JP4110159B2 - A method for predicting the effectiveness of interferon therapy in an individual to be administered interferon, a program for executing the method by a computer, a nucleic acid probe for detecting the genotype of a polymorphic site related to interferon sensitivity, and Base sequence detection chip comprising a nucleic acid probe - Google Patents

Description

  The present invention relates to a method for predicting the effectiveness of interferon therapy in an individual to be administered interferon, particularly a person infected with hepatitis C virus, a program for causing a computer to execute the method, and a polymorphism related to interferon sensitivity. The present invention relates to a polynucleotide and a fragment thereof, and a base sequence detection chip comprising the polynucleotide or fragment.

  There are 2 million HCV-infected people in Japan. When infected with hepatitis C virus (hereinafter referred to as HCV), nearly 70% of people develop chronic hepatitis, some of which are thought to develop liver cancer after 10 to 20 years. Interferon (hereinafter referred to as IFN) is effective for the treatment of chronic hepatitis. However, on the other hand, since the effect of IFN is greatly influenced by factors on the host and virus side, taking into account the side effects of IFN and its expensive treatment costs, it is not recommended to administer IFN to patients who cannot expect the effect. Not only will it bother you, but it will waste a lot of medical expenses for both patients and the country. Therefore, it is significant to diagnose in advance how much the IFN treatment effect can be expected for each individual patient.

  As factors affecting the therapeutic effect of IFN on HCV-infected patients, viral factors and patient factors are known.

  As a factor on the virus side, it is known that patients with a larger amount of virus in the blood have a lower effect of IFN, and the therapeutic effect varies depending on the type of virus the patient is infected with (A Tsubota et al., Hepatology 19, 1088-1094, 1994). The amount of virus in the blood is quantified by polymerase chain reaction (hereinafter referred to as PCR) after changing HCV to cDNA once. Virus typing is performed by amplifying the sequence of the NS5 region by PCR and determining its base sequence.

  On the other hand, the therapeutic effect of IFN varies depending on factors on the host side. For example, depending on the two SNP types of the mannose-binding lectin (MBL) gene (M. Matsushita et al., J. Hepatology, 29; 695-700, 1998), the SNPs present in the promoter region of the MxA gene It is known that the therapeutic effect of IFN depends on the type of (M.Hijikata et al., Intervirology, 43; 124-127, 2000). For example, it has been reported that the therapeutic effect increases in the order of patients whose SNP genotypes are G / G, G / T, and T / T (M. Hijikata, Y. Ohta and S. Mishiro, Intervirology 43 , 124-127, 2000). In addition, it is known that patients whose two SNPs of the MBL gene encoding mannose-binding lectin are XB type haplotypes are less effective in IFN than patients who are YA type haplotypes (M. Matsushita et al., J. Hepatology 29, 695-700, 1998). These SNPs are determined by amplifying a DNA fragment containing the SNP by PCR and determining its base sequence.

  However, even with data such as the above-described virus types, MxA and MBL SNPs, the conventional methods have not yet sufficiently predicted the effect of IFN clinically.

  Accordingly, an object of the present invention is to provide a method for predicting the degree of therapeutic effect of IFN in an individual to be administered interferon, particularly an HCV-infected person, that is, the effectiveness of IFN therapy more accurately than before. is there.

In order to achieve the above-mentioned object, the present inventors have conducted intensive research and found the following means. That is,
A method for predicting the effectiveness of interferon therapy in an individual to be administered interferon, comprising:
(1) obtaining a sample derived from the individual,
(2) For the sample in (1), determine the following types in random order;
(A) determining the MxA-8 and / or MxA-123 genotype of said individual;
(B) determining the genotype of codon 54 of the collagen-like domain of MBL-221 and MBL of said individual;
(3) Predicting the effectiveness of interferon therapy from the type determined in (2),
Is a method for predicting the effectiveness of interferon therapy in an individual to be administered interferon.

  To date, the present inventors have found that in the patients with hepatitis C, at the site of an interferon (hereinafter referred to as IFN) susceptibility-related polymorphism contained in two types of patients' genes (ie, MBL and MxA). It is based on the discovery that patients with low IFN therapeutic effect and patients with high therapeutic effect can be predicted with higher accuracy than before by determining the genotype and the state of allelic conjugation.

  That is, according to the present invention, (1) the genotype of the MBL polymorphism is the XB type and the genotype of MxA-88 is G / G homozygous and / or the genotype of MxA-123 is C / C homozygous. When conjugated, patients with hepatitis C are very likely to be IFN resistant; (2) MBL polymorphism genotype is YA type and MxA-88 genotype is G / T heterozygous Hepatitis C patients are more likely to be IFN susceptible if they are conjugative or T / T homozygous and / or the MxA-123 genotype is C / A heterozygous or A / A homozygous; A method for predicting the effectiveness of IFN therapy for patients with hepatitis C based on the above knowledge is provided.

