JP4434971B2 - Microparticles for capture beads and capture beads and biochips using the same - Google Patents

Description

  The present invention relates to microparticles for capture beads, capture beads using the same, and biochips.

  Attempts to decipher biological processes, including assessment of gene activity, disease processes, and biological processes of medicinal effects, have traditionally focused on genomics, but proteomics Provide more detailed information about functional functions. Proteomics involves the qualitative and quantitative measurement of gene activity by detecting and quantifying expression at the protein level rather than at the gene level. It also includes studies of non-gene-encoded events such as post-translational modification of proteins and protein-protein interactions.

  Now that a large amount of genomic information is available, proteomics research is increasingly required to be more efficient (high throughput). For this purpose, DNA microarrays and protein chips have been proposed and studied.

A slide array is generally used as the microarray, but a bead array using microbeads has been proposed (Patent Document 1). In addition, a technique for performing immunoassay using beads in a fine channel has been proposed (Patent Document 2).
JP2003-121436 JP 2001-004628 A Nobuo Izumiya, Tetsuo Kato, Toshihiko Aoyagi, Noriaki Waki, “Basics and Experiments of Peptide Synthesis”, published in 1985, Maruzen

However, the techniques described in Patent Documents 1 and 2 have room for improvement in the following points.
First, microbeads used when performing immunoassay in a bead array or a fine channel are those having a size of about 10 to 500 μm. In this case, there may be a problem that the beads adhere to the wall surface of the flow channel or the beads aggregate and stay in the flow channel. In addition, for DNA hybridization and antigen-antibody reaction, beads with high reaction efficiency and high signal are desired.

  The present invention has been made in view of the above circumstances, and has a high reaction efficiency between a substance immobilized on a surface and a physiologically active substance to be detected in a sample solution, and is easy to move or fill in a flow path. A simple capture bead.

According to the present invention,
A microparticle on which a capture substance for capturing a physiologically active substance is immobilized and used as a carrier for capture beads,
A polymer substance containing a first monomer having a phosphorylcholine group and a second monomer having a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group is coated on the surface. Microparticles for capture beads are provided.

Moreover, according to the present invention,
A microparticle on which a capture substance for capturing a physiologically active substance is immobilized and used as a carrier for capture beads,
A polymer material containing a first monomer having a phosphorylcholine group and a second monomer having a monovalent group represented by the following formula (1) is coated on the surface. Microparticles for capture beads are provided.
-COA (1)
(In the above formula (1), A is a monovalent leaving group excluding a hydroxyl group and an alkoxyl group.)

  In the microparticle for capture beads of the present invention, the polymer substance coated on the particle surface has a carboxylic acid-derived group or a group represented by the above formula (1) and a phosphorylcholine group. For this reason, while suppressing the non-specific adsorption | suction to the particle | grain surface and the component in test liquids including a bioactive substance, or particle | grains aggregating, it is a carboxylic acid derivative group or said Formula (1). The capture material can be chemically immobilized on the polymeric material by a nucleophilic reaction of the indicated group. Therefore, the physiologically active substance can be selectively and efficiently captured on the particle surface. Therefore, it can be suitably used as a carrier for capture beads. The specific configuration of the carboxylic acid derivative group will be described later.

  In the present specification, capture beads are particles (beads) on the order of μm that can capture a predetermined physiologically active substance by specific adsorption. In the capture beads of the present invention, a capture substance that captures a physiologically active substance is immobilized on a capture bead microparticle that is used as a support for the capture bead. Capture on the bead surface. This capture bead is used, for example, for treatment of a physiologically active substance in the test solution from the test solution, such as isolation, identification, detection, quantification, or other analysis.

  Further, in the present invention, the polymer substance covering the surface of the particle only needs to cover at least a part of the surface of the particle. By adopting a configuration in which the polymer substance covers the entire particle surface, non-specific adsorption to the particle surface or aggregation between particles can be more reliably suppressed.

  In addition, a capture substance that captures a physiologically active substance can have physiological activity. Further, the capture substance may be a molecule having a physiologically active substance. This molecule can capture a physiologically active substance by itself or can capture a physiologically active substance by a plurality of molecules.

According to the present invention,
A capture substance that captures a physiologically active substance on the particle surface is immobilized, and is a capture bead used for processing the physiologically active substance in a test solution,
There is provided a capture bead characterized in that the carboxylic acid derivative group of the capture bead microparticle reacts with the capture substance to form a covalent bond.

Moreover, according to the present invention,
A capture substance that captures a physiologically active substance on the particle surface is immobilized, and is a capture bead used for processing the physiologically active substance in a test solution,
There is provided a capture bead characterized in that the monovalent group represented by the formula (1) of the microparticle for capture bead reacts with the capture substance to form a covalent bond.

  In the capture beads of the present invention, the surface is coated with a polymer substance having a phosphorylcholine group. For this reason, when it contacts with a test liquid, it becomes the structure by which the component in a test liquid including a bioactive substance was suppressed from adsorb | sucking to a particle | grain surface nonspecifically. In addition, the carboxylic acid-derived group in the polymer material on the particle surface or the group represented by the above formula (1) reacts with the capturing substance to form a covalent bond. For this reason, the supplementary substance is configured to be stably immobilized on the particle surface. Therefore, according to this capture bead, a predetermined physiologically active substance can be selectively and efficiently captured on the particle surface. In addition, isolation, identification, detection, quantification, or other analysis of the physiologically active substance in the test solution can be reliably performed.

  In addition, the capture beads of the present invention have a structure in which aggregation between particles is suppressed because the surface is coated with a polymer substance having a phosphorylcholine group. For this reason, the dispersion stability and fluidity are sufficiently secured. Therefore, the capture beads of the present invention can suppress clogging of the flow channel when used in the flow channel, and can improve fluidity. In addition, if the particle size of the capture beads is too small, there is a concern that the reproducibility of the experiment is lowered due to clogging in the flow channel or difficulty in clogging in the flow channel. On the other hand, since the capture beads of the present invention have microparticles for capture beads, they can be stably dammed in the flow path. More specifically, the test solution can be continuously processed by flowing the test solution through the channel provided with the capture beads of the present invention. In this way, the physiologically active substance in the test solution can be more efficiently captured on the particle surface. In addition, the interaction with the supplementary substance immobilized on the surface of the capture bead can be selectively and efficiently performed to improve the accuracy of identification, detection, or quantification of the physiologically active substance in the test solution. it can. Furthermore, by using a configuration having microparticles for capture beads, it is possible to observe the microscope as a bead array. For this reason, the detection procedure of the physiologically active substance in the test solution can be simplified.

  According to the present invention, there is provided a biochip comprising a flow path and capture beads provided in the flow path, wherein the capture beads are the capture beads.

  The biochip of the present invention has a configuration in which the above-described capture beads are provided in the flow path. The capture beads of the present invention have a supplementary substance immobilized on the surface. In addition, this capture bead has excellent dispersion stability and fluidity, is easy to handle in the flow path, and has a configuration that can be easily moved and filled in the flow path without stagnation in the flow path. . For this reason, according to the biochip of the present invention, the physiologically active substance can be captured by the supplementary substance fixed to the capture beads by introducing the test solution containing the physiologically active substance into the flow path. Therefore, it is possible to reliably perform identification, detection, quantification, and other processing of the physiologically active substance. More specifically, in the detection of a physiologically active substance, a high signal can be detected with a high signal and a low signal in a blank as a background.

