JP4935969B2 - Yeast caproic acid high production strain - Google Patents

Description

The present invention relates to a yeast mutant strain that produces caproic acid at a high level, a method for producing such a mutant strain, and a method for regulating the production of caproic acid in yeast.

  Ethyl caproate is a typical aroma component of Ginjo aroma and is one of the important components in the quality of Ginjo sake. Ethyl caproate is produced by esterification of the precursor caproic acid, and the amount produced depends on the amount of caproic acid supplied. Furthermore, caproic acid in sake is biosynthesized by yeast fatty acid synthase (FAS), but is not accumulated as caproic acid but is metabolized. Therefore, the production of ethyl caproate from caproic acid is generally negligible.

  Therefore, further increasing caproic acid productivity or conversely suppressing it is an important issue in pursuing the quality of luxury products such as sake. Moreover, it can utilize for the differentiation of goods not only in sake but also in all the foods manufactured with yeast.

  Here, Patent Document 1 teaches a cerulenin-resistant mutation method as a breeding method for mutant yeast that produces caproic acid at a high yield. This document describes that mutant strains that produce a large amount of caproic acid and / or ethyl caproate can be obtained by mutation treatment of various yeasts and selection of a strain that grows on a cerulenin-containing medium. Yes. In the Examples, strains with improved caproic acid production ability are obtained from sake yeast.

  In addition, according to Non-Patent Document 1, in the yeast cerulenin-resistant strain, in the partial amino acid sequence shown in SEQ ID NO: 2 contained in FAS2 by single base substitution of the FAS2 gene encoding the α subunit of fatty acid synthase, The glycine of amino acid number 4 is substituted with serine.

Further, according to Non-Patent Document 2, in the cerulenin-resistant yeast in which the glycine is artificially substituted with cysteine by in vitro mutagenesis, the caproic acid is more effective than the cerulenin-resistant mutant strain in which the glycine is substituted with serine. Teaching that production is high.
Japanese Patent Publication No.7-46982 Inokoshi et al, Mol. Gen Genet., 244,90-96 (1994) Aritomi et al, Biosci. Biotechnol. Biochem., 68, 206-214 (2004)

  It is an object of the present invention to provide a yeast mutant with improved caproic acid production, a method for producing such a mutant, and a method for regulating the caproic acid production of yeast.

In order to solve the above-mentioned problems, the present inventor repeated research and obtained the following knowledge.
(i) In the partial amino acid sequence shown in SEQ ID NO: 1 of FAS1 of the fatty acid synthase of yeast, when Xaa of amino acid number 7 is glutamic acid, the amount of caproic acid produced by the yeast is higher than that of aspartic acid.
(ii) In the partial base sequence shown in SEQ ID NO: 3 of the FAS1 gene, when n of base number 21 is A or G , the FAS1 protein has Xaa of amino acid number 7 in the partial amino acid sequence shown in SEQ ID NO: 1 is glutamic acid It will be a thing.
(iii) FAS1 of sake yeast and shochu yeast is aspartic acid in the partial amino acid sequence shown in SEQ ID NO: 1, but laboratory yeast, wine yeast, whiskey yeast, baker's yeast, top beer yeast, Lager brewer's yeast, distilled liquor yeast, and yeast reference strains have corresponding partial amino acid sequences where Xaa is glutamic acid.

The present invention has been completed based on the above findings, and provides the following yeast caproic acid high-producing strains and the like.
Item 1. A strain producing a fatty acid synthase comprising FAS1 having a partial amino acid sequence in which Xaa of amino acid number 7 of the amino acid sequence shown in SEQ ID NO: 1 is glutamic acid is mutated, and a strain that has acquired cerulenin resistance from the mutated yeast is obtained. Yeast caproic acid high-producing strain obtained by selection.

  Item 2. Mutation treatment of yeast selected from the group consisting of laboratory yeast, wine yeast, whiskey yeast, baker's yeast, top brewer's yeast, lager brewer's yeast, distilled liquor yeast, and yeast reference strain, and cerrenin resistance from the mutated yeast A yeast caproic acid high-producing strain obtained by selecting the acquired strain.

  Item 3. Laboratory yeast itr001 strain (FERM P-20638).

  Item 4. Laboratory yeast strain S288CR (FERM P-20639).