  In general, the therapeutic effect of IFN varies depending on the type of virus (hereinafter also referred to as type). That is, patients infected with type 1 hepatitis C virus (hereinafter referred to as HCV) are generally less effective with IFN therapy, and patients infected with type 2 HCV are generally less effective with IFN therapy. high. Therefore, according to the present invention, the genotype of the susceptibility-related polymorphism of the patient is determined, and based on this, a patient who is likely to be effective for IFN therapy even if it is a type 1 HCV-infected person is detected. And a method for predicting the efficacy of IFN therapy in hepatitis C patients to detect patients who are likely to be ineffective for IFN therapy among type 2 HCV infected individuals.

  In the present specification, the term “interferon” is used as a word indicating interferon α, β, γ and / or ω.

  As used herein, “IFN sensitivity-related polymorphism” refers to a polymorphic gene that affects the effectiveness of IFN.

  Here, “polymorphic gene” or “polymorphism” refers to a plurality of allele groups occupying one locus, or individual alleles belonging to such allele groups. A polymorphic site that differs by only one base is specifically referred to as “Single Nucleotide Polymorphism” (hereinafter referred to as SNP).

  The term “genotype” as used herein indicates the presence state of the allele at the locus of interest. Moreover, the term “MBL genotype” collectively represents the genotypes of a plurality of IFN sensitivity-related polymorphisms contained in the MBL gene. For example, YA and XB. Similarly, the term “MxA (polymorphic) genotype” generically represents the genotype of multiple IFN susceptibility related polymorphisms contained in the MxA gene. For example, G / GC / C and T / TA / A.

I. Each IFN sensitivity-related polymorphism and the effect of IFN Effect of MxA gene and IFN MxA protein is an interferon-dependent protein found in mice resistant to influenza virus, and has also been found in humans. MxA protein has also been reported that the expression level of MxA mRNA and MxA protein in a person infected with hepatitis C virus (hereinafter referred to as HCV) is related to the response of the infected person to interferon therapy. For example, when human cells respond to IFN, synthesis of MxA protein increases, and single nucleotide polymorphism (hereinafter referred to as SNP) present in the promoter region of MxA gene is effective in treating IFN. It is known to have an impact.

  As shown in FIG. 1, the polymorphism of MxA that affects the effect of IFN is SNP, and positions −88 (hereinafter referred to as MxA-88 or MxA (−88)) and −123 in the promoter region of MxA. (Hereinafter referred to as MxA-123 or MxA (-123)) (FIG. 1).

  These notations “−88” and “−123” are positions where the transcription start site of the MxA gene is +1. Regions other than these SNP sites and other polymorphisms not related to IFN sensitivity are common to each sequence. In each sequence described in the sequence listing of the present specification, other polymorphic sites are indicated mainly by the notation “N” or “n” representing an arbitrary base. However, “N” and “n” are also used to represent any base in the polymorphic site associated with the IFN sensitivity. “N” and “n” represent any base of adenine, thymine, guanine or cytosine.

  As shown in FIG. 1, the base that can be taken by the genotype of MxA-88 is guanine (hereinafter referred to as G) or thymine (hereinafter referred to as T), and the base that can be taken of the genotype of MxA-123 is cytosine ( Hereinafter referred to as C) or adenine (hereinafter referred to as A).

  Polynucleotides encompassing the promoter region of the human MxA gene including MxA-88 and MxA-123 are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, And shown in SEQ ID NO: 8.

  SNP sites associated with IFN sensitivity are present at positions 455 and 420 in SEQ ID NO: 1 to SEQ ID NO: 8. This portion corresponds to the −88th position and the −123rd position, respectively, according to the usual notation where the transcription start site is +1. Therefore, hereinafter, position 455 of SEQ ID NO: 1 to SEQ ID NO: 8 is referred to as “MxA-88” and position 420 of SEQ ID NO: 1 to SEQ ID NO: 8 is referred to as “MxA-123” throughout this specification.

  Interferon-stimulated response elements (hereinafter referred to as ISRE) are present at positions 441 to 456 of each polynucleotide. Here, “ISRE” means a base sequence consisting of about 12 to 15 nucleotides present in the transcriptional regulatory region of a gene induced by stimulation of interferon α, β, γ, or ω.

  The base sequence of ISRE at positions 441 to 456 of SEQ ID NO: 1 is “GGTTTCGTTTCTGCTC” (SEQ ID NO: 9). The 15th ISRE corresponds to MxA-88 and is T.

  The base sequence of ISRE at positions 441 to 456 of SEQ ID NO: 2 is “GGTTTCGTTTCTGCGC” (SEQ ID NO: 10), and the 15th ISRE corresponds to MxA-88 and is G.