  In the biochip of the present invention, the flow path may be provided on the substrate, and a crest for restricting permeation of the capture beads may be provided on the flow path. By doing so, the capture beads can be reliably damped and held in a predetermined region of the flow path. Therefore, identification, detection, quantification, and other processing of the physiologically active substance can be performed more stably.

  According to the present invention, there is provided a technique for providing a capture bead having a high reaction efficiency between a substance immobilized on a surface and a physiologically active substance to be detected in a sample solution, which can be easily moved or filled in a flow path. Realized.

  Hereinafter, an embodiment of the present invention will be described with reference to an example in which detection or quantification of a physiologically active substance in a sample is performed using a capture bead in which a capture substance that captures the physiologically active substance is immobilized on the microparticle for the capture bead. explain. Here, the sample can be, for example, a liquid containing a predetermined physiologically active substance, and more specifically, a biological sample.

  The microparticle for capture beads is a particle used as a support for capture beads, and has a first unit having a phosphorylcholine group and a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group. A polymer material containing the second unit is coated on the surface. Since it has such a polymer coating, the microparticles for capture beads according to the present embodiment have a phosphorylcholine group present on the particle surface to suppress non-specific adsorption of physiologically active substances in the sample, and also to carboxylic acid. A capture substance that captures a physiologically active substance can be easily immobilized via the inducing group moiety.

  Microparticles for capture beads and capture beads are of a size that can be recognized by a cell sorter. Further, the shape and size are suitable for analysis using a flow channel width on the order of μm to mm, more specifically, a fine flow channel having a flow channel width of about 200 μm. The capture beads using the microparticles for capture beads as a carrier can suppress non-specific adsorption and also suppress aggregation of particles. For this reason, even when used in a fine flow path, clogging of the flow path can be suppressed and the physiologically active substance can be efficiently captured.

  The shape of the capture beads and capture microparticles can be spherical. By using a spherical shape, errors that occur in the detection reaction of a physiologically active substance can be reduced. Moreover, the fluidity | liquidity in a flow path can be stabilized further. Further, even when the particles collide with each other when used in a fine flow path or the like, the damage can be suppressed and the durability of the particles can be improved.

  The diameter (number average particle size) of the capture bead microparticles and capture beads can be, for example, 10 μm or more, preferably 20 μm or more. In this way, when used in the flow path, it can be stably damped to a predetermined position in the flow path, and the occurrence of clogging and the like can be more suitably suppressed. Moreover, it can be set as the structure which can be recognized still more reliably with a cell sorter. Moreover, these diameters (number average particle diameter) can be 500 micrometers or less, for example, Preferably it is 100 micrometers or less. By doing so, the filling rate into the fine flow path can be improved. Further, the specific surface area of the particles can be further improved, and the sensitivity in the detection reaction of the physiologically active substance can be further improved. Further, by setting the diameter of the capture beads to the order of μm, the capture beads after use can be observed with a microscope as a bead array. For this reason, the physiologically active substance can be easily detected by observing changes such as discoloration of the particle surface caused by capturing the physiologically active substance in the test solution.

  Moreover, in the capture bead of this embodiment, the carboxylic acid derivative group to which the supplementary substance is not immobilized may be inactivated. By doing so, it becomes possible to prevent nonspecific adsorption of physiologically active substances including proteins, which is the effect of phosphorylcholine. Moreover, the adhesion between the capture beads is suppressed by the phosphorylcholine group. The reason for this is presumed to be that the capture bead surface is hydrophilized by the phosphorylcholine group to increase the degree of hydrophilization.

  Hereinafter, the capture bead microparticles and the components of the capture beads will be described in more detail.

(Polymer substance)
A polymer substance having a first unit containing a phosphorylcholine group and a second unit containing a carboxylic acid derivative group immobilizes a non-specific adsorption property of a physiologically active substance and a capture substance that supplements the physiologically active substance. It is a polymer that has both properties. The phosphorylcholine group contained in the first unit serves to suppress nonspecific adsorption of the physiologically active substance, and the carboxylic acid derivative group contained in the second unit serves to chemically immobilize the capture molecule.

The first unit is, for example, a (meth) acryloyloxyalkyl phosphorylcholine group such as a 2-methacryloyloxyethyl phosphorylcholine group, a 6-methacryloyloxyhexyl phosphorylcholine group;
(Meth) acryloyloxyalkoxyalkylphosphorylcholine groups such as 2-methacryloyloxyethoxyethyl phosphorylcholine group and 10-methacryloyloxyethoxynonylphosphorylcholine group;
Alkenylphosphorylcholine groups such as allylphosphorylcholine group, butenylphosphorylcholine group, hexenylphosphorylcholine group, octenylphosphorylcholine group, and decenylphosphorylcholine group;
And a phosphorylcholine group is included in these groups.

  Of these groups, 2-methacryloyloxyethyl phosphorylcholine is preferable. By adopting a configuration in which the first unit has 2-methacryloyloxyethyl phosphorylcholine, nonspecific adsorption of the physiologically active substance to the surface of the capture beads can be more reliably suppressed.

  The carboxylic acid-derived group is a group derived from a carboxylic acid having a leaving group via C═O, wherein the carboxyl group of the carboxylic acid is activated. Specifically, the carboxylic acid-derived group is formed by bonding a group having higher electron withdrawing property than an alkoxyl group to a carbonyl group. A carboxylic acid derivative group is a group in which a nucleophilic reaction is activated by the bonding of a group having a high electron-withdrawing group, and specifically, a group having reactivity with an amino group, a thiol group, a hydroxyl group, or the like. is there.

More specifically, as the activated carboxylic acid derivative, carboxyl groups such as acrylic acid, methacrylic acid, crotonic acid, maleic acid, and fumaric acid, which are carboxylic acids, are acid anhydrides, acid halides, active esters, Examples include compounds converted to activated amides. Carboxylic acid-derived groups are activated groups derived from such compounds, for example, activated ester groups (active ester groups) such as p-nitrophenyl groups and N-hydroxysuccinimide groups;
Imido groups such as succinimide groups and phthalimide groups;
-Halogen such as Cl, -F;
And the like. The definition and specific examples of the active ester group will be described in detail later.

The carboxylic acid derivative group can be a group represented by the following formula (1).
-COA (1)
(In the above formula (1), A is a leaving group excluding a hydroxyl group and an alkoxyl group.)

The monovalent group represented by the above formula (1) can be, for example, any group selected from the following formula (p) or formula (q).
-COOCR ¹ (p)
-COONR ² (q)
(However, in the above formulas (p) and (q), R ¹ and R ² are each independently a monovalent organic group, which may be linear, branched, or cyclic. In Formula (p), R ¹ may be a divalent group that forms a ring with C. In Formula (q), R ² is a divalent group that forms a ring with N. It may be a group of

  Examples of the group represented by the formula (p) include groups represented by the following formulas (r), (s), and (w). Examples of the group represented by the formula (q) include groups represented by the following formulas (u) and (v).

The group represented by the above formula (1) is, for example, a group derived from an acid anhydride represented by the following formula (r), formula (s) or the like;
A group derived from an acid halide represented by the following formula (t);
A group derived from an active ester represented by the following formula (u) or formula (w); or a group derived from an activated amide represented by the following formula (v).