  Item 5. FAS1 having a partial amino acid sequence in which Xaa at amino acid number 7 is glutamic acid in the amino acid sequence shown in SEQ ID NO: 1 and a partial amino acid sequence in which Xaa at amino acid number 4 in the amino acid sequence shown in SEQ ID NO: 2 is serine or cysteine A yeast caproic acid high-producing strain that produces a fatty acid synthase comprising FAS2.

  Item 6. Mutating a yeast producing a fatty acid synthase having FAS1 having a partial amino acid sequence in which Xaa of amino acid number 7 is glutamic acid in the amino acid sequence shown in SEQ ID NO: 1, and acquired cerulenin resistance from the mutated yeast A method for producing a yeast caproic acid high-producing strain comprising a step of selecting a strain.

  Item 7. Mutating yeast selected from the group consisting of laboratory yeast, wine yeast, whiskey yeast, baker's yeast, top brewer's yeast, lager brewer's yeast, distilled liquor yeast, and yeast reference strain, and cerulenin from the mutated yeast A method for producing a yeast caproic acid high-producing strain comprising a step of selecting a strain that has acquired resistance.

  Item 8. A step of substituting Xaa of amino acid number 7 of the partial amino acid sequence shown in SEQ ID NO: 1 contained in fatty acid synthase FAS1 of sake yeast or shochu yeast from aspartic acid to glutamic acid, a step of mutagenesis, A method for producing a yeast caproic acid high-producing strain comprising a step of selecting a strain that has acquired cerulenin resistance from the inside.

  Item 9. A method for regulating the amount of caproic acid produced by yeast, comprising the step of substituting n of base number 21 of the partial base sequence shown in SEQ ID NO: 3 contained in the fatty acid synthase FAS1 gene of yeast.

  Item 10. A method for producing alcoholic beverages or bread using yeast, wherein the yeast is a yeast caproic acid high-producing strain according to item 1, 2, or 5, or a strain according to item 3 or 4.

  Item 11. Item 6. A liquor produced by using a yeast caproic acid high-producing strain according to Item 1, 2, or 5, or a strain according to Item 3 or 4, as bread.

  Conventionally, it has been thought that the production amount of caproic acid is increased by the mutation of FAS2 of the fatty acid synthase of yeast. However, it was found that the production amount of caproic acid is also increased by the mutation of FAS1 according to the present invention. .

  That is, in most yeasts, FAS1 is aspartic acid or glutamic acid in the partial amino acid sequence shown in SEQ ID NO: 1, but the amount of caproic acid produced is aspartic acid in yeast strains in which this amino acid is glutamic acid. It is about 1.4 times that of a certain yeast strain. Moreover, in the laboratory yeast, wine yeast, whiskey yeast, baker's yeast, top brewer's yeast, lager brewer's yeast, distilled liquor yeast, and yeast reference strain, the amino acid (Xaa) is glutamic acid.

  Therefore, cultivated yeast strains such as laboratory yeast, wine yeast, whiskey yeast, baker's yeast, top brewer's yeast, lager brewer's yeast, distilled liquor yeast, and yeast reference strains such that the amino acid is glutamic acid are cerulenin resistant. If a FAS2 mutant strain that has acquired the above is selected, a yeast mutant strain with a very high caproic acid production amount can be obtained due to the structures of both FAS1 and FAS2.

Hereinafter, the present invention will be described in detail.
(I) Yeast caproic acid high production strain and production method thereof The yeast caproic acid high production strain of the present invention has an amino acid number in the amino acid sequence (Asn Thr Asp Asp Tyr Phe Xaa Glu Leu Arg; SEQ ID NO: 1). A method comprising a step of mutating a yeast producing a fatty acid synthase comprising FAS1 having a partial amino acid sequence wherein Xaa of 7 is glutamic acid, and a step of selecting a strain having acquired cerulenin resistance from the mutated yeast can get.

  The amino acid of amino acid number 7 of SEQ ID NO: 1 (hereinafter referred to as “target amino acid”) is the amino acid located at position 171 in FAS1 of laboratory yeast S288C strain which is a yeast standard strain. The amino acid sequence of FAS1 of laboratory yeast strain S288C is shown in SEQ ID NO: 10. Examples of the yeast in which this amino acid in the corresponding partial amino acid sequence of FAS1 is glutamic acid include laboratory yeast, wine yeast, whiskey yeast, baker's yeast, top beer yeast, lager beer yeast (Saccharomyses carlsbergensis), distilled liquor yeast, And yeast reference strains.

