KR20190000970A - Saccharomyces cerevisiae strain with high productivity of flavor components and process for preparing beer using same - Google Patents

Abstract

The present invention relates to a new strain NIBRFGC000498868 of saccharomyces cerevisiae with aroma constituent high productivity. It is found that beer manufactured after being fermented by the new strain NIBRFGC000498868 (accession number: KACC 93278P) of saccharomyces cerevisiae has high appealability in all items compared with other commercially available beer in an appealability test result through the taste sensor. In addition, based on results of ITS sequence analysis and MLST analysis for the strain, yeast strain NIBRFGC000498868 in this present invention is identified as a new strain. Moreover, the strain can massively produce compounds including isoamyl alcohol and isoamyl acetate which produce fruit taste such as banana, apple, and grape, caramel taste, and cool taste such as anise and clove during a fermentation process. Therefore, craft beer with improved appealability can be manufactured by using the strain.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for producing a high-productivity Saccharomyces cerevisiae strain and a beer using the same,

More particularly, the present invention relates to a method for producing a high-productivity Saccharomyces cerevisiae strain and a method of producing a beer using the same. More specifically, the present invention relates to a method for producing a high-productivity Saccharomyces cerevisiae strain and a method for producing such a beer using 3-methyl-1-butanol, 3-methyl acetate, hexanoic acid ethyl ester, benzene ethanol, 2,3-dihydro-3,5-dihydroxy-6-methyl- ( Saccharomyces cerevisiae ) new strain NIBRFGC000498868 (produced by Saccharomyces cerevisiae ) which produces a high concentration of fragrance components such as 2,3-Dihydro-3,5-dihydroxy-6-methyl-4H-pyran- Accession No .: KACC 93278P).

Beer is a beverage made from mankind's transition from nomadic life to settlement and agriculture, and was invented by the Sumerians of Mesopotamia, located between the Tigris and Euphrates rivers around 4000 BCE.

The beer is a golden transparent liquid with an alcohol content of about 4% and contains carbon dioxide gas, which is characterized by a white creamy foam. These beers are different flavors in different parts of the world, and become a popular drink containing alcohol. Beer is generally made through eight steps: grinding, dipping, filtration of malt juice, addition of mercury and hops, cooling and yeast addition, fermentation, aging, and commercialization. The main ingredients are malt, hops, yeast and water.

In the western world, the steam engine, made by James Watt of England, made a breakthrough in the industrial revolution of the nineteenth century, making it possible to use power to transport water, grind malt, stir the juice and enable mass production of beer. did. Carl von Linde of Germany also invented the freezer and made it possible to brew fermented beer in winter regardless of season. Louis Pasteur of France found that wine was produced by the action of yeast and invented heat-treatment sterilization method. Emil Hansen of Denmark applied Pasteur's theory and applied pure culture of yeast During the development, the beer quality was improved.

Since then, research has been conducted to improve the yeast, which directly affects the fermentation of beer. In order to obtain a brewer's yeast strain having excellent taste and flavor, methods for screening an excellent strain have been heretofore used. In relation to this, Japanese Patent Application Laid-Open No. 10-1998-049303 entitled " A new high-scent beer yeast strain, Saccharomyces cerevisiae CZ15 Patent No. 10-1050125 " a yeast mutant having high temperature resistance " has been developed.

However, in Korea, two companies, Hite Jinro Co. and OB Beer Co., divide the beer market, so that even if a third party, not a company, develops superior brewer's yeast strains, Therefore, there was a relatively low attempt to develop superior brewer's yeast.

Recently, with the introduction of the micro brewery system, craft beers made by individuals or small breweries in accordance with the self-developed recipe have become popular. Craft beer uses a variety of malt raw materials, such as Pilsner Malt, Dunkel Malt, Caramel Malt, Wheat Malt and Roasted Malt, , A fermentation process, and an aging process to produce beer.