  The base sequence of ISRE at positions 441 to 456 of SEQ ID NO: 3 is “GGTTTCGTTTCTGCAC” (SEQ ID NO: 11). The 15th ISRE corresponds to MxA-88 and is A.

  The base sequence of ISRE at positions 441 to 456 of SEQ ID NO: 4 is “GGTTTCGTTTCTGCCC” (SEQ ID NO: 12), and the 15th ISRE corresponds to MxA-88 and is C.

  The relationship between the SNP genotype and IFN sensitivity will be described below.

  Those infected with HCV having a sequence (SEQ ID NO: 9) in which the 15th nucleotide of these ISREs (ie, MxA-88) is thymine is effective against interferon therapy, whereas the 15th nucleotide is thymine. Interferon therapy is not effective for HCV-infected persons who do not have a certain sequence (SEQ ID NO: 9).

  That is, an infected person having a genotype of MxA-88 with a T / T homozygote (hereinafter referred to as T / T homozygote or simply abbreviated as T / T) or a G / T heterozygote (hereinafter referred to as a G / T heterozygote, or IFN therapy is more effective for an infected person having G / T homozygote (hereinafter simply referred to as G / G homozygote or simply abbreviated as G / G).

  In addition, a nucleotide fragment in which the genotype of MxA-123 is adenine is A / A homozygous (hereinafter referred to as A / A homozygous or A / A) or C / A heterozygous (hereinafter referred to as C / A heterozygous or C / A heterozygous). HCV-infected individuals with A) are likely to be effective in interferon therapy, whereas MxA-123 genotype is cytosine homozygote (ie, C / C homozygote, hereinafter C Interferon therapy is unlikely to be effective for those with HCV infection (denoted as / C homo or C / C).

2. Effect of MBL gene and IFN The effect of IFN in patients with hepatitis C is also affected by the genotype at the polymorphic site of the MBL gene. As shown in FIG. 2, the polymorphic site that affects the effect of IFN is a single nucleotide polymorphism (hereinafter referred to as SNP), and position -221 (hereinafter referred to as MBL-) of the promoter region of the MBL gene. 221) are present at codons 52, 54 and 57 of exon 1 of the MBL gene (FIG. 2).

  This notation “−221” is a position when the transcription start site of the MBL gene is +1. Regions other than these SNP sites and other polymorphisms not related to IFN sensitivity are common to each sequence. In each of the sequences described in the sequence listing of the present specification, other polymorphic sites are indicated mainly by the notation “n” representing an arbitrary base. However, “n” is also used to represent any base of the polymorphic site associated with the IFN sensitivity.

  The MBL gene containing MBL-221 and codons 52, 54 and 57 is represented by SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37. SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44. MBL-221 is a SNP present at position 425 of these polynucleotides. This SNP site is at position -221 according to the usual notation where the transcription start site is +1. Therefore, hereinafter, position 425 of SEQ ID NO: 1 to SEQ ID NO: 8 will be referred to as “MBL-221” throughout this specification.

  Exon 1 starts from position 646 of these polynucleotides, codon 52 is located from positions 868 to 870, codon 54 is located from positions 874 to 876, and codon 57 is located from positions 883 to 885. The SNP at codon 52 is at position 868, the SNP at codon 54 is at position 875, and the SNP at codon 57 is at position 884. These SNP sites correspond to positions 868, 875, and 884, respectively, according to the normal notation where the transcription start site is +1.

  As shown in FIG. 2, the bases that can be taken by the genotype of MBL-221 are C or G. In the case of C, it is referred to as type X, and in the case of G, it is referred to as type Y. Madsen HO, Garred P, Thiel S, Kurtzhals JAL, Lamm LU, Ryder LP, et al. “The interaction between the promoter and the structural gene controls the lowest serum level of human mannan-binding protein.” J Immuol 1995; 155: 3013-20).

  Codons 52, 54 and 57 of exon 1 of the MBL gene are present in the collagen-like domain, which is a structural gene. As shown in FIG. 2, the possible genotypes of codon 52 are CGT or TGT. According to the classification of Madsen et al., The former is type A and the latter is type D (FIG. 2) (Madsen et al., Supra). Similarly, the genotype that can be taken by codon 54 is GGC or GAC. According to the same classification, the former is type A and the latter is type B (FIG. 2) (Madsen et al., Supra). The genotype that can be taken by codon 57 is GGA or GAA. According to the same classification, the former is type A and the latter is type C (FIG. 2) (Madsen et al., Supra). In all these codons, type A is a wild type allele and the other types B, C and D are mutant alleles. If alleles at codons 52, 54 and 57 are all type A, the effect of IFN is higher than in the other case, i.e. at least any allele is not type A.

