subtilis ATCC 6633 ou Bacillus pumilus ATCC 14884 ont été utilisées comme souches indicatrices pour évaluer la production d' érythromycine dans des essais biologiques par antibiogramme.Selection of plasmids in E. coli was performed on ampicillin (Sigma) at 100 μg / ml. Bacillus subtilis ATCC 6633 or Bacillus pumilus ATCC 14884 were used as indicator strains to assess erythromycin production in bioassays by antibiogram.
Les plasmides Litmus28, pUClδ et pUC19 (New England Biolabs) ont été utilisés en routine pour les sous-clonages. Le vecteur pIJ702 (Katz et al., 1983) a été obtenu du John Innés Institute. Le vecteur pIJ486 (Ward et al., 1986) a été obtenu de C.J. Thompson (Université de Bâle, Suisse) . Le phagmide pTZlδR a été obtenu de Pharmacia Biotech. Le vecteur navette coli-streptomyces pUWL218 (Wehmeier, 1995) utilisé pour l'intégration chromosomique dans Sac. erythraea a été obtenu de W.Piepersberg (Université de Wuppertal, Allemagne) .The plasmids Litmus28, pUClδ and pUC19 (New England Biolabs) were used routinely for subcloning. The vector pIJ702 (Katz et al., 1983) was obtained from the John Innés Institute. The vector pIJ486 (Ward et al., 1986) was obtained from C.J. Thompson (University of Basel, Switzerland). The phagmid pTZlδR was obtained from Pharmacia Biotech. The coli-streptomyces shuttle vector pUWL218 (Wehmeier, 1995) used for chromosomal integration in Sac. erythraea was obtained from W. Piepersberg (University of Wuppertal, Germany).
2. Manipulation de l'ADN et séquençage.2. DNA manipulation and sequencing.
Les méthodes générales de biologie moléculaire utilisées sont décrites par Sambrook et al., 1989.The general methods of molecular biology used are described by Sambrook et al., 1989.
Les réactifs d'origine commerciale ont été utilisés incluant les enzymes de restriction (New England Biolabs et Boehringer Mannheim) , le fragment de Klenow de l'ADN polymerase I (Boehringer Mannheim) . La trousse "DNA ligation System" (Amersham) a été utilisée pour effectuer les ligations et la trousse Plasmid Midi kit (Quiagen) ou RPM kit (BiolOl Inc.) pour purifier l'ADN plasmidique.Commercial reagents were used including restriction enzymes (New England Biolabs and Boehringer Mannheim), the Klenow fragment of DNA polymerase I (Boehringer Mannheim). The DNA ligation System kit (Amersham) was used to perform the ligations and the Plasmid Midi kit (Quiagen) or RPM kit (BiolOl Inc.) to purify the plasmid DNA.
La préparation de l'ADN du bactériophage λ a été réalisée selon Ausubel et al. (1995) et l'isolement de l'ADN chromosomique de Sac . erythraea selon Hopwood et al. (1985) . La transformation de S . lividans et l'isolement des plasmides ont été effectués selon Hopwood et al. (1985) .The preparation of the bacteriophage λ DNA was carried out according to Ausubel et al. (1995) and the isolation of chromosomal DNA from Sac. erythraea according to Hopwood et al. (1985). The transformation of S. lividans and the isolation of the plasmids were carried out according to Hopwood et al. (1985).
3. Préparation de l' érythronolide B et du 3-α-mycarosyl érythronolide B. L' érythronolide B et le 3-α-mycarosyl érythronolide B ont été purifiés à partir d'extraits de culture du mutant eryCI (clone WHB2221 décrit par Dhillon et al., 1989) par chromatographie sur gel d'aminopropyl (LichroprepNH2 25-40 μ, Merck) avec un gradient d'elution par des mélanges chlorure de butyle/chlorure de méthylène successifs (100:0, 80:20, 50:50 et 20:80) suivi d'un gradient d'elution linéaire par le mélange chlorure de butyle/méthanol variant de 99:1 à 90:10. Les fractions contenant les produits attendus sont amenées à sec sous vide puis analysées par chromatographie en couche mince (ccm) . L' érythronolide B est ensuite cristallisé dans un mélange acétate d'éthyle/hexane puis recristallisé dans l'éthanol. Le 3-α-mycarosyl érythronolide B est cristallisé deux fois dans un mélange acétate d'éthyle/hexane. Milieux cités.3. Preparation of erythronolide B and 3-α-mycarosyl erythronolide B. Erythronolide B and 3-α-mycarosyl erythronolide B were purified from culture extracts of the eryCI mutant (clone WHB2221 described by Dhillon et al., 1989) by chromatography on aminopropyl gel (LichroprepNH2 25-40 μ, Merck) with an elution gradient by successive butyl chloride / methylene chloride mixtures (100: 0, 80:20, 50:50 and 20:80) followed by a linear elution gradient with the chloride mixture butyl / methanol ranging from 99: 1 to 90:10. The fractions containing the expected products are brought to dryness under vacuum and then analyzed by thin layer chromatography (ccm). Erythronolide B is then crystallized from an ethyl acetate / hexane mixture and then recrystallized from ethanol. 3-α-mycarosyl erythronolide B is crystallized twice from an ethyl acetate / hexane mixture. Cited environments.
1. R2T2 :1. R2T2:
Pour 1 litre de solution aqueuse : sucrose 103 g ; K2S04 0,25g ; extrait de levure 6,5 g ; tryptone 5,0 g ; bactoagar 22,0 g ; eau distillée qsp 860 ml. La solution est stérilisée par autoclavage pendant 30 minutes à 120°C. Au moment de l'utilisation, les solutions stériles suivantes sont ajoutées : 20 ml de glucose à 50 % ; 25 ml de Tris-HCl 1M, pH7,0 ; 5 ml de KH2P04 à 0,5 % ; 2,5 ml de NaOH IN ; 50 ml de CaCl2 1M ; 50 ml de MgCl2 , 6H20 1M et 2 ml de solution de "trace éléments" (Hopwood et al., 1985).For 1 liter of aqueous solution: sucrose 103 g; K 2 S0 4 0.25 g; yeast extract 6.5 g; tryptone 5.0 g; bactoagar 22.0 g; distilled water qs 860 ml. The solution is sterilized by autoclaving for 30 minutes at 120 ° C. At the time of use, the following sterile solutions are added: 20 ml of 50% glucose; 25 ml of 1M Tris-HCl, pH 7.0; 5 ml of 0.5% KH 2 P0 4 ; 2.5 ml of NaOH IN; 50 ml of 1M CaCl 2 ; 50 ml of MgCl 2 , 6H 2 0 1M and 2 ml of "trace element" solution (Hopwood et al., 1985).
2. R2T20 :2. R2T20:
Pour un litre de solution aqueuse : milieu R2T2 contenant 206 g de sucrose. 3. Ml-102 (Kaneda et al., 1962) :For one liter of aqueous solution: R2T2 medium containing 206 g of sucrose. 3. MI-102 (Kaneda et al., 1962):
Pour 1 litre de solution aqueuse : glucose 5 g ; sucre brun commercial 10 g ; tryptone 5 g ; extrait de levure 2,5 g ; Versène 36 mg ; eau courante 1000 ml ; pH final ajusté à 7,0 à 7,2 avec KOH. La solution est stérilisée par autoclavage pendant 30 minutes à 120°C.For 1 liter of aqueous solution: glucose 5 g; commercial brown sugar 10 g; tryptone 5 g; yeast extract 2.5 g; Versene 36 mg; running water 1000 ml; final pH adjusted to 7.0 to 7.2 with KOH. The solution is sterilized by autoclaving for 30 minutes at 120 ° C.
4. R2YE(R5) (Hopwood et al., 1985) :4. R2YE (R5) (Hopwood et al., 1985):
Pour 1 litre de solution aqueuse : sucrose 103 g ; K2S04 0,25 g ; MgCl2,6H20 10,12 g ; casaminoacides 0,1 g ; solution de "trace éléments" 2 ml ; extrait de levure 5 g ; TES 5,72 g ; bactoagar 15 g ; eau distillée qsp 940 ml. La solution est stérilisée par autoclavage pendant 30 minutes à 120°C. Au moment de l'utilisation, les solutions stériles suivantes sont ajoutées : 10 ml de KH2P04 0,5 % ; 20 ml de CaCl2 1M ; 15 ml de L-proline à 20 % ; 20 ml de glucose à 50 % et 1 ml de CuCl2 lOmM.For 1 liter of aqueous solution: sucrose 103 g; K 2 S0 4 0.25 g; MgCl 2 , 6H 2 0 10.12 g; casamino acids 0.1 g; "trace elements" solution 2 ml; yeast extract 5 g; TES 5.72 g; bacteroagar 15 g; distilled water qs 940 ml. The solution is sterilized by autoclaving for 30 minutes at 120 ° C. At the time of use, the following sterile solutions are added: 10 ml of 0.5% KH 2 P0 4 ; 20 ml of 1M CaCl 2 ; 15 ml of 20% L-proline; 20 ml of 50% glucose and 1 ml of 2 lOmM CuCl.
5. 2 x TY :5. 2 x TY:
Pour 1 litre de solution aqueuse : tryptone 10 g ; extrait de levure 10 g ; NaCl 5 g.For 1 liter of aqueous solution: tryptone 10 g; yeast extract 10 g; NaCl 5 g.
6. Tampon PT :6. PT buffer:
Pour 1 litre de solution aqueuse : sucrose 100 g ; 2S04 0,25 g ; MgCl26H20 5,1 g ; solution de "trace éléments" 2 ml ; eau distillée qsp 875 ml. La solution est stérilisée par autoclavage pendant 30 minutes à 120 °C. Au moment de l'utilisation, les solutions stériles suivantes sont ajoutées : 5 ml de CaCl2 et 20 ml de TES 5,3 %.For 1 liter of aqueous solution: sucrose 100 g; 2 SO 4 0.25 g; MgCl 2 6H 2 0 5.1 g; "trace elements" solution 2 ml; distilled water qs 875 ml. The solution is sterilized by autoclaving for 30 minutes at 120 ° C. At the time of use, the following sterile solutions are added: 5 ml of CaCl 2 and 20 ml of 5.3% TES.
7. Sucrose-succinate (Caffrey et al., 1992) :7. Sucrose-succinate (Caffrey et al., 1992):
Pour 1 litre de solution aqueuse : sucrose 0,2 M ; acide succinique 20 mM ; phosphate de potassium 20 mM (pH 6,6) ; sulfate de magnésium 5 mM ; nitrate de potassium 100 mM ; solution de "trace éléments" 2 ml. La solution est stérilisée par autoclavage pendant 30 minutes à 120°C.For 1 liter of aqueous solution: 0.2 M sucrose; 20 mM succinic acid; 20 mM potassium phosphate (pH 6.6); 5 mM magnesium sulfate; 100 mM potassium nitrate; "trace elements" solution 2 ml. The solution is sterilized by autoclaving for 30 minutes at 120 ° C.
Les figures ci-annexées illustrent certains aspects de l'invention.The attached figures illustrate certain aspects of the invention.
La figure 1 représente la voie de biosynthèse deFigure 1 shows the biosynthetic pathway of
1' érythromycine A.1 erythromycin A.
La figure 2 représente la séquence nucléotidiqueFigure 2 shows the nucleotide sequence
(séquence directe et complémentaire de SEQ ID N° 1) de la région eryG-eryAIII du cluster de gènes de la biosynthèse de(direct and complementary sequence of SEQ ID No. 1) of the eryG-eryAIII region of the gene cluster for biosynthesis of
1' érythromycine comprenant les ORFs 7, 8 et 9 et leurs séquences protéiques déduites.1 erythromycin comprising ORFs 7, 8 and 9 and their deduced protein sequences.
La figure 3 représente la séquence nucléotidiqueFigure 3 shows the nucleotide sequence
(séquence de SEQ ID N° 6) de la région eryAI-eryK du cluster de gènes de la biosynthèse de l' érythromycine comprenant les(sequence of SEQ ID No. 6) of the eryAI-eryK region of the erythromycin biosynthesis gene cluster comprising the
ORFs 13 à 19 et leurs séquences protéiques déduites.ORFs 13 to 19 and their deduced protein sequences.
La figure 4 représente le schéma de substitution de gène par recombinaison homologue.Figure 4 shows the gene substitution scheme by homologous recombination.
La figure 5A représente l'organisation de la partie gauche du cluster des gènes de la biosynthèse de l'érythromycine chez Sac . erythraea dont les ORFs 1 à 9 sont indiquées par des flèches ainsi qu'une carte de restriction des plasmides pK62, pBCKl, pKB22, pBK44, pBIISB, pEco2 et pK23, générés à partir du clone génomique XSE5.5. (Abréviations des enzymes de restriction : B, BajnHI ; Bc, Bell ; Bg, BgrlII ; E, EcoRI ; K, Kpnl ; M, MluI ; P, PstI ; S, Sacl ; Sa, Sali.)FIG. 5A represents the organization of the left part of the cluster of genes for the biosynthesis of erythromycin in Sac. erythraea whose ORFs 1 to 9 are indicated by arrows as well as a restriction map of the plasmids pK62, pBCKl, pKB22, pBK44, pBIISB, pEco2 and pK23, generated from the XSE5.5 genomic clone. (Abbreviations for restriction enzymes: B, BajnHI; Bc, Bell; Bg, BgrlII; E, EcoRI; K, Kpnl; M, MluI; P, PstI; S, Sacl; Sa, Sali.)
La figure 5B représente l'organisation de la partie droite du cluster des gènes de la biosynthèse de l' érythromycine chez Sac . erythraea dont les ORFs 13 à 21 sont indiquées par des flèches ainsi qu'une carte de restriction des plasmides pBK6-12, pCN9 , pNC028, pNB49, pNC062, pPSP4 , pNC062X et pBABlδ . (Abréviations des enzymes de restriction : B, BamKI ; Ba, Bail ; Bc, Bell ; C, Clal ; E, EcoRI ; K, Kpnl ; N, Ncol ; Ns, Nsil ; P, PstI ; Pv, PvuII ; S, Sacl ; Se, Seal ; Sh, SphI ; Sp, Spel ; X, Xjal ; Xh, Xhol) .FIG. 5B represents the organization of the right part of the cluster of genes for the biosynthesis of erythromycin in Sac. erythraea whose ORFs 13 to 21 are indicated by arrows as well as a restriction map of the plasmids pBK6-12, pCN9, pNC028, pNB49, pNC062, pPSP4, pNC062X and pBABlδ. (Abbreviations of restriction enzymes: B, BamKI; Ba, Bail; Bc, Bell; C, Clal; E, EcoRI; K, Kpnl; N, Ncol; Ns, Nsil; P, PstI; Pv, PvuII; S, Sacl ; Se, Seal; Sh, SphI; Sp, Spel; X, Xjal; Xh, Xhol).
La figure 6A représente le schéma de construction du plasmide pBHΔ. La figure 6B représente une carte de restriction du plasmide pUWL218.FIG. 6A represents the construction diagram of the plasmid pBHΔ. Figure 6B shows a restriction map of plasmid pUWL218.
La figure 6C représente une carte de restriction du plasmide pBIlΔ.FIG. 6C represents a restriction map of the plasmid pBIlΔ.
La figure 7A représente le schéma de construction du plasmide pdel88.FIG. 7A represents the construction diagram of the plasmid pdel88.
La figure 7B représente le schéma de construction du plasmide pdel88A.FIG. 7B represents the construction diagram of the plasmid pdel88A.
La figure 7C représente le schéma de construction du plasmide pOBB. La figure 7D représente le schéma de construction et une carte de restriction du plasmide pCIUΔ.FIG. 7C represents the construction diagram of the plasmid pOBB. FIG. 7D represents the construction diagram and a restriction map of the plasmid pCIUΔ.
La figure 8A représente le schéma de construction du plasmide pCIlΔ.FIG. 8A represents the construction diagram of the plasmid pCIlΔ.
La figure 8B représente une carte de restriction du plasmide pORTl.Figure 8B shows a restriction map of plasmid pORTl.
La figure 8C représente une carte de restriction du plasmide pCHΔ.FIG. 8C represents a restriction map of the plasmid pCHΔ.
La figure 9A représente le schéma de construction du plasmide pBIVΔ. La figure 9B représente une carte de restriction du plasmide pBIVΔ.FIG. 9A represents the construction diagram of the plasmid pBIVΔ. FIG. 9B represents a restriction map of the plasmid pBIVΔ.
La figure 10A représente le schéma de construction du plasmide pBVΔ. La figure 10B représente une carte de restriction du plasmide pBVΔ.FIG. 10A represents the construction diagram of the plasmid pBVΔ. FIG. 10B represents a restriction map of the plasmid pBVΔ.
La figure 11A représente le schéma de construction du plasmide pPSTI. La figure 11B représente une carte de restriction du plasmide pPSTI.FIG. 11A represents the construction diagram of the plasmid pPSTI. Figure 11B shows a restriction map of the plasmid pPSTI.
La figure 12A représente le schéma de construction du plasmide pXhol .FIG. 12A represents the construction diagram of the plasmid pXhol.
La figure 12B représente une carte de restriction du plasmide pXhol.Figure 12B shows a restriction map of the plasmid pXhol.
La figure 13A représente le schéma de construction du plasmide pCIVΔ.FIG. 13A represents the construction diagram of the plasmid pCIVΔ.
La figure 13B représente une carte de restriction du plasmide pCIVΔ. La figure 14A représente le schéma de construction du plasmide pCVΔ.FIG. 13B represents a restriction map of the plasmid pCIVΔ. FIG. 14A represents the construction diagram of the plasmid pCVΔ.
La figure 14B représente une carte de restriction du plasmide pCVΔ.FIG. 14B represents a restriction map of the plasmid pCVΔ.
La figure 15 représente l'analyse par Southern blot des souches mutantes BII92, CIII68, CII62, BIV87, BV88, CIV89 et CV90, comparativement à la souche sauvage "red variant" notée Wt. Pour chaque mutant, l'enzyme de restriction utilisée est indiquée en-dessous de chaque blot et la taille des bandes détectées devant chaque blot est estimée par rapport aux marqueurs de poids moléculaire λ-HindlII et λ-BstEII (non détectables par auto-radiographie) .FIG. 15 represents the analysis by Southern blot of the mutant strains BII92, CIII68, CII62, BIV87, BV88, CIV89 and CV90, compared to the wild strain "red variant" noted Wt. For each mutant, the restriction enzyme used is indicated below each blot and the size of the bands detected in front of each blot is estimated relative to the molecular weight markers λ-HindlII and λ-BstEII (not detectable by auto-radiography ).
La figure 16 représente l'analyse par PCR des souches mutantes BII91, CIII68, CII62, BIV87, BV88, CIV89 et CV90, comparativement à la souche sauvage "red variant" notée Wt et aux plasmides pBHΔ, pCIUΔ, pCHΔ, pBIVΔ, pBVΔ, PCIVΔ et pCVΔ utilisés respectivement pour obtenir le mutant par recombinaison homologue. Les tailles des bandes détectées par coloration au bromure d'éthydium sont estimées par rapport aux marqueurs de poids moléculaire X174-HaeIII ou λ-BstEII. La figure 17 représente l'analyse par CCM des métabolites produits par les souches mutantes BII92, CIII68, CII62, BIV87, BV88, CIV89 et CV90, comparativement aux produits standards érythromycine A (Er A) , érythronolide B (EB) et 3-α-mycarosyl érythronolide B (MEB) .FIG. 16 represents the analysis by PCR of the mutant strains BII91, CIII68, CII62, BIV87, BV88, CIV89 and CV90, compared with the wild strain "red variant" denoted Wt and with the plasmids pBHΔ, pCIUΔ, pCHΔ, pBIVΔ, pBVΔ, PCIVΔ and pCVΔ used respectively to obtain the mutant by homologous recombination. The band sizes detected by staining with ethydium bromide are estimated relative to the molecular weight markers X174-HaeIII or λ-BstEII. FIG. 17 represents the TLC analysis of the metabolites produced by the mutant strains BII92, CIII68, CII62, BIV87, BV88, CIV89 and CV90, compared to the standard products erythromycin A (Er A), erythronolide B and 3-α-mycarosyl erythronolide B (SEM).
La figure 18 représente l'analyse par SDS-PAGE de la purification de la protéine EryCIII successivement après extraction à l'urée 7M (ligne 2) , chromatographie Q Sépharose (ligne 3) , chromatographie Superdex (ligne 4) , chromatographie Q source (ligne 6) avec des marqueurs standard de poids moléculaire (lignes 1 et 5) ;FIG. 18 represents the analysis by SDS-PAGE of the purification of the protein EryCIII successively after extraction with urea 7M (line 2), Q Sepharose chromatography (line 3), Superdex chromatography (line 4), Q source chromatography ( lane 6) with standard molecular weight markers (lanes 1 and 5);
La figure 19 représente l'analyse par CMM du test d'activité biologique de la protéine EryCIII, par incubation avec d-TDP-D-désosamine (ligne 2) ou avec d-TDP-D-désosamine et 3-α-mycarosyl érythronolide B (MEB) (ligne 3) comparativement au contrôle MEB (ligne 1) et au contrôle érythromycine A (ligne 4) . Les pointillés marquent les zones montrant une activité antibiotique par autobiogramme sur B. pumilus . La figure 20 représente la localisation des six cosmides (cosAB35, cosAB76, COSAB87, COSAB67, cosAB63 et cosABôl) couvrant l'ensemble du cluster des gènes de la biosynthèse de l'oléandomycine. Les fragments de restriction BaraHI (noté B) hybridant avec les sondes notées str M, D, E et les fragments BamHI (3,5 kb et 2,7 kb) hybridant avec la sonde eryCIII sont montrés .FIG. 19 represents the analysis by CMM of the test of biological activity of the protein EryCIII, by incubation with d-TDP-D-desosamine (lane 2) or with d-TDP-D-desosamine and 3-α-mycarosyl erythronolide B (SEM) (line 3) compared to SEM control (line 1) and erythromycin A control (line 4). The dotted lines mark the areas showing antibiotic activity by autobiogram on B. pumilus. FIG. 20 represents the location of the six cosmids (cosAB35, cosAB76, COSAB87, COSAB67, cosAB63 and cosABôl) covering the entire cluster of genes for oleanomomycin biosynthesis. The BaraHI restriction fragments (denoted B) hybridizing with the probes denoted str M, D, E and the BamHI fragments (3.5 kb and 2.7 kb) hybridizing with the eryCIII probe are shown.
La figure 21 représente l'organisation de la partie droite du cluster des gènes de la biosynthèse de l'oléandro- mycine chez S . antibioticus dont les différentes ORFs (notées olePl, oleGl, oleG2, oleM, oleY, oleP et oleB) sont indiquées par des flèches ainsi qu'une carte de restriction du plasmide pC035-S et l' insert du plasmide pC03 généré à partir du pC035-S. La double flèche indique l' insert correspondant à la séquence de la figure 22 (abréviations des enzymes de restriction : B, BamHI ; Bg, Bgl I ; K, Kpn ; S, Sacl ; Sh, SphI ; l'étoile indique qu'il ne s'agit pas d'un site unique) .FIG. 21 represents the organization of the right part of the cluster of genes for the biosynthesis of oleandromycin in S. antibioticus whose different ORFs (noted olePl, oleGl, oleG2, oleM, oleY, oleP and oleB) are indicated by arrows as well as a restriction map of plasmid pC035-S and the insert of plasmid pC03 generated from pC035 -S. The double arrow indicates the insert corresponding to the sequence of FIG. 22 (abbreviations of restriction enzymes: B, BamHI; Bg, Bgl I; K, Kpn; S, Sacl; Sh, SphI; the star indicates that it is not a single site).
La figure 22 représente la séquence nucléotidique (séquence de SEQ ID N° 15) de la région couvrant les gènes olePl, oleGl, oleG2 , oleM et oleY de la biosynthèse de l'oléandomycine et leurs séquences protéiques déduites. EXEMPLE 1 : clonage et séquençage de la région eryG-eryAIII du cluster de gènes de la biosynthèse de l' érythromycine. Un fragment d'ADN génomique de Sac . erythraea NRRL 2338 ayant > 20 kb en aval du gène ermE couvrant notamment les ORFs 3 à 9 et correspondant au clone XSE5.5 ainsi que la séquence nucléotidique d'un fragment de 4,5 kb correspondant à la région du cluster ery comprise entre 3,7 kb et 8,0 kb à partir de l'extrémité 3' du gène ermΕ et comprenant les ORFs 3, 4, 5 et 6 ont été décrits par Haydock et al. (1991).FIG. 22 represents the nucleotide sequence (sequence of SEQ ID No. 15) of the region covering the oleP1, oleG1, oleG2, oleM and oleY genes of oleanomomycin biosynthesis and their deduced protein sequences. EXAMPLE 1: Cloning and sequencing of the eryG-eryAIII region of the gene cluster for the biosynthesis of erythromycin. A fragment of genomic DNA from Sac. erythraea NRRL 2338 having> 20 kb downstream of the ermE gene covering in particular ORFs 3 to 9 and corresponding to the clone XSE5.5 as well as the nucleotide sequence of a 4.5 kb fragment corresponding to the region of the ery cluster between 3 , 7 kb and 8.0 kb from the 3 'end of the ermΕ gene and comprising ORFs 3, 4, 5 and 6 were described by Haydock et al. (1991).
En tenant compte de la carte de restriction montrée par Haydock et al. (1991), des sous-clones ont été dérivés du clone XSE5.5 par sous-clonage de fragments de restriction dans pUC19. Les plasmides pKB22, pBK44, pBIISB et pEco2 ont été ainsi générés selon la figure 5A de la façon suivante :Taking into account the restriction map shown by Haydock et al. (1991), subclones were derived from clone XSE5.5 by subcloning of restriction fragments in pUC19. The plasmids pKB22, pBK44, pBIISB and pEco2 were thus generated according to FIG. 5A as follows:
A partir de l'ADN du clone λSE5.5 digéré par l'enzyme de restriction Kpnl , les plasmides pK62 et pK66 ont été directement construits par sous-clonage du fragment Kpnl de 5,8 kb dans pUC19, le plasmide pK66 correspondant au même fragment Kpnl sous-cloné avec une orientation inversée de 1' insert par rapport au vecteur. Le plasmide pKB22 contenant un insert de 2,9 kb a été ensuite dérivé du plasmide pK66 par excision du fragment BamHI-Bg II (2,9 kb) couvrant 1ORF8 ainsi qu'une partie des ORFs 7 et 9 par digestion avec les enzymes de restriction BamHI et Bgl II . De la même façon, le plasmide pKB44 contenant un insert de 2,9 kb a été obtenu à partir du plasmide pK62 par excision du fragment BajnHI-BglII (2,9 kb) couvrant le gène eryG correspondant aux ORFs 5 et 6 et le gène eryF correspondant à 1 ' 0RF4.From the DNA of the λSE5.5 clone digested with the restriction enzyme Kpnl, the plasmids pK62 and pK66 were directly constructed by subcloning the 5.8 kb Kpnl fragment into pUC19, the plasmid pK66 corresponding to the same Kpnl fragment subcloned with an inverted orientation of the insert relative to the vector. The plasmid pKB22 containing an insert of 2.9 kb was then derived from the plasmid pK66 by excision of the BamHI-Bg II fragment (2.9 kb) covering 1ORF8 as well as part of ORFs 7 and 9 by digestion with the enzymes of BamHI and Bgl II restriction. Similarly, the plasmid pKB44 containing a 2.9 kb insert was obtained from the plasmid pK62 by excision of the BajnHI-BglII fragment (2.9 kb) covering the eryG gene corresponding to ORFs 5 and 6 and the gene eryF corresponding to 1 '0RF4.
Le plasmide pBIISB a été dérivé du plasmide pBK44 par sous-clonage dans pUC19 du fragment Sali de 600 pb obtenu à partir du plasmide pBK44 digéré par l'enzyme de restriction Sali (figure 5A) .Plasmid pBIISB was derived from plasmid pBK44 by subcloning into pUC19 the 600 bp SalI fragment obtained from plasmid pBK44 digested with the restriction enzyme Sali (FIG. 5A).
A partir de l'ADN du clone λSE5.5 digéré par l'enzyme de restriction EcoRI , le plasmide pEco2 a été directement construit par sous-clonage du fragment BcoRI (2,2 kb) dans pUC19. Les sous-clones pKB22, pBK44, pBIISB et pEco2 ainsi obtenus ont été ensuite séquences. L'analyse a été faite sur des échantillons d'ADN plasmidique, préalablement purifié sur une colonne de Quiagen 100 (Quiagen) , sur le séquenceur automatique ABI prism 377. Les réactions de séquençage ont été réalisées par la méthode de Sanger (1977) en utilisant les amorces M13 conventionnelles ou des amorces synthétiques et des didésoxynucléosides triphosphate fluorescents et la polymérase Taq FS (Perkin Elmer) en présence de 5 % de di éthylsulfoxide, les amorces synthétiques utilisées ayant les séquences suivantes : C3R2 TCCTCGATGGAGACCTGCC (SEQ ID N° 22) B2R1 GAGACCATGCCCAGGGAGT (SEQ ID N° 23) C3S2 TCTGGGAGCCGCTCACCTT (SEQ ID N° 24) C2R1 GACGAGGCCGAAGAGGTGG (SEQ ID N° 25) C2S GCACACCGGAATGGATGCG (SEQ ID N° 26) fullC3S CCGTCGAGCTCTGAGGTAA (SEQ ID N° 27) fullC3R GCCCGAGCCGCACGTGCGT (SEQ ID N° 28) et C4 TGCACGCGCTGCTGCCGACC (SEQ ID N° 29) .From the DNA of the λSE5.5 clone digested with the restriction enzyme EcoRI, the plasmid pEco2 was directly constructed by subcloning the BcoRI fragment (2.2 kb) in pUC19. The subclones pKB22, pBK44, pBIISB and pEco2 thus obtained were then sequenced. The analysis was carried out on plasmid DNA samples, previously purified on a column of Quiagen 100 (Quiagen), on the sequencer automatic ABI prism 377. The sequencing reactions were carried out by the method of Sanger (1977) using the primers M13 conventional or synthetic primers and dideoxynucleosides triphosphate fluorescent and the polymerase Taq FS (Perkin Elmer) in the presence of 5% of di éthylsulfoxide, synthetic primers used have the following sequences: C3R2 TCCTCGATGGAGACCTGCC (SEQ ID NO: 22) B2R1 GAGACCATGCCCAGGGAGT (SEQ ID NO: 23) C3S2 TCTGGGAGCCGCTCACCTT (SEQ ID NO: 24) C2R1 GACGAGGCCGAAGAGGTGG (SEQ ID NO: 25) C2S GCACACCGGAATGGATGCG (SEQ ID N ° 26) fullC3S CCGTCGAGCTCTGAGGTAA (SEQ ID N ° 27) fullC3R GCCCGAGCCGCACGTGCGT (SEQ ID N ° 28) and C4 TGCACGCGCTGCTGCCGACC (SEQ ID N ° 29).
L'assemblage des données de séquence a été réalisé avec le logiciel Autoassembler™ pakage (Applied Biosystem) . Les séquences ont été analysées en utilisant l'ensemble des logiciels GCG (Devereux 1984) . Les séquences nucléotidiques obtenues ont permis d'établir la séquence nucléotidique de 3412 bp de la figure 2 (séquence directe et complémentaire de SEQ ID N° 1) dans laquelle trois ORFs (7, 8 et 9) ont été identifiées respectivement du nucleotide 8957 au nucleotide 7959, du nucleotide 10219 au nucleotide 8957 et du nucleotide 11315 au nucleotide 10233 (numérotés dans la figure 2 à partir du site BajnHI situé à l'extrémité 5' du gène erjnE) (respectivement séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046, du nucleotide 1046 au nucleotide 2308 et du nucleotide 2322 au nucleotide 3404) et correspondant respectivement aux gènes eryBII, eryCIII et eryCII selon Liu et Thorson (1994) dont les caracterisations fonctionnelles n'avaient pas encore été identifiées. Les trois ORFs 7, 8 et 9 ont la même orientation, la lecture se faisant à partir de la région 3' du gène eryAIII.Sequence data was assembled using Autoassembler ™ pakage software (Applied Biosystem). The sequences were analyzed using all of the GCG software (Devereux 1984). The nucleotide sequences obtained made it possible to establish the nucleotide sequence of 3412 bp of FIG. 2 (direct and complementary sequence of SEQ ID No. 1) in which three ORFs (7, 8 and 9) were identified respectively from nucleotide 8957 to nucleotide 7959, from nucleotide 10219 to nucleotide 8957 and from nucleotide 11315 to nucleotide 10233 (numbered in FIG. 2 from the BajnHI site located at the 5 'end of the erjnE gene) (respectively sequence complementary to SEQ ID N ° 1 of the nucleotide 48 at nucleotide 1046, from nucleotide 1046 to nucleotide 2308 and from nucleotide 2322 to nucleotide 3404) and corresponding respectively to the genes eryBII, eryCIII and eryCII according to Liu and Thorson (1994) whose functional characterizations had not yet been identified. The three ORFs 7, 8 and 9 have the same orientation, the reading being done from the 3 ′ region of the eryAIII gene.
Des échantillons de E . coli XLl-blue contenant la région codante des ORFs ci-dessus ont été déposés à la Collection Nationale de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 16 juillet 1997 :Samples of E. coli XLl-blue containing the coding region of the ORFs above have been deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, July 16, 1997:
- le plasmide pK62 comprenant la séquence codante pour 1ORF7, 1ORF8 et une partie de 1ORF9 sous le numéro 1-1897, - le plasmide pJ5co2 comprenant la séquence codante pour 1ORF9 et une partie de 1ORF8 sous le numéro 1-1899. EXEMPLE 2 : construction du plasmide pBHΔ.- the plasmid pK62 comprising the coding sequence for 1ORF7, 1ORF8 and a part of 1ORF9 under the number 1-1897, - the plasmid pJ5co2 comprising the coding sequence for 1ORF9 and a part of 1ORF8 under the number 1-1899. EXAMPLE 2: Construction of the plasmid pBHΔ.
Un plasmide d'intégration, dénommé pBIlΔ et portant une délétion dans le gène eryBII codant pour 1ORF7, a été construit selon le schéma de la figure 6A.An integration plasmid, called pBIlΔ and carrying a deletion in the eryBII gene coding for 1ORF7, was constructed according to the diagram of FIG. 6A.
