JP2018011553A - Methods for making yeast with low 1,2-dihydroxy-5-(methylsulfinyl)pentan-3-one productivity - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide novel means for obtaining yeast with low DMTS-P1 productivity, practically applicable for food production.SOLUTION: The invention provides a method for making a yeast strain with low productivity of 1,2-dihydroxy-5-(methylsulfinyl)pentan-3-one comprising the steps of: providing a methionine-requiring strain from a yeast parent strain; culturing the methionine-requiring strain in a methionine-containing medium and in a MTA-containing medium that contains 5'-methylthioadenosine (MTA) but not methionine; and selecting strains that have lower proliferation capability in the MTA-containing medium than in the methionine-containing medium.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a method for producing a yeast having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one, which is a precursor of dimethyltrisulfide.

  Dimethyl trisulfide (DMTS) is a substance produced by the storage of sake and has a sulfur-like and onion-like odor. It is a main component of scent, which is a deteriorated odor of sake (Non-Patent Document 1). DMTS can cause sulfide-like off-flavors in various beverages other than sake (Non-Patent Documents 2 and 3). In recent years, the popularity of refined sake has been increasing in other countries, and exports to foreign countries have a longer transportation and storage period, so it is increasingly important to control the occurrence of DMTS in sake during storage. It has become.

  Based on previous studies, yeast MDE1 and MRI1 genes are involved in the production of 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one (DMTS-P1), one of the DMTS precursors In addition, it has been clarified that DMTS generated during storage of sake can be remarkably suppressed by disrupting these genes (Non-patent Document 4). However, there are many difficult issues for producing sake using genetically modified organisms, and it is difficult to put it to practical use.

Journal of Japan Brewing Association, 101, 125-131, 2006 J. Agric. Food Chem. 48, 6196-6199, 2000 J. Am. Soc. Brew. Chem. 56, 99-103, 1998 J. Biosci. Bioeng. 116, 475-479 (2013)

  Accordingly, an object of the present invention is to provide a novel means for obtaining a DMTS-P1 low-productivity yeast that can be put to practical use in food production.

  Phenotypes related to MDE1 gene and MRI1 gene include MDE1 disruption strains such as caspofungin (Lesage, G. et al: Genetics, 167, 35-49 (2004)) and selenomethionine (Brockhorn, J. et al: PNAS, 105 , 17682-17687 (2008)). However, when the present inventors examined in sake yeast, these phenotypes were not reproduced in sake yeast.

  On the other hand, in studies on enzymes that work in the methionine regeneration pathway, disrupting genes such as MEU1, MRI1, MDE1, and UTR4 in yeast that show methionine auxotrophy can grow in methionine supplemented media, but 5'-methylthioadenosine (MTA) supplemented media Has been reported to reduce the proliferation ability (Pirkov, I. et al., FEBS Journal, 275, 4111-4120 (2008)). As a result of earnest research focusing on this report, the inventors of the present invention have selected mution induced after giving methionine requirement to sake yeast and inferior growth in MTA-added medium than methionine-added medium. The methionine of the DMTS-P1 low-producing yeast strain that can be obtained with extremely high probability from among the strains selected for strains that have greatly reduced DMTS-P1 productivity due to mutations in the MRI1 gene or MDE1 gene. The brewing characteristics are restored by losing the requirement, and the yeast strain suitable for brewing alcoholic beverages such as sake can be obtained with a low DMTS generation potential (the amount of DMTS generated by forced deterioration). By using the obtained mutation of DMTS-P1 low-producing yeast and introducing the mutation into non-recombinant yeast by the self-cloning method, the brewing characteristics of the original non-recombinant yeast can be maintained. The present invention was completed by finding that a self-cloning yeast strain having the mutation can be produced.

That is, the present invention
Obtaining a methionine-requiring strain from the yeast parent strain, and culturing the methionine-requiring strain in both a methionine-containing medium and a MTA-containing medium that does not contain methionine and contains 5'-methylthioadenosine (MTA) A step of selecting a strain having a lower growth ability than the methionine-containing medium in the MTA-containing medium,
And a method for producing a yeast having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one.
The present invention also provides:
A region containing a mutation produced on the MDE1 gene or MRI1 gene from the yeast genome having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one produced by the method of the present invention. Amplifying the process,
Ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one, including the step of introducing the mutation into non-recombinant yeast using a plasmid vector for self-cloning into which the mutation-containing region has been inserted Provides a low yeast production method.
Furthermore, the present invention relates to a 1,2-dihydroxy- having a mutation in which the 54th proline of the protein encoded by the MDE1 gene becomes leucine or a mutation in which the 192nd glycine of the protein encoded by the MRI1 gene becomes aspartic acid. A 5- (methylsulfinyl) pentan-3-one low productivity yeast is provided. The yeast can be a brewing yeast, such as sake yeast.
Furthermore, the present invention provides an alcoholic fermentation using a brewing yeast produced by the method of the present invention or the 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one low-producing brewing yeast of the present invention. A method for producing an alcoholic beverage with reduced sulfide-like off-flavor is provided. Furthermore, the present invention provides alcohol fermentation using the sake yeast produced by the method of the present invention or the 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one low-productivity sake yeast of the present invention. And a method for producing sake with suppressed generation of scent.