  In the case of a YA-YA homozygous patient in which the above MBL-221 is type Y and the alleles of codons 52, 54 and 57 are type A, the effect of IFN is obtained compared to other types of patients. It is easy to be done. Also, in the case where the above-mentioned MBL-221 is type Y and any of the alleles of codons 52, 54 and 57 is not type A, that is, a patient who is YnonA-YA heterozygous or YnonA-YnonA homozygous Therefore, it is difficult to obtain the effect of IFN as compared with YA-YA homozygous patients.

  Moreover, in Japanese, a variant of a collagen-like domain often exists at codon 54. Therefore, in the case of Japanese, only the SNP included in codon 54 may be determined. On the other hand, races other than Japanese may have mutant alleles at SNPs at codons 52 and 57 rather than codon 54 in the collagen-like domain. In that case, the genotype of codons 52 and / or 57 may be determined. Further, the genotypes of codons 52, 54 and 57 may be detected at the same time regardless of race.

II. Method for predicting effectiveness of interferon therapy from patient genotype Prediction of IFN resistance in hepatitis C patients According to the present invention, the results obtained by determining the genotypes of polymorphisms contained in the MBL and MxA genes of the patient are analyzed by an original method, and the conventional prediction It is possible to obtain a coincidence rate that is significantly higher than the actual coincidence rate. Specifically, a patient whose MBL is XB type and MxA-88 is G / G homo or MxA-123 is C / C homo, and MBL is XB type and MxA-88 is G Patients with / G homology and MxA-123 C / C homology are very likely to be IFN resistant. Therefore, it may be desirable to refrain from IFN treatment for such patients.

(1) Comparison between predicted values of the present invention and conventional predicted values The findings regarding conventionally known IFN resistance of hepatitis C patients are as follows:
(A) In the MBL gene polymorphism, the XB type is involved in IFN resistance;
(B) In the SNP at position -88 of the MxA promoter, G / G homo is involved in IFN resistance;
(C) In the SNP at position −123 of the MxA pronoter, C / C homo is involved in IFN resistance.

  We compared the case where IFN resistance was predicted by the above conventional method and the actual therapeutic effect (details are described in Examples).

  As a result, regarding (a), there were 85 hepatitis C patients who showed XB type, which is a genotype predicting IFN resistance, but IFN treatment was actually ineffective among them. There were 65 people. Therefore, the coincidence rate between the predicted value and the actual value was 76%.

  Regarding (b) above, there were 75 hepatitis C patients who showed G / G homozygous genotypes that predict IFN resistance, of which 59 were actually ineffective with IFN treatment. It was a name. Therefore, the concordance rate between the predicted value and the actual value was 79%.

  Regarding (c), there were 91 patients with hepatitis C who showed C / C homozygos, a genotype that predicts IFN resistance, but IFN treatment was actually ineffective for 70 of them. It was a name. Therefore, the coincidence rate between the predicted value and the actual value was 77%.

(2) This invention On the other hand, the result of having predicted IFN resistance according to this invention is shown below. That is, there were 39 hepatitis C patients whose MBL was XB type, MxA-88 was G / G homo, and MxA-123 was C / C homo. Of those, 32 were actually ineffective with IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 87%. Surprisingly, when the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

  The results of predicting IFN resistance according to the present invention are shown below. That is, there were 39 hepatitis C patients in which MBL was XB type and MxA-88 was G / G homo. Of those, 34 were actually ineffective with IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 87%. Surprisingly, when the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

  The results of predicting IFN resistance according to the present invention are shown below. That is, there were 44 patients with hepatitis C in which MBL was XB type and MxA-123 was C / C homo. Of those, 39 were actually ineffective with IFN treatment. Therefore, the concordance rate between the predicted value and the actual value was 89%. Surprisingly, when the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

2. Prediction of IFN susceptibility of patients with hepatitis C According to the present invention, by analyzing the results obtained by determining genotypes of polymorphisms contained in the MBL and MxA genes of patients by an original method, It is possible to obtain a coincidence rate that is significantly higher than the actual coincidence rate. Specifically, patients with MBL of YA type and MxA-88 is G / T heterozygous or T / T homo and / or MxA-123 is C / A heterozygous or A / A homozygous are susceptible to IFN Is likely.

(1) Comparison between predicted values of the present invention and conventional predicted values The findings regarding conventionally known IFN resistance of hepatitis C patients are as follows:
(A) YA type is involved in IFN susceptibility in the genetic polymorphism of MBL;
(B) In the SNP at position -88 of the MxA promoter, G / T heterozygous or T / T homozygous is involved in IFN susceptibility;
(C) In the SNP at position −123 of the MxA pronoter, C / A hetero or A / A homo is involved in IFN susceptibility.