Le fragment Bc I-BamHI de 598 pb a été délété dans le plasmide pK62 obtenu à l'exemple 1 par digestion avec les enzymes Bell et BamHI. Le plasmide pBCKl résultant a été ensuite digéré avec les enzymes de restriction M uI et Bg/lII de façon à déléter un fragment ayant 853 pb à l'intérieur de 1ORF7 du nucleotide 8011 au nucleotide 8863 de la séquence de la figure 2. Après remplissage des extrémités à l'aide du fragment de Klenow de l'ADN polymérase I, le plasmide contenant la délétion , a été religaturé et transformé dans E . coli XLl-blue. A partir du plasmide pl9BHΔ ainsi généré, le fragment Kp.nl-HindiII (4,3 kb) qui porte la délétion a été sous-cloné dans le plasmide pUWL218 (figure 6B) . La présence de la délétion de 853 pb du nucleotide 8011 au nucleotide 8863 dans le plasmide pBHΔ ainsi généré (figure 6C) a été confirmée par séquençage.The 598 bp fragment Bc I-BamHI was deleted in the plasmid pK62 obtained in Example 1 by digestion with the enzymes Bell and BamHI. The resulting plasmid pBCKl was then digested with the restriction enzymes M uI and Bg / III so as to delete a fragment having 853 bp inside 1ORF7 from nucleotide 8011 to nucleotide 8863 of the sequence of FIG. 2. After filling ends using the Klenow fragment of DNA polymerase I, the plasmid containing the deletion, was religated and transformed into E. coli XLl-blue. From the plasmid pl9BHΔ thus generated, the Kp.nl-HindiII fragment (4.3 kb) which carries the deletion was subcloned in the plasmid pUWL218 (FIG. 6B). The presence of the 853 bp deletion from nucleotide 8011 to nucleotide 8863 in the plasmid pBHΔ thus generated (FIG. 6C) was confirmed by sequencing.
Le plasmide pBHΔ a ensuite été transféré dans la soucheThe plasmid pBHΔ was then transferred to the strain
E. coli DHδαMRC, puis utilisé pour transformer Sac . erythraea .E. coli DHδαMRC, then used to transform Sac. erythraea.
EXEMPLE 3 : construction d'une souche Sac. erythraea ery BIIΔ (BII92).EXAMPLE 3: Construction of a Sac strain. erythraea ery BIIΔ (BII92).
La construction d'une souche Sac . erythraea dans laquelle le gène eryBII porte une délétion interne telle que celle introduite dans le plasmide pBHΔ préparé à l'exemple 2 et le processus d'intégration ont été réalisés de la façon suivante :Building a Sac strain. erythraea in which the eryBII gene carries an internal deletion such as that introduced into the plasmid pBHΔ prepared in Example 2 and the integration process were carried out as follows:
La préparation des protoplastes a été réalisée selon la méthode décrite par Weber et Losick (1988) , en utilisant du PEG 3350 (Sigma) au lieu de PEG 1000 et un tampon P modifié (dénommé PT) contenant MgCl2,6H20 28 M et sans P04H2K au lieu des tampons P, L ou T décrits, selon les conditions opératoires suivantes :The protoplast preparation was carried out according to the method described by Weber and Losick (1988), using PEG 3350 (Sigma) instead of PEG 1000 and a modified P buffer. (called PT) containing MgCl 2 , 6H 2 0 28 M and without P0 4 H 2 K instead of the buffers P, L or T described, according to the following operating conditions:
Les cellules (au moins 108 spores) de Sac . erythraea "red variant" (dont un échantillon a été déposé à la Collection Nationale de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 16 juillet 1997 sous le numéro 1-1902) ont été mises à pousser dans 50 ml de milieu TBS pendant 3 à 5 jours à 30°C, puis lavées dans du sucrose à 10,3 %. Les cellules ont été remises en suspension dans 50 ml de tampon PT contenant 2 à 5 mg/ml de lysozyme (Sigma) , puis incubées à 30°C pendant 1 à 2 heures en désagrégeant les amas de mycélium toutes les 15 minutes jusqu'à conversion d'au moins 50 % du mycélium en protoplastes. Les protoplastes ont été lavés avec 50 ml de tampon PT, remis en suspension dans 12,5 à 25 ml du même tampon, congelés lentement puis stockés à -80 °C par aliquots de 200 l.Sac cells (at least 10 8 spores). erythraea "red variant" (a sample of which was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, July 16, 1997 under the number 1-1902) were grown in 50 ml of TBS medium for 3 to 5 days at 30 ° C, then washed in 10.3% sucrose. The cells were resuspended in 50 ml of PT buffer containing 2 to 5 mg / ml of lysozyme (Sigma), then incubated at 30 ° C for 1 to 2 hours by disaggregating the mycelium clusters every 15 minutes until conversion of at least 50% of the mycelium into protoplasts. The protoplasts were washed with 50 ml of PT buffer, resuspended in 12.5 to 25 ml of the same buffer, frozen slowly and then stored at -80 ° C in 200 l aliquots.
Pour la transformation, un aliquot a été décongelé et 50 μl ont été prélevés puis transférés dans un tube de 15 ml. Un à 10 μg d'ADN plasmidique pBHΔ, préparé à l'exemple 2 à partir de la souche E . coli DH5αMRC ont été mis en solution dans 5 à 10 μl de tampon TE (Tris HC1 10 mM pH 7,5, EDTA 1 mM) puis déposés sur la paroi du tube incliné auquel a été ensuite ajouté 0,5 ml d'une solution de PEG 3350 dans le tampon PT préparée extemporanément à partir d'une solution aqueuse à 50 % que l'on dilue au demi dans le tampon 2 x PT. Après dilution avec 3 à 5 ml de tampon PT puis centrifugation à 2500 rpm pendant 15 mn, le culot a été dissocié dans 0,5 ml de tampon PT et la suspension de protoplastes transformés ainsi obtenue a été immédiatement répartie sur 2 ou 3 boîtes R2T2 très sèches (3 h sous une hotte à flux laminaire) . Les boîtes ont été ensuite incubées à 32 °C pendant 16 à 24 h jusqu'à apparition du voile de régénération des protoplastes. A partir d'une solution stock de thiostrepton (Sigma) àFor processing, an aliquot was thawed and 50 μl were removed and then transferred to a 15 ml tube. One to 10 μg of plasmid DNA pBHΔ, prepared in Example 2 from the strain E. coli DH5αMRC were dissolved in 5 to 10 μl of TE buffer (Tris HC1 10 mM pH 7.5, EDTA 1 mM) then deposited on the wall of the inclined tube to which was then added 0.5 ml of a solution of PEG 3350 in the PT buffer prepared extemporaneously from a 50% aqueous solution which is diluted to half in the 2 x PT buffer. After dilution with 3 to 5 ml of PT buffer then centrifugation at 2500 rpm for 15 min, the pellet was dissociated in 0.5 ml of PT buffer and the suspension of transformed protoplasts thus obtained was immediately distributed over 2 or 3 R2T2 dishes very dry (3 hours under a laminar flow hood). The dishes were then incubated at 32 ° C for 16 to 24 h until the appearance of the protoplast regeneration veil. From a thiostrepton stock solution (Sigma) to
50 mg/ml dans le DMSO, une quantité appropriée a été diluée dans 0,5 à 1 ml d'eau puis étalée sur les boîtes de façon à obtenir une concentration finale de 20 μg de thiostrepton/ml de gélose. Après absorption complète de l'antibiotique, les boîtes ont été incubées à 32 °C pendant 3 à 4 jours, ce qui permet la visualisation des transformants. Les boîtes ont encore été incubées plusieurs jours jusqu'à développement complet des spores.50 mg / ml in DMSO, an appropriate quantity was diluted in 0.5 to 1 ml of water and then spread on the dishes so as to obtain a final concentration of 20 μg of thiostrepton / ml agar. After complete absorption of the antibiotic, the dishes were incubated at 32 ° C for 3 to 4 days, which allows the visualization of the transformants. The dishes were further incubated for several days until complete development of the spores.
La sélection des intégrants correspondant au premier événement de recombinaison (figure 4) a été réalisée par réplication des boîtes sporulées à l'aide de velours ou par étalement d'une suspension des spores sur des boîtes R2T2 contenant du thiostrepton puis incubation à 32 °C, ce qui permet la croissance des clones d'intégrants potentiels. Pour la sélection de clones ayant subi un deuxième événement de recombinaison (figure 4) , 5 à 10 clones résistants au thiostrepton obtenus ci-dessus ont été mis en culture dans 8 ml de milieu liquide TSB à 30°C pendant 3 à 4 jours. 50 à 100 μl ont été prélevés et remis en culture dans les mêmes conditions. Après 4 cycles successifs de dilution et culture destinés à favoriser la perte du marqueur de résistance au thiostrepton, des protoplastes ont été préparées à partir des cellules comme indiqué ci-dessus, de façon à chasser le plasmide. Les protoplastes ont ensuite été étalés sur des boîtes R2T2 de façon à obtenir des colonies individualisées dont la sensibilité au thiostrepton a été déterminée par réplique sur des boîtes R2T2 contenant du thiostrepton.The selection of the integrants corresponding to the first recombination event (FIG. 4) was carried out by replicating the sporulated dishes using velvet or by spreading a suspension of the spores on R2T2 dishes containing thiostrepton then incubation at 32 ° C. , which allows the growth of clones of potential integrants. For the selection of clones having undergone a second recombination event (FIG. 4), 5 to 10 clones resistant to thiostrepton obtained above were cultured in 8 ml of TSB liquid medium at 30 ° C for 3 to 4 days. 50 to 100 μl were removed and returned to culture under the same conditions. After 4 successive dilution and culture cycles intended to promote the loss of the thiostrepton resistance marker, protoplasts were prepared from the cells as indicated above, so as to drive out the plasmid. The protoplasts were then spread on R2T2 dishes so as to obtain individualized colonies whose sensitivity to thiostrepton was determined by replication on R2T2 dishes containing thiostrepton.
Selon la position du deuxième événement de recombinaison par rapport au site de délétion (figure 4) , on peut attendre que le phénotype des colonies sensibles au thiostrepton soit du type sauvage ou du type muté porteur de la délétion. Parmi les colonies sensibles au thiostrepton, la sélection des mutants ayant le phénotype ery~ a été réalisée par antibiogramme sur la souche B. pumiluε ATCC 14884 sensible à l' érythromycine. La souche B. pumilus a été utilisée comme souche indicatrice pour évaluer la production d'érythromycine dans des essais biologiques par antibiogramme. Les colonies ont été étalées à l'anse de platine sur des boîtes R2T2 , puis incubées pendant 3 à 4 jours à 30°C. Des zones d'agar où le mutant a poussé à confluence ont ensuite été prélevées à l'emporte pièce puis placées sur des boîtes A-Merck recouvertes d'une surcouche de 4 ml de 0,5 x A Merck (Antibiotic agar N°l Merck) inoculée d'une suspension de spores de B. pumilus , puis incubées une nuit à 37 °C. La présence de la délétion attendue dans le chromosome du mutant (délétion de 853 pb du nucleotide 8011 au nucleotide 8863 de la figure 2) a ensuite été confirmée par analyse génomique par Southern blot ainsi que par PCR de la façon suivante : Pour l'analyse par Southern blot, le transfert d'ADN génomique, préalablement digéré avec l'enzyme de restriction appropriée, sur des membranes GeenscreenPlus (Dupont NEN) a été réalisé dans NaOH 0,4 M selon Ausubel et al. (1995). Les hybridations ont été effectuées en utilisant comme sonde l'oligonucleotide marqué à son extrémité 5' en utilisant du [γ32P]ATP (Amersham) et la polynucléotide kinase (Boehringer Mannheim) selon Sambroock et al. (1989) , ayant la séquence suivante : B2-S TTGGCGAAGTCGACCAGGTC (SEQ ID N° 30) correspondant à la région d'ADN du début du gène eryG située de la position 4118 à la position 4137 de la séquence déposée dans la base EMBL sous la référence X60379 et décrite par Haydock et al. (1991) . Les hybridations ont été effectuées avec un tampon d'hybridation rapide (Amersham) et les conditions de lavage suivantes : 2 x 5 n, 2 x SSC, 20°C ; 30 mn, 2 x SSC, 65°C ; 30 mn, 0,1 x SSC, 20°C.Depending on the position of the second recombination event with respect to the deletion site (FIG. 4), it can be expected that the phenotype of the thiostrepton-sensitive colonies is of the wild type or of the mutated type carrying the deletion. Among the colonies sensitive to thiostrepton, the selection of the mutants having the phenotype ery ~ was carried out by antibiogram on the strain B. pumiluε ATCC 14884 sensitive to erythromycin. The B. pumilus strain was used as an indicator strain to evaluate the production of erythromycin in bioassays by antibiogram. The colonies were spread with a platinum loop on R2T2 dishes, then incubated for 3 to 4 days at 30 ° C. Agar zones where the mutant has grown to confluence have then taken with a cookie cutter and then placed on A-Merck boxes covered with a 4 ml overlay of 0.5 x A Merck (Antibiotic agar No. 1 Merck) inoculated with a suspension of B. pumilus spores , then incubated overnight at 37 ° C. The presence of the expected deletion in the mutant chromosome (deletion of 853 bp from nucleotide 8011 to nucleotide 8863 in FIG. 2) was then confirmed by genomic analysis by Southern blot as well as by PCR as follows: For analysis by Southern blot, the transfer of genomic DNA, previously digested with the appropriate restriction enzyme, onto GeenscreenPlus membranes (Dupont NEN) was carried out in 0.4 M NaOH according to Ausubel et al. (1995). The hybridizations were carried out using as probe the oligonucleotide labeled at its 5 ′ end using [γ 32 P] ATP (Amersham) and the polynucleotide kinase (Boehringer Mannheim) according to Sambroock et al. (1989), having the following sequence: B2-S TTGGCGAAGTCGACCAGGTC (SEQ ID No. 30) corresponding to the DNA region at the start of the eryG gene located from position 4118 to position 4137 of the sequence deposited in the EMBL database under the reference X60379 and described by Haydock et al. (1991). The hybridizations were carried out with a rapid hybridization buffer (Amersham) and the following washing conditions: 2 × 5 n, 2 × SSC, 20 ° C; 30 min, 2 x SSC, 65 ° C; 30 min, 0.1 x SSC, 20 ° C.
Par hybridation Southern sur l'ADN génomique isolé selon Hopwood et al. (1985) puis digéré par l'enzyme de restriction Kpnl , une bande de 5,8 kb à partir de la souche sauvage "red variant" et une bande de 4,9 kb à partir du mutant BII92 ont été détectées. Les résultats montrés à la figure 15 indiquent la présence chez le mutant d'une délétion d'environ 900 pb dans cette région du chromosome.By Southern hybridization on the genomic DNA isolated according to Hopwood et al. (1985) then digested with the restriction enzyme Kpnl, a band of 5.8 kb from the wild strain "red variant" and a band of 4.9 kb from the mutant BII92 were detected. The results shown in FIG. 15 indicate the presence in the mutant of a deletion of approximately 900 bp in this region of the chromosome.
Pour l'analyse par PCR ,un échantillon de 100 μl d'une culture de 3 jours en milieu TSB a été centrifugé. Le culot obtenu a été remis en suspension dans 10 μl de milieu TSB, puis utilisé pour l'amplification dans l'appareil genA p PCR System 9600 (Perkin El er Cetus) . Après chauffage de l'échantillon pendant 3 mn à 94 °C, les conditions d'amplification suivantes ont été utilisées : 94 °C, 1 mn ; 55°C, 1 mn ; 72 °C, 3 mn ; 30 cycles ; polymérase Ampli Taq (Perkin Elmer) en présence de diméthylsufoxyde 10 % (v/v) suivis d'une élongation de 3 mn à 72 °C . L'amplification a été effectuée en utilisant l'oligonucleotide B2S ci-dessus et l'oligonucleotide ayant la séquence suivante B2-R GCCGCTCGGCACGGTGAACTTCA (SEQ ID N° 31) correspondant à la séquence du brin complémentaire de la région d'ADN située de la position 8873 à la position 8892 de la séquence de la figure 2 à laquelle ont été ajoutés trois nucléotides à l'extrémité 5' et permettant d'encadrer par amplification PCR la région portant la délétion interne à 1 'ORF7. L'analyse par amplification par PCR sur des cellules entières a permis de détecter une bande d'environ 1 kb dans la souche sauvage et une bande de 0,16 kb dans le mutant BII92 de façon identique au signal obtenu avec le plasmide pBHΔ. Les résultats montrés à la figure 16 confirment que la délétion d'environ 900 pb détectée par l'analyse Southern est identique à celle portée par le plasmide pBHΔ (853 pb) .For the PCR analysis, a 100 μl sample of a 3-day culture in TSB medium was centrifuged. The pellet obtained was resuspended in 10 μl of TSB medium, then used for amplification in the genA p PCR System 9600 device (Perkin El er Cetus). After heating of the sample for 3 min at 94 ° C, the following amplification conditions were used: 94 ° C, 1 min; 55 ° C, 1 min; 72 ° C, 3 min; 30 cycles; Ampli Taq polymerase (Perkin Elmer) in the presence of 10% dimethylsulfoxide (v / v) followed by an elongation of 3 min at 72 ° C. The amplification was carried out using the oligonucleotide B2S above and the oligonucleotide having the following sequence B2-R GCCGCTCGGCACGGTGAACTTCA (SEQ ID No. 31) corresponding to the sequence of the complementary strand of the DNA region located in the position 8873 at position 8892 of the sequence of FIG. 2 to which three nucleotides have been added at the 5 ′ end and making it possible to frame, by PCR amplification, the region carrying the internal deletion at 1 ORF7. Analysis by PCR amplification on whole cells made it possible to detect a band of approximately 1 kb in the wild strain and a band of 0.16 kb in the mutant BII92 in an identical manner to the signal obtained with the plasmid pBHΔ. The results shown in FIG. 16 confirm that the deletion of approximately 900 bp detected by the Southern analysis is identical to that carried by the plasmid pBHΔ (853 bp).
La souche recombinante ainsi obtenue, désignée BII92, a été ensuite cultivée pour identifier les métabolites produits par la souche. EXEMPLE 4 : fermentation de la souche BII92 et identification des métabolites secondaires produits.The recombinant strain thus obtained, designated BII92, was then cultured to identify the metabolites produced by the strain. EXAMPLE 4 Fermentation of the BII92 strain and identification of the secondary metabolites produced.
Des extraits de bouillon de culture de la souche ont été analysés par chromatographie en couche mince (ccm) avec l' érythromycine A, l' érythronolide B et le 3-α-mycarosyl érythronolide B comme standards.Extracts of culture broth of the strain were analyzed by thin layer chromatography (cmc) with erythromycin A, erythronolide B and 3-α-mycarosyl erythronolide B as standards.
La souche BII92 a été cultivée en erlen de 50 ml dans les conditions permettant une production optimale d' érythromycine A et de ses dérivés qui consistent à effectuer une préculture cellulaire à 28 °C pendant 48 heures dans le milieu EPI (Solulys L-Corn steep liquor (Roquette frères) 5 g/1 ; farine de soja déshuilée (Cargill) 10 g/1 ; C03Ca 2 g/1 ; CINa 5 g/1 ; pH = 6,8 ; glucose qsp 15 g/1 ajouté après autoclavage) , puis une culture pendant 72 heures après dilution à 7 % v/v avec le milieu EP2 (farine de soja déshuilée 10 g/1 ; C03Ca 0,2 g/1 ; Cl2Co-6H20 1 mg/1 ; pH = 6,8-7,0 ; glucose qsp 20 g/1 ajouté après autoclavage).The BII92 strain was cultivated in a 50 ml Erlenmeyer flask under the conditions allowing optimal production of erythromycin A and its derivatives which consist in carrying out a cell preculture at 28 ° C. for 48 hours in PPE medium (Solulys L-Corn steep liquor (Roquette frères) 5 g / 1; deoiled soy flour (Cargill) 10 g / 1; C0 3 Ca 2 g / 1; CINa 5 g / 1; pH = 6.8; glucose qs 15 g / 1 added after autoclaving), then culture for 72 hours after dilution to 7% v / v with EP2 medium (deoiled soy flour 10 g / 1; C0 3 Ca 0.2 g / 1; Cl 2 Co-6H 2 0 1 mg / 1; pH = 6.8- 7.0; glucose qs 20 g / 1 added after autoclaving).
Le surnageant de culture a été ensuite extrait à pH 9-10 avec de l'acétate d'éthyle. Les phases organiques ont été séchées sur S04Mg, amenées à sec sous pression réduite puis analysées par ccm sur gel de silice 60 F254 (Merck) [dichloro éthane/méthanol (90:10, v/v) ou éther isopropylique/méthanol/NH4OH à 25 % (75:35:2, v/v)]. De façon alternative, l'analyse a été réalisée par ccm sur des plaques de gel de silice greffées de type NH2 F254 (Merk) [chlorure de butyle/méthanol (90:10, v/v)].The culture supernatant was then extracted at pH 9-10 with ethyl acetate. The organic phases were dried over SO 4 Mg, brought to dryness under reduced pressure and then analyzed by ccm on silica gel 60 F254 (Merck) [dichloroethane / methanol (90:10, v / v) or isopropyl ether / methanol / 25% NH 4 OH (75: 35: 2, v / v)]. Alternatively, the analysis was carried out by ccm on grafted silica gel plates of NH 2 F254 type (Merk) [butyl chloride / methanol (90:10, v / v)].
La révélation chimique des plaques a été effectuée par pulvérisation d'une solution de p-anisaldéhyde-acide sulfurique 98 %-éthanol (1:1:9, v/v), suivie de chauffage pendant quelques minutes à 80 °C. Les activités antibiotiques potentielles ont été analysées par bioautographie directe des plaques de ccm sur agar ensemencé de B. pumilus ATCC 14884. Les résultats obtenus par révélation chimique (figure 17) montrent que la souche BII92 accumule préférentiellement 1' érythronolide B comme attendu d'un mutant eryB.The chemical development of the plates was carried out by spraying with a solution of p-anisaldehyde-sulfuric acid 98% -ethanol (1: 1: 9, v / v), followed by heating for a few minutes at 80 ° C. The potential antibiotic activities were analyzed by direct bioautography of the ccm plates on agar seeded with B. pumilus ATCC 14884. The results obtained by chemical revelation (FIG. 17) show that the strain BII92 preferentially accumulates erythronolide B as expected from a mutant eryB.
Des métabolites mineurs de faible mobilité manifestant une activité antibiotique ont également été détectés. Ces métabolites ont été extraits à l'acétate d'éthyle et identifiés par chromatographie liquide à haute performance en phase inverse (RP-HPLC) couplée à la spectrométrie de masse. La RP-HPLC a été effectuée sur colonne (250 x 4,6mm) de Kro asil C18 5μ en utilisant comme phase mobile le mélange acétonitrile/méthanol/acétate d'ammonium 0,065 M pH 6,7 (350:150:500, v/v) sur un chromatographe Waters équipé d'un spectromètre de masse Finningan TSQ 7000.Low mobility minor metabolites exhibiting antibiotic activity have also been detected. These metabolites were extracted with ethyl acetate and identified by reverse-phase high performance liquid chromatography (RP-HPLC) coupled with mass spectrometry. The RP-HPLC was carried out on a column (250 x 4.6 mm) of Kro asil C18 5μ using the acetonitrile / methanol / 0.065 M ammonium acetate pH 6.7 mixture as the mobile phase (350: 150: 500, v / v) on a Waters chromatograph equipped with a Finningan TSQ 7000 mass spectrometer.
A côté de traces d' érythromycine A, B, C et D, 4 métabolites mineurs dénommés Ml à M4 ont été détectés : - Ml donne un pic parent à m/z 704 et des produits de fragmentation à m/z 576 et m/z 158. La présence de désaminyl- érythronolide A (m/z 576) indique que la différence de m/z de 30 comparée à l' érythromycine A (m/z 734) ou de 16 comparée à 1' érythromycine C (m/z 720) est portée par le résidu sucre neutre. La structure proposée pour Ml est la 3"-C désméthyl- 2",3"-ène-érythromycine C.Next to traces of erythromycin A, B, C and D, 4 minor metabolites called Ml to M4 were detected: - Ml gives a parent peak at m / z 704 and fragmentation products at m / z 576 and m / z 158. The presence of deaminerythronolide A (m / z 576) indicates that the difference in m / z of 30 compared to erythromycin A (m / z 734) or 16 compared to erythromycin C (m / z 576) z 720) is carried by the sugar residue neutral. The proposed structure for Ml is 3 "-C desmethyl- 2", 3 "-ene-erythromycin C.
- M2 donne un pic parent à m/z 706 et des produits de fragmentation à m/z 576 et m/z 158. La présence de désaminyl- érythronolide A (m/z 576) indique que la différence de m/z de 28 comparée à 1 ' érythromycine A (m/z 734) ou de 14 comparée à 1 ' érythromycine C (m/z 720) est portée par le résidu sucre neutre. La structure proposée pour M2 est la 3"-C dés éthyl- érythromycine C. - M3 donne un pic parent à m/z 690 et des produits de fragmentation à m/z 560 et m/z 158. La présence de désaminyl- érythronolide B (m/z 560) indique que la différence de m/z de 28 comparée à l' érythromycine B (m/z 718) ou de 14 comparée à 1' érythromycine D (m/z 704) est portée par le résidu sucre neutre. La structure proposée pour M3 est la 3"-C désméthyl- érythromycine D.- M2 gives a parent peak at m / z 706 and fragmentation products at m / z 576 and m / z 158. The presence of deaminerythronolide A (m / z 576) indicates that the difference in m / z of 28 compared to 1 erythromycin A (m / z 734) or 14 compared to 1 erythromycin C (m / z 720) is carried by the neutral sugar residue. The proposed structure for M2 is 3 "-C ethyl ethyl erythromycin C. - M3 gives a parent peak at m / z 690 and fragmentation products at m / z 560 and m / z 158. The presence of deaminyl erythronolide B (m / z 560) indicates that the difference in m / z of 28 compared to erythromycin B (m / z 718) or of 14 compared to erythromycin D (m / z 704) is carried by the sugar residue neutral. The proposed structure for M3 is 3 "-C desmethyl- erythromycin D.
- M4 donne un pic parent à m/z 720 et des produits de fragmentation à m/z 576 et m/z 158. Le profil est identique à celui de l' érythromycine C (m/z 720) avec la présence de désosaminylérythronolide A (m/z 576) et la perte du résidu sucre aminé (m/z 158) , mais le métabolite M4 n'a pas le même temps de rétention en RP-HPLC que l' érythromycine. La structure proposée pour M4 est la 3"-C désméthyl- érythromycine A. La détection par SM-SM du métabolite mineur Ml ayant un sucre neutre insaturé (3"-C désméthyl-2" , 3"-ène-érythromycine C) indique que le gène eryBII code pour la dTDP-4-céto-L-6- désoxyhexose 2, 3-réductase dans la voie de biosynthèse du dTDP-mycarose. La souche BII92 a été déposée à la Collection Nationale de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 16 juillet 1997 sous le numéro 1-1903. EXEMPLE 5 : construction du plasmide pCIIlΔ. LORF8 pouvant être traductionnellement couplée à 1ORF7 située en aval, une délétion en phase a été introduite de façon à éviter un effet polaire. Un plasmide d'intégration, dénommé pCIUΔ porteur d'une telle délétion, a été construit selon le schéma de la figure 7 (A-D) .- M4 gives a parent peak at m / z 720 and fragmentation products at m / z 576 and m / z 158. The profile is identical to that of erythromycin C (m / z 720) with the presence of desosaminylerythronolide A (m / z 576) and the loss of the amino sugar residue (m / z 158), but the metabolite M4 does not have the same retention time in RP-HPLC as erythromycin. The proposed structure for M4 is 3 "-C desmethyl- erythromycin A. Detection by SM-SM of the minor metabolite Ml having an unsaturated neutral sugar (3" -C desmethyl-2 ", 3" -ene-erythromycin C) indicates that the eryBII gene codes for dTDP-4-keto-L-6-deoxyhexose 2,3-reductase in the biosynthetic pathway for dTDP-mycarose. The BII92 strain was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, on July 16, 1997 under the number 1-1903. EXAMPLE 5 Construction of the plasmid pCIIlΔ. Since LORF8 can be translated in translation to 1ORF7 located downstream, a phase deletion has been introduced so as to avoid a polar effect. An integration plasmid, called pCIUΔ carrying such a deletion, was constructed according to the diagram in Figure 7 (AD).
Une délétion Sali de 663 pb a été introduite dans 1ORF8 du nucleotide 9384 au nucleotide 10046 de la séquence de la figure 2 en sous-clonant dans le plasmide pUC19 les deux fragments Sali (a : 794 pb et b : 631 pb montrés à la figure 5A ) isolés à partir du plasmide pBK44 obtenu à l'exemple 1 pour générer le plasmide pdel88 (figure 7A) . La présence de la délétion de 663 pb a été confirmée par séquençage. Le plasmide pdel88 a été ensuite soumis à deux sous-clonages additionnels de façon à élargir les régions chromosomiques utilisables pour la recombinaison homologue des deux cotés du site de délétion. Le fragment Sacl (450 pb) du plasmide pdel88 a d'abord été remplacé par le fragment Sacl (1,1 kb) du plasmide pEco2 obtenu à l'exemple 1 pour générer le plasmide pdel88A (figure 7B) . Puis le fragment EcoRI (1,5 kb) portant la délétion dans 1ORF8 a été isolé du plasmide pdelδδA et utilisé pour remplacer le fragment BcoRI (1,66 kb) porteur de l'ORF intacte dans le plasmide pOBB. Le plasmide pOBB, représenté à la figure 7C, correspond au plasmide pBK44 préparé à l'exemple 1 dans le site PstI duquel a été sous- cloné le fragment PstI de 4 kb du plasmide pIJ486 obtenu par digestion par l'enzyme de restriction PstI et porteur de l'origine de réplication streptomyces ainsi que du gène de résistance au thiostrepton. Le plasmide résultant pCIIlΔ porte des régions chromosomiques pour la recombinaison homologue de 1,27 kb et 1,38 kb respectivement en amont et en aval du site de délétion. Le plasmide pCIIlΔ ainsi obtenu (figure 7D) a ensuite été transféré dans la souche E . coli DH5αMRC, puis utilisé pour transformer Sac . erythraea . EXEMPLE 6 : construction d'une souche Sac. erythraea eryCIIlΔ (CIII68) .A Sali deletion of 663 bp was introduced into 1ORF8 from nucleotide 9384 to nucleotide 10046 of the sequence of FIG. 2 by subcloning in the plasmid pUC19 the two SalI fragments (a: 794 bp and b: 631 bp shown in FIG. 5A) isolated from the plasmid pBK44 obtained in Example 1 to generate the plasmid pdel88 (FIG. 7A). The presence of the 663 bp deletion was confirmed by sequencing. The plasmid pdel88 was then subjected to two additional subcloning so as to widen the chromosomal regions which can be used for homologous recombination on both sides of the deletion site. The SacI fragment (450 bp) of the plasmid pdel88 was first replaced by the SacI fragment (1.1 kb) of the plasmid pEco2 obtained in Example 1 to generate the plasmid pdel88A (FIG. 7B). Then the EcoRI fragment (1.5 kb) carrying the deletion in 1ORF8 was isolated from the plasmid pdelδδA and used to replace the BcoRI fragment (1.66 kb) carrying the intact ORF in the plasmid pOBB. The plasmid pOBB, represented in FIG. 7C, corresponds to the plasmid pBK44 prepared in Example 1 in the PstI site from which the 4 kb PstI fragment of the plasmid pIJ486 was subcloned, obtained by digestion with the restriction enzyme PstI and carrying the origin of replication streptomyces as well as the thiostrepton resistance gene. The resulting plasmid pCIIlΔ carries chromosomal regions for homologous recombination of 1.27 kb and 1.38 kb respectively upstream and downstream of the deletion site. The plasmid pCIIlΔ thus obtained (FIG. 7D) was then transferred to the strain E. coli DH5αMRC, then used to transform Sac. erythraea. EXAMPLE 6: Construction of a Sac strain. erythraea eryCIIlΔ (CIII68).