  In sake yeast, shochu yeast, etc., the above-mentioned target amino acid is originally aspartic acid, but mutant strains in which this target amino acid is substituted with glutamic acid in sake yeast or shochu yeast can also be used. In the FAS1 gene, the target amino acid is encoded by a codon consisting of GAn of base numbers 19 to 21 in the partial base sequence AAC ACC GAC GAC TAC TTT GAn GAA TTG CGT (SEQ ID NO: 3). In the base sequence of SEQ ID NO: 3, n of base number 21 (hereinafter referred to as “target base”) is located at position 513 in the FAS1 gene sequence of laboratory yeast strain S288C. The nucleotide sequence of the FAS1 gene of laboratory yeast strain S288C is shown in SEQ ID NO: 11. In sake yeast and shochu yeast, the target base is C. When the base is A or G, the target amino acid is glutamic acid. Therefore, for example, a mutant strain that produces FAS1 in which the target amino acid is glutamic acid is obtained by site-specific mutation in which the target base of the FAS1 gene of sake yeast or shochu yeast is substituted from C to A or G.

  The mutation treatment method is not particularly limited, and a known method can be used. For example, methods such as chemical treatment with ethyl methanesulfonic acid, N-methyl-N-nitro-N-nitrosoguanidine, nitrous acid, acridine dyes, ultraviolet irradiation, radiation irradiation and the like can be mentioned.

  Next, a strain that has acquired resistance to cerulenin is selected from the mutated yeast. Cerrenin is a substance that inhibits fatty acid synthase, and according to Patent Document 1, there are many strains in which the production amount of intermediate fatty acids including caproic acid is improved compared to the parent strain. Therefore, if a strain that has a mutation in FAS2 and has acquired resistance to cerulenin is selected from among the mutation-treated strains of the strain that has a large amount of caproic acid production due to the fact that the 171st amino acid of FAS1 is glutamic acid. Yeast mutants with very high caproic acid production are obtained.

  Further, the order of the mutation of FAS1 and the mutation of FAS2 may be switched. That is, a strain with high caproic acid production is selected from cerulenin-resistant strains obtained by mutating sake yeast or shochu yeast, and then site-specific mutation of the 513th base of FAS1 gene, etc. The amino acid at position 171 of FAS1 can be substituted with glutamic acid. This also provides a strain with very high caproic acid production.

  The cerulenin-resistant strain is prepared by applying the mutation-treated strain to, for example, YPD agar medium (YPD medium added with 2% agar) to which about 10 to 50 μM cerulenin is added. Selection is possible by culturing for about 10 days. From these, a strain having a high production amount of caproic acid may be selected.

Further, a yeast that produces a fatty acid synthase comprising FAS1 whose target amino acid is glutamic acid and mutated FAS2 having a partial amino acid sequence in which Xaa of amino acid number 4 is serine or cysteine in the amino acid sequence of SEQ ID NO: 2 Acid production is very high. Such FAS2 mutation can be caused not only by mutation treatment and selection of cerulenin-resistant strains but also by site-specific mutation of the FAS2 gene.
(II) Method for regulating caproic acid production The method for regulating the caproic acid production of the yeast of the present invention is a method comprising the step of substituting the target base of the fatty acid synthase gene FAS1 of yeast. As described above, the target base is a partial base sequence of the FAS1 gene and refers to base n of base number 21 in the base sequence shown in SEQ ID NO: 3. When the 513th base of the fatty acid synthase FAS1 gene in yeast is C or T, it can be replaced with A or G to increase caproic acid production. On the other hand, when the target base of the FAS1 gene is A or T, if this is substituted with C, caproic acid production can be reduced.