Many aroma components are involved in the taste and aroma of beer, but the direct effects are in the form of acetaldehyde, diaceyl, ethyl acetate, isoamyl acetate, isoamyl alcohol Isoamyl alcohol, phenylethyl alcohol, phenylethyl acetate, and ethyl caproate. Craft beer contains a large amount of these fragrance components. The demand for craft beer is gradually increasing.

However, most of the beer yeast used for manufacturing craft beer in Korea is imported from foreign countries, and since it is expensive, it is troublesome to purchase and it is inevitable to develop domestic brewer's yeast that can replace it.

Accordingly, the inventors of the present invention have made extensive efforts to overcome the problems of the prior art. As a result, the present inventors have found that a new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) And a beer with excellent sensibility can be produced, and the present invention has been completed.

Therefore, a main object of the present invention is to provide a new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) which produces a high concentration of a perfume ingredient.

Another object of the present invention is to provide a method for producing beer using the new strain Saccharomyces cerevisiae NIBRFGC000498868 (accession number: KACC 93278P) and the beer thus produced.

According to one aspect of the present invention, the present invention provides a flavor component high productivity Saccharomyces cerevisiae new strain NIBRFGC000498868 (accession number: KACC 93278P).

The present inventors have made intensive researches to develop a domestic yeast strain that replaces the imported beer yeast used in craft beer. As a result, the present inventors have found that a new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) It has been confirmed that beer having excellent properties in terms of sensory properties can be produced from commercial beer yeast sold in the market, and the new strain can produce a beer having a high concentration of a perfume ingredient and using it to produce a highly functional beer And the present invention has been completed.

In the Saccharomyces cerevisiae new strain NIBRFGC000498868 (Accession No .: KACC 93278P) of the present invention, the strain is characterized by having the ITS sequence of SEQ ID NO: 1. The present inventors extracted the genomic DNA of NIBRFGC000498868 strain and amplified using ITS 1 and ITS 4 primers to confirm the ITS sequence of SEQ ID NO: 1. BLAST (http://www.ncbi.nlm.nih.gov/) BLAST) program, the ITS sequence of the NIBRFGC000498868 strain was compared and analyzed, and the NIBRFGC000498868 strain was confirmed to be Saccharomyces cerevisiae strain by phylogenetic analysis. MLST analysis of the new strain Saccharomyces cerevisiae NIBRFGC000498868 (accession number: KACC 93278P) confirmed that the NIBRFGC000498868 yeast strain of the present invention and the commercially available commercial strains have a large difference in genetic traits Based on the result of ITS sequence analysis and MLST (Multilocus sequence typing) analysis, it was confirmed that NIBRFGC000498868 yeast strain of the present invention is a new strain.

The new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) of the present invention is a strain of 3-methyl-1-butanol, 1-butanol-3-methyl acetate, hexanoic acid ethyl ester, benzene ethanol, 2,3-dihydro-3,5-dihydroxy-6-methyl- 2,3-Dihydro-3,5-dihydroxy-6-methyl-4H-pyran-4-one, octanoic acid, octanoic acid, ethyl ester, 9-decenoic acid, acetic acid, phenethyl ester, 2-methoxy-4-vinylphenol, and pentanoic acid-2,2,4- Trimethyl-3-carboxy isopropyl, isobutyl ester, and the like, at a high concentration. Unlike the beer of the comparative example, which is manufactured by using commercial yeast E, which is most used for manufacturing craft beer, the beer using the new strain Saccharomyces cerevisiae NIBRFGC000498868 (accession number: KACC 93278P) Amyl alcohol, isoamyl acetate, 9-decanoic acid. And pentanoic acid, 2,2,4-trimethyl-3-carboxyisopropyl, and isobutyl ester were detected in large quantities.