  According to the present invention, a method for obtaining a DMTS-P1 low-producing yeast that does not contain a sequence derived from a heterologous organism on the genome is provided. Yeast strains selected with the decrease in growth ability in an MTA-containing medium as an index exhibit low productivity of DMTS-P1 due to mutations in the MDE1 gene or MRI1 gene with a very high probability. If brewer's yeast is used to produce DMTS-P1 low-productivity yeast and alcohol fermentation is performed using the yeast, DMTS generation during the storage of alcoholic beverages such as sake is suppressed. Alcohol beverages with suppressed generation can be made into sake with reduced generation of scent in sake. Since sequences derived from different organisms are not included in the genome, it can greatly contribute to the growth of brewing yeast used in the food industry.

The methionine auxotrophic strain MR-01 obtained in Example 1 and nine mutant strains selected from the MR-01 strain as an indicator of the decrease in growth ability in MTA medium were subjected to liquid culture, and DMTS- It is the result of examining the production amount of P1. The MRI1 gene mutant LMU-H9 strain (haploid) obtained from the haploid of the K701 strain in Example 1 and the MRI1 mutation of the LMU-H9 strain produced by self-cloning in Example 2 are homologous 30-5 It is the result of investigating the carbon dioxide loss in the small preparation test using the strain (diploid) and the self-cloning parent strain K901 (diploid). FIG. 3 shows the results of liquid culture of a mutant strain selected as an indicator of a decrease in growth ability in an MTA medium in Example 3, and examining the amount of DMTS-P1 produced in the culture supernatant (n = 2).

  The yeast strain used in the method for producing a DMTS-P1 low-producing yeast according to the present invention is preferably a brewing yeast. Specific examples of the brewing yeast include sake yeast, beer yeast, wine yeast, shochu yeast, and the like. Among them, sake yeast can be particularly preferably used as a parent strain in the present invention.

First, a strain showing methionine requirement is obtained from the yeast parent strain. Yeast strains that require methionine are known to develop dark brown to black color in the presence of lead ion Pb ²⁺ (Gregory, J. Cost et al: YEAST, 12, 939-941 (1996)) A strain exhibiting methionine requirement can be selected using the colony color on the lead-added medium as an index. The concentration of lead (Pb ²⁺ ) in the medium may be about 0.3 to 3 mM. A yeast parent strain that has been subjected to mutation treatment or a yeast parent strain that has not been subjected to mutation treatment is seeded in a lead-added medium, and colonies that have developed dark brown to black color may be recovered. Specific examples of the mutation treatment include, but are not limited to, physical mutation treatment such as ultraviolet irradiation and radiation irradiation, and chemical mutation treatment using a mutation agent such as ethylmethanesulfonic acid (EMS). The parent strain may or may not be mutated.

  Next, the obtained methionine-requiring yeast strain is cultured in both a methionine-containing medium and an MTA-containing medium that does not contain methionine and contains 5′-methylthioadenosine (MTA), and grows more than the methionine-containing medium in the MTA-containing medium. Select strains with low performance. Also in this step, the mutation treatment of the methionine-requiring strain may or may not be performed. The obtained methionine-requiring yeast strain is mutated or not mutated and seeded on a normal yeast agar medium such as a YPD plate. After culturing, each colony is both a methionine-containing medium and an MTA-containing medium. It is sufficient to select one that is inoculated and cultured and inferior in growth on an MTA-containing medium as compared to a methionine-containing medium. It is also possible to treat a methionine-requiring yeast strain with nystatin using an MTA-containing medium, concentrate the inferior growth, and then inoculate the methionine-containing medium and MTA-containing medium. Nystatin is a polyene macrolide antibiotic and is taken up by the growing yeast to kill the yeast. Those with low growth ability have a low kill rate, and as a result, yeast cells with poor growth are concentrated.

  A methionine-containing medium and an MTA-containing medium can be prepared by adding methionine and MTA to a minimal medium for yeast, respectively. The concentration of methionine and MTA may be about 0.1 mM to 10 mM. As the minimal medium, a medium having a limited sulfur source can be preferably used. That is, the methionine-containing medium and the MTA-containing medium are preferably media in which a sulfur source other than methionine and MTA is limited. Here, “the sulfur source is limited” means that the concentration of sulfur other than methionine and MTA is less than 5 mM, for example, less than 0.005 mM. By using a medium in which a sulfur source other than methionine and MTA is limited in this step, the difference in growth between the methionine-containing medium and the MTA-containing medium becomes clearer, so that the difference in proliferation ability can be easily discriminated.