Since the caproic acid production amount of yeast influences the production amount of ethyl caproate, the aroma such as ginjo aroma can be controlled by adjusting the caproic acid production amount of yeast used for sake production.
(III) Alcohol or bread and method for producing the same The method for producing liquor or bread of the present invention is a method using the above-described caproic acid high-producing strain of the present invention as yeast. Since the yeast strain of the present invention has a high production amount of caproic acid, the production amount of ethyl caproate is high. Alcohol and bread obtained by this method have a very high aroma due to ethyl caproate. Liquors are not particularly limited, and examples include sake, shochu, beer, whiskey, and wine.
EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.

Modification of caproic acid productivity of cerulenin-resistant mutant yeast by replacement of FAS1 gene
<Disruption of FAS1 gene of cerulenin resistant strain>
FAS1 of caproic acid high production mutant strain 7-C-8 (FERM-P-8252; JP 7-46982) obtained by mutation treatment and selection of cerulenin resistance by the sake brewer's association of sake brewing No.7, both ends of the kanMX marker Were transformed with a gene disruption cassette having a FAS1 homologous sequence to obtain a FAS1 disruption strain.

  Specifically, PCR was performed using the following forward primer FAS1F (ACTATGCGGTCTCGTCCTCTACGAATAT; SEQ ID NO: 4) and reverse primer (ACACTTACGCATTTTTATTTCTCTTC; SEQ ID NO: 5) using genomic DNA prepared from the 7-C-8 strain as a template. . The obtained PCR product was blunted with the TaKaRa BKL kit, phosphorylated at the 5 'end, and then ligated to the pAG25 vector cut with the restriction enzyme PvuII and treated with CIP. The prepared plasmid was named C-8FAS1-pAG25.

Plasmid C-8FAS1-pAG25 was cut with the restriction enzyme PvuII to excise most of the FAS1 coding region and replaced with the selectable marker kanMX. The selection marker kanMX is a plasmid pFA6a-kanMX4 (Wach A et.al., Yeast 10, 1793-1808 (1994)) as a template, forward primer kanF (ATCGATGAATTCGAGCTCG; SEQ ID NO: 6), reverse primer kanR (ACGTACGCTGCAGGTCGAC; SEQ ID NO: PCR was carried out using 7) as a primer. This selectable marker kanMX was blunted with the TaKaRa BKL kit and phosphorylated at the 5 ′ end, and then C-8FAS1-pAG25 was cleaved with the restriction enzyme PvuII and ligated with an about 6.7 kbp fragment purified by gel electrophoresis. Using the obtained plasmid as a template, PCR amplified fragments obtained by PCR using FAS1F and FAS1R as primers were used as a gene disruption cassette for the disruption of the yeast FAS1 gene.
<Introduction of mutant FAS1>
7-C-8 strain in which FAS1 was disrupted, (i) a FAS1 clone in which the amino acid at position 171 of FAS1 was replaced with glutamic acid by site-directed mutation; (ii) a laboratory yeast in which the amino acid of FAS1 was originally glutamic acid Each FAS1 allele of S288C strain and D458-5A strain; and (iii) FAS1 (control) were introduced.

  Specifically, (i) the 513th base of FAS1 of the plasmid C-8FAS1-pAG25 was converted from C to A by using QuikChange II Site-Directed Mutagenesis Kit of STRATAGENE. The method followed the kit protocol. For mutagenesis, forward primer D171E-1F (ACACCGACGACTACTTTGAAGAATTGCGTGATCTATATC; SEQ ID NO: 8) and reverse primer D171E-1R (GATATAGATCACGCAATTCTTCAAAGTAGTCGTCGGTGT; SEQ ID NO: 9) were used.

  Moreover, (ii) FAS1 of laboratory yeast S288C strain and D458-5A strain was obtained as follows. PCR was performed using the above-described forward primer FAS1F and reverse primer FAS1R using the genomic DNA prepared from each of the S288C strain and the D458-5A strain as a template. The obtained PCR product was blunted with the TaKaRa BKL kit, phosphorylated at the 5 'end, and then ligated to the pAG25 vector cut with the restriction enzyme PvuII and treated with CIP. The prepared plasmids were named S288CFAS1-pAG25 and D458FAS1-pAG25.