Une souche dans laquelle le gène eryCIII porte une délétion interne telle que celle introduite dans le plasmide pCIUΔ obtenu à l'exemple 5 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pCIUΔ. La préparation des protoplastes, le processus d'intégration et la sélection des mutants ayant le phénotype ery~ ont été réalisés comme à l'exemple 3. De plus, la présence de la délétion attendue dans le chromosome (délétion de 663 pb du nucleotide 9384 au nucleotide 10046 de la séquence de la figure 2) a été confirmée par analyse génomique par Southern blot ainsi que par amplification par PCR selon les conditions décrites à 1 ' exemple 3.A strain in which the eryCIII gene carries an internal deletion such as that introduced into the plasmid pCIUΔ obtained in Example 5 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCIUΔ. The protoplast preparation, the integration process and the selection of the mutants having the ery ~ phenotype were carried out as in Example 3. In addition, the presence of the expected deletion in the chromosome (663 bp deletion from nucleotide 9384 to nucleotide 10046 of the sequence of FIG. 2) was confirmed by genomic analysis by Southern blot as well as by PCR amplification according to the conditions described in Example 3.
Par hybridation Southern sur l'ADN génomique digéré par l'enzyme de restriction EcoRI , en utilisant comme sonde l'oligonucleotide ayant la séquence suivante C3-S ATGCGCGTCGTCTTCTCCTCCATG (SEQ ID N° 32) correspondant au brin complémentaire de la région d'ADN située de la position 10196 à la position 10219 de la séquence de la figure 2, une bande de 2,2 kb à partir de la souche sauvage et une bande de 1,5 kb à partir du mutant CIII68 ont été détectées. Les résultats montrés à la figure 15 indiquent la présence chez le mutant d'une délétion d'environ 700 pb dans cette région du chromosome.By Southern hybridization on genomic DNA digested by the restriction enzyme EcoRI, using as oligonucleotide probe having the following sequence C3-S ATGCGCGTCGTCTTCTCCTCCATG (SEQ ID No. 32) corresponding to the complementary strand of the DNA region located from position 10196 to position 10219 of the sequence of Figure 2, a 2.2 kb band from the wild strain and a 1.5 kb band from the mutant CIII68 were detected. The results shown in FIG. 15 indicate the presence in the mutant of a deletion of approximately 700 bp in this region of the chromosome.
L'amplification par PCR a été effectuée en utilisant l'oligonucleotide C3-S ci-dessus et l'oligonucleotide ayant la séquence suivanteThe PCR amplification was carried out using the oligonucleotide C3-S above and the oligonucleotide having the following sequence
C3-R TCATCGTGGTTCTCTCCTTCC (SEQ ID N° 33) correspondant à la séquence située de la position 8954 à la position 8974 de la séquence de la figure 2 permettant d'encadrer par amplification PCR la région portant la délétion interne à 1ORF8. L'analyse par amplification par PCR a permis de détecter une bande d'environ 1,2 kb dans la souche sauvage et une bande d'environ 0,6 kb dans le mutant CIII68 de façon identique au signal obtenu avec pCIUΔ. Les résultats montrés à la figure 16 confirment que la délétion d'environ 700 pb détectée par l'analyse de Southern est identique à celle portée par le plasmide pCIIlΔ (663 pb) .C3-R TCATCGTGGTTCTCTCCTTCC (SEQ ID No. 33) corresponding to the sequence located from position 8954 to position 8974 of the sequence in FIG. 2 allowing the region carrying the internal deletion to 1ORF8 to be framed by PCR amplification. Analysis by PCR amplification made it possible to detect a band of approximately 1.2 kb in the wild-type strain and a band of approximately 0.6 kb in the mutant CIII68 in an identical manner to the signal obtained with pCIUΔ. The results shown in FIG. 16 confirm that the deletion of approximately 700 bp detected by the Southern analysis is identical to that carried by the plasmid pCIIlΔ (663 bp).
La souche recombinante ainsi obtenue, désignée CIII68, a été ensuite cultivée pour identifier les métabolites produits par la souche. EXEMPLE 7 : fermentation de la souche CIII68 et identification des métabolites secondaires produits.The recombinant strain thus obtained, designated CIII68, was then cultured to identify the metabolites produced by the strain. EXAMPLE 7 Fermentation of the CIII68 strain and identification of the secondary metabolites produced.
La culture de la souche CIII68 et les analyses par ccm suivie de bioautographie ont été réalisées selon les conditions indiquées à l'exemple 4.The culture of the strain CIII68 and the analyzes by cmc followed by bioautography were carried out according to the conditions indicated in Example 4.
Les résultats de ccm (figure 17) montrent que la souche CII68 accumule préférentiellement du 3-α-mycarosyl érythronolide B ainsi que de petites quantités d' érythronolide B comme attendu d'un mutant eryC.The ccm results (FIG. 17) show that the CII68 strain preferentially accumulates 3-α-mycarosyl erythronolide B as well as small amounts of erythronolide B as expected from an eryC mutant.
La séquence eryCIII présente une forte homologie avec d'autres glycosyltransferases putatives telles que DauH (43 % d'identité au niveau protéique) et DnrS (47 % d'identité) impliquées dans la biosynthèse de la daunorubicine chez S. peucetiuε (Otten et al., 1995) et chez Streptomyces sp C5 (Dickens et al., 1996) ainsi que TylM2 (50 % d'identité) impliquée dans le transfert du mycaminose sur la tylactone dans la voie de biosynthèse de la tylosine chez S. fradiae (Gandecha et al., 1997). Ces observations indiquent que gène eryCIII code pour la désosaminyltransférase dans la voie de biosynthèse de 1 ' érythromycine. EXEMPLE 8 : construction du plasmide pCHΔ .The eryCIII sequence has strong homology with other putative glycosyltransferases such as DauH (43% identity at the protein level) and DnrS (47% identity) involved in the biosynthesis of daunorubicin in S. peucetiuε (Otten et al ., 1995) and in Streptomyces sp C5 (Dickens et al., 1996) as well as TylM2 (50% identity) involved in the transfer of mycaminosis to tylactone in the pathway of tylosin biosynthesis in S. fradiae (Gandecha et al., 1997). These observations indicate that the eryCIII gene codes for deosaminyltransferase in the biosynthetic pathway of erythromycin. EXAMPLE 8 Construction of the plasmid pCHΔ.
Un plasmide d'intégration, dénommé pCHΔ et portant une délétion dans le gène eryBII codant pour 1ORF9, a été construit selon le schéma de la figure 8A.An integration plasmid, called pCHΔ and carrying a deletion in the eryBII gene coding for 1ORF9, was constructed according to the diagram of FIG. 8A.
Le plasmide pK23 (figure 5A) a été obtenu par sous- clonage dans pUC19 du fragment Kpn de 10 kb isolé à partir de l'ADN du clone XSE5.5 digéré par l'enzyme de restriction Kpnl.Plasmid pK23 (FIG. 5A) was obtained by subcloning into pUC19 the 10 kb Kpn fragment isolated from the DNA of clone XSE5.5 digested with the restriction enzyme Kpn1.
Dans un premier temps, le vecteur navette pORTl, montré à la figure 8B, a été obtenu par sous-clonage du fragment PstI de 4kb isolé par digestion du plasmide pIJ486 avec l'enzyme de restriction PstI incluant le gène de résistance au thiostrepton et le réplicon Streptomyces, dans le site PstI de pUC19.Initially, the shuttle vector pORT1, shown in FIG. 8B, was obtained by subcloning the PstI fragment of 4kb isolated by digestion of the plasmid pIJ486 with the restriction enzyme PstI including the thiostrepton resistance gene and the replicon Streptomyces, in the PstI site of pUC19.
Une délétion hors phase de 304 pb a été introduite dans 1ORF9 du nucleotide 10881 au nucleotide 11184 de la séquence de la figure 2 en sous-clonant le fragment Sacl-Kpnl (1,1 kb) du plasmide pK23 avec le fragment EcoRI-Kpnl (1,7 kb) du plasmide piîco2 obtenu à l'exemple 1 dans le plasmide pORTl ci-dessus préalablement digéré avec les enzymes de restriction Sacl et EcoRI . Le plasmide d'intégration pCHΔ ainsi obtenu (figure 8C) a été ensuite transféré dans la souche E. coli DHδαMRC, puis utilisé pour transformer Sac. erythraea . EXEMPLE 9 : construction d'une souche Sac. erythraea eryCIlΔ (CII62) . Une souche dans laquelle le gène eryCII porte une délétion interne telle que celle introduite dans le plasmide pCHΔ obtenu à l'exemple 8 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pCIlΔ. La préparation des protoplastes, le processus d'inté- gration et la sélection des mutants ayant le phénotype ery~ ont été réalisés comme à l'exemple 3.An out-of-phase deletion of 304 bp was introduced into 1ORF9 from nucleotide 10881 to nucleotide 11184 of the sequence of FIG. 2 by subcloning the Sacl-Kpnl fragment (1.1 kb) of the plasmid pK23 with the EcoRI-Kpnl fragment ( 1.7 kb) of the plasmid piîco2 obtained in Example 1 in the plasmid pORTl above previously digested with the restriction enzymes Sacl and EcoRI. The integration plasmid pCHΔ as well obtained (Figure 8C) was then transferred to the E. coli DHδαMRC strain, then used to transform Sac. erythraea. EXAMPLE 9: Construction of a Sac strain. erythraea eryCIlΔ (CII62). A strain in which the eryCII gene carries an internal deletion such as that introduced into the plasmid pCHΔ obtained in Example 8 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCIlΔ. The preparation of the protoplasts, the integration process and the selection of the mutants having the ery ~ phenotype were carried out as in Example 3.
De plus, la présence de la délétion attendue dans le chromosome (délétion de 304 bp du nucleotide 10881 au nucleotide 11184 de la séquence de la figure 2) a été confirmée par analyse génomique par Southern blot ainsi que par PCR selon les conditions décrites à l'exemple 3.In addition, the presence of the expected deletion in the chromosome (deletion of 304 bp from nucleotide 10881 to nucleotide 11184 of the sequence of FIG. 2) was confirmed by genomic analysis by Southern blot as well as by PCR according to the conditions described in l 'example 3.
Par hybridation Southern sur l'ADN génomique digéré par l'enzyme de restriction EcoRI , en utilisant comme sonde l'oligonucleotide C3-S ayant la séquence ci-dessus, une bande de 2,2 kb à partir de la souche sauvage et une bande de 1,8 kb à partir du mutant CII62 ont été détectées. Les résultats montrés à la figure 15 indiquent chez le mutant la présence d'une délétion d'environ 400 pb dans cette région du chromosome. L'amplification par PCR a été effectuée en utilisant l'oligonucleotide ayant la séquence suivante C2-S GGAATTCATGACCACGACCGATC (SEQ ID N° 34) correspondant au brin complémentaire de la région d'ADN de la fin du gène eryAIII située de la position 20258 à la position 20280 de la séquence déposée dans la base EMBL sous la référence X62569 et décrite par Bevitt et al., 1992 et l'oligonucleotide ayant la séquence suivante C2-R CGCTCCAGGTGCAATGCCGGGTGCAGGC (SEQ ID N° 35) correspondant à la séquence située de la position 10558 à la position 10585 de la séquence de la figure 2 permettant d'encadrer par amplification PCR la région portant la délétion interne à 1ORF9. L'analyse par amplification par PCR a permis de détecter une bande d'environ 760 pb dans la souche sauvage et une bande d'environ 460 pb dans le mutant CII62 de façon identique au signal obtenu avec pCIlΔ. Les résultats montrés à la figure 16 confirment que la délétion d'environ 400 pb détectée par l'analyse Southern est identique à celle portée par le plasmide pCHΔ (304 pb) .By Southern hybridization on the genomic DNA digested with the restriction enzyme EcoRI, using as probe oligonucleotide C3-S having the sequence above, a band of 2.2 kb from the wild strain and a band 1.8 kb from the mutant CII62 were detected. The results shown in FIG. 15 indicate in the mutant the presence of a deletion of approximately 400 bp in this region of the chromosome. The PCR amplification was carried out using the oligonucleotide having the following sequence C2-S GGAATTCATGACCACGACCGATC (SEQ ID No. 34) corresponding to the complementary strand of the DNA region at the end of the eryAIII gene located at position 20258 at position 20280 of the sequence deposited in the EMBL base under the reference X62569 and described by Bevitt et al., 1992 and the oligonucleotide having the following sequence C2-R CGCTCCAGGTGCAATGCCGGGTGCAGGC (SEQ ID No. 35) corresponding to the sequence located in position 10558 at position 10585 of the sequence of FIG. 2 allowing the region carrying the internal deletion to 1ORF9 to be framed by PCR amplification. PCR amplification analysis detected a band of approximately 760 bp in the wild strain and a band of approximately 460 bp in the mutant CII62 in an identical manner to the signal obtained with pCIlΔ. The results shown in FIG. 16 confirm that the deletion of approximately 400 bp detected by the Southern analysis is identical to that carried by the plasmid pCHΔ (304 bp).
La souche recombinante ainsi obtenue, désignée CII62, a été ensuite cultivée pour identifier les métabolites produits par la souche. EXEMPLE 10 : fermentation de la souche CII62 et identifi- cation des métabolites secondaires produits.The recombinant strain thus obtained, designated CII62, was then cultured to identify the metabolites produced by the strain. EXAMPLE 10 Fermentation of the CII62 strain and identification of the secondary metabolites produced.
La culture de la souche CII62 et les analyses par ccm suivie de bioautographie ont été réalisées selon les conditions indiquées à l'exemple 4.The culture of the CII62 strain and the analyzes by cmc followed by bioautography were carried out according to the conditions indicated in Example 4.
Les résultats de ccm (figure 17) montrent que la souche CII62 accumule préferentiellement du 3-α-mycarosyl érythronolide B ainsi que de petites quantités d' érythronolide B comme attendu d'un mutant eryC.The ccm results (FIG. 17) show that the CII62 strain preferentially accumulates 3-α-mycarosyl erythronolide B as well as small amounts of erythronolide B as expected from an eryC mutant.
La séquence eryCII présente une forte homologie avec des gènes impliqués dans les voies de biosynthèse de la dauno- samine (DnrQ, 38 % d'identité au niveau proteique, Otten et al., 1995) et du mycaminose (protéine codée par l'ORFl*, 40 % d'identité au niveau proteique, Gandecha et al., 1997) qui ont également besoin de transférer un groupement céto en position 3 à partir d'un carbone adjacent. Ces observations indiquent que le gène eryCII code pour la dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase dans la voie de biosynthèse de la dTDP-désosamine.The eryCII sequence has a strong homology with genes involved in the biosynthesis pathways of daunosamine (DnrQ, 38% identity at protein level, Otten et al., 1995) and mycaminose (protein encoded by ORFl *, 40% identity at the protein level, Gandecha et al., 1997) which also need to transfer a keto group in position 3 from an adjacent carbon. These observations indicate that the eryCII gene codes for dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase in the biosynthesis pathway for dTDP-desosamine.
EXEMPLE 11 : clonage et séquençage de la région eryAI-eryK du cluster de gènes de la biosynthèse de l'érythromycine. Des cosmides contenant la région eryAI-eryK du cluster de gènes ery tel que le cosmide Cos6B, ont été isolés par screening d'une banque d'ADN génomique de Sac . erythraea dans le vecteur cosmidique pWE15 (Stratagene) en utilisant comme sonde un fragment d'ADN de 13,2 kb comprenant la totalité du gène eryAI et correspondant à la région d'ADN comprise entre le site Wcol situé à la position 44382 de la séquence de la figure 3 et le site Wcol situé à la position 392 de la séquence X62569 (Bevitt et al., 1992). La sonde a été préparée de la façon suivante : Dans un premier temps, le fragment Ncol de 13,2 kb a été isolé à partir du plasmide pBK25 décrit par Bevitt et al., 1992 et sous-cloné dans le site Smal de pUC18 après remplissage des extrémités Ncol avec le fragment de Klenow. A partir du plasmide pNC012 ainsi généré, le fragment de 13,2 kb a été isolé par digestion avec l'enzyme de restriction Ncol .EXAMPLE 11 Cloning and Sequencing of the eryAI-eryK Region of the Gene Cluster for Erythromycin Biosynthesis. Cosmids containing the eryAI-eryK region of the ery gene cluster, such as the cosmid Cos6B, were isolated by screening of a Sac genomic DNA library. erythraea in the cosmid vector pWE15 (Stratagene) using as probe a DNA fragment of 13.2 kb comprising the entire eryAI gene and corresponding to the region of DNA between the Wcol site located at position 44382 of the sequence in Figure 3 and the Wcol site located at position 392 of the sequence X62569 (Bevitt et al., 1992). The probe was prepared as follows: First, the 13.2 kb Ncol fragment was isolated from the plasmid pBK25 described by Bevitt et al., 1992 and subcloned into the Smal site of pUC18 after filling the Ncol ends with the Klenow fragment. From the plasmid pNC012 thus generated, the 13.2 kb fragment was isolated by digestion with the restriction enzyme Ncol.
Le cosmide cos6B ainsi obtenu a été digéré par l'enzyme de restriction Ncol et les fragments résultants de 2,8 kb et 6,1 kb ont été clones dans le site Ncol du vecteur Litmus28 générant respectivement les plasmides pNC028 et pNC062 montrés à la figure 5B.The cosmid cos6B thus obtained was digested with the restriction enzyme Ncol and the resulting fragments of 2.8 kb and 6.1 kb were cloned into the Ncol site of the vector Litmus28 generating the plasmids pNC028 and pNC062 respectively shown in the figure. 5B.
Le plasmide pNC028 a été séquence par génération de sous-clones en utilisant l'exonucléase III selon le protocole du fournisseur de la trousse Erase-a-Base Kit (Promega) en digérant par les enzymes de restriction respectivement Sac /Xba et Nsil/BamBI pour la direction inverse. La séquence a été complétée en utilisant comme amorces les oligonucléotides synthétiques ayant les séquences suivantes 644 GATCACGCTCTTCGAGCGGCAG (SEQ ID N° 36)Plasmid pNC028 was sequenced by generation of subclones using exonuclease III according to the protocol of the supplier of the Erase-a-Base Kit (Promega) by digesting with the restriction enzymes Sac / Xba and Nsil / BamBI respectively for the reverse direction. The sequence was completed using as primers the synthetic oligonucleotides having the following sequences 644 GATCACGCTCTTCGAGCGGCAG (SEQ ID N ° 36)
645 GAACTCGGTGGAGTCGATGTC (SEQ ID N° 37) et 650 GTTGTCGATCAAGACCCGCAC (SEQ ID N° 38)645 GAACTCGGTGGAGTCGATGTC (SEQ ID N ° 37) and 650 GTTGTCGATCAAGACCCGCAC (SEQ ID N ° 38)
Pour le séquençage du plasmide pNC062, des matrices ont été générées par sonication de l'ADN selon Bankier et al. (1987) en utilisant pUC18 comme vecteur. La séquence a été complétée en utilisant comme amorces les oligonucléotides synthétiques ayant les séquences suivantes :For the sequencing of the plasmid pNC062, templates were generated by sonication of the DNA according to Bankier et al. (1987) using pUC18 as a vector. The sequence was completed using as primers the synthetic oligonucleotides having the following sequences:
646 CATCGTCAAGGAGTTCGACGGT (SEQ ID N° 39)646 CATCGTCAAGGAGTTCGACGGT (SEQ ID N ° 39)
647 TGCGCAGGTCCATGTTCACCACGTT (SEQ ID N° 40) 648 GCTACGCCCTGGAGAGCCTG (SEQ ID N° 41)647 TGCGCAGGTCCATGTTCACCACGTT (SEQ ID N ° 40) 648 GCTACGCCCTGGAGAGCCTG (SEQ ID N ° 41)
649 GTCGCGGTCGGAGAGCACGAC (SEQ ID N° 42) et 874 GCCAGCTCGGCGACGTCCATC (SEQ ID N° 43) .649 GTCGCGGTCGGAGAGCACGAC (SEQ ID No.42) and 874 GCCAGCTCGGCGACGTCCATC (SEQ ID No.43).
Les jonctions Ncol ont été séquencées en utilisant comme matrice l'ADN du cosmide cos6B obtenu ci-dessus dont les régions recouvrant les sites Ncol ont été séquencées en utilisant les amorces ayant les séquences 644 et 645 indiquées ci-dessus.The Ncol junctions were sequenced using as DNA the cosmid cos6B DNA obtained above, the regions covering the Ncol sites were sequenced using the primers having the sequences 644 and 645 indicated above.
De plus, un fragment Clal-Ncol de 0,9 kb, contenant le début de la séquence du gène eryAI et la partie 5' de 1ORF13, a été clone dans pUC18. Ce fragment a été préparé de la façon suivante : Le plasmide pBK6-12 représenté à la figure 5B a d'abord été généré par sous-clonage dans le phagmide pTZ18R du fragment Kpnl de 4,5 kb isolé à partir du plasmide pBK25 décrit par Bevitt et al., 1992. Le sous-clone pCN9 a ensuite été généré par sous-clonage du fragment Clal- Ncol de 0,9 kb isolé à partir du plasmide pBK6-12 dans le site Smal de pUC19, après remplissage des extrémités à l'aide du fragment de Klenow. Le plasmide pCN9 ainsi obtenu (figure 5B) a été séquence. Des matrices ont été générées par sonication de l'ADN selon Bankier et al. (1987) en utilisant pUC18 comme vecteur. La séquence a été complétée en utilisant comme amorce l'oligonucleotide ayant la séquence suivante : 675 CGACGAGGTCGTGCATCAG (SEQ ID N° 44) .In addition, a 0.9 kb Clal-Ncol fragment containing the start of the eryAI gene sequence and the 5 'part of 1ORF13, was cloned into pUC18. This fragment was prepared as follows: The plasmid pBK6-12 shown in FIG. 5B was first generated by subcloning into phagmide pTZ18R the 4.5 kb Kpn1 fragment isolated from the plasmid pBK25 described by Bevitt et al., 1992. The subclone pCN9 was then generated by subcloning the 0.9 kb Clal-Ncol fragment isolated from the plasmid pBK6-12 in the Smal site of pUC19, after filling the ends with using the Klenow fragment. The plasmid pCN9 thus obtained (FIG. 5B) was sequenced. Arrays were generated by DNA sonication according to Bankier et al. (1987) using pUC18 as a vector. The sequence was completed using as an primer the oligonucleotide having the following sequence: 675 CGACGAGGTCGTGCATCAG (SEQ ID No. 44).
Le séquençage de l'ADN est réalisé par la méthode de Sanger (1977) en utilisant un séquenceur automatisé sur les matrices d'ADN double brin avec le séquenceur Applied Biosystem 373 A. L'assemblage des données de séquence a été réalisé avec le logiciel SAP (Staden, 19δ4) . Les séquences ont été analysées en utilisant le logiciel GCG (Devereux, 1984) .DNA sequencing is carried out by Sanger's method (1977) using an automated sequencer on double stranded DNA templates with the Applied Biosystem 373 A sequencer. The assembly of the sequence data was carried out with the software SAP (Staden, 19δ4). The sequences were analyzed using GCG software (Devereux, 1984).
Les séquences nucléotidiques obtenues ont permis d'établir la séquence nucléotidique de δl60 bp de la figure 3 (séquence de SEQ ID N° 6) dans laquelle sept ORFs (13-19) ont été identifiées respectivement du nucleotide 43641 au nucleotide 44806, du nucleotide 44809 au nucleotide 46053, du nucleotide 46109 au nucleotide 46819, du nucleotide 46907 au nucleotide 48436, du nucleotide 48436 au nucleotide 4963δ, du nucleotide 49679 au nucleotide 51145 et du nucleotide 51177 au nucleotide 51755 (numérotés dans la figure 3 à partir du site BamHI situé à l'extrémité 5' du gène erraE) (respectivement séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207, du nucleotide 1210 au nucleotide 2454, du nucleotide 2510 au nucleotide 3220, du nucleotide 3308 au nucleotide 4837, du nucleotide 4837 au nucleotide 6039, du nucleotide 6080 au nucleotide 7546 et du nucleotide 7578 au nucleotide 8156) et correspondant respectivement aux gènes eryBIV, eryBV, eryCVI, eryBVI, eryCIV, eryCV et eryBVII, selon Liu et Thorson (1994) dont les caracterisations fonctionnelles n'avaient pas encore été identifiées. Les sept ORFs (13-19) sont dans la même direction, la lecture se faisant à partir de la région 5' du gène eryAI.The nucleotide sequences obtained made it possible to establish the nucleotide sequence of δ160 bp of FIG. 3 (sequence of SEQ ID No. 6) in which seven ORFs (13-19) were identified respectively from nucleotide 43641 to nucleotide 44806, from nucleotide 44809 at nucleotide 46053, from nucleotide 46109 to nucleotide 46819, from nucleotide 46907 to nucleotide 48436, from nucleotide 48436 to nucleotide 4963δ, from nucleotide 49679 to nucleotide 51145 and from nucleotide 51177 to nucleotide 51755 (numbered in Figure 3 from the site BamHI located at the 5 'end of the erraE gene) (respectively sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207, from nucleotide 1210 to nucleotide 2454, from nucleotide 2510 to nucleotide 3220, from nucleotide 3308 to nucleotide 4837, from nucleotide 4837 at nucleotide 6039, from nucleotide 6080 to nucleotide 7546 and from nucleotide 7578 to nucleotide 8156) and corresponding respectively to the eryBIV genes, eryBV, eryCVI, eryBVI, eryCIV, eryCV and eryBVII, according to Liu and Thorson (1994) whose functional characteristics had not yet been identified. The seven ORFs (13-19) are in the same direction, the reading being done from the 5 ′ region of the eryAI gene.
Des échantillons de E. coli XLl-blue contenant la région codante des ORFs ci-dessus ont été déposés à la Collection Nationale de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 16 juillet 1997 :Samples of E. coli XLl-blue containing the coding region of the above ORFs were deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, July 16 1997 :
- le plasmide pBK6-12 comprenant la séquence codante pour 1ORF13 et pour une partie de 1ORF14 sous le numéro I-lδ98- the plasmid pBK6-12 comprising the coding sequence for 1ORF13 and for a part of 1ORF14 under the number I-lδ98
- le plasmide pNC028 comprenant la séquence codante pour les ORFs 14 et 15 ainsi que pour une partie des ORFs 13 et 16 sous le numéro 1-1901 et- the plasmid pNC028 comprising the coding sequence for ORFs 14 and 15 as well as for a part of ORFs 13 and 16 under the number 1-1901 and
- le plasmide pNC062 comprenant la séquence codante pour les ORFs 17, lδ et 19 ainsi que pour une partie de 1ORF16 sous le numéro 1-1900.- the plasmid pNC062 comprising the coding sequence for ORFs 17, lδ and 19 as well as for part of 1ORF16 under the number 1-1900.
EXEMPLE 12 : construction du plasmide pBIVΔ. LORF13 étant translationnellement couplé à 1ORF14 située en aval, une délétion en phase a dû être introduite. Un plasmide d'intégration, dénommé pBIVΔ et portant cette délétion, a été construit selon le schéma de la figure 9A. Le plasmide pPSP4 (figure 5B) a d'abord été construit par sous-clonage du fragment PvuII-Spel (2,7 kb) isolé à partir du plasmide pBK6-12 obtenu à l'exemple 11 et du fragment Spel-PstI (1,6 kb) isolé à partir du plasmide pNC02δ obtenu à l'exemple 11 dans le vecteur pUC19 préalablement digéré à l'aide des enzymes de restriction Smal et PstI. A partir du plasmide pPSP4 , le plasmide pl9BIVΔ a été généré en délétant le fragment Bcll-Ncol de 510 pb interne à 1ORF13 et en lui substituant 45 pb venant d'un adaptateur synthétique de 54 pb. Cet adaptateur a été généré par appariement des 2 oligonucléotides complémentaires ayant les séquences suivantes SEQ AEXAMPLE 12 Construction of the plasmid pBIVΔ. LORF13 being translationally coupled to 1ORF14 located downstream, a phase deletion had to be introduced. An integration plasmid, called pBIVΔ and carrying this deletion, was constructed according to the diagram in FIG. 9A. The plasmid pPSP4 (FIG. 5B) was first constructed by subcloning the PvuII-Spel fragment (2.7 kb) isolated from the plasmid pBK6-12 obtained in Example 11 and the Spel-PstI fragment (1 , 6 kb) isolated from the plasmid pNC02δ obtained in Example 11 in the vector pUC19 previously digested using the restriction enzymes SmaI and PstI. From the plasmid pPSP4, the plasmid pl9BIVΔ was generated by deleting the BclI-Ncol fragment of 510 bp internal to 1ORF13 and by replacing it with 45 bp coming from a synthetic adapter of 54 bp. This adapter was generated by pairing the 2 complementary oligonucleotides having the following sequences SEQ A
AATTGATCAAGGTGAACACGGTCATGCGCAGGATCCTCGAGCGGAACTCCATGGGG (SEQ ID N° 45) et SEQ BAATTGATCAAGGTGAACACGGTCATGCGCAGGATCCTCGAGCGGAACTCCATGGGG (SEQ ID N ° 45) and SEQ B
CCCCATGGAGTTCCGCTCGAGGATCCTGCGCATGACCGTGTTCACCTTGATCAATT (SEQ ID N° 46) créant un site Bell et un site Ncol encadrant la séquence de 45 pb.CCCCATGGAGTTCCGCTCGAGGATCCTGCGCATGACCGTGTTCACCTTGATCAATT (SEQ ID No. 46) creating a Bell site and an Ncol site framing the 45 bp sequence.
Pour l'appariement, les deux oligonucléotides ont été mis à une concentration finale l,δ μM dans le tampon d'hybridation NaCl 50 mM, Tris, HC1 20 mM pH 7,4, MgCl2,6H20 2 mM, chauffés pendant 5 mn à 100°C puis refroidis lentement à température ambiante. Après digestion avec les enzymes de restriction Ncol et Bell, une ligature a été effectuée dans le plasmide pPSP4 dont le fragment Bcll-Ncol de 510 pb avait préalablement été éliminé. A partir du plasmide pl9BIVΔ ainsi généré, le fragment SacI-BcoRI (2,2 kb) portant 1ORF13 modifiée a été sous-cloné dans le plasmide pUWL218 préalablement digéré avec les enzymes de restriction Sacl et .EcoRI. Le plasmide d'intégration pBIVΔ ainsi obtenu (figure 9B) a été ensuite transféré dans la souche E. coli DHδαMRC, puis utilisé pour transformer Sac . erythraea . EXEMPLE 13 : construction d'une souche Sac. erythraea eryBIV (BIV87) .For pairing, the two oligonucleotides were brought to a final concentration of δ μM in the 50 mM NaCl hybridization buffer, Tris, 20 mM HCl pH 7.4, MgCl 2 , 6H 2 0 2 mM, heated for 5 min at 100 ° C then slowly cooled to room temperature. After digestion with the restriction enzymes Ncol and Bell, a ligation was carried out in the plasmid pPSP4 from which the BclI-Ncol fragment of 510 bp had previously been eliminated. From the plasmid pl9BIVΔ thus generated, the SacI-BcoRI fragment (2.2 kb) carrying a modified 1ORF13 was subcloned into the plasmid pUWL218 previously digested with the restriction enzymes Sacl and .EcoRI. The integration plasmid pBIVΔ thus obtained (FIG. 9B) was then transferred to the E. coli strain DHδαMRC, then used to transform Sac. erythraea. EXAMPLE 13: Construction of a Sac strain. erythraea eryBIV (BIV87).
Une souche dans laquelle le gène eryBIV porte une délétion interne telle que celle introduite dans le plasmide pBIVΔ obtenu à l'exemple 12 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pBIVΔ. La préparation des protoplastes, le processus d'intégration et la sélection des mutants ayant le phénotype ery~ ont été réalisés comme à l'exemple 3.A strain in which the eryBIV gene carries an internal deletion such as that introduced into the plasmid pBIVΔ obtained in Example 12 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pBIVΔ. The protoplast preparation, the integration process and the selection of the mutants having the ery ~ phenotype were carried out as in Example 3.