  The evaluation of the growth ability in the methionine-containing medium and the MTA-containing medium may be repeated. That is, after selecting a strain having a low growth ability in an MTA-containing medium as a candidate strain, the candidate strain is cultured in a methionine-containing medium and an MTA-containing medium, and a strain that has been confirmed again to have a difference in growth ability is MTA-containing. You may select as a strain | stump | stock with low growth ability in a culture medium.

  The strain obtained in the above step and having a low growth ability in an MTA-containing medium has a MDE1 gene or MRI1 gene function-deficient mutation with a very high probability and exhibits low productivity of DMTS-P1. In order to confirm the low productivity of DMTS-P1 in practice, for example, the yeast strain and the parent strain are cultured in a liquid medium for a certain period of time (for example, about several days or about one week), The DMTS-P1 concentration is measured, and the parent strain and the DMTS-P1 concentration may be compared. Whether a mutation has occurred in the MDE1 gene or the MRI1 gene may be determined by sequencing the sequence of each gene and compared with the sequence of each gene in the parent strain. As an example of the MDE1 gene and MRI1 gene of wild-type brewing yeast, the sequence of MDE1 gene of sake yeast No. 701 is SEQ ID NO: 1 (base sequence of coding region), SEQ ID NO: 2 (amino acid sequence), SEQ ID NO: 3 ( In the coding region + genomic region of about 300 bp before and after each), the sequence of the MRI1 gene is SEQ ID NO: 4 (base sequence of the coding region), SEQ ID NO: 5 (amino acid sequence), SEQ ID NO: 6 (coding region + genome of about 300 bp each before and after Area). SEQ ID NO: 5 shows a genomic region containing about 300 bp each adjacent to the MDE1 gene, and SEQ ID NO: 6 shows a genomic region containing about 300 bp each adjacent to the MRI1 gene.

  In the following example, in the MDE1 gene, a substitution mutation is identified in which the cytosine at position 161 becomes thymine (161C → T), and the 54th proline of the protein becomes leucine (54Pro → Leu). A substitution mutation has been identified in which the guanine at position 575 becomes adenine (575G → A) and the 192nd glycine of the protein becomes aspartic acid (192Gly → Asp). In addition to such single base substitution, substitution or deletion of a small number of bases at different sites may occur, but mutation can be easily identified by determining the sequence. The identification of the mutation can be optionally performed after the step of selecting a strain having a low growth ability in an MTA-containing medium or after confirming the production ability of DMTS-P1 by liquid culture of the selected strain.

  In brewer's yeasts such as sake yeast, methionine-requiring strains may be delayed in growth and fermentation under conditions of low moromi content such as Daiginjo. Therefore, when a DMTS-P1 low production mutant strain is obtained as described above with brewing yeast, particularly sake yeast, it is desirable to lose methionine requirement.

  When haploid yeast is used as the parent strain, diploidization is performed. First, a DMTS-P1 low-producing mutant is crossed with a haploid yeast having different methionine requirement, and a haploid is obtained from the obtained diploid. Among the obtained haploids, a strain having the same mutation in the MDE1 gene or the MRI1 gene is obtained, although the gender is different from that of the DMTS-P1 low production mutant. By multiplying this strain with a DMTS-P1 low-producing mutant strain, a diploid having a mutation in the homozygote can be obtained. At this time, the causative gene is complemented by methionine requirement or a decrease in fermentability that may be caused by mutation, and defects are reduced with high probability. Therefore, a strain in which methionine requirement is lost can be efficiently obtained from the diploid strain. What is necessary is just to culture | cultivate the strain | stump | stock which doubled with the methionine-free culture medium, and should just select the strain | stump | stock which became proliferative.

  When diploid yeast is used as the parent strain, a revertant that can grow in a methionine-free medium may be obtained. For example, the DMTS-P1 low-producing mutant strain is subcultured by gradually reducing the methionine concentration, and finally a strain that can grow on a medium without methionine addition may be selected.

  It is also possible to produce a DMTS-P1 low-producing yeast strain by introducing a mutation of the yeast DMTS-P1 low-producing mutant produced as described above into a desired yeast by a self-cloning method. In this case, since it is not necessary to use a yeast strain exhibiting methionine requirement as a yeast for introducing a mutation, there is no risk that the brewing characteristics are impaired.