In addition, the hexanoic acid ethyl ester compound which gives an apple or anise flavor was measured to be 22% higher than the beer of the comparative example, and the 2,3-dihydro-3,5-dihydro Methyl-4-hydrogen-pyra-4-rone compound was found to be 859% higher than that of benzoyl-6-methyl-4-hydrogen-pyrene Noike acid and octanoic acid ethyl ester were found to be 315% and 32% higher, respectively, and the 2-methoxy 4-vinylphenol compound, which is known to be an important flavor ingredient that gives off bananas or clove fragrance, The content of flavor components in the beer of the example was measured to be very high as compared with the beer casted with the representative imported beer yeast.

The new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) of the present invention is a product of the fermentation process in which the fruits, such as bananas, apples, and grapes, the caramel incense, and the cool incense of anise and cloves, It has been confirmed quantitatively that a large amount of compounds such as isoamyl alcohol and isoamyl acetate can be produced on a large scale, and it has been confirmed that a beer with enhanced flavor can be prepared by enhancing the ester component as a flavor-imparting ingredient .

According to another aspect of the present invention, the present invention provides a method for producing beer comprising fermenting wort with ethanol using Saccharomyces cerevisiae new strain NIBRFGC000498868 (accession number: KACC 93278P) .

Beer is produced by first making barley and making malt, then making malt juice with malt and starchy additive, adding hops, boiling and cooling. The beer yeast is put into this cooled malt juice, and after ethanol fermentation process, it is stored and aged for a certain period of time, and then it is filtered into a product and immediately becomes a draft beer. When it is put into bottles or cans and pasteurized, it becomes a beer which can be stored for a long time. The process is well known to those skilled in the art. When the ethanol fermentation is carried out using the new strain Saccharomyces cerevisiae NIBRFGC000498868 (accession number: KACC 93278P) during the beer manufacturing process as described above, the aroma component is produced at a high concentration and the sensory properties are improved Beer can be manufactured.

In the beer manufacturing method of the present invention, the ethanol fermentation process can be performed at a temperature of 13 to 15 DEG C for 7 to 14 days, but is not limited thereto.

According to still another aspect of the present invention, there is provided a beer fortified with a perfume ingredient produced by the method for producing the beer.

Other matters related to the beer produced using the beer manufacturing method are described in detail in the above-mentioned Saccharomyces cerevisiae new strain NIBRFGC000498868 (accession number: KACC 93278P) and a method for producing beer using the same Therefore, a description thereof will be omitted.

As described above, the present invention provides a novel strain Saccharomyces cerevisiae having high aroma component productivity NIBRFGC000498868.

The beer fermented with the Saccharomyces cerevisiae new strain NIBRFGC000498868 (accession number: KACC 93278P) of the present invention has higher sensuality than commercial beer sold commercially as a result of sensory test through taste sensor . In addition, the strain produces a large amount of compounds such as isoamyl alcohol and isoamyl acetate, which produce fruit aromas such as bananas, apples, and grapes, caramel flavors, and anisome and cool aroma in the fermentation process, A craft beer having improved functionality can be produced.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the results of measurement using a flavor analyzer comparing beer prepared using NIBRFGC000498868 strain of the present invention with C beer of O company.
FIG. 2 is a diagram showing the numbers of the strains of the industrial beer fermentation strain A, industrial beer fermentation strain B, experimental comparison strain S288C, and the strain of the present invention.
FIG. 3 is a graph showing the cell concentration measured at an interval of 2 hours under the optimum culture condition.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example 1 Isolation and Identification of Yeast Strains