De plus, la présence de la délétion attendue dans le chromosome (délétion de 510 bp du nucleotide 43872 au nucleotide 44382 de la séquence de la figure 3) et son remplacement par la séquence synthétique de 45 pb a été confirmée par analyse génomique par Southern blot ainsi que par PCR selon les conditions décrites à l'exemple 3. Par hybridation Southern sur l'ADN génomique digéré par l'enzyme de restriction X ol, en utilisant comme sonde l'oligonucleotide B4-R ayant la séquence suivante B4-R AACTCGGTGGAGTCGATGTCGTCGCTGCGGAA (SEQ ID N° 47) correspondant au brin complémentaire de la région d'ADN située de la position 44687 à la position 44718 de la séquence de la figure 3, une bande de 5,4 kb à partir de la souche sauvage et une bande de 2,7 kb à partir du mutant BIV87 ont été détectées. Les résultats montrés à la figure 15 indiquent la présence d'un site Xhol supplémentaire à une distance de 2,7 kb en amont du site Xhol situé à la position 47114 de la séquence de la figure 3 confirmant ainsi l'incorporation de l'adaptateur dans le chromosome de mutant, telle qu'attendue par l'incorporation de l'adaptateur synthétique ci-dessus utilisé pour générer le plasmide pBIVΔ.In addition, the presence of the expected deletion in the chromosome (deletion of 510 bp from nucleotide 43872 to nucleotide 44382 of the sequence in FIG. 3) and its replacement by the synthetic sequence of 45 bp was confirmed by genomic analysis by Southern blot as well as by PCR according to the conditions described in Example 3. By Southern hybridization on the genomic DNA digested by the restriction enzyme X ol, using as probe the oligonucleotide B4-R having the following sequence B4-R AACTCGGTGGAGTCGATGTCGTCGCTGCGGAA (SEQ ID N ° 47) corresponding to the complementary strand of the DNA region located from position 44687 to position 44718 of the sequence of FIG. 3, a band of 5.4 kb from the wild strain and a band of 2.7 kb from mutant BIV87 were detected. The results shown in FIG. 15 indicate the presence of an additional Xhol site at a distance of 2.7 kb upstream from the Xhol site located at position 47114 of the sequence in FIG. 3, thus confirming the incorporation of the adapter. in the mutant chromosome, as expected by the incorporation of the above synthetic adapter used to generate the plasmid pBIVΔ.
L'amplification par PCR a été effectuée en utilisant l'oligonucleotide ayant la séquence suivante B4-S CAATATAGGAAGGATCAAGAGGTTGAC (SEQ ID N° 48) correspondant à la région d'ADN située de la position 43652 à la position 43678 de la séquence de la figure 3 et l'oligonucleotide B4-R ayant la séquence indiquée ci-dessus, permettant d'encadrer par amplification PCR la région portant la délétion interne à 1ORF13. L'analyse par amplification par PCR a permis de détecter une bande d'environ 1 kb dans la souche sauvage et une bande d'environ 500 pb dans le mutant BIV87 de façon identique au signal obtenu avec le plasmide pBIVδ7 (figure 16) .The PCR amplification was carried out using the oligonucleotide having the following sequence B4-S CAATATAGGAAGGATCAAGAGGTTGAC (SEQ ID No. 48) corresponding to the DNA region located from position 43652 to position 43678 of the sequence of the figure 3 and the oligonucleotide B4-R having the sequence indicated above, making it possible to frame by PCR amplification the region carrying the internal deletion at 1ORF13. Analysis by PCR amplification made it possible to detect a band of approximately 1 kb in the wild-type strain and a band of approximately 500 bp in the mutant BIV87 in an identical manner to the signal obtained with the plasmid pBIVδ7 (FIG. 16).
L'ensemble des résultats d'analyse par Southern et par PCR confirme la présence de la délétion de 510 pb et de l'adaptateur synthétique au niveau du chromosome du mutant.All the results of analysis by Southern and by PCR confirm the presence of the 510 bp deletion and of the synthetic adapter at the level of the mutant chromosome.
La souche recombinante ainsi obtenue, désignée BIV67, a été ensuite cultivée pour identifier les métabolites produits par la souche. EXEMPLE 14 : fermentation de la souche BIV87 et identification des métabolites secondaires produits.The recombinant strain thus obtained, designated BIV67, was then cultured to identify the metabolites produced by the strain. EXAMPLE 14 Fermentation of the BIV87 strain and identification of the secondary metabolites produced.
La culture de la souche BIV87 et les analyses par ccm ont été réalisées selon les conditions indiquées à l'exemple 4. Les résultats de ccm (figure 17) montrent que la souche BIV87 accumule préferentiellement de l' érythronolide B comme attendu d'un mutant eryB.The culture of the BIV87 strain and the ccm analyzes were carried out according to the conditions indicated in Example 4. The ccm results (FIG. 17) show that the BIV87 strain preferentially accumulates erythronolide B as expected from a mutant eryB.
Des métabolites mineurs de faibles mobilités manifestant une activité antibiotique ont également été détectés. Ces métabolites ont été extraits et analysés par RP-HPLC couplée à la spectrométrie de masse comme décrit à l'exemple 4.Minor metabolites of low mobility manifesting Antibiotic activity was also detected. These metabolites were extracted and analyzed by RP-HPLC coupled to mass spectrometry as described in Example 4.
Les résultats de spectre de masse indiquent que des formes modifiées de l' érythromycine A, B, C et D ont été produites. Un métabolite majeur et 3 métabolites mineurs ont été détectés.Mass spectrum results indicate that modified forms of erythromycin A, B, C and D have been produced. One major metabolite and 3 minor metabolites were detected.
Le métabolite majeur M5 donne un pic parent à m/z 702 avec des produits de déshydratation et de fragmentation à m/z 684, m/z 560 et m/z 158 et correspond à l'élimination de 2 atomes d'hydrogène dans l' érythromycine D (m/z 704, m/z 686). La présence de désosaminyl érythronolide B (fragment m/z à 560) indique que la différence de masse est portée par le sucre neutre. La structure proposée pour ce métabolite est la 4"-céto érythromycine D.The major metabolite M5 gives a parent peak at m / z 702 with dehydration and fragmentation products at m / z 684, m / z 560 and m / z 158 and corresponds to the elimination of 2 hydrogen atoms in l erythromycin D (m / z 704, m / z 686). The presence of desosaminyl erythronolide B (fragment m / z at 560) indicates that the difference in mass is carried by the neutral sugar. The proposed structure for this metabolite is 4 "-keto erythromycin D.
Les métabolites mineurs donnent aussi un profil avec une différence de 2 dans les valeurs m/z respectivement :The minor metabolites also give a profile with a difference of 2 in the m / z values respectively:
- M6 (m/z à 718, m/z 700, m/z 576, m/z 158) au lieu de m/z 720, m/z 702 pour 1 ' érythromycine C ; - M7 (m/z à 732, m/z 714, m/z 576, m/z 158) au lieu de m/z 734, m/z 716 pour l' érythromycine A ;- M6 (m / z to 718, m / z 700, m / z 576, m / z 158) instead of m / z 720, m / z 702 for erythromycin C; - M7 (m / z to 732, m / z 714, m / z 576, m / z 158) instead of m / z 734, m / z 716 for erythromycin A;
- M8 (m/z à 716, m/z 698, m/z 560, m/z 158) au lieu de m/z 718, m/z 700 pour l' érythromycine B.- M8 (m / z to 716, m / z 698, m / z 560, m / z 158) instead of m / z 718, m / z 700 for erythromycin B.
Les structures proposées sont respectivement la 4"-céto érythromycine C pour M6, la 4"-céto érythromycine A pour M7 et la 4"-céto érythromycine B pour M8.The proposed structures are respectively 4 "-keto erythromycin C for M6, 4" -keto erythromycin A for M7 and 4 "-keto erythromycin B for M8.
Ces observations indiquent que le gène eryBIV code pour la dTDP-4-céto-L-6-désoxyhexose 4-réductase dans la voie de biosynthèse du dTDP-mycarose. La souche BIV87 a été déposé à la Collection Nationale de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 16 juillet 1997 sous le numéro 1-1904 EXEMPLE 15 : construction du plasmide pBVΔ. Un plasmide d'intégration, dénommé pBVΔ et portant une délétion dans le gène eryBV codant pour 1ORF14, a été construit selon le schéma de la figure 10A.These observations indicate that the eryBIV gene codes for dTDP-4-keto-L-6-deoxyhexose 4-reductase in the biosynthetic pathway for dTDP-mycarose. The BIV87 strain was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, on July 16, 1997 under the number 1-1904 EXAMPLE 15: construction of the plasmid pBVΔ. An integration plasmid, called pBVΔ and carrying a deletion in the eryBV gene coding for 1ORF14, was constructed according to the diagram of FIG. 10A.
Une délétion de 726 pb a été générée dans 1ORF14 du nucleotide 44963 au nucleotide 45688 de la séquence de la figure 3 par ligature du fragment Bcll-Kpnl (1,1 kb) isolé à partir du plasmide pBK6-12, obtenu à l'exemple 11, au fragment Kpnl-BamHI (1,1 kb) isolé à partir du plasmide pNC028, obtenu à l'exemple 11, dans le plasmide pUWL218 préalablement digéré par l'enzyme de restriction BamHI. Le plasmide d'intégration pBVΔ ainsi obtenu (figure 10B) a ensuite été transféré dans la souche E. coli DHδαMRC, puis utilisé pour transformer Sac . erythraea . EXEMPLE 16 : construction d'une souche Sac. erythraea eryBV A (BV88) .A 726 bp deletion was generated in 1ORF14 of nucleotide 44963 to nucleotide 45688 of the sequence of FIG. 3 by ligation of the Bcll-Kpnl fragment (1.1 kb) isolated from the plasmid pBK6-12, obtained in Example 11, to the Kpnl-BamHI fragment (1.1 kb) isolated from the plasmid pNC028, obtained in Example 11, in the plasmid pUWL218 previously digested with the restriction enzyme BamHI. The integration plasmid pBVΔ thus obtained (FIG. 10B) was then transferred to the E. coli strain DHδαMRC, then used to transform Sac. erythraea. EXAMPLE 16: Construction of a Sac strain. erythraea eryBV A (BV88).
Une souche dans laquelle le gène eryBV porte une délétion interne telle que celle introduite dans le plasmide pBVΔ obtenu à l'exemple 15 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pBVΔ. La préparation des protoplastes, le processus d'intégration et la sélection des mutants ayant le phénotype ery~ ont été réalisés comme à l'exemple 3.A strain in which the eryBV gene carries an internal deletion such as that introduced into the plasmid pBVΔ obtained in Example 15 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pBVΔ. The protoplast preparation, the integration process and the selection of the mutants having the ery ~ phenotype were carried out as in Example 3.
De plus, la présence de la délétion attendue dans le chromosome (délétion de 726 pb du nucleotide 44963 au nucleotide 45688 de la séquence de la figure 3) a été confirmée par analyse génomique par Southern blot ainsi que par PCR selon les conditions décrites à l'exemple 3.In addition, the presence of the expected deletion in the chromosome (726 bp deletion from nucleotide 44963 to nucleotide 45688 of the sequence of FIG. 3) was confirmed by genomic analysis by Southern blot as well as by PCR according to the conditions described in l 'example 3.
Par hybridation Southern sur l'ADN génomique digéré par l'enzyme de restriction Ncol, en utilisant comme sonde l'oligonucleotide ayant la séquence suivante :By Southern hybridization on the genomic DNA digested by the restriction enzyme Ncol, using as oligonucleotide probe having the following sequence:
B5-R TCCGGAGGTGTGCTGTCGGACGGACTTGTCGGTCGGAAA (SEQ ID N° 49) correspondant au brin complémentaire de la région d'ADN située de la position 46060 à la position 46098 de la séquence de la figure 3, une bande de 2,7 kb à partir de la souche sauvage et une bande de 2,0 kb à partir du mutant BV88 ont été détectées. Les résultats montrés à la figure 15 indiquent chez le mutant la présence d'une délétion d'environ 700 pb dans cette région du chromosome. L'amplification par PCR a été effectuée en utilisant l'oligonucleotide ayant la séquence suivante : B5-S AGGAGCACTAGTGCGGGTACTGCTGACGTCCTT (SEQ ID N° 50) correspondant à la région d'ADN située de la position 44799 à la position 44831 de la séquence de la figure 3 et l'oligonucleotide B5-R ayant la séquence indiquée ci-dessus, permettant d'encadrer par amplification PCR la région portant la délétion interne à 1ORF14. L'analyse par amplification par PCR a permis de détecter une bande d'environ 1,3 kb dans la souche sauvage et une bande d'environ 570 pb dans le mutant BV88 de façon identique au signal obtenu avec le plasmide pBV88 (figure 16) . Ces résultats confirment que la délétion de 710 pb détectée par analyse Southern est identique à celle portée par le plasmide pBVΔ (726 pb) .B5-R TCCGGAGGTGTGCTGTCGGACGGACTTGTCGGTCGGAAA (SEQ ID No. 49) corresponding to the complementary strand of the DNA region located from position 46060 to position 46098 of the sequence of FIG. 3, a band of 2.7 kb from the strain wild and a 2.0 kb band from the mutant BV88 were detected. The results shown in FIG. 15 indicate in the mutant the presence of a deletion of approximately 700 bp in this region of the chromosome. The PCR amplification was carried out using the oligonucleotide having the following sequence: B5-S AGGAGCACTAGTGCGGGTACTGCTGACGTCCTT (SEQ ID No. 50) corresponding to the DNA region located at position 44799 at position 44831 of the sequence of FIG. 3 and the oligonucleotide B5-R having the sequence indicated above, making it possible to frame by PCR amplification the region carrying the internal deletion at 1ORF14. Analysis by PCR amplification made it possible to detect a band of approximately 1.3 kb in the wild strain and a band of approximately 570 bp in the mutant BV88 in an identical manner to the signal obtained with the plasmid pBV88 (FIG. 16). . These results confirm that the deletion of 710 bp detected by Southern analysis is identical to that carried by the plasmid pBVΔ (726 bp).
La souche recombinante ainsi obtenue, désignée BV88, a été ensuite cultivée pour identifier les métabolites produits par la souche.The recombinant strain thus obtained, designated BV88, was then cultured to identify the metabolites produced by the strain.
EXEMPLE 17 : fermentation de la souche BV88 et identification des métabolites secondaires produits.EXAMPLE 17 Fermentation of the BV88 strain and identification of the secondary metabolites produced.
La culture de la souche BV88 et les analyses par ccm ont été réalisées selon les conditions indiquées à l'exemple 4.The culture of the BV88 strain and the ccm analyzes were carried out according to the conditions indicated in Example 4.
Les résultats de ccm (figure 17) montrent que la souche BV88 accumule préferentiellement de l' érythronolide B comme attendu d'un mutant eryB.The ccm results (FIG. 17) show that the BV88 strain preferentially accumulates erythronolide B as expected from an eryB mutant.
Des métabolites mineurs de faibles mobilités ont également été détectés puis extraits et identifiés par RP- HPLC couplée à la spectrométrie de masse selon les conditions utilisées à l'exemple 4. Le spectre de masse montre la présence d'un métabolite ayant un pic parent à m/z 560 et des produits de déshydratation et de fragmentation à m/z 542 et m/z 158 pour lequel la structure proposée est le désosaminyl érythronolide B. La séquence eryBV présente une forte homologie avec d'autres glycosyltransferases ainsi qu'avec le gène eryCIII ci-dessus (60,7 % d'identité au niveau nucléotidique, 44 % au niveau proteique) .Minor metabolites of low mobility were also detected, then extracted and identified by RP-HPLC coupled to mass spectrometry according to the conditions used in Example 4. The mass spectrum shows the presence of a metabolite having a parent peak at m / z 560 and dehydration and fragmentation products at m / z 542 and m / z 158 for which the proposed structure is desosaminyl erythronolide B. The sequence eryBV has strong homology with other glycosyltransferases as well as with eryCIII gene above (60.7% identity at nucleotide level, 44% at protein level).
Ces observations indiquent que le gène eryBV code pour la mycarosyltransférase impliquée dans la biosynthèse de 1 ' érythomycine .These observations indicate that the eryBV gene codes for the mycarosyltransferase involved in the biosynthesis of erythomycin.
EXEMPLE 18 : construction d'un plasmide pCVlΔ (pPSTI) .EXAMPLE 18 Construction of a plasmid pCVlΔ (pPSTI).
Un plasmide d'intégration, dénommé pPSTI et portant une délétion dans le gène eryCVI codant pour 1ORF15, a été construit selon le schéma de la figure 11A de la façon suivante :An integration plasmid, called pPSTI and carrying a deletion in the eryCVI gene coding for 1ORF15, was constructed according to the diagram of FIG. 11A as follows:
Dans un premier temps, le plasmide pNB49 a été généré par traitement à l'exonucléase III du plasmide pNC028 obtenu à l'exemple 11 préalablement digéré par les enzymes de restriction Nsil et BamHI. Le plasmide pNB49 (figure 5B) contenant les nucléotides 44382 à 46562 de la séquence de la figure 3, a été ensuite digéré à l'aide de l'enzyme de restriction PstI puis traité par la nucléase Mung Bean (NE Biolabs) comme décrit par Sambrook et al. (1989) . Après religature et transformation dans E . coli XLl-Blue, les colonies résistantes à l'ampicilline ont été sélectionnées par analyse de restriction avec l'enzyme PstI. La perte du site PstI a été confirmée par séquençage d'un clone en utilisant l'amorce M13 inverse et la délétion du nucleotide 46364 de la séquence de la figure 3 a été observée créant un changement de phase dans 1ORF15 dans le plasmide pNB49ΔPst ainsi généré. Le plasmide pIJ702 digéré avec l'enzyme de restriction Bg II a été ensuite ligaturé au site BglII du plasmide pNB49ΔPst générant le plasmide pPSTI . L'orientation de pIJ702 dans pPSTI a été confirmée par la présence d'un fragment d'ADN ayant 0,9 kb après digestion avec l'enzyme de restriction Sphl. Le plasmide d'intégration pPSTI (figure 11B) ainsi obtenu a été transféré dans la souche E . coli DH5αMRC, puis utilisé pour transformer Sac . erythraea .Initially, the plasmid pNB49 was generated by treatment with exonuclease III of the plasmid pNC028 obtained in Example 11 previously digested with the restriction enzymes Nsil and BamHI. The plasmid pNB49 (FIG. 5B) containing the nucleotides 44382 to 46562 of the sequence of FIG. 3, was then digested using the restriction enzyme PstI then treated with the Mung Bean nuclease (NE Biolabs) as described by Sambrook et al. (1989). After religion and transformation in E. coli XLl-Blue, ampicillin resistant colonies were selected by restriction analysis with the enzyme PstI. The loss of the PstI site was confirmed by sequencing a clone using the reverse M13 primer and the deletion of nucleotide 46364 from the sequence of FIG. 3 was observed creating a phase change in 1ORF15 in the plasmid pNB49ΔPst thus generated . The plasmid pIJ702 digested with the restriction enzyme Bg II was then ligated to the BglII site of the plasmid pNB49ΔPst generating the plasmid pPSTI. The orientation of pIJ702 in pPSTI was confirmed by the presence of a DNA fragment having 0.9 kb after digestion with the restriction enzyme Sphl. The integration plasmid pPSTI (FIG. 11B) thus obtained was transferred to the strain E. coli DH5αMRC, then used to transform Sac. erythraea.
EXEMPLE 19 : construction d'une souche Sac. erythraea eryCVlA (PstlO) .EXAMPLE 19: Construction of a Sac strain. erythraea eryCVlA (PstlO).
Une souche dans laquelle le gène eryCVI porte une délétion interne telle que celle introduite dans le plasmide pPSTI obtenu à l'exemple 18 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pPSTI.A strain in which the eryCVI gene carries an internal deletion such as that introduced into the plasmid pPSTI obtained in Example 18 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pPSTI.
La préparation des protoplastes et le processus d'intégration ont été réalisés comme à l'exemple 3.The protoplast preparation and the integration process were carried out as in Example 3.
La sélection des mutants ayant le phénotype ery~ a été réalisée comme à l'exemple 3 en utilisant une soucheThe selection of mutants with the ery ~ phenotype was carried out as in Example 3 using a strain
B. subtilis sensible à l' érythromycine au lieu d'une souche B. pumilus comme souche indicatrice. La souche B. subtilis ATCC 6633 a été utilisée pour évaluer la production d' érythromycine dans des essais biologiques sur des boîtes d'agar en milieu Ml-102 inoculées avec le mutant à analyser et incubées pendant 3 jours à 30°C. Des zones d'agar recouvertes de bactéries ont ensuite été prélevées à l'emporte pièce puis placées sur des boîtes 2 x TY recouvertes d'une surcouche de 5 ml d'agar en milieu TY contenant 200 μl d'une culture de B. subtilis ATCC 6633, puis incubées une nuit à 37°C.B. subtilis sensitive to erythromycin instead of a B. pumilus strain as an indicator strain. B. subtilis ATCC 6633 was used to assess production of erythromycin in biological tests on agar dishes in Ml-102 medium inoculated with the mutant to be analyzed and incubated for 3 days at 30 ° C. Agar areas covered with bacteria were then taken with a cookie cutter and then placed on 2 x TY dishes covered with an overlay of 5 ml of agar in TY medium containing 200 μl of a B. subtilis culture. ATCC 6633, then incubated overnight at 37 ° C.
L'absence de production d'érythromycine a été évaluée également en présence de précurseurs ajoutés tels queThe absence of erythromycin production was also evaluated in the presence of added precursors such as
1' érythronolide B ou le 3-α-mycarosyl érythronolide B par application de 10 μl d'une solution 10 mM de chaque métabolite sur les zones d'agar découpées suivie d'une incubation à 30°C pendant une nuit avant de recouvrir les boîtes de la culture de B. subtilis comme indiqué ci-dessus. La souche Sac . erythraea sauvage "red variant" a été utilisée comme contrôle.1 erythronolide B or 3-α-mycarosyl erythronolide B by application of 10 μl of a 10 mM solution of each metabolite to the cut agar zones followed by incubation at 30 ° C. overnight before covering the culture dishes of B. subtilis as indicated above. The Sac strain. wild erythraea "red variant" was used as a control.
Après la transformation des protoplastes avec le plasmide pPSTI et la sélection des colonies résistantes au thiostrepton, l'intégration dans le chromosome a été confirmée par analyse de Southern selon les méthodes générales décrites à l'exemple 3.After the transformation of the protoplasts with the plasmid pPSTI and the selection of the thiostrepton-resistant colonies, the integration into the chromosome was confirmed by Southern analysis according to the general methods described in Example 3.
Un fragment d'ADN de 1269 pb correspondant à 1ORF14 généré par PCR en utilisant les oligonucléotides synthétiques ayant les séquences suivantes :A DNA fragment of 1269 bp corresponding to 1ORF14 generated by PCR using the synthetic oligonucleotides having the following sequences:
14-1 GGGGGATCCCATATGCGGGTACTGCTGACGTCCTTCG (SEQ ID N° 51) et 14-2 GAAAAGATCTGCCGGCGTGGCGGCGCGTGAGTTCCTC (SEQ ID N° 52) a été utilisé comme sonde.14-1 GGGGGATCCCATATGCGGGTACTGCTGACGTCCTTCG (SEQ ID No. 51) and 14-2 GAAAAGATCTGCCGGCGTGGCGGCGCGTGAGTTCCTC (SEQ ID No. 52) was used as the probe.
L'oligonucleotide 14-1 a été dessiné de façon à introduire un site BamHI et un site Ndel en amont de la séquence correspondant à la région d'ADN située de la position 44811 à la position 44833 de la séquence de la figure 3.The oligonucleotide 14-1 was designed so as to introduce a BamHI site and an NdeI site upstream of the sequence corresponding to the DNA region located from position 44811 to position 44833 of the sequence of FIG. 3.
L'oligonucleotide 14-2 a été dessiné de façon à introduire un site BglII en aval de la séquence correspondant au brin complémentaire de la région d'ADN située de la position 46027 à la position 46053 de la séquence de la figure 3. L'ADN chromosomique préalablement digéré avec les enzymes de restriction Clal et PstI a montré les bandes attendues de 4 kb et 7 kb à partir de l'intégrant alors que la souche sauvage présentait la bande de 3 kb attendue.The oligonucleotide 14-2 was designed to introduce a BglII site downstream of the sequence corresponding to the complementary strand of the DNA region located from position 46027 to position 46053 of the sequence of FIG. 3. Chromosomal DNA previously digested with restriction enzymes Clal and PstI showed the expected bands of 4 kb and 7 kb from the integrant while the wild strain presented the expected 3 kb band.
Après cultures répétées des intégrants, les colonies individualisées obtenues ont été analysées pour la sensi- bilité au thiostrepton et la production d' érythromycine, puis l'intégration de la délétion attendue (délétion du nucleotide 46364 de la séquence de la figure 3) dans le chromosome d'un clone mutant ayant le phénotype ery~ (PstlO) a été confirmée par analyse de Southern. L'ADN chromosomique, isolé respecti- vement à partir de la souche sauvage et du mutant PstlO, a été digéré avec l'enzyme de restriction PstI. L'hybridation avec la sonde Pstl-Ncol de 0,8kb (nucléotides 46368 à 47142 de la séquence de la figure 3) a donné le profil attendu avec une bande PstI de lkb correspondant aux nucléotides 46368 à 47397 de la séquence de la figure 3 à partir de la souche sauvage et avec une bande >20 kb à partir du mutant. La perte du site PstI à la position 46368 ci-dessus a aussi été montrée après double digestion par les enzymes PstI et Ncol , résultant en une bande Pstl-Ncol de 0,8 kb (nucleotide 46368 à 47142) à partir de la souche sauvage et une bande Ncol de 2,8 kb (nucleotide 44382 à 47142) avec le mutant.After repeated cultures of the integrants, the individualized colonies obtained were analyzed for sensitivity to thiostrepton and the production of erythromycin, then integration of the expected deletion (deletion of nucleotide 46364 from the sequence of FIG. 3) in the chromosome of a mutant clone having the phenotype ery ~ (Pst10) was confirmed by Southern analysis. The chromosomal DNA, isolated respectively from the wild-type strain and the Pst10 mutant, was digested with the restriction enzyme PstI. Hybridization with the 0.8 kb Pstl-Ncol probe (nucleotides 46368 to 47142 of the sequence of FIG. 3) gave the expected profile with a PstI band of lkb corresponding to nucleotides 46368 to 47397 of the sequence of FIG. 3 from the wild strain and with a band> 20 kb from the mutant. Loss of the PstI site at position 46368 above has also been shown after double digestion with the enzymes PstI and Ncol, resulting in a PstI-Ncol band of 0.8 kb (nucleotide 46368 to 47142) from the wild strain. and a 2.8 kb Ncol band (nucleotide 44382 to 47142) with the mutant.
La souche recombinante ainsi obtenue, désignée PstlO, a ensuite été cultivée pour identifier les métabolites produits. EXEMPLE 20 : fermentation de la souche PstlO et identification des métabolites secondaires produits.The recombinant strain thus obtained, designated Pst10, was then cultured to identify the metabolites produced. EXAMPLE 20 Fermentation of the Pst10 strain and identification of the secondary metabolites produced.
La souche PstlO a été cultivée dans le milieu sucrose- succinate décrit par Caffrey et al. (1992) pendant 3 jours à 30°C. Le surnageant de culture a été ensuite extrait à pH 9 avec de l'acétate d'éthyle. Les phases organiques obtenues ont été séchées sur S04Mg2 puis amenées à sec sous pression réduite. Le résidu a été dissous dans le mélange acétonitrile-eau (1:1, v/v), puis a ensuite été analysé par spectrométrie de masse sur un spectromètre BioQ (Micromass, Manchester, UK) ou Finningan LCQ (Finningag, CA) .The Pst10 strain was cultivated in the sucrose-succinate medium described by Caffrey et al. (1992) for 3 days at 30 ° C. The culture supernatant was then extracted at pH 9 with ethyl acetate. The organic phases obtained were dried over SO 4 Mg 2 and then brought to dryness under reduced pressure. The residue was dissolved in acetonitrile-water (1: 1, v / v), then was analyzed by mass spectrometry on a BioQ (Micromass, Manchester, UK) or Finningan LCQ (Finningag, CA) spectrometer.
La production d'érythomycine A (m/z 734 et m/z 716) n'a pas été observée mais la présence d' érythronolide B (MK+ : m/z 441 et MNa+ : m/z 425) ainsi que de 3-α-mycarosyl érythronolide B (MK+ : m/z 585 et MNa+ : m/z 569) mise en évidence caractérise la souche PstlO comme un mutant eryC. La séquence eryCVI présente une forte homologie avec d'autres methyltransferases telles que SnoX impliquée dans la biosynthèse de la nogalamycine chez S. nogalater (numéro d'accession EMBL S52403) (55,5 % d'identité au niveau proteique) , TylMl impliquée dans la biosynthèse de la tylosine chez S. fradiae (numéro d'accession EMBL X81885) (65 % d'identité au niveau proteique) et SrmX impliquée dans la biosynthèse de la spiramycine chez S. ambofaciens (numéro d'accession EMBL S25204) (52,8 % d'identité au niveau proteique) .The production of erythomycin A (m / z 734 and m / z 716) was not observed but the presence of erythronolide B (MK +: m / z 441 and MNa +: m / z 425) as well as 3- α-mycarosyl Erythronolide B (MK +: m / z 585 and MNa +: m / z 569) demonstrated characterizes the Pst10 strain as an eryC mutant. The eryCVI sequence has strong homology with other methyltransferases such as SnoX involved in the biosynthesis of nogalamycin in S. nogalater (accession number EMBL S52403) (55.5% identity at the protein level), TylMl involved in the biosynthesis of tylosin in S. fradiae (accession number EMBL X81885) (65% protein identity) and SrmX involved in the biosynthesis of spiramycin in S. ambofaciens (accession number EMBL S25204) (52 , 8% identity at protein level).
Ces observations indiquent que le gène eryCVI code pour la dTDP-D-6-désoxyhexose 3-N-méthyltransférase impliquée dans la voie de biosynthèse de la dTDP-D-désosamine. EXEMPLE 21 : construction d'un plasmide pBVlΔ (pXhol) .These observations indicate that the eryCVI gene encodes the dTDP-D-6-deoxyhexose 3-N-methyltransferase involved in the biosynthesis pathway of dTDP-D-desosamine. EXAMPLE 21: Construction of a plasmid pBVlΔ (pXhol).