In the present invention, the self-cloning method refers to a recombinant DNA technique in which nucleic acids derived from the same species are transplanted and no heterologous nucleic acids remain on the genome. The heterologous nucleic acid includes marker genes such as drug resistance for selection of transformants, and nucleic acids derived from gene recombination plasmid vectors. In the cultivation of practical yeasts used in the food industry, a technique that does not leave a foreign DNA sequence necessary only for such gene transfer on the genome is desirable.
Yeast self-cloning techniques are well known in the art, and are described, for example, in Aritomi et al., Biosci. Biotechnol. Biochem., 68 (1), 206-214, 2004, JP 2003-144164, etc. . In these methods, a normal gene in the genome is replaced with a mutated gene using a plasmid vector containing a drug resistance marker for selecting a transformant and a growth suppression marker for selecting a marker-removed strain. Hereinafter, a method for producing a DMTS-P1 low productivity yeast strain by the self-cloning method using this technique will be described.

  First, from the yeast DMTS-P1 low-producing mutant strain obtained as described above with a decrease in growth ability in an MTA-containing medium as described above, a region (mutant region) containing a mutation generated on the MDE1 gene or MRI1 gene was amplified. Incorporated into a plasmid vector for self-cloning containing a drug resistance marker for selection of transformants and a growth suppression marker for selection of marker-removed strains. The mutant region to be amplified may be of any size as long as it contains the mutation site, and may be a partial region or full length of the MDE1 gene or MRI1 gene having the mutation. Then, since a homologous recombination mechanism is used, it is preferable to amplify and use a region of about 500 bp or more in consideration of the efficiency of homologous recombination. In addition, the plasmid vector for transformation is cut at one place in the mutant region to be introduced into yeast, linearized and introduced into yeast cells, so the mutant region is not cut at the site that does not cut the vector and does not affect the mutation site. The amplification region is selected so that it has a restriction enzyme site that cuts at only one site.

  As a drug resistance marker, YAP1 (cellurenin, cycloheximide resistance), AUR1-C (aureobasidin resistance) and the like, and as a growth suppression marker, known markers such as GIN11 can be used. Yeast self-cloning plasmids using such marker genes are described in Aritomi et al., Biosci. Biotechnol. Biochem., 68 (1), 206-214, 2004, JP 2003-144164, etc. There are also commercially available products such as pAUR135. Any one may be used.

  A plasmid vector for self-cloning incorporating a mutated region is linearized by cutting with a restriction enzyme that cuts at only one site in the mutated region, and then introduced into yeast cells. As the yeast used here, a normal diploid non-recombinant yeast that does not exhibit methionine requirement, for example, a brewing yeast such as sake yeast can be preferably used. As used herein, “non-recombinant” is typically yeast having wild-type or natural or artificially induced mutations, but also includes yeasts that do not contain heterologous sequences. Self-cloning strains that are imparted with characteristics are also included.

  In a DNA construct that linearizes a plasmid, a mutant region divided into two (one of which contains a mutation site) is arranged at both ends, and a drug resistance marker, a growth suppression marker, and a plasmid-derived sequence between them. It has a structure that includes This DNA construct is incorporated into the gene region by homologous recombination between the mutant region divided at both ends and the original gene region having no mutation on the yeast genome. . As a result, in the genome of the yeast cell, the normal gene sequence and the mutant gene sequence exist in tandem through the marker gene and the plasmid-derived sequence. First, a yeast in which a DNA construct is integrated into the genome is selected by drug resistance.

  Next, when homologous recombination occurs between the normal gene sequence and the mutant gene sequence that exist in tandem in the genome, the plasmid sequence containing the drug resistance marker and the growth suppression marker is dropped, and the normal gene and mutation Either type gene is left on the genome. Therefore, for yeast cells in which the DNA construct is integrated into the genome, under conditions for expressing a growth suppression marker (for example, when the growth suppression marker is under the control of a galactose-inducible overexpression promoter, When further selection is made, yeast cells in which the plasmid sequence remains cannot grow due to the action of the growth inhibitory marker, whereas yeast cells in which the plasmid sequence has dropped due to homologous recombination can grow. Can be obtained, and yeast strains in which only normal genes or mutant genes remain in the genome can be obtained. Whether the gene remaining in the genome is a mutant sequence gene may be confirmed by sequencing in the vicinity of the mutation site.

  When self-cloning is performed using a diploid yeast as a parent strain, a transformant obtained by one self-cloning operation is usually a hetero mutant strain in which only one allele is replaced with a mutant sequence. By introducing the DNA construct described above into this heterozygous mutant and screening using a drug resistance marker and a growth suppression marker, a homomutant in which both alleles are replaced with a mutant sequence can be obtained.

  Yeast DMTS-P1 low-producing mutant strains obtained by using a decrease in growth ability in an MTA-containing medium as an index, and self-cloning strains using the mutant site of the mutant strain have low DMTS-P1 productivity and DMTS production potential. Low. Therefore, if these strains are produced using brewing yeast and alcohol fermentation is performed using these strains, the generation of DMTS during storage of alcoholic beverages is suppressed, so the generation of sulfide-like off-flavors is suppressed. In the case of sake yeast, it is possible to produce sake with suppressed generation of scent.