    We compared the case where IFN resistance was predicted by the above conventional method and the actual therapeutic effect (details are described in Examples).

  As a result, regarding (a), there were 74 hepatitis C patients who showed YA type, which is a genotype that predicts IFN susceptibility, but IFN treatment was actually effective among them. There were 32 people. Therefore, the coincidence rate between the predicted value and the actual value was 43%.

  Regarding (b) above, there were 84 hepatitis C patients who showed G / T heterozygous or T / T homozygous genotypes predicting IFN susceptibility, but IFN treatment was actually effective There were 36 of them. Therefore, the coincidence rate between the predicted value and the actual value was 43%.

  Regarding (c), there were 68 hepatitis C patients who showed C / A heterozygous or A / A homozygous genotype predicting IFN susceptibility, but IFN treatment was actually effective There were 31 of them. Therefore, the agreement rate between the predicted value and the actual value was 46%.

(2) This invention On the other hand, the result of having predicted IFN sensitivity according to this invention is shown below. That is, there are 27 hepatitis C patients whose MBL is YA type, MxA-88 is G / T heterozygous or T / T homozygous, and MxA-123 is C / A heterozygous or A / A homozygous. there were. Of those, 16 were actually effective in IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 59%. Surprisingly, when the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

  On the other hand, the results of predicting IFN susceptibility according to the present invention are shown below. That is, there were 38 hepatitis C patients whose MBL was YA type and MxA-88 was G / T heterozygous or T / T homozygous. Of those, 21 were actually effective at IFN treatment. Therefore, the concordance rate between the predicted value and the actual value was 55%. Surprisingly, when the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

  On the other hand, the results of predicting IFN susceptibility according to the present invention are shown below. That is, there were 27 hepatitis C patients whose MBL was YA type and MxA-123 was C / A hetero or A / A homo. Of those, 16 were actually effective in IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 59%. Surprisingly, when the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

3. Method for predicting the effectiveness of interferon therapy According to the present invention, prior to the implementation of interferon therapy, in an individual to be administered interferon, in particular an HCV-infected person, by determining the genotype of the SNP, It is possible to predict whether interferon therapy is effective for HCV-infected persons.

According to the present invention, a method for predicting the effectiveness of interferon therapy in an HCV infected person comprising:
(1) obtaining a sample derived from the infected person,
(2) For the sample in (1), determine the following types in random order;
(A) determining the genotype of MxA-88 and / or MxA-123 of the infected person;
(B) determining the genotype of codon 54 of the collagen-like domain of MBL-221 and MBL of said infected person;
(3) Predicting the effectiveness of interferon therapy from the type determined in (2),
A method is provided for predicting the effectiveness of interferon therapy in HCV-infected individuals comprising:

  Prediction is possible if at least one of the MxA-88 and MxA-123 genotypes of the infected person is determined, but more preferably, the prediction accuracy is better when both genotypes are determined and predicted. Higher and desirable.

  According to the present invention, the MBL genotype is XB, the MxA-88 genotype is G / G, and the MxA-123 genotype is C / C, or the MBL When the genotype is XB and the MxA-88 genotype is G / G, or when the MBL genotype is XB and the MxA-123 genotype is C / C In addition, a method is provided for predicting the effectiveness of interferon therapy in HCV-infected individuals who are predicted to be very unlikely to benefit from IFN therapy.

  And a method for predicting the effectiveness of interferon therapy in an HCV-infected person, wherein the MBL genotype is YA, and the MxA-88 genotype is G / T or T / T, and When the genotype of MxA-123 is C / A or A / A, the genotype of MBL is YA, and when the genotype of MxA-88 is G / T or T / T, the MBL Interferon therapy in HCV-infected individuals who are predicted to be very likely to be effective if the genotype of YA is YA and the genotype of MxA-123 is C / A or A / A A method is provided to predict the effectiveness of.

Furthermore, since the indication of interferon therapy is not limited to hepatitis C, according to the present invention, a method for predicting the effectiveness of interferon therapy in an individual to be administered interferon, comprising:
(1) obtaining a sample derived from the individual,
(2) For the sample in (1), determine the following types in random order;
(A) determining the MxA-88 and / or MxA-123 genotype of the individual;
(B) determining the genotype of codon 54 of the collagen-like domain of MBL-221 and MBL of said individual;
(3) Predicting the effectiveness of interferon therapy from the type determined in (2),
A method for predicting the effectiveness of interferon therapy in an individual to be administered interferon comprising:

  The individual to which the method is to be applied may be a patient suffering from a disease for which interferon therapy is effective, preferably a disease for which interferon α, β or ω is effective. The individual may be a healthy person. In addition to hepatitis C, diseases in which interferon α, β or ω is effective include glioblastoma, medulloblastoma, astrocytoma, cutaneous malignant melanoma, hepatitis B, renal cancer, multiple myeloma, Hairy cell leukemia, chronic myelogenous leukemia, subacute sclerosing panencephalitis, viral encephalitis, systemic herpes zoster and chickenpox in immunosuppressed patients, nasopharyngeal undifferentiated cancer, viral inner ear infection with hearing loss, herpes cornea Inflammation, flattened condyroma, conjunctivitis caused by adenovirus and herpes virus infection, genital herpes, cold sores, cervical cancer, cancerous pleural effusion, keratophyte cell carcinoma, basal cell carcinoma, type δ chronic active hepatitis Including, but not limited to.