Un plasmide d'intégration, dénommé pXhol et portant une délétion dans le gène eryBVI codant pour 1ORF16, a été construit selon le schéma de la figure 12A de la façon suivante :An integration plasmid, called pXhol and carrying a deletion in the eryBVI gene coding for 1ORF16, was constructed according to the diagram of FIG. 12A as follows:
Le fragment Ncol-Xhol (3,1 kb) du plasmide pNC062 obtenu à l'exemple 11 et contenant les nucléotides 47142 à 50254 de la séquence de la figure 3 a été sous-cloné dans les sites Ncol et Xhol du plasmide Litmus 28. Le plasmide pNC062X (figure 5B) ainsi généré a été digéré avec l'enzyme de restriction PstI puis traité avec l'ADN polymérase T4 (Boehringer Mannheim) . Après religature et transformation dans E. coli XLl-Blue, la perte du site PstI au nucleotide 47397 de la séquence de la figure 3 a été confirmée par sequençage et une délétion de 60 pb du nucleotide 47337 au nucleotide 47397 de la séquence de la figure 3 ont été observés. Le plasmide pIJ702 digéré avec l'enzyme de restriction BglII a été ensuite ligaturé au site BglII de cette contruction. L'orientation de pIJ702 dans la construc- tion a été confirmée par la présence d'un fragment d'ADN ayant 4,3 kb après digestion avec l'enzyme de restriction Xhol. Le plasmide d'intégration pXhol (figure 12B) ainsi obtenu a été utilisé pour transformer Sac . erythraea . EXEMPLE 22 : construction d'une souche Sac. erythraea eryBVlΔ (Xho91) .The Ncol-Xhol fragment (3.1 kb) of the plasmid pNC062 obtained in Example 11 and containing the nucleotides 47142 to 50254 of the sequence of FIG. 3 was subcloned in the Ncol and Xhol sites of the plasmid Litmus 28. The plasmid pNC062X (FIG. 5B) thus generated was digested with the restriction enzyme PstI and then treated with DNA polymerase T4 (Boehringer Mannheim). After religion and transformation in E. coli XLl-Blue, the loss of the PstI site at nucleotide 47397 of the sequence of FIG. 3 was confirmed by sequencing and a deletion of 60 bp from nucleotide 47337 to nucleotide 47397 of the sequence of FIG. 3 have been observed. The plasmid pIJ702 digested with the restriction enzyme BglII was then ligated to the BglII site of this contruction. The orientation of pIJ702 in the construct was confirmed by the presence of a DNA fragment having 4.3 kb after digestion with the restriction enzyme Xhol. The integration plasmid pXhol (FIG. 12B) thus obtained was used to transform Sac. erythraea. EXAMPLE 22: construction of a Sac strain. erythraea eryBVlΔ (Xho91).
Une souche dans laquelle le gène eryBVI porte une délétion interne telle que celle introduite dans le plasmide pXhol obtenu à l'exemple 21 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pXhol.A strain in which the eryBVI gene carries an internal deletion such as that introduced into the plasmid pXhol obtained in example 21 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pXhol.
La préparation des protoplastes et le processus d'intégration ont été réalisés comme à l'exemple 3.The protoplast preparation and the integration process were carried out as in Example 3.
La sélection et l'analyse des mutants ayant le phénotype ery~ a été réalisée selon les conditions décrites à l'exemple 19.The selection and analysis of the mutants having the ery ~ phenotype was carried out according to the conditions described in Example 19.
L'intégration dans le chromosome et la présence de la délétion attendue ont été confirmées par analyse de Southern selon les méthodes générales décrites à l'exemple 19. Après la transformation des protoplastes avec le plasmide pXhol et la sélection des colonies résistantes au thiostrepton, l'intégration dans le chromosome a été confirmée par analyse de Southern. En utilisant comme sonde le fragment PstI de 3,3 kb du plasmide pNC062, l'ADN chromosomique d'un intégrant préalablement digéré avec les enzymes de restriction PstI et BglII a montré les bandes 3 kb et 6 kb attendues.Integration into the chromosome and the presence of the expected deletion were confirmed by Southern analysis according to the general methods described in Example 19. After the transformation of the protoplasts with the plasmid pXhol and the selection of the thiostrepton-resistant colonies, the integration into the chromosome was confirmed by Southern analysis. Using the 3.3 kb PstI fragment of the plasmid pNC062 as probe, the chromosomal DNA of an integrant previously digested with the restriction enzymes PstI and BglII showed the expected 3 kb and 6 kb bands.
Après cultures répétées des intégrants, les colonies individualisées obtenues ont été analysées pour la sensi- bilité au thiostrepton et la production d' érythromycine, puis l'intégration de la délétion attendue (délétion de 60 pb du nucleotide 47338 au nucleotide 47397 de la séquence de la figure 3) dans le chromosome d'un clone mutant ayant le phénotype ery~ (Xhol) a été confirmée par analyse de Southern. L'ADN chromosomique, isolé respectivement à partir de la souche sauvage et du mutant Xhol, a été digéré avec l'enzyme de restriction PstI. L'hybridation avec la sonde Pstl-Ncol de 0,8 kb (nucléotides 46368 à 47142 de la séquence de la figure 3) a donné le profil attendu avec une bande PstI de 1 kb correspondant aux nucléotides 46368 à 47397 de la séquence de la figure 3 à partir de la souche sauvage et avec une bande de 4 kb à partir du mutant indiquant que le site PstI à la position 47397 ci-dessus a été perdu. La perte du site PstI à la position 47397 a aussi été confirmée par PCR. L'ADN chromosomique a été soumis à une amplification par PCR en utilisant les amorces correspondant respectivement à la séquence du nucleotide 47300 au nucléo- tide 57320 et à la séquence du nucleotide 47661 au nucleotide 47636 de la séquence d la figure 3. Un fragment attendu de 306 pb a été ainsi amplifié à partir de la souche sauvage générant après digestion avec l'enzyme de restriction PstI deux bandes d'environ 100 et 300 pb. A partir du mutant Xho91, un fragment de 300 pb a été amplifié, résultant de la délétion de 60 pb. Ce fragment a été ensuite isolé et a été trouvé résistant à la digestion par l'enzyme PstI.After repeated cultures of the integrants, the individualized colonies obtained were analyzed for sensitivity to thiostrepton and the production of erythromycin, then integration of the expected deletion (60 bp deletion from nucleotide 47338 to nucleotide 47397 of the sequence Figure 3) in the chromosome of a mutant clone having the phenotype ery ~ (Xhol) was confirmed by Southern analysis. The chromosomal DNA, isolated respectively from the wild strain and the Xhol mutant, was digested with the restriction enzyme PstI. Hybridization with the 0.8 kb Pstl-Ncol probe (nucleotides 46368 to 47142 of the sequence of FIG. 3) gave the expected profile with a PstI band of 1 kb corresponding to nucleotides 46368 to 47397 of the sequence of the sequence. Figure 3 from the wild strain and with a 4 kb band from the mutant indicating that the PstI site at position 47397 above has been lost. The loss of the PstI site at position 47397 was also confirmed by PCR. The chromosomal DNA was subjected to a PCR amplification using the primers corresponding respectively to the sequence of nucleotide 47300 to nucleotide 57320 and to the sequence of nucleotide 47661 to nucleotide 47636 of the sequence of FIG. 3. An expected fragment of 306 bp was thus amplified from the wild strain generating after digestion with the restriction enzyme PstI two bands of approximately 100 and 300 bp. From the Xho91 mutant, a 300 bp fragment was amplified, resulting from the 60 bp deletion. This fragment was then isolated and found to be resistant to digestion with the PstI enzyme.
La souche recombinante ainsi obtenue et désignée Xho91, a ensuite été cultivée pour identifier les métabolites produits.The recombinant strain thus obtained and designated Xho91, was then cultured to identify the metabolites produced.
EXEMPLE 23 : fermentation de la souche Xho91 et identification des métabolites secondaires produits.EXAMPLE 23 Fermentation of the Xho91 strain and identification of the secondary metabolites produced.
La culture de la souche Xho91 et l'analyse du surnageant de culture par spectrométrie de masse ont été réalisées selon les conditions décrites à l'exemple 20.The culture of the Xho91 strain and the analysis of the culture supernatant by mass spectrometry were carried out according to the conditions described in Example 20.
La production d'érythomycine A (m/z 734 et m/z 716) n'a pas été observée mais la présence d'une quantité majoritaire d' érythronolide B (MK+ : m/z 441 ; MNa+ : m/z 425 ; M-H20 H+ : m/z 385) ainsi que la présence de désosaminyl érythronolide B (m/z 560) mises en évidence caractérisent la souche PstlO comme un mutant eryB.The production of erythomycin A (m / z 734 and m / z 716) was not observed but the presence of a majority amount of erythronolide B (MK + : m / z 441; MNa + : m / z 425; MH 2 0 H + : m / z 385) as well as the presence of desosaminyl erythronolide B (m / z 560) demonstrated characterize the strain Pst10 as a mutant eryB.
Les résultats de spectrométrie de masse ont été confirmés par spectrométrie de masse en haute résolution sur un spectromètre Brucker FT-ICR (Brucker, FRG) . La séquence eryBVI présente une forte homologie avec DnmT impliquée dans la biosynthèse de la daunorubicine chez S. peucetius (numéro d'accession EMBL U77891) (43,9 % d'identité au niveau proteique).The mass spectrometry results were confirmed by high resolution mass spectrometry on a Brucker FT-ICR spectrometer (Brucker, FRG). The eryBVI sequence has a strong homology with DnmT involved in the biosynthesis of daunorubicin in S. peucetius (accession number EMBL U77891) (43.9% identity at the protein level).
Ces observations indiquent que le gène eryBVI code pour la dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase impliquée dans la biosynthèse du dTDP-mycarose , comme suggéré par Scotti et Hutchinson, 1996. EXEMPLE 24 : construction du plasmide pCIVΔ. Un plasmide d'intégration, dénommé pCIVΔ et portant une délétion dans le gène eryCIV codant pour 1ORF17, a été construit selon le schéma de la figure 13A de la façon suivante : Le plasmide pNC062 obtenu à l'exemple 11 a été digéré à l'aide des enzymes de restriction Bail et BcII de façon à éliminer un fragment ayant 949 pb à l'intérieur de 1ORF17 du nucleotide 48650 au nucleotide 49598 de la séquence de la figure 3. Après remplissage des extrémités à l'aide du fragment de Klenow de l'ADN polymerase I, le plasmide a été religaturé et transformé dans E. coli XLl-blue. A partir du plasmide pBCB17 ainsi généré, le fragment de 2,68 kb portant la délétion a été isolé par digestion à l'aide des enzymes Xbal et SphI, puis sous-cloné dans les sites correspondant du plasmide pUWL218. La présence de la délétion de 949 pb du nucleotide 48650 au nucleotide 49598 de la séquence de la figure 3 a été confirmée par sequençage. Le plasmide d'intégration pCIVΔ ainsi obtenu (figure 13B) a ensuite été transféré dans la souche E. coli DHδαMRC, puis utilisé pour transformer Sac . erythraea .These observations indicate that the eryBVI gene codes for dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase involved in the biosynthesis of dTDP-mycarose, as suggested by Scotti and Hutchinson, 1996. EXAMPLE 24: construction of the plasmid pCIVΔ. An integration plasmid, called pCIVΔ and carrying a deletion in the eryCIV gene coding for 1ORF17, was constructed according to the diagram of FIG. 13A in the following manner: The plasmid pNC062 obtained in Example 11 was digested with using the restriction enzymes Bail and BcII so as to eliminate a fragment having 949 bp inside 1ORF17 from nucleotide 48650 to nucleotide 49598 of the sequence of FIG. 3. After filling the ends with the Klenow fragment of DNA polymerase I, the plasmid was religated and transformed into E. coli XLl-blue. From the plasmid pBCB17 thus generated, the 2.68 kb fragment carrying the deletion was isolated by digestion using the enzymes Xbal and SphI, then subcloned into the corresponding sites of the plasmid pUWL218. The presence of the 949 bp deletion from nucleotide 48650 to nucleotide 49598 of the sequence of Figure 3 was confirmed by sequencing. The integration plasmid pCIVΔ thus obtained (FIG. 13B) was then transferred to the E. coli strain DHδαMRC, then used to transform Sac. erythraea.
EXEMPLE 25 : construction d'une souche Sac. erythraea eryCIV A (CIV89) .EXAMPLE 25: Construction of a Sac strain. erythraea eryCIV A (CIV89).
Une souche, dans laquelle le gène eryCIV porte une délétion interne telle que celle introduite dans le plasmide pCIVΔ obtenu à l'exemple 24, a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pCIVΔ.A strain, in which the eryCIV gene carries an internal deletion such as that introduced into the plasmid pCIVΔ obtained in Example 24, was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCIVΔ.
La préparation des protoplastes, le processus d'intégration et la sélection des mutants ayant le phénotype ery~ ont été réalisés comme à l'exemple 3.The protoplast preparation, the integration process and the selection of the mutants having the ery ~ phenotype were carried out as in Example 3.
De plus, la présence de la délétion attendue dans le chromosome (délétion de 949 bp du nucleotide 48650 au nucleotide 49598 de la séquence de la figure 3 a été confirmée par analyse génomique par Southern blot ainsi que par PCR selon les conditions décrites à l'exemple 3.In addition, the presence of the expected deletion in the chromosome (deletion of 949 bp from nucleotide 48650 to nucleotide 49598 of the sequence of FIG. 3 was confirmed by genomic analysis by Southern blot as well as by PCR according to the conditions described in example 3.
Par hybridation Southern sur l'ADN génomique digéré par l'enzyme de restriction Ncol, en utilisant comme sonde l'oligonucleotide ayant la séquence suivante : C4-R AGCGGCTTGATCGTGTTGGACCAGTAC (SEQ ID N° 53) correspondant au brin complémentaire de la région d'ADN située de la position 49996 à la position 50022 de la séquence de la figure 3, une bande de 6,2 kb à partir de la souche sauvage et une bande de 5,2 kb à partir du mutantBy Southern hybridization on the genomic DNA digested by the restriction enzyme Ncol, using as oligonucleotide probe having the following sequence: C4-R AGCGGCTTGATCGTGTTGGACCAGTAC (SEQ ID No. 53) corresponding to the complementary strand of the DNA region located from position 49996 to position 50022 of the sequence of FIG. 3, a 6.2 kb band from the strain wild and 5.2 kb band from mutant
CIV89 ont été détectées. Les résultats montrés à la figure 15 indiquent la présence dans le mutant d'une délétion d'environ 1 kb dans cette région du chromosome.CIV89 have been detected. The results shown in FIG. 15 indicate the presence in the mutant of a deletion of approximately 1 kb in this region of the chromosome.
L'amplification par PCR a été effectuée en utilisant l'oligonucleotide ayant la séquence suivante :The PCR amplification was carried out using the oligonucleotide having the following sequence:
C4-S GGCCTATGTGGACTACGTGTTGAACGT (SEQ ID N° 54) correspondant à la région d'ADN située de la position 48169 à la position 48195 de la séquence de la figure 3 et l'oligonucleotide C4-R ayant la séquence indiquée ci-dessus, permettant d'encadrer par amplification PCR la région portant la délétion interne à 1ORF17. L'analyse par amplification par PCR a permis de détecter une bande de 1,8 kb dans la souche sauvage et une bande de 900 pb dans le mutant CIV89 de façon identique au signal obtenu avec le plasmide pCIVΔ. Les résultats montrés à la figure 16 confirment que la délétion d'environ 900 pb détectée par l'analyse Southern est identique à celle portée par le plasmide pCIVΔ (949 pb) .C4-S GGCCTATGTGGACTACGTGTTGAACGT (SEQ ID No. 54) corresponding to the DNA region located from position 48169 to position 48195 of the sequence of FIG. 3 and the oligonucleotide C4-R having the sequence indicated above, allowing to frame by PCR amplification the region carrying the internal deletion at 1ORF17. Analysis by PCR amplification made it possible to detect a band of 1.8 kb in the wild strain and a band of 900 bp in the mutant CIV89 in an identical manner to the signal obtained with the plasmid pCIVΔ. The results shown in FIG. 16 confirm that the deletion of approximately 900 bp detected by the Southern analysis is identical to that carried by the plasmid pCIVΔ (949 bp).
La souche recombinante ainsi obtenue, désignée CIV89, a été ensuite cultivée pour identifier les métabolites produits par la souche.The recombinant strain thus obtained, designated CIV89, was then cultured to identify the metabolites produced by the strain.
EXEMPLE 26 : fermentation de la souche CIV89 et identification des métabolites secondaires produits.EXAMPLE 26 Fermentation of the CIV89 strain and identification of the secondary metabolites produced.
La culture de la souche CIV89 et les analyses par ccm ont été réalisées selon les conditions indiquées à l'exemple 4.The culture of the CIV89 strain and the analyzes by cmc were carried out according to the conditions indicated in Example 4.
Les résultats de ccm (figure 17) montrent que la souche CIV89 accumule préferentiellement du 3-α-mycarosyl érythronolide B ainsi que de l' érythronolide B comme attendu d'un mutant eryC. Des métabolites mineurs de faibles mobilités ont été également détectés, puis extraits et analysés par RP-HPLC couplée à la spectrométrie de masse selon les conditions utilisées à l'exemple 4. Un métabolite mineur donne un pic parent à m/z 720 et des produits de déshydration et de fragmentation à m/z 702, m/z 576 et m/z 174. Le pic 174 peut correspondre à la 4-hydroxydésosamine et le pic 576 au 4 ' -hydroxydésosaminyl érythronolide B.The results of ccm (FIG. 17) show that the strain CIV89 preferentially accumulates 3-α-mycarosyl erythronolide B as well as erythronolide B as expected from an eryC mutant. Minor metabolites of low mobility were also detected, then extracted and analyzed by RP-HPLC coupled to mass spectrometry according to the conditions used in Example 4. A minor metabolite gives a parent peak at m / z 720 and dehydration and fragmentation products at m / z 702, m / z 576 and m / z 174. Peak 174 may correspond to 4-hydroxydososamine and peak 576 with 4 '-hydroxydesosaminyl erythronolide B.
Ces résultats suggèrent que la différence de m/z de 16 comparée à l' érythromycine D (pic parent m/z 704) est portée par le sucre aminé. La structure proposée pour ce métabolite est la 4'-hydroxy érythromycine D. Ces observations indiquent que l'enzyme est impliquée dans le retrait du groupement hydroxyle dans la voie de biosynthèse de l' érythromycine et que le gène eryCIV code pour la dTDP-6-désoxyhexose 3 , 4-déshydratase.These results suggest that the difference in m / z of 16 compared to erythromycin D (parent peak m / z 704) is carried by the amino sugar. The proposed structure for this metabolite is 4'-hydroxy erythromycin D. These observations indicate that the enzyme is involved in the removal of the hydroxyl group in the biosynthetic pathway of erythromycin and that the eryCIV gene codes for dTDP-6 -deoxyhexose 3, 4-dehydratase.
La souche CIV89 a été déposée à la Collection Nationale de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 16 juillet 1997 sous le numéro 1-1905. EXEMPLE 27 : construction du plasmide pCVΔ .The CIV89 strain was deposited at the National Collection of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, on July 16, 1997 under the number 1-1905. EXAMPLE 27 Construction of the plasmid pCVΔ.
Un plasmide d'intégration, dénommé pCVΔ et portant une délétion dans le gène eryCV codant pour 1ORF18, a été construit selon le schéma de la figure 14A de la façon suivante :An integration plasmid, called pCVΔ and carrying a deletion in the eryCV gene coding for 1ORF18, was constructed according to the diagram of FIG. 14A as follows:
Le fragment BalI-BamHI (3,48 kb) , obtenu à partir du plasmide pNC062 préparé à l'exemple 11 par digestion avec les enzymes de restriction Bail et BamHI, a été sous-cloné dans les sites Smal-BamHI du vecteur pUC19. Du plasmide résultant pBABlδ (figure 5B) , le fragment interne Seal (lkb) a été ensuite délété par digestion avec l'enzyme Seal pour générer une délétion de 1044 pb du nucleotide 49998 au nucleotide 51041 de la séquence de la figure 3 dans 1ORF18. Du plasmide pBABΔCV ainsi obtenu, le fragment portant la délétion a ensuite été réisolé à partir du polylinker de pUC19 par digestion avec les enzymes de restriction HindIII et .EσoRI , puis sous-cloné dans le plasmide pUWL218. Le plasmide d'intégration pCVΔ ainsi obtenu (figure 14B) a été transféré dans la souche E . coli DH5αMRC, puis utilisé pour transformer Sac. erythraea . EXEMPLE 28 : construction d'une souche Sac. erythraea eryCVA (CV90 ) .The BalI-BamHI fragment (3.48 kb), obtained from the plasmid pNC062 prepared in Example 11 by digestion with the restriction enzymes Bail and BamHI, was subcloned into the SmaI-BamHI sites of the vector pUC19. From the resulting plasmid pBABlδ (Figure 5B), the internal Seal fragment (1kb) was then deleted by digestion with the Seal enzyme to generate a 1044 bp deletion from nucleotide 49998 to nucleotide 51041 of the sequence of Figure 3 in 1ORF18. From the plasmid pBABΔCV thus obtained, the fragment carrying the deletion was then re-isolated from the polylinker of pUC19 by digestion with the restriction enzymes HindIII and .EσoRI, then subcloned in the plasmid pUWL218. The integration plasmid pCVΔ thus obtained (FIG. 14B) was transferred to the strain E. coli DH5αMRC, then used to transform Sac. erythraea. EXAMPLE 28: construction of a Sac strain. erythraea eryCVA (CV90).
Une souche dans laquelle le gène eryCV porte une délétion interne telle que celle introduite dans le plasmide pCVΔ obtenu à l'exemple 27 a été préparée par transformation des protoplastes de Sac . erythraea avec le plasmide pCVΔ. La préparation des protoplastes, le processus d'intégration et la sélection des mutants ayant le phénotype ery~ ont été réalisés comme à l'exemple 3.A strain in which the eryCV gene carries an internal deletion such as that introduced into the plasmid pCVΔ obtained in Example 27 was prepared by transformation of the sac protoplasts. erythraea with the plasmid pCVΔ. The protoplast preparation, the integration process and the selection of the mutants having the ery ~ phenotype were carried out as in Example 3.
De plus, la présence de la délétion attendue dans le chromosome (délétion de 1044 pb du nucleotide 49998 au nucleotide 51041) a été confirmée par analyse génomique par Southern blot ainsi que par PCR selon les conditions décrites à l'exemple 3.In addition, the presence of the expected deletion in the chromosome (1044 bp deletion from nucleotide 49998 to nucleotide 51041) was confirmed by genomic analysis by Southern blot as well as by PCR according to the conditions described in Example 3.
Par hybridation Southern sur l'ADN génomique digéré par l'enzyme de restriction Ncol, en utilisant comme sonde l'oligonucleotide ayant la séquence suivante : C5-R AACGCCTCGTCCTGCAGCGGAGACACGAACA (SEQ ID N° 55) correspondant au brin complémentaire de la région d'ADN située de la position 51229 à la position 51259 de la séquence de la figure 3, une bande de 6,2 kb à partir de la souche sauvage et une bande de 5,1 kb à partir du mutant CV90 ont été détectées. Les résultats montrés à la figure 15 indiquent chez le mutant la présence d'une délétion d'environ 1,1 kb dans cette région du chromosome. L'amplification par PCR a été effectuée en utilisant l'oligonucleotide ayant la séquence suivante : C5-S TTCGCTCCCCGATGAACACAACTCGTA (SEQ ID N° 56) correspondant à la région d'ADN située de la position 49668 à la position 49694 de la séquence de la figure 3 et l'oligonucleotide C5-R ayant la séquence indiquée ci-dessus, permettant d'encadrer par amplification PCR la région portant la délétion interne à 1ORF18. L'analyse par amplification par PCR a permis de détecter une bande d'environ 1,6 kb dans la souche sauvage et une bande d'environ 500 pb dans le mutant CV90 de façon identique au signal obtenu avec le plasmide pCVΔ. Les résultats montrés à la figure 16 confirment que la délétion d'environ 1,1 kb détectée par l'analyse Southern est identique à celle portée par le plasmide PCVΔ (1044 pb) .By Southern hybridization on the genomic DNA digested with the restriction enzyme Ncol, using as probe the oligonucleotide having the following sequence: C5-R AACGCCTCGTCCTGCAGCGGAGACACGAACA (SEQ ID No. 55) corresponding to the complementary strand of the DNA region located from position 51229 to position 51259 of the sequence of FIG. 3, a band of 6.2 kb from the wild strain and a band of 5.1 kb from the mutant CV90 were detected. The results shown in FIG. 15 indicate in the mutant the presence of a deletion of approximately 1.1 kb in this region of the chromosome. The PCR amplification was carried out using the oligonucleotide having the following sequence: C5-S TTCGCTCCCCGATGAACACAACTCGTA (SEQ ID No. 56) corresponding to the DNA region located at position 49668 at position 49694 of the sequence of the FIG. 3 and the oligonucleotide C5-R having the sequence indicated above, making it possible to frame by PCR amplification the region carrying the internal deletion at 1ORF18. Analysis by PCR amplification made it possible to detect a band of approximately 1.6 kb in the wild-type strain and a band of approximately 500 bp in the mutant CV90 in an identical manner to the signal obtained with the plasmid pCVΔ. The results shown in FIG. 16 confirm that the deletion of approximately 1.1 kb detected by the Southern analysis is identical to that carried by the plasmid PCVΔ (1044 bp).
La souche recombinante ainsi obtenue, désignée CV90, a été ensuite cultivée pour identifier les métabolites produits par la souche. EXEMPLE 29 : fermentation de la souche CV90 et identification des métabolites secondaires produits.The recombinant strain thus obtained, designated CV90, was then cultured to identify the metabolites produced by the strain. EXAMPLE 29 Fermentation of the CV90 strain and identification of the secondary metabolites produced.
La culture de la souche CV90 et les analyses par ccm ont été réalisées selon les conditions indiquées à l'exemple 4. Les résultats de ccm (figure 17) montre que la souche CV90 accumule préférentiellement du 3-α-mycarosyl érythronolide B ainsi que de l' érythronolide B comme attendu d'un mutant eryC.The culture of the CV90 strain and the analyzes by ccm were carried out according to the conditions indicated in Example 4. The results of ccm (FIG. 17) show that the CV90 strain preferentially accumulates 3-α-mycarosyl erythronolide B as well as Erythronolide B as expected from an eryC mutant.
La séquence des résidus 38-50 (VTGAGDGDADVQA) Val Thr Gly Ala Gly Asp Gly Asp Ala Asp Val Gin Ala (SEQ ID N° 61) de la protéine codée par eryCV (séquence de SEQ ID N° 11) est proche de la séquence consensus de liaison au NAD+ décrit par Wierenga et al., 1985 et par Scrutton et al., 1990.The sequence of residues 38-50 (VTGAGDGDADVQA) Val Thr Gly Ala Gly Asp Gly Asp Ala Asp Val Gin Ala (SEQ ID No 61) of the protein coded by eryCV (sequence of SEQ ID No 11) is close to the sequence NAD + binding consensus described by Wierenga et al., 1985 and by Scrutton et al., 1990.
Ces observations permettent de conclure que le gène eryCV code pour une reductase qui interviendrait comme une dTDP-4 , 6-désoxyhexose 3 , 4-réductase dans la voie de biosynthèse de la d-TDP-désosamine.These observations make it possible to conclude that the eryCV gene codes for a reductase which would intervene as a dTDP-4, 6-deoxyhexose 3, 4-reductase in the biosynthetic pathway of d-TDP-desosamine.
EXEMPLE 30 : surexpression du produit du gène eryCIII dans E. coli. L'expression hétérologue du produit du gène eryCIII de Sac . erythraea correspondant à 1ORF8 décrite à l'exemple 1 et codant pour l'activité désosaminyltransférase identifiée à l'exemple 7 a été réalisée en utilisant E . coli comme souche hôte. La protéine ainsi produite sous forme de corps d'inclusion a été ensuite purifiée et son activité enzymatique déterminée in vitro. 1) Expression de la protéine EryCIII dans E. coliEXAMPLE 30 Overexpression of the eryCIII gene product in E. coli. The heterologous expression of the Sac eryCIII gene product. erythraea corresponding to 1ORF8 described in Example 1 and coding for the deosaminyltransferase activity identified in Example 7 was carried out using E. coli as the host strain. The protein thus produced in the form of inclusion bodies was then purified and its enzymatic activity determined in vitro. 1) Expression of the EryCIII protein in E. coli
L'expression a été réalisée en utilisant le vecteur pETlla (Stratagene) pour le clonage et l'expression de protéines recombinantes dans E . coli sous le contrôle du promoteur de l'ARN polymerase du bactériophage T7.Expression was achieved using the pET11a vector (Stratagene) for cloning and expression of recombinant proteins in E. coli under the control of the promoter of RNA polymerase of bacteriophage T7.
Dans un premier temps, le gène eryCIII a été amplifié à partir du plasmide pK62 décrit à l'exemple 1 de la façon suivante :First, the eryCIII gene was amplified from the plasmid pK62 described in Example 1 in the manner next :
L'amplification par PCR a été effectuée en utilisant la polymerase Native Pfu (Stratagene) et comme amorces l'oligonucleotide A homologue au brin codant du gène eryCIII ayant la séquenceThe PCR amplification was carried out using the Native Pfu polymerase (Stratagene) and as primers the oligonucleotide A homologous to the strand coding for the eryCIII gene having the sequence
A GAAGGAGATATACATATGCGCGTCGTCTTCTCCTC (SEQ ID N° 57) permettant d'introduire un site Ndel en amont de l'ATG initiateur de eryCIII et l'oligonucleotide B homologue au brin complémentaire du gène eryCIII ayant la séquence B CGGGATCCTCATCGTGGTTCTCTCCTTCCTGC (SEQ ID N° 58) permettant d'introduire un site BamHI en aval du codon stop du gène eryCIII.A GAAGGAGATATACATATGCGCGTCGTCTTCTCCTC (SEQ ID N ° 57) making it possible to introduce an NdeI site upstream of the ATG initiating eryCIII and the oligonucleotide B homologous to the complementary strand of the eryCIII gene having the sequence B CGGGATCCTCATCGTGGTTCTCTCCTTCCTGC) to introduce a BamHI site downstream of the stop codon of the eryCIII gene.