1-1. Isolation of yeast strains

10 g of koji was pulverized, suspended in 90 ml of 0.1% peptone, and then diluted 10 ^-7 times at 10 ^-2 times in a stepwise manner. The diluted suspension was plated at 100 占 퐇 in a separate plate medium and cultured at 25 占 폚. The separation medium used was Dichloran-glycerol agar (DG18: Peptone 0.5%, Glucose 1%, KH ₂ PO ₄ 0.1%, MgSO ₄ .7H ₂ O 0.05%, 0.2% Dichloran 1.0ml, Chloramphenicol 0.01%, and Agar 1.5%) and Dichloran rose bengal chloramphenicol agar (DRBC: DRBC: Peptone 0.5%, Glucose 1%, KH ₂ PO ₄ 0.1%, MgSO ₄ .7H ₂ O 0.05%, 0.2% Dichloran 1.0 ml, Rose bengal 0.0025%, Chloramphenicol 0.01%, and Agar 1.5%). After isolating the strain showing the characteristics of yeast, the strain was inoculated on PDA (Potato dextrose agar: 0.4% Potato starch, Dextrose 2%, Agar 1.5%) medium, and the strain identified by yeast was preserved.

1-2. Production of beer using yeast strains

5.5 kg of malt was crushed to such an extent that the malt husk layer was not completely ground and a little of the husk remained. The pulverized malt was suspended in 30 L of water, and then reacted at a temperature of 63 ° C to 68 ° C for 1 hour. After the reaction, the malt suspension was filtered to remove the skin layer, and the extracted wort was obtained. After filtering the obtained filtered juice at 100 DEG C for 1 hour, 50 g of the juice of the juice was added 10 minutes before the end of the juice was added to the juice.

After the mercury was transferred to the whirlpool, the hop residue and protein - polyphenol precipitate were removed by filtration in the whirlpool.

The yeast isolated in Example 1-1, in which the filtered juice was transferred to a fermentation tank, was inoculated at 10 ⁶ CFU / ml and fermented at 13 ° C to 15 ° C for 10 days. After the alcohol fermentation, the wort was stored at 1 ° C for 48 hours, filtered, and the supernatant was taken and the carbonic acid was saturated with carbonic acid injector to prepare beer.

Example 2. Sensory test using a taste sensor

In order to select the best yeast among the yeasts isolated in the above examples, the taste of the beer prepared according to the method of Example 1-2 was measured using a flavor analyzer (Insent, 5-1-1 Onna, Atsugi-shi, Kanagawa-Pref., Japan). Using the yeasts isolated according to Example 1-1, 35 mL of each analytical sample prepared according to the method of Example 1-2 was compared with C beer of commercially available O company, After the measurement, the mean value was calculated by the remaining measurement values except for the first measurement value. After each sample was analyzed, the sensor was washed with standard solution (30 mM KCl + 0.3 mM tartaric acid) and a 10 mM KCl solution was used as the buffer. TS-5000Z was used for the taste sensor, and the sensor was repeated four times with five food stuff sensors (CT0, C00, AAE, CA0 and AE1) and a sensor for measuring sweetness (GL1) (Taste analysis application, Insent, Japan) was used to change the measured value of the sensor electrode to the value of taste.

[Table 1]

As a result, it was confirmed that the yeast strain numbered NIBRFGC000498868 had a superior taste value in all the items compared to the C beer of O company, and the yeast strain was identified and the characteristics of the yeast and the beer using the yeast strain were analyzed 1).