  One embodiment of the present invention will be described with reference to FIG. The following operations are all performed by the practitioner.

  In step 3a, the practitioner collects a sample such as a blood sample from the individual to be administered interferon, and starts prediction. The collected sample is subjected to treatment such as purification and extraction as necessary, and then the MBL and MxA genotypes are determined. Specifically, at least one genotype of MxA-88 and MxA-123, the genotype of MBL-221, and the genotype of codon 54 of the collagen-like domain of MBL are determined in any order, and the process proceeds to step 3b.

  In step 3b, based on the MBL and MxA genotypes determined in step 3a, IFN sensitivity is determined as to whether the individual is IFN resistant or IFN susceptible, and the process proceeds to step 3c. This determination can be made by setting a genotype as an index for determining IFN sensitivity in advance. The genotypes that serve as such indicators are as shown in Table 1. That is, when MBL is XB type, or MxA-88 is G / G, or MxA-123 is C / C, it is IFN resistant, and MBL is YA type, or MxA-88. Is G / T or T / T, or MxA-123 is C / A or A / A, it is IFN susceptible. For example, when such an index is MBL, the sensitivity is determined depending on whether the MBL genotype of the individual is XB or YA. Or you may determine according to the table which matched the genotype and IFN sensitivity, for example, the table 1 shown as a table in Table 1.

  In step 3c, if the IFN sensitivity determined in step 3b is resistance, it is determined to proceed to step 3d, and if it is easy sensitivity, it is determined to proceed to step 3g.

  In step 3d, the combination of MBL and MxA genotypes determined in step 3a is XB and G / G (MxA-88), XB and C / C (MxA-123), or XB and G / G (MxA- 88) and C / C (MxA-123), it is determined that the process proceeds to Step 3e, and otherwise, it is determined that the process proceeds to Step 3f. In this specification, XB and G / G (MxA-88) are "XB-G / G", XB and C / C (MxA-123) are "XB-C / C", XB and G / G G (MxA-88) and C / C (MxA-123) are referred to as “XB-G / GC / C”.

  In step 3e, it is predicted from the result of the determination in step 3d that the possibility that the IFN therapy in the individual is effective is very low, and the entire prediction process is terminated.

  In Step 3f, it is predicted from the result of the determination in Step 3d that the possibility that the IFN therapy in the individual is effective is low, and the entire prediction process is terminated.

  In step 3g, the combination of MBL and MxA genotype determined in step 3a is “not containing XB or G / G” (ie, YA-G / T or YA-T / T), “XB or C / C Does not contain "(ie YA-C / A, YA-AA) or" does not contain XB or G / G or C / C "(ie YA-G / TC-A, YA-G / T -A / A, YA-T / TC-A, YA-T / TA-A / A), it is determined to proceed to step 3h. Otherwise, step 3i is determined. Determine to proceed to.

  In step 3h, it is predicted from the result of the determination in step 3d that the possibility that the IFN therapy is effective in the individual is very high, and the entire prediction process is terminated.

In step 3i, it is predicted from the result of the determination in step 3d that there is a high possibility that the IFN therapy is effective in the individual, and the entire prediction process is terminated.

  Another embodiment of the present invention will be described with reference to FIG. The following operations are all performed by the practitioner.

  In step 4a, the practitioner collects a sample such as a blood sample from the individual to be administered interferon, and starts prediction. The collected sample is subjected to treatment such as purification and extraction as necessary, and then the MBL and MxA genotypes are determined. Specifically, the genotypes of MxA-88 and MxA-123, the genotype of MBL-221, and the genotype of codon 54 of the collagen-like domain of MBL are determined in any order, and the process proceeds to step 4b.

  In step 4b, based on the genotypes of MBL and MxA determined in step 4a, the table 1 in which the genotypes and IFN sensitivities are associated is searched to extract the corresponding IFN susceptibility. It is determined whether there is an IFN sensitivity or not, and the process proceeds to Step 4c. Alternatively, this determination may be performed by determining a genotype that serves as an index for determining IFN sensitivity in advance. For example, when such an index is MBL, the sensitivity is determined depending on whether the MBL genotype of the individual is XB or YA.