L'ADN amplifié a été ensuite digéré par les enzymes de restriction Ndel et BamHI, puis le fragment Ndel-BamHI de 1,2 kb obtenu contenant la totalité du gène eryCIII a été ligaturé dans le vecteur d'expression pETlla (Stratagene) qui contient le gène β-lactamase de résistance à l'ampicilline, l'origine de réplication ColEl et le promoteur du gène de l'ARN polymerase T7 situé en amont du site de clonage Ndel , préalablement digéré avec les enzymes de restriction Ndel et BamHI. Après ligation et transformation dans E . coli XLl- blue, le plasmide pCEIII ainsi obtenu a été confirmé par carte de restriction et sequençage.The amplified DNA was then digested with the restriction enzymes Ndel and BamHI, then the 1.2 kb Ndel-BamHI fragment obtained containing the entire eryCIII gene was ligated into the expression vector pETlla (Stratagene) which contains the ampicillin resistance β-lactamase gene, the origin of ColEl replication and the promoter of the T7 RNA polymerase gene located upstream of the Ndel cloning site, previously digested with the restriction enzymes Ndel and BamHI. After ligation and transformation in E. coli XLl-blue, the plasmid pCEIII thus obtained was confirmed by restriction card and sequencing.
La souche d'E. coli BL21(DE3) de la trousse pET (Stratagene) qui contient dans son ADN chromosomique le gène lacl^ et le promoteur IacUV5 en amont du gène de l'ARN polymerase T7 , a ensuite été transformée par le plasmide pECIII.5.The strain of E. coli BL21 (DE3) of the pET kit (Stratagene) which contains in its chromosomal DNA the gene lacl ^ and the promoter IacUV5 upstream of the RNA polymerase T7 gene, was then transformed by the plasmid pECIII.5.
La souche transformée obtenue, dénommée BL21/pECIII, a été cultivée en erlen de 50 ml à 37 °C en milieu LB ensemencé à DO60Q=0,1 à partir d'une préculture, puis induite par l'isopropyl- -D-thiogalactopyranoside (IPTG) ImM à DO600=l. Après 3 h 30 d'induction, 1 ml de culture a été prélevé et centrifugé, puis le culot bactérien obtenu a été dissout dans 240 μl d'eau et 120 μl de tampon d'échantillon SDS 3X (Tris- HC1 1M pH = 6,8 : 1,9 ml ; glycérol 3 ml ; β-mercaptoéthanol 1,5 ml ; SDS 20 % , 3 ml ; bleu de bromophénol 1 % pH = 7 : 0,3 ml ; H20 qsq 10 ml). A partir de 15 μl de la solution obtenue, les protéines totales extraites ont été analysées par SDS-PAGE sur un gel à 10 % de polyacrylamide avec une coloration au bleu de Comassie.The transformed strain obtained, named BL21 / pECIII, was cultured in a 50 ml Erlenmeyer flask at 37 ° C in LB medium seeded at DO 60Q = 0.1 from a preculture, then induced by isopropyl- -D- thiogalactopyranoside (IPTG) ImM at DO 600 = l. After 3 h 30 of induction, 1 ml of culture was taken and centrifuged, then the bacterial pellet obtained was dissolved in 240 μl of water and 120 μl of SDS 3X sample buffer (Tris- HC1 1M pH = 6 , 8: 1.9 ml; glycerol 3 ml; β-mercaptoethanol 1.5 ml; SDS 20%, 3 ml; bromophenol blue 1% pH = 7: 0.3 ml; H 2 0 qsq 10 ml). From 15 μl of the solution obtained, the total proteins extracted were analyzed by SDS-PAGE on a 10% polyacrylamide gel with Comassie blue staining.
La surexpression d'une protéine ayant un poids moléculaire apparent d'environ 46 Kd correspondant au PM attendu pour la protéine EryCIII a été observée comparativement aux protéines totales d'une souche témoin transformée par le plasmide pETlla. 2) Purification de la protéine EryCIII La souche transformée BL21/pECIII ci-dessus a été cultivée en fermenteur de 6 litres en milieu minimum contenant du glycérol comme source de carbone (Korz et al., 1995) à 25°C jusqu'à D0600=12, puis induite par l'IPTG pendant lδ h jusqu'à D0600=54. A partir du bouillon récolté, le culot bactérien contenant des corps d'inclusion a été isolé par centrifugation à 5000 g pendant 30 mn.The overexpression of a protein having an apparent molecular weight of approximately 46 Kd corresponding to the expected PM for the EryCIII protein was observed compared to the total proteins of a control strain transformed by the plasmid pET11a. 2) Purification of the EryCIII protein The transformed strain BL21 / pECIII above was cultivated in a 6 liter fermenter in a minimum medium containing glycerol as carbon source (Korz et al., 1995) at 25 ° C until D0 600 = 12, then induced by IPTG for 1 h until D0 600 = 54. From the broth collected, the bacterial pellet containing inclusion bodies was isolated by centrifugation at 5000 g for 30 min.
L'induction de la protéine EryCIII a été contrôlée par SDS-PAGE (gradient de polyacrylamide : 10 à 20 %) et avec une coloration au bleu de Comassie après lyse sur un aliquot dans le tampon SDS 1 %, à 100 °C pendant 5 min, soit directement sur le bouillon récolté, soit sur le culot bactérien après une première lyse par sonication dans un tampon phosphate.The induction of the EryCIII protein was monitored by SDS-PAGE (polyacrylamide gradient: 10 to 20%) and with Comassie blue staining after lysis on an aliquot in the 1% SDS buffer, at 100 ° C. for 5 min, either directly on the broth harvested, or on the bacterial pellet after a first lysis by sonication in a phosphate buffer.
190 g de culot bactérien correspondant à 1 litre de bouillon récolté ont été remis en suspension dans 2,5 volumes de tampon KH2P04/K2HP04 20 mM pH 7,2 contenant de l'EDTA190 g of bacterial pellet corresponding to 1 liter of broth harvested were resuspended in 2.5 volumes of KH 2 P0 4 / K 2 HP0 4 20 mM pH 7.2 buffer containing EDTA
2,5 mM et du DTT 2,5 mM. Les cellules ont été ensuite lysées en utilisant un appareil Rannie (Mini-Lab, type δ-30H, APV Homogenisers As, Denmark) avec trois passages sous une pression de 1000 bars. Après centrifugation à 46.000 g pendant 3 heures, le culot obtenu a été mis en suspension dans 2,5 volumes d'urée 2M puis centrifugé dans les mêmes conditions.2.5 mM and 2.5 mM DTT. The cells were then lysed using a Rannie device (Mini-Lab, type δ-30H, APV Homogenisers As, Denmark) with three passages under a pressure of 1000 bars. After centrifugation at 46,000 g for 3 hours, the pellet obtained was suspended in 2.5 volumes of 2M urea and then centrifuged under the same conditions.
Le culot ainsi lavé a été ensuite mis en suspension dans 2,5 volumes d'une solution d'urée 7M dans du tampon tris 50 mM pH 7,5 (tampon A) de façon à solubiliser la protéine EryCIII. Après centrifugation dans les mêmes conditions, le surnageant recueilli obtenu contient 2,1 g de protéines totales déterminées par la méthode de Bradford en utilisant 5δ une trousse du commerce (Pierce) .The pellet thus washed was then suspended in 2.5 volumes of a 7M urea solution in 50 mM tris buffer pH 7.5 (buffer A) so as to dissolve the EryCIII protein. After centrifugation under the same conditions, the collected supernatant obtained contains 2.1 g of total proteins determined by the Bradford method using 5δ a commercial kit (Pierce).
L'extrait dans l'urée 7M a été ensuite chargé à la vitesse de 0,5 mètres/h et à 4-8 °C sur une colonne de 180 ml (5 cm x 9 cm) de Q sepharose (Pharmacia) préalablement équilibrée avec le tampon A ci-dessus et avec une détection à 280 nm. La protéine EryCIII a été ensuite éluée avec le tampon A contenant NaCl 0,3M. Les fractions réunies, contenant la protéine EryCIII, mise en évidence par SDS-PAGE (gradient de polyacrylamide : 10 à 20 %) révélée par coloration au bleu de Comassie et 835 mg de protéines totales, ont été ensuite chargées sur une colonne de 5,5 litres (10 cm x 70 cm) de Superdex 200 Prep grade (Pharmacia) préalablement équilibrée avec le tampon A ci-dessus. Par élution de la colonne avec le tampon A et par détection à 280 nm, un pic de protéine a été obtenu dont les fractions contenant la protéine EryCIII mise en évidence par SDS-PAGE et 200 mg de protéines totales ont été réunies puis purifiées sur une colonne de lδO ml (5 cm x 9 cm) de Q Source (Pharmacia) préalablement équilibrée avec le tampon A. Par élution avec un gradient linéaire de NaCl variant de 0 àThe extract in 7M urea was then loaded at the speed of 0.5 meters / h and at 4-8 ° C. on a 180 ml (5 cm × 9 cm) column of Q sepharose (Pharmacia) previously balanced. with buffer A above and with detection at 280 nm. The EryCIII protein was then eluted with buffer A containing 0.3M NaCl. The combined fractions, containing the EryCIII protein, demonstrated by SDS-PAGE (polyacrylamide gradient: 10 to 20%) revealed by staining with Comassie blue and 835 mg of total proteins, were then loaded onto a column of 5, 5 liters (10 cm x 70 cm) of Superdex 200 Prep grade (Pharmacia) previously balanced with buffer A above. By elution from the column with buffer A and by detection at 280 nm, a protein peak was obtained, the fractions containing the EryCIII protein demonstrated by SDS-PAGE and 200 mg of total proteins were combined and then purified on a column of 10 ml (5 cm x 9 cm) of Q Source (Pharmacia) previously equilibrated with buffer A. By elution with a linear NaCl gradient varying from 0 to
0,3 M dans le tampon A, 30 ml de solution contenant 100 mg de protéine EryCIII dénaturée homogène en pureté évaluée par SDS-PAGE, avec une révélation au nitrate d'argent, ont été obtenus . La figure lδ montre l'évolution de la pureté de la protéine EryCIII suivie par SDS-PAGE (gradient de polyacrylamide : 10 à 15 %) pour un dépôt de 500 ng de protéines totales et une révélation au nitrate d'argent successivement après extraction à l'urée 7M (ligne 2) , chromatographie Q sepharose (ligne 3), chromatographie0.3 M in buffer A, 30 ml of solution containing 100 mg of denatured homogeneous protein EryCIII in purity evaluated by SDS-PAGE, with a development with silver nitrate, were obtained. FIG. 1δ shows the evolution of the purity of the EryCIII protein followed by SDS-PAGE (polyacrylamide gradient: 10 to 15%) for a deposit of 500 ng of total proteins and a revelation with silver nitrate successively after extraction with 7M urea (line 2), Q sepharose chromatography (line 3), chromatography
Superdex (ligne 4) , chromatographie Q source (ligne 6) par rapport aux marqueurs de poids moléculaire (lignes 1 et 5) .Superdex (lane 4), source Q chromatography (lane 6) versus molecular weight markers (lanes 1 and 5).
La protéine EryCIII a été ensuite renaturée par dilution de l'éluat homogène avec une solution de tampon A contenant du DTT 10 mM pour obtenir une concentration finale en protéine de 0,1 mg/ml. La solution diluée a été ensuite dialysée contre du tampon Tris 50 mM ; NaCl 0,15 M ; 0,3 % n-octyl-β-D-glucopyranosyl (NOG) ; DTT 10 mM, pH δ , 3 puis concentrée à 4 mg/ml par ultrafiltration sur une membrane PLGC04310 (Millipore) ayant un seuil de coupure de 10.000.The EryCIII protein was then renatured by diluting the homogeneous eluate with a solution of buffer A containing 10 mM DTT to obtain a final protein concentration of 0.1 mg / ml. The diluted solution was then dialyzed against 50 mM Tris buffer; 0.15 M NaCl; 0.3% n-octyl-β-D-glucopyranosyl (NOG); DTT 10 mM, pH δ, 3 then concentrated to 4 mg / ml by ultrafiltration on a PLGC04310 membrane (Millipore) having a cutoff threshold of 10,000.
La protéine EryCIII purifiée a été ensuite conservée à l'état congelé à -20 °C en aliquots de 500 μl. 3) Caractérisation de la protéine EryCIIIThe purified EryCIII protein was then stored frozen at -20 ° C in 500 μl aliquots. 3) Characterization of the EryCIII protein
La caractérisation de la protéine EryCIII ainsi obtenue a été examinée pour les propriétés suivantes : a) Homogénéité.The characterization of the protein EryCIII thus obtained was examined for the following properties: a) Homogeneity.
L'électrophorèse par SDS-PAGE (gradient de polyacrylamide : 10 à 15 %) en utilisant l'appareil Phast System (Pharmacia) et une révélation au nitrate d'argent montre une pureté supérieure à 99 % pour un dépôt de 2000 ng. b) Poids moléculaire par électrophorèse et spectrométrie de masse. Par électrophorèse, un PM apparent de 46 kDa a été déterminé en accord avec le PM calculé de 45929.Electrophoresis by SDS-PAGE (polyacrylamide gradient: 10 to 15%) using the Phast System device (Pharmacia) and revelation with silver nitrate shows a purity greater than 99% for a deposit of 2000 ng. b) Molecular weight by electrophoresis and mass spectrometry. By electrophoresis, an apparent MW of 46 kDa was determined in agreement with the calculated MW of 45929.
L'analyse par RP-HPLC couplée à la spectrométrie de masse (HPLC : ESI-SM) donne une masse de 45934 uma. c) Séquence en acide aminés N-terminale La séquence N-terminale a été déterminée par microséquençage sur un microsequenceur de protéine Model A492 couplé à un analyseur HPLC de PTH-aminoacides (Applied Biosystems) . Aucune séquence secondaire n'a été décelée pour les 10 premiers résidus qui est en accord avec la séquence en acides aminés décrite à la figure 2 (séquence de SEQ ID N° 5) . d) Activité biologiqueAnalysis by RP-HPLC coupled to mass spectrometry (HPLC: ESI-SM) gives a mass of 45,934 uma. c) N-terminal amino acid sequence The N-terminal sequence was determined by microsequencing on a Model A492 protein microsequencer coupled to an HPLC PTH-amino acid analyzer (Applied Biosystems). No secondary sequence was detected for the first 10 residues which is in agreement with the amino acid sequence described in FIG. 2 (sequence of SEQ ID No. 5). d) Biological activity
L'activité désosaminyl transférase de la protéine EryCIII a été déterminée in vitro par la mise en évidence de la formation d' érythromycine D à partir de dTDP-D-désosamine, dont la préparation est décrite plus loin et de 3-α-mycarosyl érythronolide B (MEB) dont la préparation est décrite ci- dessus dans Matériels et Méthodes générales. Le milieu de réaction contient 150 nmoles de dTDP-D- désosamine, 137,4 nmoles de MEB et 1 mg de protéine EryCIII en utilisant les conditions opératoires suivantes :The desosaminyl transferase activity of the EryCIII protein was determined in vitro by demonstrating the formation of erythromycin D from dTDP-D-desosamine, the preparation of which is described below and from 3-α-mycarosyl erythronolide B (SEM) whose preparation is described above in General Materials and Methods. The reaction medium contains 150 nmol of dTDP-D-desosamine, 137.4 nmol of SEM and 1 mg of EryCIII protein using the following operating conditions:
Dans un tube en verre à vis, on introduit successivement 4,7δ ml de tampon Tris 50 mM pH 7,3 (tampon B) ; 20 μl de dTDP-D-désosamine, sel de triéthylamine (150 nmoles) en solution dans le tampon B contenant EDTA 1 mM et PEFABLOC O, 4 mM (Merck) ; 100 μl de MEB (137,4 nmoles) en solution dans le tampon B et 1 mg de protéine EryCIII correspondant à 250 μl d'un aliquot de solution congelée obtenue ci-dessus.In a screw glass tube, successively introduced 4.7δ ml of 50 mM Tris buffer pH 7.3 (buffer B); 20 μl of dTDP-D-desosamine, triethylamine salt (150 nmol) in solution in buffer B containing 1 mM EDTA and PEFABLOC O, 4 mM (Merck); 100 μl of SEM (137.4 nmol) in solution in buffer B and 1 mg of EryCIII protein corresponding to 250 μl of an aliquot of frozen solution obtained above.
Après homogénisation au Vortex, le tube bouché est placé pendant 5 h dans un bain thermostaté à 30 °C, puis on ajuste le pH à 9-10 avec NaOH 32 % puis extrait le mélange reactionnel 3 fois avec 5 ml d'acétate d'éthyle. L'extrait obtenu, amené à sec sous pression réduite, puis repris par 100 μl de chlorure de méthylène est ensuite analysé par ccm dans les conditions indiquées à l'exemple 4 en utilisant comme éluant le mélange chlorure de méthylène/méthanol (90 : 10,v/v) .After homogenization with Vortex, the stoppered tube is placed for 5 h in a bath thermostatically controlled at 30 ° C., then the pH is adjusted to 9-10 with 32% NaOH and then the reaction mixture is extracted 3 times with 5 ml of acetate. ethyl. The extract obtained, brought to dryness under reduced pressure, then taken up in 100 μl of methylene chloride is then analyzed by ccm under the conditions indicated in Example 4 using as eluent the methylene chloride / methanol mixture (90:10 , v / v).
Un essai témoin (t = 0) dont l'incubation est arrêtée immmédiatement par l'ajout de NaOH, est effectué dans les mêmes conditions.A control test (t = 0), the incubation of which is stopped immediately by the addition of NaOH, is carried out under the same conditions.
Les résultats obtenus par révélation chimique montrent l'apparition d'un produit moins mobile ayant un Rf voisin de 1' érythromycine D attendue et pour lequel une faible activité antibiotique est détectée par autobiogramme direct des plaques sur B. pumilus . Aucune activité biologique n'est observée pour l'essai témoin (figure 19). Ces résultats confirment que la protéine EryCIII produite dans E . coli et purifiée ci-dessus a l'activité desoaminyl transférase attendue et a été correctement renaturée . EXEMPLE 31 : utilisation de la séquence du gène eryCIII comme sonde pour isoler les gènes oleGl et oleG2 codant pour des glycosyltransferases chez S. antibioticus . 1) clonage des gènes oleGl et oleG2The results obtained by chemical revelation show the appearance of a less mobile product having an Rf close to the expected erythromycin D and for which a weak antibiotic activity is detected by direct autobiogram of the plates on B. pumilus. No biological activity was observed for the control test (Figure 19). These results confirm that the EryCIII protein produced in E. coli and purified above has the expected desoaminyl transferase activity and has been properly renatured. EXAMPLE 31 Use of the eryCIII gene sequence as a probe to isolate the oleGl and oleG2 genes coding for glycosyltransferases in S. antibioticus. 1) cloning of the oleGl and oleG2 genes
La séquence du gène eryCIII de Sac . erythraea correspondant à l'ORFδ décrite à l'exemple 1 codant pour l'activité désosaminyltransférase a été utilisée pour préparer une sonde d'hybridation et a permis d'isoler des gènes homologues dans la souche S . antibioticus ATCC 11691 productrice d'oléandomycine par hybridation Southern. L'intégralité du gène eryCIII a été amplifiée par PCR à partir de 6 ng du plasmide pK62 obtenu à l'exemple 1 en suivant les conditions opératoires décrites à l'exemple 3 en utilisant la polymerase native pfu (Stratagene) et comme amorces l'oligonucleotide ayant la séquence suivante : eryCIII-1 CGGGTACCATGCGCGTCGTCTTCTCCTCCATG (SEQ ID N° 59) comportant un site de restriction Kpnl dans sa région 5' et dont la partie 3 ' correspond au brin complémentaire de la région d'ADN située de la position 10196 à la position 10219 de la séquence de la figure 2 et l'oligonucleotide eryCIII2 ayant la séquence suivante : eryCIII-2 CGGGTACCTCATCGTGGTTCTCTCCTTCC (SEQ ID N° 60) comportant un site Kpnl dans sa région 5' et dont la partie 3' correspond à la région d'ADN située de la position 6954 à la position 8974 de la séquence de la figure 2.The sequence of the Sac eryCIII gene. erythraea corresponding to the ORFδ described in example 1 coding for the deosaminyltransferase activity was used to prepare a hybridization probe and made it possible to isolate homologous genes in the strain S. oleandomycin-producing ATCC 11691 antibioticus by Southern hybridization. The entire eryCIII gene was amplified by PCR from 6 ng of the plasmid pK62 obtained in Example 1 by following the operating conditions described in Example 3 using the native polymerase pfu (Stratagene) and as primers. oligonucleotide having the following sequence: eryCIII-1 CGGGTACCATGCGCGTCGTCTTCTCCTCCATG (SEQ ID No. 59) having a Kpnl restriction site in its 5 'region and of which the 3' part corresponds to the complementary strand of the DNA region located at position 10196 to position 10219 of the sequence of FIG. 2 and the oligonucleotide eryCIII2 having the following sequence: eryCIII-2 CGGGTACCTCATCGTGGTTCTCTCCTTCC (SEQ ID No. 60) comprising a KpnI site in its 5 'region and whose part 3' corresponds to the region of DNA located from position 6954 to position 8974 of the sequence of Figure 2.
La bande d'environ 1,2 kb obtenue par amplification a été ensuite digérée par l'enzyme de restriction Kpnl et clonée dans le plasmide pUC19 préalablement digéré par l'enzyme Kpnl. Le plasmide pCIIIPCRl ainsi obtenu a été ensuite utilisé pour réisoler le fragment Kpnl de 1,2 kb correspondant à l'intégralité du gène eryCIII montré à la figure 2. Le fragment ainsi isolé a été ensuite marqué au 32P par la technique "random priming" décrite par Sambrook et al., 1989 et utilisé comme sonde eryCIII pour analyser par hybridation Southern des clones cosmides obtenus à partir d'une banque d'ADN génomique de S. antibioticus ATCC 11691 et préparés de la façon suivante (figure 20) :The approximately 1.2 kb band obtained by amplification was then digested with the restriction enzyme Kpnl and cloned into the plasmid pUC19 previously digested with the enzyme Kpnl. The plasmid pCIIIPCRl thus obtained was then used to re-isolate the 1.2 kb Kpnl fragment corresponding to the entire eryCIII gene shown in FIG. 2. The fragment thus isolated was then labeled with 32 P by the "random priming" technique "described by Sambrook et al., 1989 and used as an eryCIII probe to analyze by Southern hybridization cosmid clones obtained from a genomic DNA library of S. antibioticus ATCC 11691 and prepared as follows (FIG. 20):
Une série de six cosmides (cosAB35, cosAB76, cosAB87, cosAB67, cosAB63 et cosAB61) se chevauchant et couvrant environ 100 kb de la région correspondant au cluster de gènes de la biosynthèse de l'oléandomycine a été isolée en suivant la méthode décrite par Swan et al., 1994 en utilisant comme sondes le fragment Smal de 2 kb interne à la troisième sous- unité de la polykétide synthase de Sac . erythraea dans le cluster de gènes de la biosynthèse de l'érythromycine (Cortes et al., 1990) suivie d'une marche sur le chromosome. Les sondes strD, strE et strM codant respectivement pour la dTDP- glucose synthase, la dTDP-glucose 4 , 6-déshydratase et la dTDP-6-désoxyglucose 3 , 5-épimérase de S. griseus (Stockmann et Piepersberg, 1992) hybrident avec les cosmides cosAB61 et cosAB63 (fig. 20) . De façon analogue, par hybridation Southern avec la sonde eryCIII préparée ci-dessus effectuée selon les conditions standard décrites par Hopwood et al., 1985, le cosmide cosAB35 (Swan et al., 1994) donne des signaux positifs dans deux fragments de restriction BamHI de 3,5kb et de 2,7 kb représentés à la figure 20. Le sous- clonage et le sequençage ultérieurs montrent que ces deux fragments sont séparés par un fragment BamHI de 0,6 kb non détecté par hybridation.A series of six cosmids (cosAB35, cosAB76, cosAB87, cosAB67, cosAB63 and cosAB61) overlapping and covering approximately 100 kb of the region corresponding to the olandomycin biosynthesis gene cluster was isolated using the method described by Swan et al., 1994 using as probes the 2 kb Smal fragment internal to the third subunit of the polyketide synthase of Sac. erythraea in the erythromycin biosynthesis gene cluster (Cortes et al., 1990) followed by a walk on the chromosome. The strD, strE and strM probes coding respectively for dTDP-glucose synthase, dTDP-glucose 4, 6-dehydratase and dTDP-6-deoxyglucose 3, 5-epimerase from S. griseus (Stockmann and Piepersberg, 1992) hybridize with the cosmids cosAB61 and cosAB63 (fig. 20). Similarly, by Southern hybridization with the eryCIII probe prepared above carried out according to the standard conditions described by Hopwood et al., 1985, the cosmid cosAB35 (Swan et al., 1994) gives positive signals in two BamHI restriction fragments. 3.5 kb and 2.7 kb shown in FIG. 20. Subcloning and subsequent sequencing show that these two fragments are separated by a 0.6 kb BamHI fragment not detected by hybridization.
Un fragment SstI de 10,8 kb d'ADN génomique de S. antibioticus ATCC 11891 représenté à la figure 21, correspondant à la partie droite du cluster de gènes de la biosynthèse de l'oléandomycine comprise entre le site SstI en position 11081 du gène 0LE-0RF3 des PKS de la séquence EMBL n°L09654) et le site SstI en position 5 de la séquence EMBL n°L36601 situé à 1,4 kb en amont du gène oleB et hybridant avec la sonde eryCIII préparée ci-dessus, a été isolé à partir du cosmide cosAB35 et sous-cloné dans le vecteur plasmidique pSLllδO (Pharmacia Biotech) . Le clone pC035-S ainsi obtenu a été utilisé pour générer des matrices simple brin par sous-clonage de différents fragments d'ADN dans les bactériophages M13mplδ et MP13mpl9 (New England Biolabs) , puis la séquence nucléotidique de ces fragments a été déterminée selon la méthode de Sanger et al. (1977) en utilisant une polymerase T7 modifiée (Sequenase version 2.0; U.S. Biochemicals) en présence d'α[35S]dCTP (Amersham) et de 7-déaza-dGTP, selon les recommandations du fournisseur afin de limiter les problèmes de compression de bandes. Les amorces conventionnelles fournies avec la trousse Sequenase ainsi que les amorces synthétiques (17mer) internes ont été utilisées.A 10.8 kb SstI fragment of genomic DNA of S. antibioticus ATCC 11891 represented in FIG. 21, corresponding to the right part of the gene cluster for the biosynthesis of oleandomycin between the SstI site at position 11081 of the gene 0LE-0RF3 of PKS of the EMBL sequence no L09654) and the SstI site in position 5 of the EMBL sequence no L36601 located 1.4 kb upstream of the oleB gene and hybridizing with the eryCIII probe prepared above, a was isolated from the cosmid cosAB35 and subcloned into the plasmid vector pSLllδO (Pharmacia Biotech). The clone pC035-S thus obtained was used to generate single-stranded templates by subcloning of different DNA fragments in the bacteriophages M13mplδ and MP13mpl9 (New England Biolabs), then the nucleotide sequence of these fragments was determined according to the method of Sanger et al. (1977) using a modified T7 polymerase (Sequenase version 2.0; US Biochemicals) in the presence of α [ 35 S] dCTP (Amersham) and 7-deaza-dGTP, according to the supplier's recommendations in order to limit compression problems of bands. The conventional primers supplied with the Sequenase kit as well as the internal synthetic primers (17 mer) were used.
L'assemblage des données de séquence a été réalisé en utilisant le programme Fragment Assembly (Genetic Computer Group, University of Wisconsin) et l'identification des phases ouvertes de lecture en utilisant le programme CODONPREFERENCE (Devereux et al., 1984). Les séquences nucléotidiques obtenues ont permis d'établir la séquence nucléotidique de 6093 bp représentée à la figure 22 (séquence de SEQ ID N° 15) , comprise entre les sites SphI et Kpnl montrés à la figure 21, dans laquelle 5 cinq ORFs ont été identifiées respectivement du nucleotide 184 au nucleotide 1386 (ORF dénommée olePl) , du nucleotide 1437 au nucleotide 2714 (ORF dénommée oleGl) , du nucleotide 2722 au nucleotide 3999 (ORF dénommée o!eG2) , du nucleotide 3992 au nucleotide 4729 (ORF dénommée oleM) et du nucleotide 0 4810 au nucleotide 5967 (ORF dénommée oleY) . Les cinq ORFs sont transcrites dans la même direction.The assembly of the sequence data was carried out using the Fragment Assembly program (Genetic Computer Group, University of Wisconsin) and the identification of the open reading phases using the CODONPREFERENCE program (Devereux et al., 1984). The nucleotide sequences obtained made it possible to establish the nucleotide sequence of 6093 bp represented in FIG. 22 (sequence of SEQ ID No. 15), comprised between the SphI and Kpnl sites shown in FIG. 21, in which 5 five ORFs were identified respectively from nucleotide 184 to nucleotide 1386 (ORF designated olePl), from nucleotide 1437 to nucleotide 2714 (ORF designated oleGl), from nucleotide 2722 to nucleotide 3999 (ORF designated o! eG2), from nucleotide 3992 to nucleotide 4729 (ORF designated oleM ) and from nucleotide 0 4810 to nucleotide 5967 (ORF called oleY). The five ORFs are transcribed in the same direction.
Des échantillons de E. coli contenant le plasmide pC035-S comprenant la région codante des ORFs olePl, oleGl, oleG2, oleM et oleY ont été déposés à la Collection Nationale 5 de Cultures de Microorganismes (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, le 8 avril 1996 sous le numéro 1-2003.Samples of E. coli containing the plasmid pC035-S comprising the coding region of the ORFs oleP1, oleGl, oleG2, oleM and oleY were deposited at the National Collection 5 of Cultures of Microorganisms (CNCM) INSTITUT PASTEUR, 25, Rue du Docteur Roux 75724 PARIS CEDEX 15 FRANCE, April 8, 1996 under number 1-2003.
Le gène oleGl code pour un polypeptide ayant 426 acides aminés (séquence de SEQ ID N° 17) . Cependant, la présence 0 d'un codon CGC codant pour une arginine très conservée dans cette classe de glycosyltransférase chez les Streptomycètes situé immédiatement en amont du codon GTG, indiquerait que le codon initiateur pourrait être le codon CTG en position 1431 de la séquence SEQ ID N° 17.The oleGl gene codes for a polypeptide having 426 amino acids (sequence of SEQ ID No. 17). However, the presence 0 of a CGC codon coding for an arginine very conserved in this class of glycosyltransferase in Streptomycetes located immediately upstream of the GTG codon, would indicate that the initiating codon could be the CTG codon at position 1431 of the sequence SEQ ID N ° 17.
25 Le gène o!eG2 code pour un polypeptide ayant 426 acides aminés (séquence de SEQ ID N° 18) .The o! EG2 gene codes for a polypeptide having 426 amino acids (sequence of SEQ ID NO: 18).
La comparaison des séquences en acides aminés déduites des ORFs oleGl et o!eG2 ci-dessus avec les protéines de bases de données à l'aide du programme Blast (Altschul et al.,Comparison of the amino acid sequences deduced from the oleGl and o! EG2 ORFs above with the database proteins using the Blast program (Altschul et al.,
30 1990) a montré des similarités avec des glycosyl transferases de différentes sources, notamment environ 72 % de similarité et 53 % d'identité avec la déosaminyltransférase EryCIII décrite à l'exemple 30.30 1990) showed similarities with glycosyl transferases from different sources, in particular approximately 72% similarity and 53% identity with the deosaminyltransferase EryCIII described in Example 30.
L'identification de la fonction du gène oleGl ou du gèneIdentification of the function of the oleGl gene or of the gene
35 o!eG2 a été ensuite réalisée par interruption du gène cible dans la souche de S. antibioticus ATCC 11891 et par identification d'un précurseur non glycosylé de l'oléandomycine produit par la souche mutante en utilisant les méthodes décrites dans les exemples 3 à 4.35 o! EG2 was then carried out by interrupting the target gene in the strain of S. antibioticus ATCC 11891 and by identifying a non-glycosylated oleandomomycin precursor produced by the mutant strain using the methods described in examples 3 to 4.