  In the following examples, as an example of a mutation obtained by a method using a decrease in growth ability in an MTA-containing medium as an index, in the MDE1 gene, cytosine at position 161 becomes thymine (161C → T), The 54th proline becomes leucine (54Pro → Leu), and the substitution mutation has been identified. In the MRI1 gene, the 575th guanine becomes adenine (575G → A), and the 192nd glycine of the protein becomes aspartic acid. (192Gly → Asp) substitution mutations have been identified. In addition to the method of the present invention described above, the yeast strain having these mutations amplifies the corresponding region from the genome of the wild-type yeast strain, and introduces a single base substitution into the amplified fragment by a conventional method in the field of genetic engineering. Can also be produced by introducing the yeast into yeast by the self-cloning method. Yeast strains introduced with these mutations using yeast having good brewing characteristics should also be preferably used for the production of alcoholic beverages with reduced sulfide-like off-flavor generation and sake with reduced generation of scent. Can do.

  Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples. Analysis of DMTS-P1 and DMTS was performed as follows.

<Analysis of DMTS-P1 (LC / MS)>
To 1 mL of sample (culture supernatant or sake), 20 mg / L 1,2-dihydroxy-5- (methyl (d3) sulfinyl) pentan-3-one (methyl (d3) DMTS-P1) as an internal standard 25 μL was added and made up to 2 mL with distilled water. This was passed through about 1 mL of cation exchange resin (Dowex50WX4) and washed with 6 mL of distilled water. The passing solutions were combined, dissolved in 1 mL of distilled water after lyophilization, or the combined passing solutions were filtered as they were to obtain LC / MS samples. LC / MS conditions are as follows.
Apparatus: Shimadzu Corporation high performance liquid chromatograph mass spectrometer LCMS-8040
Column: BDS Hypersil C18 (3.0 × 150mm)
Mobile phase: Ultrapure water, 0.3 mL / min
Injection: 5μL
Ionization mode: ESI (+)
Interface voltage: 4.5 kV
Nebulizer gas flow rate: 1.5 L / min
Drying gas flow rate: 10.0 L / min
Block heater temperature: 500 ℃
Sample introduction part temperature: 300 ℃
MRM conditions
DMTS-P1: Precursor ion; m / z 181, Monitor ion; m / z 117
Methyl (d3) DMTS-P1: Precursor ion; m / z 184, Monitor ion; m / z 117

<DMTS analysis (GC / MS)>
Stir bar sorptive extraction (SBSE) was used. Add 2 g of sodium chloride and dimethyl (d6) trisulfide (DMTS-d6) as an internal standard to a concentration of 1 μg / L to 10 ml of sake sample watered to an ethanol concentration of 10%. Gerstel) was added and stirred at 700 rpm for 30 minutes to extract aroma components. The Twister that adsorbed the aroma component was attached to a heat desorption device (TDSA) manufactured by Gerstel.
Thermal desorption conditions
TDSA: 20 ℃ (1min) → 60 ℃ / min → 230 ℃ (4min)
CIS4: -150 ℃ (0.7min) → 12 ℃ / sec → 250 ℃ (10min)
GC / MS condition equipment: Agilent GC6890 and MSD5973
Column: HP-INNOWax (30 m × 0.25 mm × 0.25 μm)
Oven temperature: 40 ℃ (5min) → 5 ℃ / min → 120 ℃ → 15 ℃ / min → 240 ℃ (10min)
Carrier gas: He, 1.0 mL / min
Injection: Splitless
SIM mode monitor ion: DMTS; m / z 126, DMTS-d6; m / z 132

Example 1: Screening of a DMTS-P1 low-producing mutant yeast strain using a decrease in growth ability in MTA medium as an index (part 1)
(1) Screening for methionine-requiring mutant strains Sake yeast does not have Met requirement, so first from K701-α9 strain, a haploid strain of Sake Sake Kyokai 701 (K701), colonies on Pb-added medium. Met-requiring mutants were screened using color as an index (Gregory, J. Cost et al., YEAST, 12, 939-941 (1996)).

K701-α9 strain is treated with EMS, seeded on Pb-supplemented medium (lead nitrate added, medium lead (Pb ²⁺ ) concentration is 3mM), cultured at 30 ° C for 4-5 days, then colored dark brown to black Colonies were collected. As a result of screening from about 14,000 colonies, seven methionine-requiring mutant strains were obtained. From these seven strains, four strains were obtained which had good growth in the growth test and had a low revertant rate (rate of returning to lose methionine requirement). Among these 4 strains, the MR-01 strain with the best MTA utilization ability was subjected to the subsequent screening process.