  Of the carboxylic acid-derived groups, an active ester group is preferably used because of its excellent reactivity under mild conditions. The mild conditions include, for example, neutral to alkaline conditions, specifically pH 7.0 or more and 10.0 or less, more specifically pH 7.6 or more and 9.0 or less, and more specifically pH 8.0. It can be.

  The definition of “active ester group” as defined in this specification is not strictly defined. However, as a conventional technical expression, an electron withdrawing property having high acidity on the alcohol side of the ester group is used. An ester group having a group and activating a nucleophilic reaction, that is, an ester group having a high reaction activity, is commonly used in various chemical synthesis fields such as polymer chemistry and peptide synthesis. is there. In the field of peptide synthesis, as described in Nobuo Izumiya, Tetsuo Kato, Toshihiko Aoyagi, Noriaki Waki, “Basics and Experiments of Peptide Synthesis”, published in 1985, Maruzen, It is used as one of the methods for activating the C-terminus of amino acids or peptides.

  The active ester group is actually an ester group having an electron-withdrawing group on the alcohol side of the ester group and activated more than the alkyl ester. The active ester group has reactivity with a group such as an amino group, a thiol group, or a hydroxyl group.

More specifically, phenol esters such as p-nitrophenyl group;
Thiophenol esters;
N-hydroxyamine esters such as N-hydroxysuccinimide (NHS) group;
Esters of heterocyclic hydroxy compounds such as 5-norbornene-2,3-dicarboximide group, N-hydroxy-5-norbornene-2,3-dicarboximide; and cyanomethyl ester group;
Are known as active ester groups having much higher activity than alkyl esters and the like.

  Hereinafter, the case where the activated carboxylic acid derivative group in the polymer substance is an active ester group will be described as an example. The active ester group can be properly used depending on the capture substance to be immobilized, and for example, a p-nitrophenyl group or an N-hydroxysuccinimide group is preferably used.

  As a combination of more specific configurations of the first unit and the second unit, for example, a configuration in which the first unit containing a phosphorylcholine group has a 2-methacryloyloxyethyl phosphorylcholine group and the active ester group is a p-nitrophenyl group It can be. Further, the first unit containing a phosphorylcholine group may have a 2-methacryloyloxyethyl phosphorylcholine group, and the active ester group may be an N-hydroxysuccinimide group.

  The polymer substance may contain other groups in addition to the phosphorylcholine group and the carboxylic acid derivative group. The polymer substance can be a copolymer. Specifically, the polymer substance is preferably a copolymer containing a butyl methacrylate group in addition to the phosphorylcholine group and the carboxylic acid derivative group. By so doing, the polymer substance can be appropriately hydrophobized, and the adsorptivity to the surface of the core particles can be more suitably ensured.

  Specifically, the polymer substance is composed of a first monomer having a 2-methacryloyloxyethyl phosphorylcholine (MPC) group, a second monomer having a p-nitrophenylcarbonyloxyethyl methacrylate (NPMA) group, A copolymer with a third monomer having a butyl metallate (BMA) group can be obtained. These copolymers, poly (MPC-co-BMA-co-NPMA) (PMBN), are schematically represented by the following general formula (2).

  However, in the said General formula (2), a, b, and c are respectively independently a positive integer. In the general formula (2), the first to third monomers may be block copolymerized, or these monomers may be copolymerized randomly.

  The copolymer represented by the general formula (2) has a more excellent structure due to the balance between appropriate hydrophobicity of the polymer substance, the property of suppressing non-specific adsorption, and the property of immobilizing the capture substance. . For this reason, by using this, the surface of the core particle is more reliably coated with the polymer substance, and the non-specific adsorption onto the core particle having the polymer substance coating is suppressed, while the capture substance is used. Furthermore, it can be reliably immobilized by covalent bonding and introduced into the microparticle for capture beads.

  The copolymer represented by the general formula (2) can be obtained by mixing MPC, BMA, and NPMA monomers and using a known polymerization method such as radical polymerization. When the copolymer represented by the general formula (2) is prepared by radical polymerization, solution polymerization can be performed, for example, in an inert gas atmosphere such as Ar under a temperature condition of 30 ° C. or higher and 90 ° C. or lower.

  The solvent used for the solution polymerization is appropriately selected. For example, alcohols such as methanol, ethanol and isopropanol, ethers such as diethyl ether, and organic solvents such as chloroform can be used alone or in combination. Specifically, a mixed solvent in which diethyl ether and chloroform are in a volume ratio of 8 to 2 can be obtained.

Moreover, what is used normally can be used as a radical polymerization initiator used for radical polymerization reaction. For example, azo initiators such as azobisisobutyronitrile (AIBN) and azobisvaleronitrile;
Oil-soluble organic peroxides such as lauroyl peroxide, benzoyl peroxide, t-butylperoxyneodecanoate, t-butylperoxypivalate;
Etc. are used.

  More specifically, polymerization can be carried out in Ar at 60 ° C. for about 2 to 6 hours using a mixed solvent of diethyl ether and chloroform in a volume ratio of 8 to 2 and AIBN.

  In addition, the polymer substance has a plurality of carboxylic acid-derived groups, and the plurality of carboxylic acid-derived groups react with the capturing substance to form a covalent bond or are inactivated. Here, the carboxylic acid-derived group is inactivated means that a part of the group (leaving group) constituting the carboxylic acid-derived group is substituted with another group and the activity is lost. Say.

  The polymer substance may be formed in layers on the surface of the core particle. In this way, nonspecific adsorption on the surface of the capture bead microparticles can be more reliably suppressed. In this case, the thickness of the layer made of the polymer substance is not particularly limited, but can be, for example, 5 nm or more. In this way, nonspecific adsorption can be more reliably suppressed. Further, the upper limit of the thickness of the layer made of the polymer substance may be such that the capture bead microparticles are in the order of μm, and can be determined, for example, according to the particle diameter of the core particles.

  The polymer substance may be provided in the form of a film on the surface of the core particle. By doing so, the surface of the core particle can be more stably coated with the polymer material film. The polymer substance may be provided on the entire surface of the core particle. In this way, non-specific adsorption to the surface of the core particle can be more reliably suppressed.

(Core particles)
Examples of the core particle material used for the capture beads used in the present invention include glass, plastic, and metal. Among these, from the viewpoint of ease of surface treatment and mass productivity, plastic is preferable, and thermoplastic resin is more preferable. As a thermoplastic resin, a thing with little fluorescence generation amount can be used. By using a resin with a small amount of fluorescence generation, the background in the detection reaction of the physiologically active substance can be reduced, so that the detection sensitivity can be further improved.

  Further, the core particles can be made of a resin that is transparent to the detection light. The material of the transparent resin is appropriately selected according to the wavelength of the detection light used for the detection reaction of the physiologically active substance, and examples thereof include saturated cyclic polyolefin, PMMA, polystyrene, and polycarbonate. By making the core particle a transparent material at the wavelength of the detection light, the state of liquid feeding can be easily confirmed. In addition, the core particles can be colored appropriately. By doing so, the detection sensitivity can be improved when detecting the detection reaction by optical observation.

(Capture substance)
The capturing substance that captures the physiologically active substance can be a substance that specifically interacts with the physiologically active substance. The specific interaction may be a physical interaction or a chemical interaction. In addition, the capture substance can have physiological activity. As a capture substance having physiological activity, for example, a nucleic acid, aptamer, protein, enzyme, antibody, oligopeptide, sugar chain, or glycoprotein can be used.