Example 3. Identification of yeast strains and MLST analysis

3-1 Identification of ITS sequence

The identification of the selected strain NIBRFGC000498868 was carried out in the following manner. First, the genomic DNA required for identification of the strain was obtained as follows. The selected strains were cultured in YPD (Yeast extract 1%, Peptone 2%, Dextrose 2%) medium at 30 ℃ for two days. The cultured strains were centrifuged to obtain the cultures, followed by rapid freezing with liquid nitrogen, and the yeast cells were finely pulverized. To the pulverized cells, 500 μL of lysis buffer (200 mM Tris-HCl pH 8.5, 250 mM NaCl, 25 mM EDTA, 0.5% SDS) was added and mixed well. Then, 500 μL of a mixed solution of phenol / chloroform / isoamyl alcohol (25: 25: 1) was added and mixed, followed by centrifugation at 4 ° C. and 12,000 rpm for 30 minutes. The supernatant was taken and 150 μL of 3M sodium acetate was added and mixed. 900 μL of isopropyl alcohol was added, and the mixture was mixed again. Then, centrifugation was carried out at 4 ° C. and 12,000 rpm for 5 minutes . Thereafter, the supernatant was removed, and then 500 μL of 70% ethanol was added, followed by centrifugation at 4 ° C. and 12,000 rpm for 1 minute. After removal of the supernatant, the ethanol was evaporated at 45 ° C, and 30 μL of TE buffer (100 mM Tris-HCl pH 8, 10 mM EDTA) containing 20 μg / mL of RNase A was added to obtain genomic DNA. For each genomic DNA extracted, the rDNA-ITS portion was PCR amplified using ITS 1 (TCCGTAGGTGAACCTGCGG) and ITS 4 (TCCTCCGCTTATTGATATGC). The PCR conditions were initial denaturation at 95 ° C for 5 minutes using recombinant Taq polymerase, denaturation at 95 ° C for 1 minute, annealing at 55 ° C for 1 minute, , Extension at 72 ° C for 1 minute, and final extension at 72 ° C for 5 minutes. The gene sequence of the amplified ITS fragment of SEQ ID NO: 1 was confirmed. Based on the homology of the genes using BLAST (http://www.ncbi.nlm.nih.gov/BLAST) program, the ITS sequences of the NIBRFGC000498868 strain were compared and analyzed, and NIBRFGC000498868 was analyzed by using Saccharomyces cerevisiae Saccharomyces cerevisiae) strains were identified by phylogenetic analysis.

3-2 MLST Analysis of Housekeeping Genes

Enzyme activities of the housekeeping gene were compared with the NIBRFGC000498868 yeast strain of the present invention and commercially available yeast strains, and analyzed using the MLST (Multilocus sequence typing) method performed by MunR et al. (MunR, GoA, Robles V, Rodri P, Cebollero E, Tabera L, Carrascosa AV, Gonzalez R, Multilocus sequence typing of oenological Saccharomyces cerevisiae strains, 2009. Food Microbiology 26, 841846).

The housekeeping genes include ADP1 (ATP-Dependent Permease), ACC1 (Acetyl-CoA carboxylase), NUP116 (FU nucleoporin component of central core of the nuclear pore complex), GLN4 (Glutamine tRNA synthetase), RPN2 (Subunit of the 26S proteasome) , And MET4 (Leucine-zipper transcriptional activator).

PCR primers for each housekeeping gene are summarized in Table 2 below.

[Table 2]

DNA sequence data for the forward and reverse primers of the six housekeeping genes were obtained and assembled using the SeqMan program of the DNA sequencing software Lasergene (DNASTAR, Madison, Wis.). The confirmed nucleotide sequence was confirmed by using the National Center for Biotechnology Information (NCBI) -BLAST (Basic Local Sequence Alignment Search Tool) program to confirm that the PCR product amplified matches the housekeeping gene.

The total nucleotide sequence of the housekeeping gene provided by the Saccharomyces Genome Database (SGD) was set as a standard and compared with the assembly sequence of the PCR product. Housekeeping gene standard sequences and assembly sequences were generated in FASTA format and analyzed using the Clustal Omega alignments program. The nucleotide sequences of the yeast strains were compared to determine the difference. The polymorphic sites of the nucleotide sequences were classified and genotyped.

Two results were observed in the polymorphic site, homozygous site and heterozygous site. In the dissociation site, a mixed base of R (A, G), K (G, T), M (A, C), S (C, G), Y mixed base) was present.

From the results of the following Table 3, it was confirmed through MLST analysis that the NIBRFGC000498868 yeast strain of the present invention and the commercially available commercially available strains had a large difference in genetic traits, and the results of ITS sequence analysis and MLST analysis As a result, it was confirmed that the strain NIBRFGC000498868 of the present invention was a novel strain (see FIG. 2).