2) génération d'une souche de S. antibioticus oleGlΔ (A35G1) .2) generation of a strain of S. antibioticus oleGlΔ (A35G1).
Une souche dans laquelle le gène oleGl est interrompu a été préparée par intégration d'un plasmide pC03 dans les régions homologues de l'ADN chromosomique de la souche de S. antibioticus ATCC 11891 productrice d'oléandomycine. Dans un premier temps , le fragment BamHI de 0,6 kb interne au gène oleGl, obtenu par digestion du plamide pC035-S préparé ci-dessus, avec l'enzyme de restriction BamHI (figure 21) , a été sous-cloné dans le site BamHI du plasmide pOJ260 NRRL B-14785.A strain in which the oleG1 gene is interrupted was prepared by integration of a plasmid pC03 into the homologous regions of the chromosomal DNA of the strain of S. antibioticus ATCC 11891 producing oleandomycin. First, the 0.6 kb BamHI fragment internal to the oleGl gene, obtained by digestion of the pC035-S plamide prepared above, with the restriction enzyme BamHI (FIG. 21), was subcloned into the BamHI site of plasmid pOJ260 NRRL B-14785.
Le plasmide pC03 ainsi généré a été ensuite transféré dans la souche E. coli TG1 rec01504 : :Tn5 (Kolodner et al., 1965) , puis utilisé pour transformer les protoplastes de S. antibioticus . La sélection des transformants a été réalisée par résistance à l'apramycine (Apramycine pour injection, Rhône Mérieux) .The plasmid pC03 thus generated was then transferred into the strain E. coli TG1 rec01504:: Tn5 (Kolodner et al., 1965), then used to transform the protoplasts of S. antibioticus. The selection of transformants was carried out by resistance to apramycin (Apramycin for injection, Rhône Mérieux).
La préparation des protoplastes a été réalisée à partir de la souche S. antibioticus ATCC llδ91 en suivant les conditions décrites par Hopwood et al., 1985.The protoplasts were prepared from the strain S. antibioticus ATCC llδ91 following the conditions described by Hopwood et al., 1985.
La transformation a été réalisée en utilisant 50 μl d'aliquot de protoplastes, 5 μg d'ADN plasmidique pC03 et en remplaçant le thiostrepton par de l'apramycine à la concentration finale de 25 μg/ml. La sélection des intégrants effectuée par résistance à l'apramycine a permis d'isoler un clone dénommé A35G1.The transformation was carried out using 50 μl of aliquot of protoplasts, 5 μg of plasmid DNA pC03 and replacing the thiostrepton with apramycin at the final concentration of 25 μg / ml. The selection of integrants carried out by resistance to apramycin made it possible to isolate a clone called A35G1.
L'altération attendue dans la région correspondante du chromosome de S. antibioticus a été confirmée par analyse génomique par Southern blot. L'ADN chromosomique isolé puis digéré par l'enzyme de restriction PstI à partir de la souche S. antibioticus sauvage ou du mutant A35G1 a été analysé par Southern en utilisant comme sonde d'hybridation le fragment BamHI de 0,6 kb indiqué ci-dessus. Le remplacement du fragment PstI de 4,7 kb ainsi détecté dans la souche sauvage par deux fragments PstI de 2,4 et 6,5 kb dans le mutant A35G1 confirme l'intégration du plasmide pC03 dans le chromosome de la souche A35G1 au niveau de l'ORF oleGl.The expected alteration in the corresponding region of the chromosome of S. antibioticus was confirmed by genomic analysis by Southern blot. The chromosomal DNA isolated and then digested with the restriction enzyme PstI from the strain S. antibioticus wild or from the mutant A35G1 was analyzed by Southern using, as hybridization probe, the 0.6 kb BamHI fragment indicated above. above. The replacement of the 4.7 kb PstI fragment thus detected in the wild-type strain by two PstI fragments of 2.4 and 6.5 kb in the mutant A35G1 confirms the integration of the plasmid pC03 into the chromosome of the strain A35G1 at the level of the oleGl ORF.
La souche recombinante A35G1 ainsi obtenue a été ensuite cultivée pour identifier les précurseurs produits par la souche.The recombinant strain A35G1 thus obtained was then cultivated to identify the precursors produced by the strain.
3) fermentation de la souche A35G1 et identification des précurseurs de l'oléandomycine produits. La souche A35G1 a été cultivée pendant 72 h en erlen de 50 ml dans le milieu EP2 à partir d'une préculture de 48 h en milieu EPI dans les conditions décrites à l'exemple 4.3) fermentation of the strain A35G1 and identification of the oleandomycin precursors produced. The strain A35G1 was cultured for 72 h in 50 ml Erlenmeyer flask in EP2 medium from a 48 h preculture in PPE medium under the conditions described in Example 4.
Les extraits de bouillon avec de l'acétate d'éthyle ont été ensuite analysés selon les méthodes utilisées dans les exemples 3 et 4. a) L'essai biologique par antibiogramme a été réalisé de la façon suivante :The broth extracts with ethyl acetate were then analyzed according to the methods used in Examples 3 and 4. a) The biological test by antibiogram was carried out as follows:
Après croissance de la souche B. pumilus sur milieu TSB pendant une nuit à 37°C, la culture a été diluée à 1/100 dans du milieu contenant 50 % (w/v) de glycerol, puis la suspension cellulaire obtenue a été conservée à -20 °C avant utilisation.After growth of the B. pumilus strain on TSB medium overnight at 37 ° C., the culture was diluted to 1/100 in medium containing 50% (w / v) of glycerol, then the cell suspension obtained was kept. at -20 ° C before use.
L'essai biologique a ensuite été effectué en introduisant 150 μl de la suspension cellulaire décongelée dans 100 ml de milieu TSB contenant 1 % d'agar et maintenu à 55 °C. Le mélange a été ensuite versé dans des boîtes de pétri. Après refroidissement, des cylindres oxford contenant 50 à 200 μl d'extraits à l'acétate d'éthyle ont été placés sur les boîtes d'agar, maintenus 2 h à 4°C, puis incubés pendant une nuit à 37 °C.The biological test was then carried out by introducing 150 μl of the thawed cell suspension into 100 ml of TSB medium containing 1% agar and maintained at 55 ° C. The mixture was then poured into petri dishes. After cooling, oxford cylinders containing 50 to 200 μl of ethyl acetate extracts were placed on the agar dishes, kept for 2 h at 4 ° C., then incubated overnight at 37 ° C.
Les extraits ne montrent pas d'effet inhibiteur sur la croissance de B. pumilus ATCC 14884. b) L'analyse par ccm par révélation chimique a été effectuée selon les conditions décrites à l'exemple 4 en utilisant comme standards l' érythromycine A, l' érythronolideThe extracts do not show an inhibitory effect on the growth of B. pumilus ATCC 14884. b) The analysis by cmc by chemical development was carried out according to the conditions described in Example 4 using as standards erythromycin A, erythronolide
B ainsi que le 6-désoxyérythronolide B.B as well as 6-deoxyerythronolide B.
L'analyse par ccm montre que la souche A35G1 ne produit pas d'oléandomycine mais accumule préferentiellement un produit pourpre ayant une mobilité plus grande que l' érythronolide B et voisine du 6-désoxyérythronolide B et que l'on peut attendre de la partie aglycone 8,8a-désoxy- oléandolide. c) L'analyse par chromatographie RP-HPLC couplée à la spectrométrie de masse a été réalisée selon les conditions décrites à l'exemple 4. Deux métabolites majeurs, dénommmés M9 et MIO, ont été détectés (élution à 6,12 mn et 17,23 mn respectivement) . Les deux produits donnent un pic parent m/z 373 et des profils de fragmentation analogues qui peuvent être en accord avec la structure [8, 8a-désoxyoléandolide]H+. Cependant seul le temps de rétention du métabolite MIO est en accord avec la structure proposée alors que le métabolite M9 pourrait correspondre à une structure isomère ou au noyau lactone ouvert.The ccm analysis shows that the strain A35G1 does not produce oleandomycin but preferentially accumulates a purple product having greater mobility than erythronolide B and close to 6-deoxyerythronolide B and which can be expected from the aglycone part 8.8a-deoxy-oleandolide. c) Analysis by RP-HPLC chromatography coupled to Mass spectrometry was carried out according to the conditions described in Example 4. Two major metabolites, called M9 and MIO, were detected (elution at 6.12 min and 17.23 min respectively). The two products give a parent peak m / z 373 and similar fragmentation profiles which may be in agreement with the structure [8, 8a-deoxyoleandolide] H + . However, only the retention time of the metabolite MIO is in agreement with the proposed structure whereas the metabolite M9 could correspond to an isomer structure or to the open lactone nucleus.
Des expériences de complémentation des souches mutantes de Sac . erythraea CIII68 décrite à l'exemple 6 et BV68 décrite à l'exemple 16 ont été également réalisées en utilisant des constructions plasmidiques permettant d'exprimer respectivement chacun des gènes oleGl et o!eG2.Complementary experiments with mutant Sac strains. erythraea CIII68 described in Example 6 and BV68 described in Example 16 were also carried out using plasmid constructs making it possible to express each of the oleGl and o! eG2 genes, respectively.
Ces observations et l'absence de détection d'oléandrosyl 8, δa-désoxyoléandolide ou de désosaminyl 8 , 8a-désoxyoléando- lide indiquent que le gène oleGl code pour la désoaminosyl- transférase et le gène oleG2 code pour l'oléandrosyltransfé- rase respectivement impliquées dans la biosynthèse de 1 ' oléandomycine.These observations and the absence of detection of oleandrosyl 8, δa-deoxyoleandolide or desosaminyl 8, 8a-deoxyoleandolide indicate that the oleGl gene codes for deoaminosyl transferase and the oleG2 gene codes for oleandrosyltransferase respectively. in the biosynthesis of oleandomycin.
PREPARATION DE L'EXEMPLE 30 : Thymidine 5 '- (trihydrogen- diphosphate) , ' - [3 , 4 , 6-tridéoxy-3- (diméthylamino) -D-xylo- hexopyranosyl] ester,N,N-diéthyléthanamine STADE A : chlorhydrate 3 , 4 , 6-tridéoxy-3- (diméthylamino) -D- xylohexopyranosePREPARATION OF EXAMPLE 30: Thymidine 5 '- (trihydrogen diphosphate),' - [3, 4, 6-trideoxy-3- (dimethylamino) -D-xylohexopyranosyl] ester, N, N-diethylethanamine STAGE A: 3, 4, 6-trideoxy-3- (dimethylamino) -D- xylohexopyranose hydrochloride
On ajoute sous agitation et à température ambiante 146,6 g d' érythromycine A, à 1,5 litres d'acide chlorhydrique 6N. On porte la solution obtenue au reflux pendant 2 h. On refroidit à la température ambiante, filtre et lave à l'eau le résidu obtenu. On extrait la phase aqueuse au chlorure de méthylène, puis à l'éther sulfurique. On ajoute à la phase aqueuse 10 g de noir L2S et chasse les traces d'éther sous pression réduite. On filtre, et concentre. On effectue un second envoi dans les mêmes conditions. On rassemble les deux essais, dissout dans l'éthanol (150 cm3) , ajoute 150 cm d'éther éthylique. On essore, lave et sèche les cristaux obtenus. On obtient 42 g de produit recherché. F = 158~160°C. STADE B : 3 , 4 , 6-tridéoxy-3- (diméthylamino) -D-xylo-hexopyra- nose,1,2-diacétate146.6 g of erythromycin A are added with stirring and at room temperature to 1.5 liters of 6N hydrochloric acid. The solution obtained is brought to reflux for 2 h. It is cooled to room temperature, filtered and the residue obtained is washed with water. The aqueous phase is extracted with methylene chloride, then with sulfuric ether. 10 g of black L 2 S are added to the aqueous phase and the traces of ether are removed under reduced pressure. We filter and concentrate. A second shipment is made under the same conditions. The two tests are combined, dissolved in ethanol (150 cm 3 ), added 150 cm of ethyl ether. The crystals obtained are drained, washed and dried. 42 g of sought product is obtained. M = 158 ~ 160 ° C. STAGE B: 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylo-hexopyra-nose, 1,2-diacetate
On ajoute sous agitation à 20°C, 60 cm3 de triéthylamine dans un mélange renfermant 15,27 g de produit du stade A et 150 cm3 de chlorure de méthylène. On ajoute à 20°C une solution renfermant 20 cm3 d'anhydride acétique et 80 cm3 de chlorure de méthylène. On agite à la température ambiante pendant 20 heures. On filtre, lave et concentre. On empâte dans l'éther sulfurique. On concentre le filtrat sous pression réduite. On chromatographie le résidu obtenu en éluant avec le mélange acétate d'éthyle-triéthylamine (95-5) . On obtient 18,6 g de produit recherché que l'on utilise tel quel dans le stade suivant. STADE C : 3, 4, 6-tridéoxy-3- (diméthylamino) -D-xylo-hexopyra- nose, 2-acétate60 cm 3 of triethylamine in a mixture containing 15.27 g of product from stage A and 150 cm 3 of methylene chloride are added with stirring at 20 ° C. A solution containing 20 cm 3 of acetic anhydride and 80 cm 3 of methylene chloride is added at 20 ° C. Stir at room temperature for 20 hours. It is filtered, washed and concentrated. We paste in sulfuric ether. The filtrate is concentrated under reduced pressure. The residue obtained is chromatographed, eluting with an ethyl acetate-triethylamine mixture (95-5). 18.6 g of sought product is obtained which is used as it is in the following stage. STAGE C: 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylo-hexopyra-nose, 2-acetate
On porte à 50°C un mélange renfermant 18,6 g du produit du stade B et 50 cm3 de DMF et ajoute 6,62 g d'acétate d'hydrazine NH2NH2 , ACOH. On agite le mélange reactionnel et le verse sur une solution saturée de carbonate acide de sodium. On extrait la phase aqueuse à l'acétate d'éthyle. On rassemble les phases organiques, sèche, filtre et concentre. On distille sous pression réduite pour éliminer le DMF par entraînement azéotrophirque avec le toluène. On obtient 11,28 g de produit que l'on chromatographie sur silice en éluant avec le mélange acétate d'éthyle-triéthylamine (90-10). On obtient 6,5 g de produit recherché que l'on utilise tel quel dans le stade suivant.A mixture containing 18.6 g of the product from stage B and 50 cm 3 of DMF is brought to 50 ° C. and 6.62 g of hydrazine acetate NH 2 NH 2 , ACOH are added. The reaction mixture is stirred and poured onto a saturated solution of sodium hydrogen carbonate. The aqueous phase is extracted with ethyl acetate. The organic phases are combined, dried, filtered and concentrated. Distillation is carried out under reduced pressure to remove the DMF by azeotrophic entrainment with toluene. 11.28 g of product are obtained which is chromatographed on silica eluting with an ethyl acetate-triethylamine mixture (90-10). 6.5 g of sought product is obtained which is used as it is in the following stage.
STADE D : 3 , 4 , 6-tridéoxy-3- (diméthylamino) -D-xylo-hexopyra- nose, 2-acétate bis (phénylméthyl) phosphate On ajoute à -70°C, 5,7 cm3 d'une solution de n-butyl- lithium dans l'hexane dans une solution renfermant 1,738 g du produit du stade précédent et 40 cm3 de THF. On ajoute à -70—75°C 10 g de dibenzylphosphochlorure préparé extempora- nément (J. Chem. Soc. 1958, p. 1957),STAGE D: 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylo-hexopyra-nose, 2-acetate bis (phenylmethyl) phosphate 5.7 cm 3 of a solution are added at -70 ° C of n-butyl lithium in hexane in a solution containing 1.738 g of the product of the previous stage and 40 cm 3 of THF. 10 g of extemporaneously prepared dibenzylphosphochloride are added at -70-75 ° C. (J. Chem. Soc. 1958, p. 1957),
////
CI-THIS-
(OCH2C6H5) en solution dans 20 cm3 de THF. On maintient l'agitation pendant 1 h 30 entre -70 et -74 °C. On verse sur une solution saturée de carbonate acide de sodium, extrait à l'acétate d'éthyle. On sèche la phase organique sur sulfate de sodium, filtre et concentre. On chromatographie le produit obtenu sur silice en éluant avec le mélange acétone-chlorure de méthylène (5-5). On obtient 1,070 g du produit recherché. STADE E : 3 , 4 , 6-tridéoxy-3- (diméthylamino) -D-xylo- hexopyranose, l-(dihydrogen phosphate) ,N,N-diéthyléthanamine On place sous agitation et sous courant d'hydrogène pendant 30 minutes à la température ambiante, un mélange renfermant 1,070 g du produit du stade précédent, 20 cm3 d'acétate d'éthyle, 10 cm3 de methanol, 0,622 cm3 de triéthy- lamine et 200 mg de palladium sur charbon. On filtre, lave au methanol et à l'acétate d'éthyle et concentre le filtrat. On obtient 1 g d'une huile à laquelle on ajoute 10 cm3 de methanol. On agite la solution obtenue pendant 20 heures. On chasse le methanol sous pression réduite à 30°C. On obtient 6δ0 g de produit recherché. STADE F : 3 , 4 , 6-tridéoxy-3- (diméthylamino) -D-xylo- hexopyranose, l-(dihydrogen phosphate)(OCH 2 C 6 H 5 ) dissolved in 20 cm 3 of THF. Stirring is continued for 1 hour 30 minutes between -70 and -74 ° C. Poured onto a saturated solution of sodium hydrogen carbonate, extracted with ethyl acetate. The organic phase is dried over sodium sulfate, filtered and concentrated. The product obtained is chromatographed on silica, eluting with an acetone-methylene chloride mixture (5-5). 1.070 g of the sought product is obtained. STAGE E: 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylohexopyranose, l- (dihydrogen phosphate), N, N-diethylethanamine Is placed under stirring and under a stream of hydrogen for 30 minutes at at room temperature, a mixture containing 1.070 g of the product of the preceding stage, 20 cm 3 of ethyl acetate, 10 cm 3 of methanol, 0.622 cm 3 of triethylamine and 200 mg of palladium on carbon. It is filtered, washed with methanol and ethyl acetate and the filtrate is concentrated. 1 g of an oil is obtained to which 10 cm 3 of methanol are added. The solution obtained is stirred for 20 hours. Methanol is removed under reduced pressure at 30 ° C. 6δ0 g of sought product is obtained. STAGE F: 3, 4, 6-trideoxy-3- (dimethylamino) -D-xylohexopyranose, l- (dihydrogen phosphate)
On dissout 420 mg du produit isolé sous forme de sels de triéthylamine, obtenu au stade précédent, dans 1,6 cm3 de methanol. On ajoute 3,2 cm3 d'éther sulfurique. On ajoute ensuite 6,4 cm3 d'éther sulfurique. On obtient 250 mg de produit recherché fondant à 242~244°C.420 mg of the isolated product in the form of triethylamine salts, obtained in the preceding stage, are dissolved in 1.6 cm 3 of methanol. 3.2 cm 3 of sulfuric ether are added. Then added 6.4 cm 3 of sulfuric ether. 250 mg of sought product is obtained, melting at 242 ° -244 ° C.
STADE G : Thymidine 5'- (trihydrogen diphosphate) ,P'-[3 , 4 , 6- tridéoxy-3- (diméthylamino) -D-xylo-hexopyranosy1] ester ,N,N- diéthyléthanamine On mélange 228 mg du produit de la préparation 1, 6 cmJ de pyridine et 544 mg de thymidine 5 ' -monophosphate morpholi- date-4-morpholine-NN'-dicyclohexylcarboxamidine. On chasse la pyridine sous pression réduite au rotorvapor en maintenant la température à 30°C ou en dessous. On ajoute 6 cm3 de pyridine que l'on chasse sous pression réduite. On répète l'opération 2 fois. On ajoute 6 cm3 de pyridine, 105 mg de lH-tétrazole. On agite pendant 3 jours à la température ambiante. On chasse la pyridine sous pression réduite. On reprend dans l'eau, filtre, concentre et obtient un produit que l'on purifie par chromatographie. On obtient ainsi le produit recherché, rf = 0,12 éluant CH2C12, MeOH, H20 (60-35-6).STAGE G: Thymidine 5'- (trihydrogen diphosphate), P '- [3, 4, 6- trideoxy-3- (dimethylamino) -D-xylo-hexopyranosy1] ester, N, N- diethylethanamine 228 mg of the product is mixed preparation 1, 6 cm J of pyridine and 544 mg of thymidine 5 '-monophosphate morpholi- date-4-morpholine-NN'-dicyclohexylcarboxamidine. The pyridine is removed under reduced pressure on the rotor-vapor while maintaining the temperature at 30 ° C. or below. 6 cm 3 of pyridine are added, which is removed under reduced pressure. The operation is repeated 2 times. 6 cm 3 of pyridine, 105 mg of 1H-tetrazole are added. The mixture is stirred for 3 days at room temperature. The pyridine is removed under reduced pressure. We resume in the water, filter, concentrate and obtain a product which is purified by chromatography. The desired product is thus obtained, rf = 0.12 eluting CH 2 C1 2 , MeOH, H 2 0 (60-35-6).
Références bibliographiques :Bibliographic references:
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) J Mol Biol 215 : 403-410.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) J Mol Biol 215: 403-410.
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA Struhl K (1995) Current protocols in molecular biology. Massachusetts General Hospital and Harvard médical School . John Wiley and Sons, Inc.Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA Struhl K (1995) Current protocols in molecular biology. Massachusetts General Hospital and Harvard Medical School. John Wiley and Sons, Inc.
Bankier AT, Weston KM, Barrell BG (19δ7) Methods in Enzymo- logy 155 : 51-93.Bankier AT, Weston KM, Barrell BG (19δ7) Methods in Enzymology 155: 51-93.
Bevitt DJ, Cortes J, Haydock SF and Leadlay PF, (1992) , Eur. J. Biochem 204 : 39-49.Bevitt DJ, Cortes J, Haydock SF and Leadlay PF, (1992), Eur. J. Biochem 204: 39-49.
Caffrey P, Bevitt DJ, Staunton J, Leadlay PF (1992) FEBS 304 : 225-228.Caffrey P, Bevitt DJ, Staunton J, Leadlay PF (1992) FEBS 304: 225-228.
Cortés J, Haydock SF, Roberts GA, Bevitt DJ, Leadlay PF (1990) Nature 348 : 176-178.Cortés J, Haydock SF, Roberts GA, Bevitt DJ, Leadlay PF (1990) Nature 348: 176-178.
Devereux J, Haeberli P, Smithies O (1984) Nucl Acids Res 12 : 387-395.Devereux J, Haeberli P, Smithies O (1984) Nucl Acids Res 12: 387-395.
Dhillon N, Haie RS, Cortes J, Leadlay PF (1989) Mol Microbiol 3 : 1405-1414.Dhillon N, Haie RS, Cortes J, Leadlay PF (1989) Mol Microbiol 3: 1405-1414.
Dickens ML, Ye J, Strohl WR (1996) J Bacteriol 178 : 3384-3388.Dickens ML, Ye J, Strohl WR (1996) J Bacteriol 178: 3384-3388.
Donadio S, Stassi J, McAlpine JB, Staver MJ, Sheldon PJ, Jackson M, Swanson SJ, Wendt-Pienkowski E, Wang YG, Jarvis B, Hutchinson CR, Katz L (1993) In : Baltz RH, Hegeman GD, Skatrud PL (eds) Industrial Microorganisms : Basic and Applied Molecular Genetics : American Society for Micro- biology, Washington, DC, 257-265.Donadio S, Stassi J, McAlpine JB, Staver MJ, Sheldon PJ, Jackson M, Swanson SJ, Wendt-Pienkowski E, Wang YG, Jarvis B, Hutchinson CR, Katz L (1993) In: Baltz RH, Hegeman GD, Skatrud PL (eds) Industrial Microorganisms: Basic and Applied Molecular Genetics: American Society for Microbiology, Washington, DC, 257-265.
Gandecha AR, Large SL, Cundliffe E (1997) Gène 184 : 197-203.Gandecha AR, Large SL, Cundliffe E (1997) Gene 184: 197-203.
Haydock SF, Dowson JA, Dhillon N, Roberts GA, Cortes J, Leadlay PF (1991) Mol Gen Genêt 230 : 120-128.Haydock SF, Dowson JA, Dhillon N, Roberts GA, Cortes J, Leadlay PF (1991) Mol Gen Genêt 230: 120-128.
Hessler PE, Larsen PE, Constantinou AI, Schram KH, Weber JM, Appl Microbiol. Biotechnol (1997), 47 : 398-404.Hessler PE, Larsen PE, Constantinou AI, Schram KH, Weber JM, Appl Microbiol. Biotechnol (1997), 47: 398-404.
Hopwood DA, Kieser T, Wright HM an Bibb MJ, Journal of General Microbiology (1983), 129, 2257-2269. Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton C, Kieser HM, Lydiate DJ, Smith CP, Ward JM, Schremp H (1985) Genetic manipulation of Streptomyces. A laboratory Manual. John Innés Foundation, Norwich.Hopwood DA, Kieser T, Wright HM an Bibb MJ, Journal of General Microbiology (1983), 129, 2257-2269. Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton C, Kieser HM, Lydiate DJ, Smith CP, Ward JM, Schremp H (1985) Genetic manipulation of Streptomyces. A laboratory Manual. John Innés Foundation, Norwich.
Kaneda T, Butte JC, Taubman B, Corcoran JW (1962) J Biol Chem 237 : 322-327.Kaneda T, Butte JC, Taubman B, Corcoran JW (1962) J Biol Chem 237: 322-327.
Katz E, Thompson CJ, Hopwood DA (1983) J Gen Microbiol 129 : 2703-2714.Katz E, Thompson CJ, Hopwood DA (1983) J Gen Microbiol 129: 2703-2714.
Korz DJ, Rinas U, Hellmuth K, Sanders EA, Deckwer W-D (1995) Journal of Biotechnology 39 : 59-65.Korz DJ, Rinas U, Hellmuth K, Sanders EA, Deckwer W-D (1995) Journal of Biotechnology 39: 59-65.
Katz L, Donadio S (1995) Macrolides. In : Vining LC, Stuttard C (eds) . Genetics and Biochemistry of Antibiotic Production. Butterworth-Heinemann, Newton, MA, 385-420.Katz L, Donadio S (1995) Macrolides. In: Vining LC, Stuttard C (eds). Genetics and Biochemistry of Antibiotic Production. Butterworth-Heinemann, Newton, MA, 385-420.
Liu H-W, Thorson JS (1994) Annu Rev Microbiol 48 : 223-56.Liu H-W, Thorson JS (1994) Annu Rev Microbiol 48: 223-56.
Otten SL, Liu X, Ferguson J, Hutchinson CR (1995) J Bacteriol 177 : 6688-6692.Otten SL, Liu X, Ferguson J, Hutchinson CR (1995) J Bacteriol 177: 6688-6692.
Sakakibara H and Omura S (1984) . In : Omura S. (ed) Macrolide Antibiotics : Chemistry, Biology, and Practice. Académie Press, Inc. London, 65-125.Sakakibara H and Omura S (1984). In: Omura S. (ed) Macrolide Antibiotics: Chemistry, Biology, and Practice. Academy Press, Inc. London, 65-125.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd éd. Cold Spring Harbor Laboratory Press, N.Y.Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, N.Y.
Sanger F, Nicklen S, Coulson AR (1977) Proc Natl Acad Sci USA 74 : 5463-5467.Sanger F, Nicklen S, Coulson AR (1977) Proc Natl Acad Sci USA 74: 5463-5467.
Scotti C, Hutchinson CR (1996) J Bacteriol 178 : 7316-7321.Scotti C, Hutchinson CR (1996) J Bacteriol 178: 7316-7321.
Scrutton NS, Berry A, Perham RN (1990) Nature 343 : 38-43.Scrutton NS, Berry A, Perham RN (1990) Nature 343: 38-43.
Staden R (1964), Nucleic Acids Res 12 : 521-528.Staden R (1964), Nucleic Acids Res 12: 521-528.
Stassi D, Donadio S, Staver MJ, Katz L (1993) J Bacteriol 175 : 182-169.Stassi D, Donadio S, Staver MJ, Katz L (1993) J Bacteriol 175: 182-169.
Stemmer WPC (1994) Proc. Natl. Acad. Sci., Vol. 91, pp. 10747-10751.Stemmer WPC (1994) Proc. Natl. Acad. Sci., Vol. 91, pp. 10747-10751.
Stockmann M, and Piepersberg W (1992) FEMS Microbiol Lett 90 : 185-190.Stockmann M, and Piepersberg W (1992) FEMS Microbiol Lett 90: 185-190.
Swan D.G., Rodriguez A.M. , Vilches C. , Méndez C. , Salas J.A. , (1994) Mol Gen Genêt 242 : 358-362.Swan D.G., Rodriguez A.M., Vilches C., Méndez C., Salas J.A., (1994) Mol Gen Genêt 242: 358-362.
Ward JM, Janssen GR, Kieser T, Bibb MJ, Buttner MJ, Bibb MJ (1986) Mol. Gen. Genêt. 203 : 468-475Ward JM, Janssen GR, Kieser T, Bibb MJ, Buttner MJ, Bibb MJ (1986) Mol. Gen. Broom. 203: 468-475
Weber JM, Wierman CK, Hutchinson CR (1985) J Bacteriol 164 : 425-433.Weber JM, Wierman CK, Hutchinson CR (1985) J Bacteriol 164: 425-433.
Weber JM, Losick R (1988) Gène 68 : 173-180.Weber JM, Losick R (1988) Gene 68: 173-180.
Weber JM, Schoner B, Losick R (1989) Gène 75 : 235-241. Weber JM, Leung JO, Maine GT, Potenz RHB, Paulus TJ, DeWitt JP (1990) J Bacteriol 172 : 2372-2383.Weber JM, Schoner B, Losick R (1989) Gene 75: 235-241. Weber JM, Leung JO, Maine GT, Potenz RHB, Paulus TJ, DeWitt JP (1990) J Bacteriol 172: 2372-2383.
Weber JM, Leung JO, Swanson SJ, Idler KB, McAlpine JB (1991) Science 252 : 114-117.Weber JM, Leung JO, Swanson SJ, Idler KB, McAlpine JB (1991) Science 252: 114-117.
Wehmeier UF (1995) Gène 165 : 149-150.Wehmeier UF (1995) Gene 165: 149-150.
Wierenga RK, Terpstra P, Hol WGJ (1986) J. Mol. Biol. 187 : 101-107.Wierenga RK, Terpstra P, Hol WGJ (1986) J. Mol. Biol. 187: 101-107.
Yamamoto H, Maurer KH, Hutchinson CR (1986) J Antibiot 34 : 1304-1313. Yamamoto H, Maurer KH, Hutchinson CR (1986) J Antibiot 34: 1304-1313.
Texte libre de la liste de séquencesFree text from sequence list
SEQ ID NO: 1:SEQ ID NO: 1:
/function≈ "implique dans la biosynthese du mycarose" /gene= "eryBII"/ function≈ "involved in the biosynthesis of mycarosis" / gene = "eryBII"
/function≈ "implique dans la biosynthese de la desosamine" /gene= "eryCII"/ function≈ "involves in the biosynthesis of desosamine" / gene = "eryCII"
SEQ ID NO: 4: /function≈ "implique dans la biosynthese de la desosamine" /gene= "eryCIII" /note= "SEQ ID NO 1 DE 1046 A 2308"SEQ ID NO: 4: / function≈ "involved in the biosynthesis of desosamine" / gene = "eryCIII" / note = "SEQ ID NO 1 FROM 1046 TO 2308"
SEQ ID NO: 6: /function= "implique dans la biosynthese du mycarose"SEQ ID NO: 6: / function = "involved in the biosynthesis of mycarosis"
/gene≈ "eryBIV"/ gene≈ "eryBIV"
/transl_except= (pos: 242 .. 244, aa: Met)/ transl_except = (pos: 242 .. 244, aa: Met)
/function= "implique dans la biosynthese du mycarose"/ function = "involved in the biosynthesis of mycarosis"
/gene≈ "eryBV" /transl_except= (pos: 1210 .. 1212, aa: Met)/ gene≈ "eryBV" / transl_except = (pos: 1210 .. 1212, aa: Met)
/function≈ "implique dans la biosynthese de la desosamine"/ function≈ "involves in the biosynthesis of desosamine"
/gene≈ "eryCVI"/ gene≈ "eryCVI"
/function≈ "implique dans la biosynthese du mycarose"/ function≈ "involves in the biosynthesis of mycarosis"
/gene≈ "eryBVI" /transl_except= (pos: 3308 .. 3310, aa: Met)/ gene≈ "eryBVI" / transl_except = (pos: 3308 .. 3310, aa: Met)
/function≈ "implique dans la biosynthese de la desosamine"/ function≈ "involves in the biosynthesis of desosamine"
/gene≈ "eryCV"/ gene≈ "eryCV"
/function≈ "implique dans la biosynthese du mycarose"/ function≈ "involves in the biosynthesis of mycarosis"
/gene≈ "eryBVII" /transl_except= (pos: 7578 .. 7580, aa: Met)/ gene≈ "eryBVII" / transl_except = (pos: 7578 .. 7580, aa: Met)
SEQ ID NO: 13:SEQ ID NO: 13:
/function≈ "implique dans la biosynthese de la desosamine" /gene≈ "eryCIV" /note≈ "SEQ ID NO 6 DE 4837 A 6039"/ function≈ "involved in the biosynthesis of desosamine" / gene≈ "eryCIV" / note≈ "SEQ ID NO 6 FROM 4837 TO 6039"
SEQ ID NO: 15: /gene≈ "olePl" /function≈ "glycosylation de 8 , 8a-desoxyoleandolide" /gene≈ "oleGl"SEQ ID NO: 15: / gene≈ "olePl" / function≈ "glycosylation of 8, 8a-desoxyoleandolide" / gene≈ "oleGl"
/transl_except= (pos: 1437 .. 1439, aa: Met) /function≈ "glycosylation de 8,8a-desoxyoleandolide" /gene≈ "oleG2" /gene≈ "oleY"/ transl_except = (pos: 1437 .. 1439, aa: Met) / function≈ "glycosylation of 8,8a-desoxyoleandolide" / gene≈ "oleG2" / gene≈ "oleY"
SEQ ID NO: 20: /gene≈ "oleM" /note≈ "SEQ ID NO 15 DE 3992 A 4729"SEQ ID NO: 20: / gene≈ "oleM" / note≈ "SEQ ID NO 15 FROM 3992 TO 4729"
SEQ ID NO: 22 à SEQ ID NO: 60 /desc = "OLIGONUCLEOTIDE"SEQ ID NO: 22 to SEQ ID NO: 60 / desc = "OLIGONUCLEOTIDE"
SEQ ID NO: 61:SEQ ID NO: 61:
/note≈ "SEQ ID NO 11 DE 38 A 50" / note≈ "SEQ ID NO 11 FROM 38 TO 50"