(2) Screening for DMTS-P1 low-producing mutants using growth difference in MTA medium and Met medium as an indicator Screening for target mde1 or mri1 mutants involves adding MTA or Met, and using other sulfur sources. A growth difference in a restricted minimal medium (MTA medium, Met medium) was used as an index.

  The Met-requiring mutant strain MR-01 obtained above was cultured and expanded, and then treated with EMS to induce mutation. After the yeast cells after the mutation treatment were seeded on a YPD plate and cultured, the colonies that emerged were replicated in MTA medium and Met medium, and a strain that was inferior in growth in MTA medium as compared to Met medium was used as a candidate strain. The compositions of the MTA medium and the Met medium are as shown in Table 1, and the composition is such that sulfur sources other than MTA and Met are limited (the concentration of sulfur content other than MTA and Met is less than about 1.2 μM).

For candidate strains, confirm growth differences by spot method (a method of observing differences in cell growth after a certain period of time by dropping a cell suspension adjusted to the same initial cell count on an agar medium) Then, strains showing differences were selected. After pre-cultured overnight in YPD medium, these were inoculated into YPD medium so that the number of cells was 1 × 10 ⁶ cells / mL, and allowed to stand at 30 ° C for 1 week. DMTS-P1 concentration was measured by LC-MS.

  As a result of screening from about 24,000 colonies derived from the MR-01 strain, 19 strains having low growth ability in the MTA medium were obtained. Among them, nine strains produced significantly less DMTS-P1 than the parent strain, and three of the nine strains produced almost no DMTS-P1 (FIG. 1). As a result of DNA sequencing, mutations with amino acid substitutions were confirmed in the ORFs of MDE1 and MRI1 in 2 of 3 strains (LMU-H1 strain and LMU-H9 strain), respectively (MDE1, 161C → T, 54Pro → Leu; MRI1, 575G → A, 192Gly → Asp).

  As a result of the small preparation test of the 3 strains obtained, the fermentation of LMU-H9 strain was greatly delayed, but LMU-H1 strain showed a good fermentation process and was considered promising as a practical strain.

(3) Doubled LMU-H1 strain
Since LMU-H1 strain (MATα) is haploid, diploidization was performed. The LMU-H1 strain was crossed with K701-a4 (MATa), which is a wild type haploid of K701, and the resulting hybrid strain was sporulated. About 400 colonies were obtained from the sporulated plate by the random spore method. MTA assimilation ability decreased in 8 of these strains. As a result of sequencing of the MDE1 gene, 1 strain of MATa haploid, 2 strains of MATα haploid, 2 of MATa / α diploid The strain was confirmed to be an mde1 mutant. The above two strains of MATa / α were obtained by accidental diploid mde1 mutants in the process of random spores (mde-D1, D2). Also, haploid mde1 mutants with different mating types including LMU-H1 were crossed to obtain three diploid mde1 mutants (mde-D3 to D5).

(4) Small sake preparation test using diploid mde1 mutant
Using 5 strains of mde-D1 to D5, a small-scale sake preparation test using pregelatinized rice was conducted. Using rice starch with a rice milling rate of 77% and rice bran with a rice polishing rate of 75%, a three-stage charge was made according to the charge composition shown in Table 2, and the fermentation temperature was kept constant at 13 ° C. mde-D2 was placed on the tank on the 20th day of charging, and the tank was placed on the 15th day. The produced sake was analyzed for alcohol content, sake content, total acidity and amino acid content according to the analysis method prescribed by the National Tax Agency. DMTS-P1 was measured by LC-MS. DMTS production potential (DMTS-pp, DMTS production due to forced deterioration) was measured by GC-MS after the produced liquor was stored at 70 ° C. for 1 week.

  As a result, the DMTS-P1 concentration in all strains was greatly reduced compared to the control strain (Table 3). DMTS production potential (DMTS-pp) decreased to 1/9 to 1/3 in 4 out of 5 strains. The mde-D2 strain did not show a decrease in DMTS-pp, but this is probably due to its high amino acid content. In addition, methionine requirement disappeared except for the mde-D2 strain among the five strains.

  Furthermore, using the mde-D1 and mde-D5 strains, a 1 kg total sake sake preparation test was conducted. Using steamed rice and rice bran with a rice polishing ratio of 75%, a three-stage charge was made according to the charge composition shown in Table 4, and the fermentation temperature was kept constant at 13 ° C. K701 and mde-D5 were placed in the upper tank on the 14th day, and mde-D1 was placed on the 15th day. The produced liquor was adjusted to 15% alcohol (Table 5) and stored at 40 ° C. for sensory evaluation. Sensory evaluation was conducted by a panel of 11 people.