  The capture substance immobilized on the capture bead microparticles preferably has an amino group in order to increase the reactivity with the active ester group. Since the amino group is excellent in reactivity with the active ester group, the capture substance can be immobilized on the particles efficiently and firmly by using the capture substance having an amino group. The amino group may be introduced at the molecular chain end or side chain, but is preferably introduced at the molecular chain end. It is possible to maintain the orientation of the immobilized capture substance by introducing an amino group at the end of the molecular chain and introducing this amino group at the end. For example, DNA strand hybridization and antigen-antibody reaction are more efficient. Can be done well.

  For example, when a nucleic acid or aptamer is used as a capture substance to be immobilized on the capture bead microparticles described in this embodiment and the following embodiments, an amino group is introduced to increase the reactivity with the active ester group. It is preferable. In the case of a nucleic acid chain such as DNA or aptamer, an amino group may be introduced at the end of the molecular chain. By carrying out like this, the amino group introduce | transduced into the terminal can be made to react with an active ester group, and a polymeric bond can be formed more reliably. In addition, by using the terminal amino group for immobilization, hybridization with a DNA complementary strand and mutual reaction with a protein can be performed more efficiently.

  Also, when a protein, enzyme, antibody, oligopeptide, sugar chain, or glycoprotein is used as a capture substance, it is preferable to introduce an amino group as necessary.

Next, a method for producing microparticles for capture beads will be described.
First, core particles are prepared. The material of the core particles is configured as described above. Specifically, resin fine particles typified by polystyrene having a diameter of 10 μm to 500 μm, preferably a diameter of 20 μm to 100 μm can be prepared.

  The surface of the core particle is coated with a polymer substance having a phosphorylcholine group and an active ester group. The coating of the polymer substance is performed by dispersing the core particles in a liquid in which a polymer substance having a phosphorylcholine group and an active ester group is dissolved or dispersed, and allowing to stand for a predetermined time, and then collecting the particles by centrifugation. Done. Then, the collected particles are dispersed in pure water and washed, and the particles are collected again by centrifugation. The recovered particles have a surface coated with a polymer substance having phosphorylcholine groups and active ester groups.

  As described above, since the microparticles for capture beads of the present embodiment are obtained by coating the surface of core particles prepared in advance with a polymer substance, the microbeads can be efficiently manufactured by a simple method. ing. Further, the particle diameter can be easily controlled by adjusting the particle diameter of the core particles.

  Next, a method of immobilizing a supplementary substance on the obtained microparticles for capture beads to obtain capture beads will be described. Here, the capture substance is immobilized on the polymer substance by a covalent bond. Specifically, microparticles for capture beads coated with a polymer substance are charged and dispersed in a liquid in which the capture substance is dissolved or dispersed. The pH of the liquid containing the trapping substance can be, for example, 2 or more and 11 or less, and preferably pH 7.0 or more and 10.0 or less as described above under mild conditions. When the pH of the liquid containing the trapping substance is too large or too small, it becomes a strong acid side or a strong alkali side, and thus there is a possibility that the trapping substance having physiological activity may be denatured. For example, when the capture substance is a protein, the pH of the liquid containing the capture substance can be around neutral.

  After allowing the microbead dispersion liquid for capture beads to stand for a predetermined time, the particles are collected by centrifugation. And the excess capture | acquisition substance which was not fix | immobilized is removed by wash | cleaning with a pure water etc. After washing, the active ester groups remaining on the particles are deactivated. The inactivation treatment of the active ester group to which the capture substance is not fixed can be performed using, for example, an alkali compound or a compound having a primary amino group.

  As the alkali compound, sodium hydroxide, potassium hydroxide, sodium carbonate, sodium hydrogen carbonate, disodium hydrogen phosphate, calcium hydroxide, magnesium hydroxide, sodium borate, lithium hydroxide, potassium phosphate, etc. are preferably used. be able to.

  Examples of the compound having a primary amino group include glycine, 9-amino aquadine, aminobutanol, 4-aminobutyric acid, aminocaprylic acid, aminoethanol, 5-amino-2,3-dihydro-1,4-pentanol, aminoethanethiol hydrochloride Salt, aminoethanethiolsulfuric acid, 2- (2-aminoethylamino) ethanol, 2-aminoethyl dihydrogen phosphate, aminoethyl hydrogensulfate, 4- (2-aminoethyl) morpholine, 5-aminofluorescein, 6-amino Hexanoic acid, aminohexyl cellulose, p-aminohippuric acid, 2-amino-2-hydroxymethyl-1,3-propanediol, 5-aminoisophthalic acid, aminomethane, aminophenol, 2-aminooctane, 2-aminooctane Acid, 1-amino-2-propanol, 3-amino-1-pro Nord, 3-aminopropene, 3-aminopropionitrile, aminopyridine, 11-aminoundecanoic acid, aminosalicylic acid, aminoquinoline, 4-aminophthalonitrile, 3-aminophthalimide, p-aminopropiophene, aminophenylacetic acid, Aminonaphthalene or the like can be used. Of these, aminoethanol and glycine are preferably used.

  After inactivation of the active ester, washing with pure water can be performed to obtain capture beads on which the supplementary substance is immobilized on the surface.

  The obtained capture beads can be used, for example, for detection or quantification of a physiologically active substance in the test liquid captured by the capture substance by flowing together with the test liquid in the flow path. In addition, it is possible to specify the components contained in the test solution. The physiologically active substance to be detected can be, for example, a nucleic acid, aptamer, protein, enzyme, antibody, oligopeptide, sugar chain, or glycoprotein.

  Next, a method for treating a physiologically active substance using the obtained capture beads will be described. Here, a case where a biochip having capture beads is used will be described as an example.

  FIG. 1 is a plan view showing a configuration of a biochip including capture beads. The biochip 100 shown in FIG. 1 is provided with a substrate 101 in which two plate-like members of a flow path substrate and a lid substrate are bonded, a groove 107 provided on a bonding surface of the substrate 101, and provided at both ends of the groove 107. And an introduction hole 103 and a discharge hole 105 communicating with the groove 107. The introduction hole 103 and the discharge hole 105 are through holes that penetrate the lid substrate. Since these through holes are connected to the outside air, they also function as air guide holes for allowing the liquid in the groove 107 to flow.

  The groove 107 functions as a fine channel through which a liquid can flow, and a filter 109 is provided at a predetermined position. Capture beads 111 are dammed upstream of the filter 109 (on the introduction hole 103 side). The capture bead 111 is configured as described above. The filter 109 is a membrane filter having a pore diameter smaller than the diameter of the capture beads 111, for example. By providing the filter 109, the permeation of the capture beads 111 can be restricted, and the capture beads 111 can be more securely damped and held in a predetermined region of the fine channel. Therefore, the operation of the physiologically active substance using the capture beads can be performed more stably. The biochip 100 only needs to be configured to hold the capture beads 111 in the middle of the groove 107, and is not limited to the configuration in which the filter 109 is provided. For example, you may use the board | substrate which has the groove | channel 107 of the structure which narrowed down part of flow path width.