  In step 4c, if the IFN sensitivity determined in step 4b is resistance, it is determined to proceed to step 4d, and if it is easy sensitivity, it is determined to proceed to step 4e.

  In step 4d, based on the genotypes of MBL and MxA determined in step 4a, the table 2 in which the genotype and the effect of IFN are associated is searched to extract the corresponding IFN effect, thereby the effectiveness of the IFN therapy Predict the sex and finish the whole prediction process.

In step 4e, based on the genotypes of MBL and MxA determined in step 4a, the corresponding IFN effect is extracted according to Table 2, and the effectiveness of IFN therapy is predicted from the result. This completes the prediction.

  The table used here is information associating genotypes with IFN sensitivity or IFN effects. Each table is a table corresponding to each table number. Each table used in the above method is given as an example. Moreover, the table and table used here should just be what matched each genotype and the effect of IFN. For example, Table 2 is a table showing the relationship between the genotype of IFN resistance and the effect of IFN. The table to be used may be a table including only any one of the components, or may be a table including other combinations of components. In the above example, Table 2 is used as the table referred to in Step 4d and Step 4e. However, two tables prepared by selecting necessary items in advance for each step may be used. Good. Or the table | surface which consists of a component of another combination may be sufficient. For example, in the selection of the component, in the table used in step 4e, information indicating whether the genotype related to resistance is effective or not effective is selected, and in step 4d, the genotype related to susceptibility is selected. It is sufficient to select information indicating the relationship between and effective or ineffective. However, the present invention is not limited to this, and selection of components may be arbitrarily performed by a practitioner.

  Moreover, the numerical value as a component described in Table 2 used here is an example of a display indicating information in which a genotype is associated with IFN sensitivity or IFN effect, and is limited to the numerical value described in the table. Is not to be done. In other words, if it is a notation that can substantially indicate the correlation between genotype and effective or ineffective, for example, “○”, “×”, and “△” are simplified. A numerical score (for example, 1, 2, 3, 4, 5, etc.) may be used.

  The means for determining the genotype of a polymorphism associated with IFN sensitivity may be performed using any means known per se. For example, a nucleic acid containing the target polynucleotide may be prepared from a sample obtained from the subject individual and the genotype determined.

  The “individual” subject to the method of the present invention can be any mammal including humans, dogs, cats, cows, goats, pigs, sheep, and monkeys, but humans are the most preferred individuals.

  As used herein, “sample” refers to a biological sample such as blood, serum, lymph and tissue collected from an individual organism. Moreover, the sample obtained by performing arbitrary necessary pretreatments, such as a homogenate and extraction, may be sufficient as a "sample" as needed. Such pretreatment could be selected by one skilled in the art depending on the biological sample of interest.

  A nucleic acid containing a target polynucleotide prepared from a biological sample may be prepared from DNA and RNA. For example, a means for preparing a genomic DNA sample from a subject uses a phenol chloroform method, a salting-out method or a commercially available kit from blood cells such as leukocytes, monocytes, lymphocytes and granulocytes in peripheral blood obtained from the subject. In the case of extracting mRNA that can be carried out using any commonly used means such as extraction method, it may be applied to an oligo dT column. .

  When the amount of the polynucleotide is small, an operation of amplifying the polynucleotide may be performed as necessary. The amplification operation can be performed, for example, by a polymerase chain reaction (hereinafter abbreviated as PCR) including reverse transcription polymerase reaction (RT-PCR).

  If necessary, after performing extraction operation and / or amplification operation, the genotype of the target polymorphic site is determined. As a means for determining a genotype, any commonly used means such as a direct sequencing method, an SSCP method, an oligonucleotide hybridization method and a specific primer method may be used.

  When the nucleotide to be determined is present in the recognition site of a restriction enzyme, a restriction enzyme fragment length polymorphism method may be used. For example, when determining the polymorphism of the promoter region of the MxA gene, the ISRE of SEQ ID NO: 3 in which the nucleotide at position 455 is guanine is cleaved by a restriction enzyme HhaI that can specifically recognize and cleave the base sequence GCGC. On the other hand, when the nucleotide at position 455 is not guanine, it is not cleaved by HhaI. Therefore, when the nucleotide at position 455 of SEQ ID NO: 1 is identified, the RFLP method using HhaI can be used.

  Other methods for determining polymorphism include PCR-SSP (PCR-specific sequence primers) method, PCR-SSO (PCR-sequence specific oligonucleotide) method combining dot plot method and PCR, and PCR-SSCP method. Well-known methods can be used, but are not limited thereto.