[Table 3]

Example  4. Physicochemical analysis of beer

4-1 Physicochemical analysis

The physicochemical properties of the reducing sugar, acidity and alcohol content of the beer prepared in Example 1-2 were analyzed.

Reducing sugar analysis was performed using dinitrosalicylic acid (DNS) method.

The beer samples were centrifuged and filtered to obtain 1 mL. Then, 3 mL of the DNS solution was added, and the mixture was reacted at 100 ° C for 10-15 minutes. Then, 21 mL of distilled water was added to the beer samples. The mixture was mixed with a spectrophotometer (Genesys 10-S, Thermo Fisher Scientific Inc . The absorbance was measured at 550 nm using Waltham, USA. Reduced sugars were calculated using glucose as a standard sugar.

The acidity is measured by adding 2 mL of 3 mL of the mixed indicator (BTB & NR), neutralizing with 0.1N NaOH solution, and adding 10 mL of the filtered sample to the 100 mL Erlenmeyer flask. Was titrated to pH 6.85-7.0, and the consumed mL of 0.1 N sodium hydroxide solution was measured to determine the acidity.

Alcohol content was measured according to the mainstream analysis regulations. The beer sample was centrifuged and filtered, and then 100 mL was filled in a measuring cylinder, transferred to a 500 mL Erlenmeyer flask, washed once with 30 mL of distilled water in the measuring cylinder, and then added to the 500 mL Erlenmeyer flask containing the filtrate gave. Then, connect the flask to the alcohol distiller, connect the measuring cylinder to the tube from which the distillate is cooled, and collect 80 mL of the distillate, and then fill it with distilled water until the volume reaches 100 mL. The alcohol content of the distilled solution was measured using a density meter (DMA 35, Anton paar, Austria).

A comparative experiment was conducted using beer prepared in the same manner as in Example 1-2 using comparative yeast strain E, which is the most commonly used for craft beer production, and the results are shown in Table 4 below .

[Table 4]

As a result, the beer prepared using the strain of the present invention had a high acidity, a low pH, and a low reducing sugar content compared to beer prepared using a commercial yeast strain.

4-2 Organic acid composition of beer

Organic acids in beer were analyzed by post-column method. The analysis was performed under the conditions of Table 5 below, and the results are shown in Table 6 below.

As a result, the content of citric acid, malic acid and lactic acid was not significantly different in the beer prepared using the strain of the present invention and the beer prepared using commercial yeast E. However, the content of succinic acid and sake The beer prepared by using the strain of the present invention showed a value two times higher than the strain of the comparative example.

Based on the above results, it was analyzed that the beer prepared by using the NIBRFGC000498868 yeast strain of the present invention had characteristics of ale beer with increased flavor and acidity.

[Table 5]

[Table 6]

Example 5. Analysis of fragrance component

The fragrance components were analyzed using GC-MS (Agilent 6890N GC / Agilent 5973 MSD, Agilent Co., Pal Alto, CA, USA). For the extraction of volatile components, SPME fiber (50/30 μm divinylbenzene, carboxen on polydimethylsiloxane., Supelco Co., Bellefonte, PA, USA) was used and 10 mL of beer sample was placed in a 20 mL headspace vial, The fiber was exposed to the injector (200 ° C) of the GC-MS for 5 minutes. The fiber was exposed to the SPME fiber for 30 minutes, and the volatile components were adsorbed to the fiber for 30 minutes. Lt; / RTI > The GC / MS column used for the chromatography was DB-5 ms (60 m length × 0.25 mm id × 0.25 μm film thickness: J & W Scientific, Folsom, CA, USA) The temperature was raised to 200 DEG C at a rate of 5 DEG C / min and maintained for 20 minutes. The injector temperature was 200 ° C and the detector temperature was 250 ° C. Helium was used as the carrier gas. The flow rate was 1.1 ml / min. The ionization voltage was 70 eV. The range of molecular weight (m / z) to be analyzed was 33-500.