For (iii), the plasmid C-8FAS1-pAG25 was used as it was.
<Transformation method>
Using the plasmids (i), (ii), and (iii) above, the FAS1-disrupted strain of the 7-C-8 strain was transformed. Transformation was performed according to Gietz et. al. Yeast 11, 355-360 (1995) et al. Specifically, yeast cultured overnight in YPD medium (2% glucose, 2% polypeptone, 1% yeast extract) was inoculated to a fresh YPD medium of 2 to 5 × 10 ⁶ cells / ml, and 2 to 3 The cells were cultured by shaking at 30 ° C. for a period of time. The yeast cells were washed twice with 10 ml of sterilized water and once with 10 ml of TE / LiAc solution (100 mM lithium acetate pH 7.5, 10 mM Tris-HCl buffer, 1 mM EDTA pH 7.5), and 2 × 10 ⁹ cells. / Ml in TE / LiAc solution and incubated at 30 ° C. for 15 minutes. 50 μl of the suspension is put into a sterilized Eppendorf tube, 5 μl (50 μg) of single-stranded carrier DNA, 5 μl (10 μg) of DNA, PEG / TE / LiAc solution (40% (w / v) PEG 3350, 100 mM-lithium acetate pH 7.5, 10 mM Add 300 μl of Tris-HCl buffer, 1 mM EDTA pH 7.5), mix well by vortexing, incubate for 30 minutes at 30 ° C., heat shock for 20 minutes at 42 ° C., and centrifuge for 15 seconds to collect the collected yeast cells. The suspension was suspended in a YPD medium and cultured for 2 hours at 30 ° C. with shaking. The selection medium for the FAS1 gene disruption strain is YPD + FA + G418 agar (2% glucose, 2% polypeptone, 1% yeast extract, 2 mM sodium myristate, 0.5% Tween 40, 1000 ppm G418 (geneticin), 2% agar), FAS1 trait YPD + NAT agar medium (2% glucose, 2% polypeptone, 1% yeast extract, 200 ppm clonNAT (norsethotricin), 2% agar) was used as a selective medium for the transformant.

The state of replacement of FAS1 in the 7-C-8 strain described above is shown in FIG.
<Method for measuring caproic acid production>
Each transformed yeast cell cultured at 30 ° C. for 2 days in 5 ml of YPD medium is collected and mixed with 7.8 g of α rice, 1.9 g of dried koji, 23.2 ml of water, and 15 μl of 50% brewed lactic acid. Fermentation was carried out at a constant 15 ° C. for 20 days. Take 0.8 ml of the resulting supernatant of the fermented moromi in a vial, add 10 μl of 100 ppm 4-methyl-2-pentanol (internal standard solution), seal tightly, and SPME (solid phase microextraction) fiber in the head space of the vial. Was inserted and extracted at 30 ° C. for 20 minutes while shaking the fiber, and then SPME fiber was injected into the gas chromatography and analyzed.

  The results are shown in FIG. C-8FAS1 in FIG. 2 shows (iii) a control having FAS1 of C-8 strain, and D171E shows a FAS1 mutant in which (i) the 171st amino acid of FAS1 of 7-C-8 strain is substituted with glutamic acid. , S288CFAS1 and D458FAS1 represent mutants having (ii) laboratory yeast FAS1 in which 171st of FAS1 is originally glutamic acid, respectively. FIG. 2 shows that the caproic acid production amount when the 171st amino acid of FAS1 is glutamic acid is 1.3 to 1.4 times the caproic acid production amount when it is aspartic acid.

About yeast FAS1 polymorphic sake yeast, shochu yeast, wine yeast, top beer yeast ( Yell yeast), distilled liquor yeast, whiskey yeast, baker's yeast, laboratory yeast, lager beer yeast (Saccharomyces carlsbergensis), and yeast reference strain The amino acid sequence of FAS1 and the base sequence of FAS1 gene were analyzed.

  The results are shown in Table 1 below.

  In sake yeast and shochu yeast, the 513th base of the FAS1 gene is C except for one exception, and the 171st amino acid of FAS1 is one exception except for one strain, regardless of the separation age and location. Aspartic acid. It is speculated that the mutation that occurred in the common ancestors of sake yeast and shochu yeast was established as a polymorphism. Only the sake yeast association No. 2 was an exception, but it was shown by genome polymorphism analysis that the association No. 2 is different from the group of sake yeast currently mainly used (Azumi et.al. Yeast 18, 1145-1154 (2001)). On the other hand, in other yeasts, the 513th base of FAS1 gene was A, and the 171st amino acid of FAS1 was glutamic acid.