  In the biochip 100, since a plurality of capture beads 111 are blocked at a predetermined position of the groove 107, a supplementary substance fixed to the capture beads 111 is introduced by introducing a test solution into the groove 107 from the introduction hole 103. In addition, the physiologically active substance in the test solution can be specifically captured. For this reason, a physiologically active substance can be stably processed with a simple configuration. In addition, by capturing the physiologically active substance on the surface of the capture bead 111, the physiologically active substance can be concentrated in a region where the capture bead 111 is blocked. For this reason, even when the physiologically active substance is a trace component in the test solution, it can be reliably concentrated and detected. Further, since the capture substance that supplements the physiologically active substance is immobilized on the surface of the capture bead 111, the immobilization density of the supplement substance can be improved as compared with the case where the supplement substance is directly immobilized in the groove 107. . Therefore, the physiologically active substance can be more reliably concentrated. In addition, the capture beads 111 have specificity for a physiologically active substance, and in addition to being able to efficiently capture the physiologically active substance, aggregation and nonspecific adsorption are suppressed in the flow path. Yes. For this reason, it is the structure which can perform this stably, without the movement and filling in a flow path being overdue.

  Further, in the biochip 100, when trying to apply nm order particles, the particles pass through the filter 109, making it difficult to dampen a predetermined region of the groove 107, or the filter 109 is clogged. There is a concern that may occur. In order to stop this, it is necessary to further reduce the width and depth of the groove 107 together with the configuration of the filter 109, which complicates the processing of the substrate 101. On the other hand, in the biochip 100, by using the capture beads 111 in the order of μm, the filter 109 is reliably damped while the fluidity of the capture beads 111 is secured, and clogging of the filter 109 is further suppressed. It has become. Further, the groove 107 can be easily processed.

  1 shows a configuration in which three linear grooves 107 are provided in parallel to each other on the surface of the flow path substrate constituting the substrate 101. However, the number, the planar shape, and the arrangement of the grooves 107 are not illustrated. It is not limited to one aspect.

  The fine flow path may be provided in a groove shape on the surface of the substrate, for example. The shape of the substrate is not limited to a plate shape, and may be a film shape or a sheet shape, for example. Specifically, the substrate can be a flexible plastic film. Moreover, the board | substrate may be comprised from one member and may be comprised from the some member. Moreover, you may have the protection member which covers a microchannel. In this way, it is possible to suppress capture beads and liquid in the fine channel from leaking out of the channel or drying. For this reason, the analysis using the capture beads can be performed more stably. Although there is no restriction | limiting in particular in the shape of a protection member, For example, it can be set as plate shape, sheet shape, or film shape.

  In the biochip 100, the surface of the groove 107, the introduction hole 103, and the discharge hole 105 as well as the surface of the capture bead 111 may be coated with a polymer substance. In this way, nonspecific adsorption of the physiologically active substance can be more reliably suppressed in the entire apparatus. For this reason, the treatment of the physiologically active substance can be performed more reliably.

  Next, as a specific example of a method of using the biochip 100, a case where an antibody is solid-phased and an antigen is detected by an antigen-antibody reaction in a fine channel will be described.

  When detecting or quantifying a physiologically active substance in a test solution using the biochip 100, first, a predetermined amount of capture beads is dispersed in a buffer solution such as PBS. As the capture beads 111, those obtained by immobilizing an antibody against a substance (antigen) to be detected or quantified on the aforementioned capture bead microparticles are used.

  Next, using a liquid feeding means such as a micropump or a microsyringe, a fixed amount of the dispersion of the capture beads 111 is fed from the introduction hole 103 into the fine flow path (groove 107). At this time, with the conventional beads, the beads often adhere in the middle of the flow path or involve air between the beads, but these can be effectively suppressed with the capture beads 111. In addition, when the introduction hole 103 or the discharge hole 105 is connected to the liquid supply tube or the like during liquid supply, it is preferable that air does not enter the hole from the connection portion. By so doing, it is possible to further reliably suppress the air from being sent into the groove 107 and to perform the capture by the capture beads 111 more efficiently and reliably.

  After catching and holding the capture beads 111 in the region provided with the filter 109 in the groove 107, a predetermined amount of sample solution is fed using a micropump or microsyringe. In this step, a substance (antigen) such as a protein to be detected or quantified is captured by the antibody immobilized on the surface of the capture beads 111 by the antigen-antibody reaction.

  Thereafter, according to the sandwich method by ELISA, the washing solution, the enzyme-labeled secondary antibody solution, and the washing solution are fed into the groove 107 in this order, and finally the chromogenic substrate is fed. Then, the degree of color development is measured by absorbance, fluorescence intensity, emission intensity, and the like. Since the capture beads 111 are configured to enable efficient immobilization of the supplementary substance while suppressing non-specific adsorption, the use of the capture beads 111 increases the efficiency of the antigen-antibody reaction, and a small amount of liquid is sufficient. Capturing proteins is possible. For this reason, it is possible to reliably detect or quantify even a small amount of components in the sample.

  In this way, by using the capture beads of this embodiment, non-specific adsorption of the components in the test solution, here the components containing the physiologically active substance to be detected, to the bead surface without coating the adsorption inhibitor. Can be suppressed. For this reason, the detection sensitivity in the detection of the physiologically active substance using the fine channel and the capture beads can be improved without coating the adsorption inhibitor.

  In addition, by using the detection unit as a fine flow path and filling a predetermined region of the fine flow path with capture beads, the capture substance is immobilized compared to the case where the capture substance is directly immobilized on the flow path surface. The specific surface area of the region can be increased. For this reason, the efficiency of the specific interaction between the capture substance and the physiologically active substance can be further improved, and the physiologically active substance can be reliably detected. For this reason, analysis of physiologically active substances such as proteins and nucleic acids in a biological sample can be reliably performed using the fine flow path.

  In addition, the capture bead of this embodiment may be used in combination with a chip having a fine channel as described above, or may be used alone. Note that, as described above, by setting the particle diameter of the capture beads to 10 μm or more and 500 μm or less, it is possible to obtain a more suitable configuration when filling in a fine flow path or when analyzing using a cell sorter.

  The present invention has been described based on the embodiments. It is to be understood by those skilled in the art that this embodiment is merely an example, and that various modifications are possible and that such modifications are within the scope of the present invention.

  For example, in the above embodiment, the immobilization reaction of the capture substance may be performed under neutral or alkaline conditions. For example, a liquid in which a capture substance is dissolved or dispersed is made neutral or alkaline. By doing so, the capture substance and the active ester group in the second unit of the polymer substance can be more reliably reacted to form a covalent bond.

  As such conditions, for example, pH 7.0 or higher, preferably pH 7.6 or higher can be set. More specifically, the pH can be set to 8.0. Under conditions where the pH is too low, there is a concern that the active ester group and the capture substance hardly react with each other and it is difficult to immobilize the capture substance. Further, the lower limit of the pH of the liquid containing the trapping substance is appropriately selected according to the type of trapping substance and the material of the polymer substance, and can be, for example, pH 10 or less.

  In the present embodiment, after capturing the capture substance, when capturing the physiologically active substance, an acidic or neutral liquid containing the physiologically active substance may be brought into contact with the polymer substance on the microparticle for capture beads. it can. Specifically, the pH of the liquid can be 8.0 or less, preferably 7.6 or less. More specifically, the pH can be set to 7.0, for example. By doing so, it is possible to more stably interact with the capture substance while suppressing nonspecific adsorption of the physiologically active substance. If the pH is too high, the active ester group reacts with the amino group of the physiologically active substance, and the physiologically active substance to be detected is easily immobilized by covalent bonding on a portion other than where the capture molecule is spotted.