As a result of analysis, beer prepared by using Saccharomyces cerevisiae new strain NIBRFGC000498868 (accession number: KACC 93278P), isoamyl alcohol (3-methyl-1-butanol), isoamyl acetate 1-butanol-3-methyl acetate, hexanoic acid ethyl ester, benzene ethanol, 2,3-dihydro-3,5-dihydroxy- Dihydroxy-6-methyl-4H-pyran-4-one, octanoic acid, octanoic acid, ethyl ester, 9-decenoic acid, acetic acid, phenethyl ester, 2-methoxy-4-vinylphenol, (4-trimethyl-3-carboxy isopropyl, isobutyl ester) were detected in the presence of a catalyst.

Unlike the beer of the comparative example, which is manufactured by using commercial yeast E, which is most used for manufacturing craft beer, the beer using the new strain Saccharomyces cerevisiae NIBRFGC000498868 (accession number: KACC 93278P) Amyl alcohol, isoamyl acetate, 9-decanoic acid. And pentanoic acid, 2,2,4-trimethyl-3-carboxyisopropyl, and isobutyl ester were detected in large quantities.

In addition, the hexanoic acid ethyl ester compound which gives an apple or anise flavor was measured to be 22% higher than the beer of the comparative example, and the 2,3-dihydro-3,5-dihydro Methyl-4-hydrogen-pyra-4-rone compound was found to be 859% higher than that of benzoyl-6-methyl-4-hydrogen-pyrene Noike acid and octanoic acid ethyl ester were found to be 315% and 32% higher, respectively, and the 2-methoxy 4-vinylphenol compound, which is known to be an important flavor ingredient that gives off bananas or clove fragrance, The content of flavor components in the beer of the example was measured to be very high as compared with the beer casted with the representative imported beer yeast.

[Table 7]

Through the above results, it was found that the new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) of the present invention is effective in the fermentation process in that the fruit flavor such as banana, apple, grape, caramel flavor, And isoamyl alcohol, isoamyl acetate, etc., which give a cool aroma of clove, and quantitatively produce compounds such as isoamyl acetate. By using this strain, an ester component as a flavor-contributing ingredient is strengthened to produce a beer with improved functionality I can confirm that I can do it.

Example 6: Optimization of culture process for yeast strains for two cultivation

 The cultivation of this strain in flasks using a general medium is not industrially applicable. Therefore, an optimized culture process has been studied by cultivating in a 5 L fermentor level for economical production.

The Fermentor was fed-batch with a total volume of 2.3 L for 16 hours under fed-batch conditions at a culture temperature of 30 ° C, an air feed rate of 0.5 vvm, a stirring speed of 900 rpm, and a pH of 5.75.

The optimum medium was 60 g / L of glucose and 60 g / L of glucose at the end of the fermentation period, and 10 g / L of yeast extract, 20 g / L of peptone, , KH ₂ PO ₄ 1 g / L, MgSO _{4 7} H ₂ O 0.5 g / L, NaCl 0.1 g / L, CaCl ₂ 0.1 g / L and urea 2.5 g / L were added and maintained at pH 5.75 using ammonia water Respectively.

 The cells were cultured under the above conditions, and the cell concentration was measured at intervals of 2 hours. At 16 hours, the cell concentration (OD 600 nm) was measured to be 80.2 and the stationary phase was started (see Table 8 and FIG. 3) The strain production process was optimized.

[Table 8]

As a result, the beer fermented with the new strain Saccharomyces cerevisiae strain NIBRFGC000498868 (accession number: KACC 93278P) showed a sensory test through the taste sensor, and as a result, And it was confirmed that NIBRFGC000498868 yeast strain of the present invention is a new strain based on the result of ITS sequence analysis and MLST analysis of the strain.