Claims

REVENDICATIONS
1) Séquence d'ADN simple ou double brin isolée, représentée à la figure 2 (séquence directe ou complémentaire de SEQ ID1) Isolated single or double stranded DNA sequence, represented in FIG. 2 (direct or complementary sequence of SEQ ID
N° 1) correspondant à la région eryG-eryAIII du cluster de gènes de la biosynthèse de 1 ' érythromycine .No. 1) corresponding to the eryG-eryAIII region of the gene cluster for the biosynthesis of erythromycin.
2) Séquence d'ADN selon la revendication 1 comprenant :2) DNA sequence according to claim 1 comprising:
- la séquence eryBII correspondant à 1ORF7 (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046) et codant pour une dTDP-4-céto-L-6-désoxyhexose 2, 3-réductase,the sequence eryBII corresponding to 1ORF7 (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046) and coding for a dTDP-4-keto-L-6-deoxyhexose 2,3-reductase,
- la séquence eryCIII correspondant à 1ORF8 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) et codant pour une désosaminyltransférase etthe sequence eryCIII corresponding to 1ORF8 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308) and coding for a deosaminyltransferase and
- la séquence eryCII correspondant à 1 ' ORF9 (séquence complé- mentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide- the eryCII sequence corresponding to ORF9 (sequence complementary to SEQ ID N ° 1 from nucleotide 2322 to nucleotide
3404) et codant pour une dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase .3404) and coding for a dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase.
3) Séquence d'ADN isolée représentée à la figure 2 choisie parmi la séquence eryBII correspondant à 1 ' ORF7 (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046), la séquence eryCIII correspondant à l'ORF8 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) ou la séquence eryCII correspondant à l'ORF9 (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) et les séquences qui hybrident et/ou présentent des homologies significatives avec cette séquence ou des fragments de celle-ci et ayant la même fonction.3) Isolated DNA sequence represented in FIG. 2 chosen from the eryBII sequence corresponding to 1 ORF7 (sequence complementary to SEQ ID N ° 1 from nucleotide 48 to nucleotide 1046), the eryCIII sequence corresponding to ORF8 (complementary sequence from SEQ ID No.1 from nucleotide 1046 to nucleotide 2308) or the eryCII sequence corresponding to ORF9 (sequence complementary to SEQ ID No.1 from nucleotide 2322 to nucleotide 3404) and the sequences which hybridize and / or show significant homologies with this sequence or fragments thereof and having the same function.
4) Séquence d'ADN isolée eryCIII représentée à la figure 2 correspondant à 1ORF8 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308 = séquence complémentaire de SEQ ID N° 4) et codant pour une désosaminyl transférase .4) Isolated DNA sequence eryCIII represented in FIG. 2 corresponding to 1ORF8 (sequence complementary to SEQ ID No. 1 from nucleotide 1046 to nucleotide 2308 = sequence complementary to SEQ ID No. 4) and coding for a deosaminyl transferase.
5) Polypeptide codé par l'une des séquences d'ADN selon l'une des revendications 1 à 4. 6) Polypeptide selon la revendication 5 correspondant à une ORF représentée à la figure 2, choisie parmi 1 ' ORF7 (ayant la séquence de SEQ ID N° 2), 1ORF8 (ayant la séquence de SEQ ID N° 5) ou 1ORF9 (ayant la séquence de SEQ ID N° 3) et les analogues de ce polypeptide.5) Polypeptide encoded by one of the DNA sequences according to one of claims 1 to 4. 6) Polypeptide according to claim 5 corresponding to an ORF represented in FIG. 2, chosen from 1 ORF7 (having the sequence of SEQ ID No. 2), 1ORF8 (having the sequence of SEQ ID No. 5) or 1ORF9 (having the sequence of SEQ ID No. 3) and the analogs of this polypeptide.
7) Polypeptide selon la revendication 5 correspondant à 1ORF8 représentée à la figure 2 (ayant la séquence de SEQ ID N° 5) et ayant une activité désosaminyltransférase, dénommée EryCIII.7) A polypeptide according to claim 5 corresponding to 1ORF8 represented in FIG. 2 (having the sequence of SEQ ID No. 5) and having a deosaminyltransferase activity, called EryCIII.
8) Séquence d'ADN isolée représentée à la figure 3 (séquence de SEQ ID N° 6) correspondant à la région eryAI-eryK du cluster de gènes de la biosynthèse de l' érythromycine .8) Isolated DNA sequence represented in FIG. 3 (sequence of SEQ ID No. 6) corresponding to the eryAI-eryK region of the erythromycin biosynthesis gene cluster.
9) Séquence d'ADN selon la revendication 8 comprenant : - la séquence eryBIV correspondant à 1ORF13 (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) et codant pour une dTDP-4-céto-L-6-désoxyhexose 4-réductase,9) DNA sequence according to claim 8 comprising: - the eryBIV sequence corresponding to 1ORF13 (sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207) and coding for a dTDP-4-keto-L-6-deoxyhexose 4 -reductase,
- la séquence eryBV correspondant à 1ORF14 (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) et codant pour une mycarosyltransférase,the sequence eryBV corresponding to 1ORF14 (sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454) and coding for a mycarosyltransferase,
- la séquence eryCVI correspondant à 1ORF15 (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) et codant pour une dTDP-D-6-désoxyhexose 3-N-méthyltransférase,the sequence eryCVI corresponding to 1ORF15 (sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220) and coding for a dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- la séquence eryBVI correspondant à 1ORF16 (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) et codant pour une dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase,the sequence eryBVI corresponding to 1ORF16 (sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837) and coding for a dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase,
- la séquence eryCIV correspondant à 1ORF17 (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) et codant pour une dTDP-D-6-désoxyhexose 3 , 4-déshydratase, - la séquence eryCV correspondant à 1ORF18 (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) et codant pour une dTDP-D-4 , 6-didésoxyhexose 3 , 4-réductase et- the eryCIV sequence corresponding to 1ORF17 (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039) and coding for a dTDP-D-6-deoxyhexose 3, 4-dehydratase, - the eryCV sequence corresponding to 1ORF18 (sequence of SEQ ID No. 6 from nucleotide 6080 to nucleotide 7546) and coding for a dTDP-D-4, 6-dideoxyhexose 3, 4-reductase and
- la séquence eryBVII correspondant à 1ORF19 (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) et codant pour une dTDP-4-céto-D-6-désoxyhexose 3,5 épimérase.the sequence eryBVII corresponding to 1ORF19 (sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156) and coding for a dTDP-4-keto-D-6-deoxyhexose 3.5 epimerase.
10) Séquence d'ADN isolée représentée à la figure 3 choisie parmi la séquence eryBIV correspondant à 1ORF13 (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) , la séquence eryBV correspondant à 1ORF14 (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454), la séquence eryCVI correspondant à 1ORF15 (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220), la séquence eryBVI correspondant à 1ORF16 (séquence de SEQ ID N° 6 du nucléo- tide 3308 au nucleotide 4837) , la séquence eryCIV correspondant à 1ORF17 (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039), la séquence eryCV correspondant à 1ORF18 (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) ou la séquence eryBVII correspondant à 1ORF1910) Isolated DNA sequence represented in FIG. 3 chosen from the eryBIV sequence corresponding to 1ORF13 (sequence of SEQ ID No. 6 from nucleotide 242 to nucleotide 1207), the eryBV sequence corresponding to 1ORF14 (sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454), the eryCVI sequence corresponding to 1ORF15 (sequence of SEQ ID No. 6 from nucleotide 2510 to nucleotide 3220), the eryBVI sequence corresponding to 1ORF16 (sequence of SEQ ID No. 6 of the nucleo- tide 3308 at nucleotide 4837), the eryCIV sequence corresponding to 1ORF17 (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039), the eryCV sequence corresponding to 1ORF18 (sequence of SEQ ID No. 6 from nucleotide 6080 to nucleotide 7546) or the eryBVII sequence corresponding to 1ORF19
(séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) et les séquences qui hybrident et/ou présentent des homologies significatives avec cette séquence ou des fragments de celle-ci et ayant la même fonction. 11) Séquence d'ADN isolée eryBV représentée à la figure 3 correspondant à 1ORF14 (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) et codant pour une mycarosyltransférase .(sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156) and the sequences which hybridize and / or show significant homologies with this sequence or fragments thereof and having the same function. 11) Isolated DNA sequence eryBV represented in FIG. 3 corresponding to 1ORF14 (sequence of SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454) and coding for a mycarosyltransferase.
12) Polypeptide codé par l'une des séquences d'ADN selon l'une des revendications 8 à 11.12) Polypeptide encoded by one of the DNA sequences according to one of claims 8 to 11.
13) Polypeptide selon la revendication 12 correspondant à une ORF représentée à la figure 3, choisie parmi 1ORF13 (ayant la séquence de SEQ ID N° 7), 1ORF14 (ayant la séquence de SEQ ID N° 8), 1ORF15 (ayant la séquence de SEQ ID N° 9), 1ORF16 (ayant la séquence de SEQ ID N° 10), 1ORF17 (ayant la séquence de SEQ ID N° 14) , 1ORF18 (ayant la séquence de SEQ ID N° 11) ou 1ORF19 (ayant la séquence de SEQ ID N° 12) et les analogues de ce peptide.13) Polypeptide according to claim 12 corresponding to an ORF represented in FIG. 3, chosen from 1ORF13 (having the sequence of SEQ ID No. 7), 1ORF14 (having the sequence of SEQ ID No. 8), 1ORF15 (having the sequence of SEQ ID No. 9), 1ORF16 (having the sequence of SEQ ID No. 10), 1ORF17 (having the sequence of SEQ ID No. 14), 1ORF18 (having the sequence of SEQ ID No. 11) or 1ORF19 (having the sequence of SEQ ID No. 12) and the analogs of this peptide.
14) Polypeptide selon la revendication 12 correspondant à 1ORF14 représentée à la figure 3 (ayant la séquence de SEQ14) Polypeptide according to claim 12 corresponding to 1ORF14 represented in FIG. 3 (having the sequence of SEQ
ID N° 8) et ayant une activité mycarosyltransférase, dénommé EryBV.ID No. 8) and having mycarosyltransferase activity, called EryBV.
15) Utilisation d'au moins l'une des séquences d'ADN choisie parmi les séquences eryBII (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046) , eryCIII (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) ou eryCII (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) représentées à la figure 2, eryBIV (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) , eryBV (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) , eryCVI (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) , eryBVI (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) , eryCIV (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) , eryCV (séquence de SEQ ID N° 6 du nucleotide 6080 au nucleotide 7546) ou eryBVII (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) représentée à la figure 3, pour synthétiser des métabolites secondaires hybrides chez Sac . erythraea .15) Use of at least one of the DNA sequences chosen from the sequences eryBII (sequence complementary to SEQ ID No. 1 from nucleotide 48 to nucleotide 1046), eryCIII (sequence complementary to SEQ ID No. 1 to nucleotide 1046 at nucleotide 2308) or eryCII (sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404) shown in FIG. 2, eryBIV (sequence from SEQ ID No. 6 from nucleotide 242 to nucleotide 1207), eryBV (sequence from SEQ ID No 6 from nucleotide 1210 to nucleotide 2454), eryCVI (sequence of SEQ ID No 6 from nucleotide 2510 to nucleotide 3220), eryBVI (sequence of SEQ ID No 6 from nucleotide 3308 to nucleotide 4837), eryCIV (sequence of SEQ ID No 6 from nucleotide 4837 to nucleotide 6039), eryCV (sequence of SEQ ID No 6 from nucleotide 6080 to nucleotide 7546) or eryBVII (sequence of SEQ ID No 6 of nucleotide 7578 to nucleotide 8156) shown in Figure 3, to synthesize hybrid secondary metabolites in Sac. erythraea.
16) Utilisation d'au moins l'une des séquences d'ADN choisie parmi les séquences eryBII (séquence complémentaire de SEQ ID N° 1 du nucleotide 48 au nucleotide 1046), eryCIII (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308) ou eryCII (séquence complémentaire de SEQ ID N° 1 du nucleotide 2322 au nucleotide 3404) représentées à la figure 2, eryBIV (séquence de SEQ ID N° 6 du nucleotide 242 au nucleotide 1207) , eryBV (séquence de SEQ ID N° 6 du nucleotide 1210 au nucleotide 2454) , eryCVI (séquence de SEQ ID N° 6 du nucleotide 2510 au nucleotide 3220) , eryBVI (séquence de SEQ ID N° 6 du nucleotide 3308 au nucleotide 4837) , eryCIV (séquence de SEQ ID N° 6 du nucleotide 4837 au nucleotide 6039) , eryCV (séquence de SEQ ID N° 6 du nucléo- tide 6080 au nucleotide 7546) ou eryBVII (séquence de SEQ ID N° 6 du nucleotide 7578 au nucleotide 8156) représentée à la figure 3 ou d'un fragment de cette séquence, comme sondes d' hybridation .16) Use of at least one of the DNA sequences chosen from the sequences eryBII (sequence complementary to SEQ ID N ° 1 from nucleotide 48 to nucleotide 1046), eryCIII (sequence complementary to SEQ ID N ° 1 from nucleotide 1046 at nucleotide 2308) or eryCII (sequence complementary to SEQ ID No. 1 from nucleotide 2322 to nucleotide 3404) shown in FIG. 2, eryBIV (sequence from SEQ ID No. 6 from nucleotide 242 to nucleotide 1207), eryBV (sequence from SEQ ID No. 6 from nucleotide 1210 to nucleotide 2454), eryCVI (sequence of SEQ ID No. 6 of nucleotide 2510 to nucleotide 3220), eryBVI (sequence of SEQ ID No. 6 from nucleotide 3308 to nucleotide 4837), eryCIV (sequence of SEQ ID No. 6 from nucleotide 4837 to nucleotide 6039), eryCV (sequence of SEQ ID No. 6 of nucleotide 6080 to nucleotide 7546) or eryBVII (sequence of SEQ ID No. 6 from nucleotide 7578 to nucleotide 8156) shown in Figure 3 or a fragment of this sequence, as hybridization probes we .
17) Utilisation de la séquence d'ADN eryCIII représentée à la figure 2 (séquence complémentaire de SEQ ID N° 1 du nucleotide 1046 au nucleotide 2308 = séquence complémentaire de SEQ ID N° 4) comme sonde d'hybridation pour isoler des gènes homologues responsables de la glycosylation de la macrolactone chez une souche productrice de macrolide. 18) Utilisation selon la revendication 17 dans laquelle les gènes homologues sont les gènes de la biosynthèse de l'oléandomycine chez S. antibioticus .17) Use of the DNA sequence eryCIII represented in FIG. 2 (sequence complementary to SEQ ID N ° 1 from nucleotide 1046 to nucleotide 2308 = sequence complementary to SEQ ID N ° 4) as a hybridization probe to isolate homologous genes responsible for the glycosylation of macrolactone in a macrolide producing strain. 18) Use according to claim 17 wherein the homologous genes are the genes for the biosynthesis of oleandomycin in S. antibioticus.
19) Séquence d'ADN isolée représentée à la figure 2219) Isolated DNA sequence shown in Figure 22
(séquence de SEQ ID N° 15) correspondant à une région du cluster de gènes de la biosynthèse de l'oléandomycine comprenant :(sequence of SEQ ID No. 15) corresponding to a region of the gene cluster for the biosynthesis of oleandomycin comprising:
- la séquence correspondant à l'ORF olePl du nucleotide 184 au nucleotide 1386, - la séquence correspondant à l'ORF oleGl du nucleotide 1437 au nucleotide 2714 codant pour une activité glycosyltransférase,the sequence corresponding to the oleP1 ORF from nucleotide 184 to nucleotide 1386, the sequence corresponding to the ORF oleGl from nucleotide 1437 to nucleotide 2714 coding for a glycosyltransferase activity,
- la séquence correspondant à l'ORF oleG2 du nucleotide 2722 au nucleotide 3999 codant pour une activité glycosyltransférase,the sequence corresponding to the oleG2 ORF from nucleotide 2722 to nucleotide 3999 encoding a glycosyltransferase activity,
- la séquence correspondant à l'ORF oleM du nucleotide 3992 au nucleotide 4720 (= séquence de SEQ ID N° 20) etthe sequence corresponding to the oleM ORF from nucleotide 3992 to nucleotide 4720 (= sequence of SEQ ID No. 20) and
- la séquence correspondant à l'ORF oleY du nucleotide 4810 au nucleotide 5967.the sequence corresponding to the oleY ORF from nucleotide 4810 to nucleotide 5967.
20) Séquence d'ADN isolée représentée à la figure 22 choisie parmi la séquence correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714 codant pour une activité glycosyltransférase et la séquence correspondant à l'ORF oleG2 (séquence de SEQ ID N° 15 du nucleotide 2722 au nucleotide 3999) codant pour une activité glycosyltransférase .20) Isolated DNA sequence represented in FIG. 22 chosen from the sequence corresponding to the oleG1 ORF (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714 coding for a glycosyltransferase activity and the sequence corresponding to the oleG2 ORF (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) coding for glycosyltransferase activity.
21) Séquence d'ADN isolée selon la revendication 20 correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714) codant pour une activité désosaminyltransférase .21) Isolated DNA sequence according to claim 20 corresponding to the ORF oleGl (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) coding for deosaminyltransferase activity.
22) Séquence d'ADN isolée selon la revendication 20 correspondant à l'ORF oleG2 (séquence de SEQ ID N° 15 du nucleotide 2722 au nucleotide 3999) codant pour une activité oléandrosyltransférase .22) Isolated DNA sequence according to claim 20 corresponding to the ORF oleG2 (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) coding for an oleandrosyltransferase activity.
23) Polypeptide codé par la séquence d'ADN correspondant à l'ORF oleGl et ayant une activité désosaminyltransférase (séquence de SEQ ID N° 17) .23) Polypeptide encoded by the DNA sequence corresponding to the ORF oleG1 and having a deosaminyltransferase activity (sequence of SEQ ID No. 17).
24) Polypeptide codé par la séquence d'ADN correspondant à l'ORF oleG2 et ayant une activité oléandrosyltransférase24) Polypeptide encoded by the DNA sequence corresponding to the oleG2 ORF and having oleandrosyltransferase activity
(séquence de SEQ ID N° 18) .(sequence of SEQ ID No. 18).
25) Procédé de préparation de métabolites secondaires hybrides chez Sac . erythraea dans lequel :25) Process for the preparation of hybrid secondary metabolites in Sac. erythraea in which:
- on isole une séquence ADN contenant au moins une séquence eryB ou une séquence eryC du cluster de gènes de la biosynthèse de l' érythromycine représentée à la figure 2 (séquence complémentaire de SEQ ID N° 1) ou à la figure 3 (séquence de SEQ ID N° 6) , - on crée une modification dans la dite séquence et on obtient une séquence altérée,- a DNA sequence is isolated containing at least one eryB sequence or one eryC sequence from the erythromycin biosynthesis gene cluster shown in FIG. 2 (sequence complementary to SEQ ID No. 1) or in FIG. 3 (sequence of SEQ ID N ° 6), - we create a modification in the said sequence and we obtain an altered sequence,
- on intègre la séquence altérée dans le chromosome de la souche hôte et on obtient une souche modifiée, - on cultive la souche modifiée dans des conditions permettant la formation du métabolite secondaire hybride et- the altered sequence is integrated into the chromosome of the host strain and a modified strain is obtained, - the modified strain is cultivated under conditions allowing the formation of the hybrid secondary metabolite and
- on isole le métabolite secondaire hybride.- the hybrid secondary metabolite is isolated.
26) Procédé selon la revendication 25 dans lequel la séquence ADN code pour l'une des enzymes choisie parmi une - dTDP-4-céto-L-6-désoxyhexose 2 , 3-réductase,26) Method according to claim 25 wherein the DNA sequence codes for one of the enzymes chosen from a - dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase,
- désosaminyltransférase,- desosaminyltransferase,
- dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase,- dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase,
- dTDP-4-céto-L-6-désoxyhexose 4-réductase,- dTDP-4-keto-L-6-deoxyhexose 4-reductase,
- mycarosyltransférase, - dTDP-D-6-désoxyhexose 3-N-méthyltransférase,- mycarosyltransferase, - dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- dTDP-4-céto-L-6-désoxyhexose 2 , 3 -déshydratase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase,
- dTDP-D-6-désoxyhexose 3 , 4-déshydratase,- dTDP-D-6-deoxyhexose 3, 4-dehydratase,
- dTDP-D-4 , 6-didésoxyhexose 3 , 4-réductase ou- dTDP-D-4, 6-dideoxyhexose 3, 4-reductase or
- dTDP-4-céto-D-6-désoxyhexose 3,5 épimérase. 27) Procédé selon la revendication 25 dans lequel l'altération de la séquence résulte dans l'inactivation d'au moins l'une des enzymes choisie parmi une- dTDP-4-keto-D-6-deoxyhexose 3,5 epimerase. 27) The method of claim 25 wherein the alteration of the sequence results in the inactivation of at least one of the enzymes chosen from a
- dTDP-4-céto-L-6-désoxyhexose 2 , 3-réductase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase,
- désosaminyltransférase, - dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase,- desosaminyltransferase, - dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase,
- dTDP-4-céto-L-6-désoxyhexose 4-réductase,- dTDP-4-keto-L-6-deoxyhexose 4-reductase,
- mycarosyltransférase,- mycarosyltransferase,
- dTDP-D-6-désoxyhexose 3-N-méthyltransférase,- dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase, - dTDP-D-6-désoxyhexose 3 , 4-déshydratase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase, - dTDP-D-6-deoxyhexose 3, 4-dehydratase,
- dTDP-D-4, 6-didésoxyhexose 3 , 4-réductase ou- dTDP-D-4, 6-dideoxyhexose 3, 4-reductase or
- dTDP-4-céto-D-6-désoxyhexose 3,5 épimérase.- dTDP-4-keto-D-6-deoxyhexose 3,5 epimerase.
28) Procédé selon la revendication 27 dans lequel l'enzyme inactivée est une dTDP-4-céto-L-6-désoxyhexose 4-réductase. 29) Procédé selon la revendication 27 dans lequel l'enzyme inactivée est une dTDP-D-6-désoxyhexose 3 , 4-déshydratase . 30) Procédé selon la revendication 27 dans lequel l'enzyme inactivée est une mycarosyltransférase. 31) Procédé selon la revendication 27 dans lequel l'enzyme inactivée est une dTDP-4-céto-L-6-désoxyhexose 2 , 3-réductase .28) The method of claim 27 wherein the inactivated enzyme is a dTDP-4-keto-L-6-deoxyhexose 4-reductase. 29) The method of claim 27 wherein the inactivated enzyme is a dTDP-D-6-deoxyhexose 3, 4-dehydratase. 30) The method of claim 27 wherein the inactivated enzyme is a mycarosyltransferase. 31) The method of claim 27 wherein the inactivated enzyme is a dTDP-4-keto-L-6-deoxyhexose 2,3-reductase.
32) Procédé selon la revendication 25 dans lequel le métabolite secondaire hybride isolé est un analogue de 1' érythromycine choisi parmi la 4 " -céto-érythromycine, la 4 ' -hydroxy-érythromycine ou la 3 " -C-désméthyl-2" , 3 " -ène- érythromycine .32) The method according to claim 25, in which the isolated hybrid secondary metabolite is an erythromycin analog chosen from 4 "-keto-erythromycin, 4" -hydroxy-erythromycin or 3 "-C-desmethyl-2", 3 "-ene- erythromycin.
33) Procédé selon la revendication 25 dans lequel le métabolite secondaire hybride isolé est le désosaminyl érythronolide B.33) The method of claim 25 wherein the isolated hybrid secondary metabolite is desosaminyl erythronolide B.
34) Souche de Sac . erythraea modifiée dans laquelle au moins l'une des enzymes choisie parmi une34) Bag strain. modified erythraea in which at least one of the enzymes chosen from
- dTDP-4-céto-L-6-désoxyhexose 2 , 3-réductase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase,
- désosaminyltransférase, - dTDP-4-céto-D-6-désoxyhexose 3 , 4-isomérase,- desosaminyltransferase, - dTDP-4-keto-D-6-deoxyhexose 3, 4-isomerase,
- dTDP-4-céto-L-6-désoxyhexose 4-réductase,- dTDP-4-keto-L-6-deoxyhexose 4-reductase,
- mycarosyltransférase,- mycarosyltransferase,
- dTDP-D-6-désoxyhexose 3-N-méthyltransférase,- dTDP-D-6-deoxyhexose 3-N-methyltransferase,
- dTDP-4-céto-L-6-désoxyhexose 2 , 3-déshydratase, - dTDP-D-6-désoxyhexose 3 , 4-déshydratase,- dTDP-4-keto-L-6-deoxyhexose 2, 3-dehydratase, - dTDP-D-6-deoxyhexose 3, 4-dehydratase,
- dTDP-D-4, 6-didésoxyhexose 3 , 4-réductase ou- dTDP-D-4, 6-dideoxyhexose 3, 4-reductase or
- dTDP-4-céto-D-6-désoxyhexose 3,5 épimérase est inactivée et produisant au moins un métabolite secondaire hybride . 35) Souche de Sac . erythraea modifiée (BII92) dans laquelle une dTDP-4-céto-L-6-désoxyhexose 2 , 3-réductase est inactivée et produisant la 3 " -C-désméthyl-2 ", 3 " -ène-érythromycine C.- dTDP-4-keto-D-6-deoxyhexose 3,5 epimerase is inactivated and produces at least one secondary hybrid metabolite. 35) Bag strain. modified erythraea (BII92) in which a dTDP-4-keto-L-6-deoxyhexose 2, 3-reductase is inactivated and producing 3 "-C-desmethyl-2", 3 "-ene-erythromycin C.
36) Souche de Sac . erythraea modifiée (BIV87) dans laquelle une dTDP-4-céto-L-6-désoxyhexose 4-réductase est inactivée et produisant la 4" -céto-érythromycine .36) Bag strain. modified erythraea (BIV87) in which a dTDP-4-keto-L-6-deoxyhexose 4-reductase is inactivated and producing 4 "-keto-erythromycin.
37) Souche de Sac . erythraea modifiée (CIV89) dans laquelle une dTDP-D-6-désoxyhexose 3 , 4-déshydratase est inactivée et produisant la 4 ' -hydroxyérythromycine D.37) Bag strain. modified erythraea (CIV89) in which a dTDP-D-6-deoxyhexose 3, 4-dehydratase is inactivated and producing 4 '-hydroxyerythromycin D.
38) Souche de Sac . erythraea modifiée (BV88) dans laquelle une mycarosyltransférase est inactivée et produisant du desoaminyl érythronolide B.38) Bag strain. modified erythraea (BV88) in which a mycarosyltransferase is inactivated and produces desoaminyl erythronolide B.
39) Procédé de préparation de précurseurs de l'oléandomycine chez S . antibioticus dans lequel - on crée une altération de la séquence du gène choisie parmi la séquence d'ADN correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714) et la séquence d'ADN correspondant à l'ORF oleG2 (séquence de SEQ ID N° 15 du nucleotide 2722 au nucleotide 3999) dans le chromosome d'une souche hôte et obtient une souche modifiée,39) Process for the preparation of oleandomycin precursors in S. antibioticus in which - an alteration of the gene sequence chosen from the DNA sequence corresponding to the oleG1 ORF (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) and the DNA sequence corresponding to the oleG2 ORF is created (sequence of SEQ ID No. 15 from nucleotide 2722 to nucleotide 3999) in the chromosome of a host strain and obtains a modified strain,
- on cultive la souche modifiée dans des conditions permettant l'accumulation des précurseurs de l'oléandomycine etthe modified strain is cultivated under conditions allowing the accumulation of the oleandomycin precursors and
- on isole ces précurseurs.- these precursors are isolated.
40) Procédé selon la revendication 39 dans lequel l'altération est créée dans la séquence d'ADN correspondant à l'ORF oleGl (séquence de SEQ ID N° 15 du nucleotide 1437 au nucleotide 2714) et dont il résulte au moins l'élimination de l'activité désoaminyltransférase et l'accumulation du précurseur de l'oléandomycine 8 , 8a-désoxyoléandolide .40) The method of claim 39 wherein the alteration is created in the DNA sequence corresponding to the ORF oleGl (sequence of SEQ ID No. 15 from nucleotide 1437 to nucleotide 2714) and which results in at least the elimination deoaminyltransferase activity and the accumulation of the oleandomycin 8,8a-deoxyoleandolide precursor.
41) Thymidine 5 ' - (trihydrogène diphosphate) , P' - [3 , 4 , 6- tridésoxy-3- (diméthylamino) -D- .xylo. -hexopyranosyl] ester (dTDP-D-désosamine) et les sels d'addition avec les bases. 41) Thymidine 5 '- (trihydrogen diphosphate), P' - [3, 4, 6-trideoxy-3- (dimethylamino) -D- .xylo. -hexopyranosyl] ester (dTDP-D-desosamine) and the addition salts with bases.
EP98940290A 1997-07-25 1998-07-21 Genes for biosynthesis and transfer of 6-deoxy-hexoses in saccharopolyspora erythrea and streptomyces antibioticus and uses thereof Withdrawn EP1032679A2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
FR9709458 1997-07-25
FR9709458A FR2766496B1 (en) 1997-07-25 1997-07-25 GENES OF BIOSYNTHESIS AND TRANSFER OF 6-DEOXYHEXOSES IN SACCHAROPOLYSPORA ERYTHRAEA AND THEIR USE
FR9807411A FR2786200A1 (en) 1998-06-12 1998-06-12 New nucleic acid sequences encoding enzymes involved in macrolide biosynthesis
FR9807411 1998-06-12
PCT/FR1998/001593 WO1999005283A2 (en) 1997-07-25 1998-07-21 Biosynthesis genes and transfer of 6-desoxy-hexoses in saccharopolyspora erythraea and in streptomyces antibioticus and their use

Publications (1)

Publication Number Publication Date
EP1032679A2 true EP1032679A2 (en) 2000-09-06

Family

ID=26233703

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98940290A Withdrawn EP1032679A2 (en) 1997-07-25 1998-07-21 Genes for biosynthesis and transfer of 6-deoxy-hexoses in saccharopolyspora erythrea and streptomyces antibioticus and uses thereof

Country Status (3)

Country Link
EP (1) EP1032679A2 (en)
JP (1) JP2001511349A (en)
WO (1) WO1999005283A2 (en)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6399789B1 (en) 1996-12-18 2002-06-04 Kosan Biosciences, Inc. Multi-plasmid method for preparing large libraries of polyketides and non-ribosomal peptides
US6388099B2 (en) 1998-10-29 2002-05-14 Kosan Biosciences, Inc. Production of 8,8a-dihydroxy-6-deoxyerythronolide B
ATE331028T1 (en) * 1999-04-16 2006-07-15 Kosan Biosciences Inc MULTI-PLASMID PROCESS FOR PRODUCING LARGE LIBRARIES OF POLYKETIDES AND NON-RIBOSOMAL PEPTIDES
ES2165278B1 (en) * 1999-06-24 2003-06-16 Univ Oviedo A PROCEDURE FOR OBTAINING GLYCOSILATED PRODUCTS THROUGH THE BIOSYNTHESIS OF THE DEOXIAZUCAR: L-OLIVE, L-OLEANDROSA AND L-RAMNOSA.
US7033818B2 (en) 1999-10-08 2006-04-25 Kosan Biosciences, Inc. Recombinant polyketide synthase genes
US6524841B1 (en) 1999-10-08 2003-02-25 Kosan Biosciences, Inc. Recombinant megalomicin biosynthetic genes and uses thereof
DK1278881T3 (en) 2000-04-13 2010-05-10 Biotica Tech Ltd Glycosylated hybrid products and their preparation and use
WO2002029035A2 (en) * 2000-10-05 2002-04-11 Regents Of The University Of Minnesota Method to alter sugar moieties
FR2845394A1 (en) * 2002-10-08 2004-04-09 Aventis Pharma Sa New polynucleotides encoding proteins involved in spiramycin biosynthesis, useful for improving synthesis of macrolide antibiotics or for generating new hybrid macrolides
US7579167B2 (en) 2002-10-08 2009-08-25 Aventis Pharma S. Polypeptides involved in the biosynthesis of spiramycins, nucleotide sequences encoding these polypeptides and applications thereof
FR2851773A1 (en) * 2003-02-27 2004-09-03 Aventis Pharma Sa New polynucleotides encoding proteins involved in spiramycin biosynthesis, useful for improving synthesis of macrolide antibiotics or for generating new hybrid macrolides
AU2003300479B2 (en) * 2002-10-08 2009-12-10 Aventis Pharma S.A. Polypeptides involved in spiramycin biosynthesis, nucleotide sequences encoding said polypeptides and uses thereof
GB0327721D0 (en) * 2003-11-28 2003-12-31 Biotica Tech Ltd Polyketides and their synthesis
EP2668284B1 (en) 2011-01-28 2014-10-15 Amyris, Inc. Gel-encapsulated microcolony screening
WO2012158466A1 (en) 2011-05-13 2012-11-22 Amyris, Inc. Methods and compositions for detecting microbial production of water-immiscible compounds
BR112015002724B1 (en) 2012-08-07 2022-02-01 Total Marketing Services Method for producing a heterologous non-catabolic compound, and, fermentation composition
CA2903053C (en) 2013-03-15 2023-01-17 Amyris, Inc. Use of phosphoketolase and phosphotransacetylase for production of acetyl-coenzyme a derived compounds
CN105934517A (en) 2013-08-07 2016-09-07 阿迈瑞斯公司 Methods for stabilizing production of acetyl-coenzyme A derived compounds
CN107075461B (en) 2014-11-14 2020-10-23 浙江海正药业股份有限公司 Spinosad heterologous expression strain and construction method and application thereof
AU2016284689B9 (en) 2015-06-25 2022-01-20 Amyris, Inc. Maltose dependent degrons, maltose-responsive promoters, stabilization constructs, and their use in production of non-catabolic compounds

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5141926A (en) * 1990-04-18 1992-08-25 Abbott Laboratories Erythromycin derivatives
US5801032A (en) * 1995-08-03 1998-09-01 Abbott Laboratories Vectors and process for producing high purity 6,12-dideoxyerythromycin A by fermentation
US5998194A (en) * 1995-12-21 1999-12-07 Abbott Laboratories Polyketide-associated sugar biosynthesis genes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9905283A3 *

Also Published As

Publication number Publication date
JP2001511349A (en) 2001-08-14
WO1999005283A3 (en) 1999-05-27
WO1999005283A2 (en) 1999-02-04

Similar Documents

Publication Publication Date Title
EP1032679A2 (en) Genes for biosynthesis and transfer of 6-deoxy-hexoses in saccharopolyspora erythrea and streptomyces antibioticus and uses thereof
CA2322449C (en) Biosynthetic genes for spinosyn insecticide production
EP2271666B1 (en) Nrps-pks gene cluster and its manipulation and utility
Niemi et al. Nucleotide sequences and expression of genes from Streptomyces purpurascens that cause the production of new anthracyclines in Streptomyces galilaeus
JP2000502899A (en) Polyketide-linked sugar biosynthesis gene
Suwa et al. Identification of two polyketide synthase gene clusters on the linear plasmid pSLA2-L in Streptomyces rochei
AU728870B2 (en) Isolation of the biosynthesis genes for pseudo- oligosaccharides from Streptomyces glaucescens GLA.O and their use
US5786181A (en) Process for producing high purity 6, 12-dideoxyerythromycin A by fermentation
Arisawa et al. Direct fermentative production of acyltylosins by genetically-engineered strains of Streptomyces fradiae
JP7086984B2 (en) Compositions and Methods for Enhancing Enduracididine Production in Recombinant strains of Streptomyces fungicidicus
FR2786200A1 (en) New nucleic acid sequences encoding enzymes involved in macrolide biosynthesis
WO2001002585A1 (en) Gene encoding cyclic lipopeptide acylase and expression of the same
US20040219645A1 (en) Polyketides and their synthesis
FR2786189A1 (en) New nucleic acid sequences encoding enzymes involved in macrolide biosynthesis
FR2766496A1 (en) New nucleic acid sequences encoding enzymes involved in macrolide biosynthesis
FR2786201A1 (en) New nucleic acid sequences encoding enzymes involved in macrolide biosynthesis
JP2005512506A (en) Biosynthetic genes for the production of butenyl-spinosine insecticides
Stratigopoulos et al. Inactivation of a transcriptional repressor during empirical improvement of the tylosin producer, Streptomyces fradiae
CA2441275A1 (en) Gene cluster for rabelomycin biosynthesis and its use to generate compounds for drug screening
KR101110175B1 (en) Polypeptides involved in spiramycin biosynthesis, nucleotide sequences encoding said polypeptides and uses thereof
EP0792285B1 (en) Process for producing anthracyclines and intermediates thereof
EP0806480A2 (en) Frenolicin gene cluster
JP2009502187A (en) Genes involved in thiocoralin biosynthesis and their heterologous production
JP2004089156A (en) Vicenistatin synthetase gene cluster, vicenisamine sugar transferase polypeptide and gene encoding the polypeptide
KR20000016470A (en) Method for isolating pseudo-oligosaccharide biosynthesizing gene from streptomyces glaucescens gla.o and usage of the same

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000117

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AVENTIS PHARMA S.A.

17Q First examination report despatched

Effective date: 20040305

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20050514