  In the present embodiment, the pH of the liquid containing the physiologically active substance can be set to a pH lower than the pH of the liquid containing the trapping substance, preferably lower than the pH of the liquid containing the trapping substance. In this way, the reaction between the capture substance and the active ester group can be further caused to form a covalent bond, and the reaction between the physiologically active substance and the active ester group can be further reliably suppressed.

  In the above description, the biochip having the polymer substance on the surface of the flow path has been described. However, an adhesive layer for bonding these may be provided between the flow path and the polymer substance. For example, on the surface of the core particle, a second layer containing a polymer material having a first layer containing a compound having an amino group and a second unit containing a first unit containing a phosphorylcholine group and a carboxylic acid derivative. And can be configured to be stacked in this order. The first layer can include, for example, an aminosilane such as a silane coupling agent having an amino group. If it carries out like this, a 1st layer can be provided more stably in the surface of a core particle, and the surface of a core particle can be coat | covered more reliably with a 1st layer. In addition, the silane coupling agent which has an amino group may exist with forms, such as organosiloxane and polyorganosiloxane.

  In this embodiment, among the carboxylic acid-derived groups, some of the carboxylic acid-derived groups react with the capturing substance to form a covalent bond, and the remaining carboxylic acid-derived groups and hydrophilic groups are converted. It is good also as a structure which reacts with the hydrophilic polymer which has and forms a covalent bond. By introducing the hydrophilic polymer into the macromolecular substance by covalent bonding, nonspecific adsorption of the protein to the macromolecular substance on the surface of the capture beads can be further reduced.

  The hydrophilic polymer is a polymer having a hydrophilic group and can contain, for example, polyalkylene oxide or a plurality of types of polyalkylene oxides in the structure. As the polyalkylene oxide, for example, any of polyethylene glycol, polypropylene glycol, copolymers thereof, and copolymers of at least one of these with other polyalkylene oxides can be included in the structure. Moreover, it is preferable that the terminal of the hydrophilic polymer is aminated in order to increase the reactivity with the active ester group.

Moreover, it can also be set as the structure which a polymeric substance is a structure which consists of a following (a) component, or a mixture of the following (a) component and the following (b) component.
(A) a polymer having a first unit containing a phosphorylcholine group and a second unit having an active ester group as essential components, and a third unit having a butyl methacrylate group as an optional component (b) a first unit containing a phosphorylcholine group And a polymer having a third unit containing a butyl methacrylate group

  In this configuration, the ratio of the phosphorylcholine group contained in the polymer substance to the total of the phosphorylcholine group, the active ester group, and the butyl methacrylate group is, for example, 3 mol% or more, preferably 20 mol% or more, more preferably 25 mol. % Or more. If the ratio of the phosphorylcholine group is too small, non-specific adsorption of the physiologically active substance occurs, which may increase the background. The ratio of the phosphorylcholine group contained in the polymer substance to the total of the phosphorylcholine group, the active ester group, and the butyl methacrylate group is, for example, 40 mol% or less, preferably less than 40 mol%, more preferably 35 mol%. In the following, it can be more preferably less than 35 mol%. If the ratio of the phosphorylcholine group is too large, the water solubility of the mixed polymer becomes high, so that the surface layer may be peeled off.

  Moreover, the ratio with respect to the sum total of the phosphorylcholine group, an active ester group, and a butylmethacrylate group of the active ester group contained in a high molecular substance can be 1 mol% or more, for example. If the ratio of the active ester group is too small, there is a concern that the amount of the physiologically active substance immobilized is lowered and a sufficient signal cannot be obtained. Further, the ratio of the active ester group contained in the polymer substance to the total of the phosphorylcholine group, the active ester group, and the butyl methacrylate group can be, for example, 25 mol% or less, preferably 8 mol% or less. If the ratio of the active ester group is too large, there is a concern that the amount of the active ester group present on the outermost surface is saturated and the signal intensity is not improved.

  Further, in this embodiment, a first layer containing an organosiloxane is provided on the core particle, and a monomer having a phosphorylcholine group and a monomer having a carboxylic acid derivative group are formed on the first layer. It can be set as the structure provided with the 2nd layer containing a polymer. The organosiloxane constituting the first layer can be a compound having a group having a polymerizable double bond. A group having a polymerizable double bond may constitute an alkenyl group (olefin group). Further, at least part of the group having a polymerizable double bond may constitute an acrylate group, a methacrylate group, or a vinyl group. The first layer can have a compound having at least one group selected from acrylate groups, methacrylate groups, vinyl groups, or other alkenyl groups.

(Experimental example)
In the following experimental examples, samples containing proteins, nucleic acids, etc. are used as samples containing physiologically active substances, and supplementary substances used in performing these analyzes are immobilized on microparticles for the production of capture beads, and these detections are performed. went.

(Preparation of solutions)
DNA solution 1: Dissolve 24 bp oligo DNA having an amino group at the 5 ′ end (TAGAAGCATTTTGCGGGGAGATG (SEQ ID NO: 1) (manufactured by Sigma Genosys) in a predetermined buffer to a concentration of 5 μg / mL. Prepared.
DNA solution 2: 3 × SSC (standard saline citrate), 0.2% SDS with a 24 bp-length oligo DNA (CATCGTCCCACCGCAAAATGCTTCTA (SEQ ID NO: 2)) having a biotin label at the 5 ′ end to a concentration of 2 μg / mL Dissolved in a solution of (sodium dodecyl sulfate).

Antibody solution: An anti-mouse IgG2a antibody (rat-derived) was prepared by dissolving in PBS (phosphate buffered saline) at a concentration of 10 μg / mL.
Antigen solution 1: mouse IgG2a antibody was dissolved at 1 μg / mL in FBS (fetal bovine serum), 100 μL of FBS containing the mouse IgG2a antibody was added to 1 mL of pH 9.5 carbonate buffer, and 1 mg / mL was further added. 10 μL of a solution in which biotin introduced with NHS active ester at a concentration was dissolved in ultrapure water was added, left at 25 ° C. for 2 hours, unreacted NHS-biotin was removed by gel filtration column, and in mouse IgG2a and FBS Biotin was introduced into the protein. Biotin-introduced protein was dissolved in PBS to make antigen solution 1.
Antigen solution 2: In the preparation of the antigen solution 1, FBS protein was labeled with biotin under the same conditions except for the mouse IgG2a antibody. The FBS protein introduced with biotin was dissolved in PBS to obtain an antigen solution 2.

POD (peroxidase) labeled avidin solution: Avidin labeled with POD was dissolved in PBS at 0.1 μg / mL to prepare.
Coloring substrate solution: TMBZ (3,3 ′, 5,5′-Tetramethylbenzidine) coloring reagent for ELISA (manufactured by Sumitomo Bakelite Co., Ltd.) was prepared by a predetermined method.
Blocking solution 1: Prepared by dissolving glycine at a concentration of 20 mM in a carbonate buffer of pH 9.5.
Blocking solution 2: Prepared by dissolving sodium borohydride in PBS at a concentration of 0.5% by weight.
Blocking solution 3: Prepared by dissolving BSA in PBS at a concentration of 1% by weight.