In addition, the beer casted with the strains was analyzed to have a characteristic of ale beer with increased flavor and acidity. In the fermentation process, fruit flavors such as bananas, apples, and grapes, caramel flavors, and cool aromas of anise and cloves , And isoamyl acetate, which are produced in a large quantity, and it is scientifically proved that a beer having enhanced sensory properties can be produced by enhancing an ester component as a flavor-imparting ingredient by using the strain I could.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

National Academy of Agricultural Sciences KACC93278P 20170616

<110> NATIONAL INSTITUTE OF BIOLOGICAL RESOURCES          Hankyong National University The Industrial-Academic Cooperation Group          Kyung Hee University the Industrial-Academic Cooperation Group          Sookmyung Women's University the Industrial-Academic Cooperation Group          The Industrial-Academic Cooperation Group at Chung-Ang University <120> Peptide from Parapolybia varia having antitumor activity and uses          the <130> PN170006AN <160> 1 <170> KoPatentin 3.0 <210> 1 <211> 813 <212> DNA <213> Artificial Sequence <220> <223> ITS sequence <400> 1 gggccctgtg gattatattt tgaatggatt tttttgtttt ggcaagagca tgagagcttt 60 tactgggcaa gaagacaaga gatggagagt ccagccgggc ctgcgcttaa gtgcgcggtc 120 ttgctaggct tgtaagtttc tttcttgcta ttccaaacgg tgagagattt ctgtgctttt 180 gttataggac aattaaaacc gtttcaatac aacacactgt ggagttttca tatctttgca 240 actttttctt tgggcattcg agcaatcggg gcccagaggt aacaaacaca aacaatttta 300 tttattcatt aaatttttgt caaaaacaag aattttcgta actggaaatt ttaaaatatt 360 aaaaactttc aacaacggat ctcttggttc tcgcatcgat gaagaacgca gcgaaatgcg 420 atacgtaatg tgaattgcag aattccgtga atcatcgaat ctttgaacgc acattgcgcc 480 ccttggtatt ccagggggca tgcctgtttg agcgtcattt ccttctcaaa cattctgttt 540 ggtagtgagt gatactcttt ggagttaact tgaaattgct ggccttttca ttggatgttt 600 tttttccaaa gagaggtttc tctgcgtgct taggtataat gcaagtacgg tcgttttagg 660 ttttaccaac tgcggctaat cttttttata ctgagcgtat tggaacgtta tcgataagaa 720 gagagcgtct aggcgaacaa tgttcttaaa gtttgacctc aaatcaggta ggagtacccg 780 ctgaacttaa gcatatcaat aagccggagg gaa 813

Claims (6)

High activity Saccharomyces cerevisiae New strain NIBRFGC000498868 (Accession number: KACC 93278P). The novel strain NIBRFGC000498868 (accession number: KACC 93278P) according to claim 1, wherein said strain has the ITS sequence of SEQ ID NO: 1. The method of claim 1, wherein the fragrance component is selected from the group consisting of 3-methyl-1-butanol, 1-butanol-3-methyl acetate, hexanoic acid ethyl ester, Dihydroxy-6-methyl-4-hydrogen-3,5-dihydro-3,5-dihydroxy- 4H-pyran-4-one, octanoic acid, octanoic acid, ethyl ester, 9-decenoic acid, acetic acid, 2-methoxy-4-vinylphenol, and pentanoic acid-2, 2,4-trimethyl-3-carboxyisopropyl-isobutyl ester , 2,4-trimethyl-3-carboxy isopropyl, isobutyl ester). The strain NIBRFGC000498868 (accession number: KACC 93278P) is a new strain of Saccharomyces cerevisiae. A method for producing beer comprising the step of fermenting wort with ethanol using Saccharomyces cerevisiae fresh strain NIBRFGC000498868 (accession number: KACC 93278P) of claim 1. 5. The method of claim 4, wherein the ethanol fermentation is performed at a temperature of 13 to 15 DEG C for 7 to 14 days. A beer with enhanced aroma components produced by the method of claim 4 or 5.

Images