  As a result, the small brewed sake from the mde-D1 and mde-D5 strains showed less tenderness after long-term storage than the control strain, and the overall evaluation showed a good evaluation (Table 6). From the above results, it was clarified that DMTS-P1 low-producing yeast can be bred by the above-mentioned method, and that the sake prepared with the obtained strain can suppress the production of DMTS by storage.

Example 2: Creation of a mutant strain by self-cloning method
(1) Creation of a self-cloning strain into which the mutant MRI1 sequence of LMU-H9 strain was introduced The parent strain was designated as Sake Kyokai No. 901 (K901 strain), and a mutant-introduced strain was prepared using the mutant MRI1 sequence of LMU-H9 strain. The region containing the point mutation 575 G → A of the LMU-H9 strain was amplified from the genome of the LMU-H9 strain by PCR, and then cloned into the integrative sequence-removed plasmid pAUR135 (Takara). Since this plasmid has a galactose-induced suicide gene in addition to the AUR1-C gene conferring aureobasidin resistance as a transformant selection marker, only the strain from which the sequence has been removed can survive in the galactose medium. Plasmid removal is performed (Aritomi K, et al. Biosci Biotechnol Biochem. 68, 206-214 (2004); JP 2003-144164, etc.). Specific steps are described below.

  A 993 bp region containing a point mutation (SEQ ID NO: 9) by PCR using the genome of LMU-H9 strain as a template and primers MRI1-SF (CTTTGATAGATCGGAGCCAGA, SEQ ID NO: 7) and MRI1-SR (TTGAATTCCTCAGGGTTACGTT, SEQ ID NO: 8) Was amplified. The amplified fragment was treated with EcoRI for insertion into pAUR135, and an 986 bp insert fragment was recovered. pAUR135 was cleaved with SmaI and EcoRI, and the insert fragment was ligated to obtain a plasmid for transformation (SEQ ID NO: 10, 741-1726 positions of mutant MRI1 partial sequence of insert).

  The transformation plasmid was linearized by cutting with Spe I, and introduced into the K901 strain, and then a strain in which the plasmid was integrated into the genome was selected based on the drug resistance (aureobasidin resistance) of the plasmid. The selected strain was cultured in a galactose medium to obtain a strain from which the plasmid sequence was removed. Removal of the plasmid was confirmed by PCR using primers (pAUR135-checkF3: GCCTGATGCGGTATTTTCTC (SEQ ID NO: 11) and pAUR135-checkR3: TCGTCGTTTGGTATGGCTTC (SEQ ID NO: 12)) set in the plasmid sequence portion. In addition, when the plasmid sequence is removed, there are cases where it returns to the normal MRI1 sequence and sometimes it is a mutant MRI1 sequence. Therefore, the incorporation of the mutant sequence was confirmed by sequencing the base sequence of the MRI1 gene.

  Since the K901 strain is diploid, reintroduction of the plasmid for transformation into the strain in which the plasmid sequence was removed and the mutant sequence was confirmed to be incorporated, and the MRI1 gene of both alleles was replaced with the mutant type. 30-30 strains were obtained.

(2) Fermentation test using self-cloning strain
300 g total rice using K901 strain (parent strain, diploid), LMU-H9 strain (monoploid), and self-cloning strain 30-5 strain (diploid) having MRI1 mutation of LMU-H9 strain A small preparation test (Table 7) was conducted in triplicate, and DMTS-P1 concentration, DMTS-pp measurement and general analysis of the sake were conducted. The alcohol content was measured using a simple analysis method (alcomate), the sake content was measured using a vibration densitometer, and the acidity and amino acid content were measured using a pH titration method. DMTS-P1 was measured by LC-MS, and DMTS-pp was measured by GC-MS.

  The results are shown in FIG. 2 and Tables 8 and 9. Carbon dioxide reduction of haploid LMU-H9 was low, and carbon dioxide reduction of 30-5 was almost the same as that of parent K901 (Figure 2, Table 8). Compared to the parent strain K901, DMTS-P1 production was significantly reduced in LMU-H9 and 30-5 strains (Table 8). According to the results of general component analysis, haploid LMU-H9 strain was characterized by low alcohol, but 30-5 strain was almost the same as K901 strain (Table 9). In addition, when DMTS-P1 production ability was also examined in the diploid strain having a heterozygous mutation obtained in the process of creating a self-cloning strain, no decrease in DMTS-P1 production ability was observed.

Example 3: Screening of a mutant yeast strain with low production of DMTS-P1 using a decrease in growth ability in MTA medium as an index (part 2)
(1) Screening for methionine-requiring mutants Met-requiring mutants were screened from sake yeast No. 7 (K7, diploid) using colony color on Pb-added medium as an index.