(Experimental example 1)
Commercially available polystyrene resin particles having a diameter of 40 μm were dispersed in a 0.5 wt% ethanol solution of 3-methacryloyloxyethylfosphorylcholine-butyl methacrylate-p-nitrophenylcarbonyloxyethyl methacrylate copolymer. After leaving this for 1 hour, the particles were collected by centrifugation. The collected particles were dispersed in pure water for washing. Then, the particles were collected again by centrifugation. Thus, microparticles for capture beads were obtained.

  Subsequently, the collected particles were dispersed in the DNA solution 1 and left for 1 hour. Thereafter, the particles were collected by centrifugation. Furthermore, after the recovered particles were washed with pure water, the particles were recovered by a centrifugal operation.

  And in order to inactivate the active ester group to which DNA is not fixed, the particles were dispersed in the blocking solution 1 and allowed to stand for 1 hour, and then the particles were collected by centrifugation. Subsequently, the collected particles were washed with pure water, and the particles were collected by centrifugation. The particles recovered as capture beads on which DNA was immobilized were used for evaluation by DNA hybridization described later.

(Experimental example 2)
Commercially available polystyrene resin particles having a diameter of 40 μm were dispersed in a 0.5 wt% ethanol solution of 3-methacryloyloxyethylfosphorylcholine-butyl methacrylate-p-nitrophenylcarbonyloxyethyl methacrylate copolymer. After leaving this for 1 hour, the particles were collected by centrifugation. The particles collected for washing were dispersed in pure water, and the particles were collected again by centrifugation. Thus, microparticles for capture beads were obtained.

  Subsequently, the collected particles were dispersed in the antibody solution and left for 1 hour. Thereafter, the particles were collected by centrifugation. Furthermore, after the recovered particles were washed with pure water, the particles were recovered by a centrifugal operation.

  In order to inactivate the active ester group to which the antibody is not immobilized, the particles were dispersed in the blocking solution 1 and left for 1 hour, and then the particles were collected by centrifugation. Subsequently, after the collected particles were washed with pure water, the particles were collected by centrifugation. The particles collected as capture beads with immobilized antibodies were used for evaluation by antigen-antibody reaction described later.

(Experimental example 3)
The surface of polystyrene resin particles having a diameter of 40 μm was hydrophilized, then dispersed in a 2% by weight aminoalkylsilane solution and allowed to stand for 1 hour. Then, pure water heat treatment was performed to introduce amino groups on the surface of the particles. The particles were dispersed in a 1% by weight glutaraldehyde aqueous solution and allowed to stand for 1 hour, whereby amino groups on the particle surface and glutaraldehyde were reacted to introduce aldehyde groups. The particles were collected by centrifugation. And after collect | recovering the collect | recovered particle | grains in a pure water and wash | cleaning, it collect | recovered by centrifugation operation again.

  Subsequently, the collected particles were dispersed in the DNA solution 1 and left for 1 hour. Thereafter, the particles were collected by centrifugation. Furthermore, after the recovered particles were washed with pure water, the particles were recovered by a centrifugal operation.

  And in order to inactivate the aldehyde group to which DNA is not fixed, the particles were dispersed in the blocking solution 2 and allowed to stand for 1 hour, and then the particles were collected by centrifugation. Subsequently, the collected particles were washed with pure water, and the particles were collected by centrifugation. The recovered particles were used for evaluation by DNA hybridization described later.

(Experimental example 4)
The surface of polystyrene resin particles having a diameter of 40 μm was hydrophilized, then dispersed in a 2% by weight aminoalkylsilane solution and allowed to stand for 1 hour. Then, pure water heat treatment was performed to introduce amino groups on the surface of the particles. The particles were dispersed in a 1% by weight glutaraldehyde aqueous solution and allowed to stand for 1 hour, whereby amino groups on the particle surface and glutaraldehyde were reacted to introduce aldehyde groups. The particles were collected by centrifugation. And after collect | recovering the collect | recovered particle | grains in a pure water and wash | cleaning, it collect | recovered by centrifugation operation again.

  Subsequently, the collected particles were dispersed in the antibody solution and left for 1 hour. Thereafter, the particles were collected by centrifugation. Furthermore, after the recovered particles were washed with pure water, the particles were recovered by a centrifugal operation.

  In order to inactivate the aldehyde group to which the antibody is not immobilized, the particles were dispersed in the blocking solution 2 and allowed to stand for 1 hour, and then the particles were collected by centrifugation. Subsequently, after the collected particles were washed with pure water, the particles were collected by centrifugation. Further, the collected particles were dispersed in the blocking solution 3 and left for 1 hour. After washing this with pure water, the particles were collected by centrifugation. The collected particles were subjected to evaluation by antigen-antibody reaction described later.

(Experimental example 5)
Polystyrene resin particles having a diameter of 40 μm were dispersed in the antibody solution and allowed to stand for 1 hour, and then the particles were collected by centrifugation. And after collect | recovering the collect | recovered particle | grains with a pure water, particle | grains were collect | recovered by centrifugation operation. Subsequently, the collected particles were dispersed in the blocking solution 3 and allowed to stand for 1 hour, washed with pure water, and then collected by centrifugation. The collected particles were subjected to evaluation by antigen-antibody reaction described later.

(Evaluation by DNA hybridization)
Evaluation was performed using the particles (capture beads) obtained in Experimental Example 1 and Experimental Example 3. For evaluation, an acrylic resin micro-channel chip having a channel having a width of 200 μm and a depth of 60 μm and provided with a blocking means for holding capture beads in the middle of the channel was used. A membrane filter having a pore diameter of 100 nm (0.1 μm) was used as a means for stopping the capture beads fixed to both sides and the bottom of the channel.

  First, the capture beads were dispersed in PBS. Then, a bead dispersion containing about 100 capture beads was injected into the channel from the injection hole of the microchannel chip. In Experimental Example 1, the capture beads did not adhere to the flow path, moved in the flow path, and stayed in the vicinity of the membrane filter as a cough. In Experimental Example 3, since adhesion was observed in the middle of the flow path during the injection of the capture bead dispersion, all beads were moved to the vicinity of the membrane filter by continuing to flow PBS at a speed of 5 μL / min for 10 minutes.

  Next, after the DNA solution 2 was fed into the flow path at a speed of 2 μL / min for 5 minutes, PBS (−) was fed at a speed of 5 μL / min for 10 minutes for washing. Then, after feeding the POD-labeled avidin solution at a speed of 2 μL / min for 5 minutes, PBS (−) was sent at a speed of 5 μL / min for 10 minutes for washing. Subsequently, the TMBZ solution was fed at a speed of 2 μL / min for 30 minutes, the solution flowing out from the discharge hole was collected in a sampling tube, and 60 μL of 2N sulfuric acid was added. The colored solution was transferred to a 96-well plate for ELISA, and the degree of color development of TMBZ was compared by absorbance measurement. The results are shown in Table 1.

(Evaluation by antigen-antibody reaction)
Evaluation was performed using Experimental Example 2, Experimental Example 4, and Experimental Example 5. For the evaluation, an acrylic microchannel chip having a channel having a width of 200 μm and a depth of 60 μm and having a blocking means for holding the capture beads in the middle of the channel was prepared and used. A membrane filter having a pore diameter of 100 nm (0.1 μm) was used as a means for stopping the capture beads fixed to both sides and the bottom of the channel.