Isolation of Caproic Acid High-Producing Strain A high caproic acid-producing strain was obtained by mutation treatment of the laboratory yeast strain D458-5A and S288C. Specifically, 9.2 ml of 0.2 M phosphate buffer (pH 8.0), 0.5 ml of 40% glucose solution and 0.3 ml of EMS (ethyl methanesulfonate) are adjusted to about 1 × 10 ⁶ cells / ml. The yeast was added to the mixture and gently shaken at 30 ° C. for 60 minutes. The treated yeast cells were collected and washed several times with water, and then the yeast suspension was spread on a YPD agar medium containing 25 μM cerulenin. The plate was incubated at 30 ° C. for 3 to 7 days, and the grown colony was used as a cerulenin resistant mutant.

  The caproic acid production amount of each strain was measured in the same manner as in Example 1, the strain having the largest caproic acid production amount was selected, the D458-5A mutant strain was named itr001 strain, and the S288C strain mutant strain was designated as S288CR. The strain was named. The itr001 strain has been deposited as FERM P-20638 at the National Institute of Advanced Industrial Science and Technology, and the S288CR strain has also been deposited as FERM P-20639 at the same center.

Sake was produced using Sake Sake 7-C-8, itr001, and S288CR and their parent strains (G1103, D458-5A, S288C). The 7-C-8 strain is a cerulenin resistant strain isolated by EMS mutation treatment of the haploid yeast strain G1103 isolated from the Sake Yeast Association No. 701 as described in Patent Document 1. Sake brewing was performed as follows. Yeast cells which were cultured with shaking in 5 ml of YPD medium at 30 ° C. for 2 days were collected and mixed with 7.8 g of α-rice, 1.9 g of dried koji, 23.2 ml of water, and 15 μl of 50% brewed lactic acid, and kept at 15 ° C. And fermented for 20 days.

  Take 0.8 ml of the centrifuged supernatant of the resulting fermentation mash in a vial, add 10 μl of 100 ppm 4-methyl-2-pentanol (internal standard solution), seal tightly, and SPME (solid phase microextraction) fiber in the head space of the vial. Was inserted and extracted at 30 ° C. for 20 minutes while shaking the fiber, and then SPME fiber was injected into the gas chromatography and analyzed.

  The results are shown in FIG. The 7-C-8 strain, itr001 strain, and S288CR strain to which cerulenin resistance was imparted had caproic acid production of 2.5 to 3 times the parent strain. Among the cerulenin-resistant strains, in the itr001 strain obtained by FAS2 mutation of laboratory yeast in which the 171st amino acid of FAS1 is glutamic acid and the S288CR strain, the 171st amino acid of FAS1 is aspartic acid. Compared with the 7-C-8 strain obtained by FAS2 mutation, caproic acid production was about 1.4 times.

It is a figure explaining substitution of FAS1 of 7-C-8 stock | strain performed in Example 1. FIG. It is a graph which shows the change of the caproic acid production amount by substitution of FAS1 of 7-C-8 stock | strain performed in Example 1. FIG. It is a graph which shows that the caproic acid production amount of the cerulenin resistant strain obtained by the mutation treatment increases when the 171st amino acid of FAS1 of the yeast to be subjected to the mutation treatment is glutamic acid.

Claims (5)

Laboratory yeast itr001 strain (FERM P-20638). Laboratory yeast strain S288CR (FERM P-20639). A step of substituting Xaa of amino acid number 7 of the partial amino acid sequence shown in SEQ ID NO: 1 contained in fatty acid synthase FAS1 of sake yeast or shochu yeast from aspartic acid to glutamic acid, a step of mutagenesis, A method for producing a yeast caproic acid high-producing strain comprising a step of selecting a strain that has acquired cerulenin resistance from the inside. Acquiring cerulenin resistance from the process of substituting n of base number 21 of the partial base sequence shown in SEQ ID NO: 3 contained in the fatty acid synthase FAS1 gene of yeast with A or G, the process of mutation treatment, and the mutation-treated yeast And a method for regulating the amount of caproic acid produced by the yeast. A method of producing alcoholic beverages, or bread using the yeast, a method of using a yeast, a strain of 請 Motomeko 1 or 2.

Images