The K7 strain was UV-irradiated (10 minutes, 80% survival rate) and non-UV-irradiated on Pb-added medium (Pb ²⁺ concentration 3 mM), cultured at 30 ° C. for 4-5 days, and then dark brown -Collected colonies colored black. As a result of screening from a total of about 300,000 colonies, two Met-requiring mutants were obtained with UV irradiation and one without UV irradiation. Mutant strains obtained with UV treatment were named U5 and U6 strains, and natural mutant strains obtained without UV treatment were named S1-2 strains.

(2) Screening of DMTS-P1 low production mutants using growth difference in MTA medium and Met medium as an index After the obtained Met-requiring mutant S1-2 is cultured and grown, UV irradiation (30 Mutation was induced with 10-20% survival for 10 minutes. After the yeast cells after the mutation treatment were seeded on a YPD plate and cultured, the colonies that emerged were replicated in MTA medium and Met medium, and a strain that was inferior in growth in MTA medium as compared to Met medium was used as a candidate strain. The composition of MTA medium and Met medium was the same as Table 1 except that Sodium glutamate 7.1g / L was changed to Urea 2.3g / L and Biotin and Thiamine were excluded (Sulfur content other than MTA and Met included) do not do).

Regarding candidate strains, 1. The growth difference was confirmed by the spot method in the same manner as in (2), and the strain in which the difference was observed was selected. After pre-cultured overnight in YPD medium, these were inoculated into YPD medium so that the number of cells was 1 × 10 ⁶ cells / mL, and allowed to stand at 30 ° C for 1 week. DMTS-P1 concentration was measured by LC-MS.

  As a result of screening from about 60,000 colonies derived from the S1-2 strain, 51 strains having low growth ability in the MTA medium were obtained. Five of them showed a significant decrease in DMTS-P1 concentration compared to the parent strain. FIG. 3 shows DMTS-P1 measurement results.

Claims (15)

Obtaining a methionine-requiring strain from the yeast parent strain, and culturing the methionine-requiring strain in both a methionine-containing medium and a MTA-containing medium that does not contain methionine and contains 5'-methylthioadenosine (MTA) A step of selecting a strain having a lower growth ability than the methionine-containing medium in the MTA-containing medium,
A method for producing a yeast having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one.   The method according to claim 1, wherein the methionine-containing medium and the MTA-containing medium are media in which a sulfur source other than methionine and MTA is limited.   Strain selected as a strain having a low growth ability in a medium containing MTA and the parent strain are subjected to liquid culture, and the concentration of 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one in the culture supernatant is measured, The method according to any one of claims 1 to 2, further comprising a step of selecting a strain having a lower production amount of 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one than the parent strain.   The method according to claim 3, further comprising obtaining a strain having lost methionine requirement from a yeast strain having low productivity of the obtained 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one. Method.   Using a haploid yeast as a yeast parent strain, and further doubling the obtained yeast strain with low productivity of 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one, The method of claim 3.   6. The method according to claim 5, further comprising the step of selecting a strain having lost methionine requirement from a diploid strain.   Select the strain in which MTA-containing medium has a lower growth ability than methionine-containing medium, or select a strain that produces 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one lower than the parent strain The method according to any one of claims 1 to 6, further comprising the step of determining the sequence of the MDE1 gene and MRI1 gene of the selected strain and identifying the mutation site after the step of performing the step. A mutation produced in the MDE1 gene or MRI1 gene from the genome of yeast having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one produced by the method according to claim 7 Amplifying the region,
Ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one, including the step of introducing the mutation into non-recombinant yeast using a plasmid vector for self-cloning into which the mutation-containing region has been inserted Method of producing yeast with low level.   The method according to any one of claims 1 to 8, wherein the yeast is a brewing yeast.   The method according to claim 9, wherein the yeast is sake yeast.   1,2-dihydroxy-5- (methylsulfinyl) having a mutation in which the 54th proline of the protein encoded by the MDE1 gene becomes leucine or a mutation in which the 192nd glycine of the protein encoded by the MRI1 gene becomes aspartic acid Pentan-3-one low productivity yeast.   The 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one low-producing yeast according to claim 11, which is a brewing yeast.   The 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one low-producing yeast according to claim 12, which is a sake yeast.   A brewing yeast produced by the method according to claim 9 and having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one, or 1,2-dihydroxy-5- (Methylsulfinyl) pentan-3-one A method for producing an alcoholic beverage with reduced sulfide-like off-flavor, comprising performing alcohol fermentation using a low-productivity yeast.   A sake yeast produced by the method according to claim 10 and having a low ability to produce 1,2-dihydroxy-5- (methylsulfinyl) pentan-3-one, or 1,2-dihydroxy-5- (Methylsulfinyl) pentan-3-one A method for producing sake with suppressed generation of perfume, comprising performing alcohol fermentation using a low-producing yeast.