  First, the capture beads were dispersed in PBS. Moreover, the blocking solution 3 was sent in the flow path, and the blocking process in a flow path was performed. A bead dispersion containing about 100 capture beads was injected into the channel from the injection hole of the fine channel chip that had been subjected to the blocking treatment. In Experimental Example 2, the capture beads did not adhere to the flow path, moved in the flow path, and stayed in the vicinity of the membrane filter as a cough. In Experimental Example 4 and Experimental Example 5, adhesion was observed in the middle of the flow path during the injection of the bead dispersion liquid. By continuing to flow PBS at a speed of 5 μL / min for 10 minutes, all beads were moved to the vicinity of the membrane filter. It was.

  Next, after the antigen solution 1 or 2 was fed at a speed of 2 μL / min for 5 minutes, PBS (−) was fed at a speed of 5 μL / min for 10 minutes for washing. Then, after feeding the POD-labeled avidin solution at a speed of 2 μL / min for 5 minutes, PBS (−) was sent at a speed of 5 μL / min for 10 minutes for washing. Subsequently, the TMBZ solution was fed at a speed of 2 μL / min for 30 minutes, the solution flowing out from the discharge hole was collected in a sampling tube, and 60 μL of 2N sulfuric acid was added. The colored solution was transferred to a 96-well plate for ELISA, and the absorbance was measured for the degree of color development of TMBZ. The results are shown in Table 2.

  A microchip was manufactured in the same manner with the capture beads having a particle size of about 0.2 μm. Then, when a plurality of microchips were manufactured, particles may pass through the pores of the membrane filter, and the manufacturing yield of microchips was lower than in the case of the above experimental example. Further, when glass beads were used instead of polystyrene resin particles as the core particles, the same tendency as above was recognized.

  The capture beads of the present invention have high dispersion stability and fluidity, and are easy to handle in a flow path and use in combination with a cell sorter. Moreover, highly sensitive detection is possible in the detection of a physiologically active substance.

It is a top view which shows the structure of the biochip which concerns on embodiment.

Explanation of symbols

100 Biochip 101 Substrate 103 Introduction hole 105 Discharge hole 107 Groove 109 Filter 111 Capture beads

Claims (23)

A microparticle on which a capture substance for capturing a physiologically active substance is immobilized and used as a carrier for capture beads,
A polymer substance containing a first monomer having a phosphorylcholine group and a second monomer having a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group is coated on the surface. Microparticles for capture beads, characterized in that The microparticle for capture beads according to claim 1,
The microparticle for capture beads, wherein the carboxylic acid derivative group is an active ester group having an electron-withdrawing substituent on the alcohol side of the ester group.   The microparticle for capture beads according to claim 2, wherein the ester group is a p-nitrophenyl ester group or an N-hydroxysuccinimide ester group. A microparticle on which a capture substance for capturing a physiologically active substance is immobilized and used as a carrier for capture beads,
A polymer material containing a first monomer having a phosphorylcholine group and a second monomer having a monovalent group represented by the following formula (1) is coated on the surface. Microparticles for capture beads.
-COA (1)
(In the above formula (1), A is a monovalent leaving group excluding a hydroxyl group and an alkoxyl group.) The microparticle for capture beads according to claim 4, wherein the monovalent group represented by the formula (1) is any group selected from the following formula (p) or the formula (q). Microparticles for capture beads.
-COOCR ¹ (p)
-COONR ² (q)
(However, in the above formulas (p) and (q), R ¹ and R ² are each independently a monovalent organic group, which may be linear, branched, or cyclic. In Formula (p), R ¹ may be a divalent group that forms a ring with C. In Formula (q), R ² is a divalent group that forms a ring with N. It may be a group of   The microparticle for capture beads according to any one of claims 1 to 5, wherein the microparticles have a spherical shape with a diameter of 10 µm to 500 µm. The microparticle for capture beads according to any one of claims 1 to 6, wherein the first monomer containing a phosphorylcholine group has a 2-methacryloyloxyethyl phosphorylcholine group.   The microparticle for capture beads according to any one of claims 1 to 7, wherein the polymer substance further contains a butyl methacrylate group.   In the microparticle for capture beads according to any one of claims 1 to 8,
  The first monomer has a 2-methacryloyloxyethyl phosphorylcholine group;
  The second monomer has a p-nitrophenylcarbonyloxyethyl methacrylate group;
  The microparticle for capture beads, wherein the polymer substance is a copolymer of the first monomer, the second monomer, and a third monomer having a butyl metallate group .   The microparticle for capture beads according to claim 8 or 9,
  The ratio of the phosphorylcholine group contained in the polymer substance to the total of the phosphorylcholine group, the active ester group, and the butyl methacrylate group is 3 mol% or more and 40 mol% or less,
  The trapping characterized in that the ratio of the active ester group contained in the polymer substance to the total of the phosphorylcholine group, the active ester group, and the butyl methacrylate group is 1 mol% or more and 25 mol% or less. Microparticle for beads. In the microparticle for capture beads according to any one of claims 1 to 10,
  A first layer containing an organosiloxane is provided on the core particle, and a second layer containing the polymer substance is provided on the first layer.
  The microparticle for capture beads, wherein the polymer substance is a copolymer containing the first monomer and the second monomer. The microparticle for capture beads according to any one of claims 1 to 11, comprising core particles made of a plastic material. The microparticle for capture beads according to any one of claims 1 to 11, comprising core particles made of a glass material. A capture substance that captures a physiologically active substance on the particle surface is immobilized, and is a capture bead used for processing the physiologically active substance in a test solution,
A capture bead, wherein the carboxylic acid derivative group of the microparticle for capture beads according to any one of claims 1 to 3 reacts with the capture substance to form a covalent bond. In capture bead according to claim 1 4, comprising a plurality of the carboxylic acid derivative group, the plurality of carboxylic acid derivative groups, or form a covalent bond by reacting with the capture substance, or inactivated A capture bead characterized in that A capture substance that captures a physiologically active substance on the particle surface is immobilized, and is a capture bead used for processing the physiologically active substance in a test solution,
The capture | acquisition characterized by the monovalent group shown by the said Formula (1) of the microparticle for capture beads of Claim 4 or 5 reacting with the said capture | acquisition substance, and forming the covalent bond beads. The capture bead according to claim 16 , wherein the capture beads have a plurality of monovalent groups represented by the formula (1), and the monovalent groups represented by the plurality of formulas (1) react with the capture substance. A capture bead characterized in that a covalent bond is formed or inactivated. In capture beads according to any of claims 1 4 to 1 7, the capture beads wherein capture bead micro particles, characterized in that it is a 500μm or less spherical or diameter 10 [mu] m. In capture beads according to any of claims 1 4 to 1 8, capture bead, wherein the first monomer containing phosphorylcholine groups have 2-methacryloyloxyethyl phosphorylcholine group. In capture beads according to any of claims 1 4 to 1 9, wherein the capture substance is a nucleic acid, an aptamer, a protein, enzyme, antibody, oligopeptide, one or more selected from the group consisting of sugar chains and glycoproteins A capture bead characterized in that In capture beads according to any of claims 1 4 to 20, wherein the physiologically active substance is a nucleic acid, an aptamer, a protein, enzyme, antibody, oligopeptide, one or more selected from the group consisting of sugar chains and glycoproteins A capture bead characterized in that A flow path;
Capture beads provided in the flow path;
Hints, biochip, wherein the capture beads are capturing beads according to any one of claims 1 4 to 21. The biochip according to claim 22 ,
The flow path is provided in the substrate;
A biochip, wherein a crest for restricting permeation of the capture beads is provided in the flow path.

Images