  The dot blot method is a method for detecting a nucleic acid chain having a specific sequence contained in a sample using a probe nucleic acid chain having a known sequence. In this method, for example, a single-stranded nucleic acid sample is immobilized on an organic thin film on a substrate, and then a solution of a single-stranded probe nucleic acid chain labeled with a fluorescent substance or the like is brought into contact with the sample on the thin film. If the sample has a sequence complementary to the probe nucleic acid strand, it hybridizes with the probe nucleic acid strand to form a double strand, and is thus immobilized on the substrate. Therefore, after removing the unreacted nucleic acid strand by washing, the sample nucleic acid strand having a sequence complementary to the probe can be detected by detecting the label attached to the probe. Accordingly, the present invention also includes the use of the polynucleotide according to the present invention as a probe in the detection of an IFN sensitivity-related polymorphic gene. Also included in the present invention is a test agent for predicting whether interferon therapy is effective for an individual to be administered interferon, which contains such a polynucleotide.

  By the method as described above, the genotypes of MxA-88, MxA-123, MBL-221 and polymorphic sites present in the codon can be determined, and the effectiveness of interferon therapy can be predicted based on the results. .

III. Type of hepatitis C virus and effect of IFN As described above, there are two types of hepatitis C virus (hereinafter also referred to as HCV), type 1 and type 2. Furthermore, type 2 has two types, 2a and 2b.

  The effect of IFN is more apparent in patients infected with type 2 HCV than in patients infected with type 1 HCV (Table 3). Further, in patients infected with both type 1 and type 2, it is difficult to obtain the effect of IFN as in patients infected only with type 1. In addition, the effect of IFN is weaker as the amount of infected virus increases.

  Therefore, according to the present invention, in the case of a patient infected with type 1, by detecting the genotype of the IFN susceptibility-related polymorphism on the patient side, it is possible to detect a patient who is likely to obtain the effect of IFN. Is possible.

On the other hand, when the type of HCV in which the patient is infected is type 2, the effect of IFN is easily obtained as compared with the case of being infected with type 1. Therefore, in the case of a patient infected with type 2, it is possible to detect a patient who is unlikely to obtain an IFN effect by determining the genotype of the IFN sensitivity-related polymorphism on the patient side. is there. In the method of the present invention, at least one of MxA-88 and MxA-123 is determined as the MxA genotype. In particular, when the virus type is type 1, determination of MxA-88 is essential. It is desirable to make a prediction by determining as

  In accordance with the present invention, from the genotype of codon 54 of the infected HCV virus type, MxA-88, MxA-123, MBL-221 and MBL collagen-like domain of the infected person, hepatitis C infection type C It is possible to predict the effectiveness of interferon therapy in patients with hepatitis infection.

Thus, according to the present invention, a method for predicting the effectiveness of interferon therapy in a person with hepatitis C infection, comprising:
(1) obtaining a sample derived from the infected person,
(2) For the sample in (1), determine the following types in random order;
(A) determining the type of hepatitis C virus;
(B) determining the genotype of MxA-88 and / or MxA-123 of the infected person;
(C) determining the genotype of codon 54 of the collagen-like domain of MBL-221 and MBL of said infected person;
(3) Predicting the effectiveness of interferon therapy from the type determined in (2),
A method for predicting the effectiveness of interferon therapy in a hepatitis C infected person is provided.

  An example of a method for predicting the effect of IFN therapy from the virus type, MBL and MxA genotype will be described below with reference to FIG.

  In step 5a, the practitioner collects a sample such as a blood sample from the individual to be administered interferon, and starts prediction. The collected sample is subjected to treatment such as purification and extraction as necessary, and then the virus type, and the MBL and MxA genotypes, that is, the MxA-88 and MxA-123 genotypes, MBL-221. And the genotype of codon 54 of the collagen-like domain of MBL are determined in any order, and the process proceeds to step 5b.

  In step 5b, if type 1 is included in the virus type determined in step 5a, it is determined to proceed to step 5c, and if only type 2 is determined, it is determined to proceed to (5d).

  In step 5c, based on the MBL and MxA genotypes determined in step 5a, the table 4 in which the genotypes and the effects of IFN are associated is searched to extract the corresponding IFN effects, thereby enabling the IFN therapy to be effective. Predict the sex and finish the whole prediction process.

  In step 5d, based on the MBL and MxA genotypes determined in step 5a, the table 5 in which the genotypes and IFN effects are associated is searched to extract the corresponding IFN effects, thereby the effectiveness of the IFN therapy. Is predicted, and the entire prediction process is completed.

  The table used here is information that associates genotypes with IFN susceptibility. Each table is a table corresponding to each table number. Each table used in the above method is given as an example. The table and table used here may be any table in which each genotype is associated with the effect of IFN. For example, Table 4 shows the relationship between genotype and FN effects in patients infected with type 1 HCV. On the other hand, Table 5 is a table showing the relationship between genotype and IFN effect in patients infected with type 2 HCV. Further, the table used may be a table including only any one of the components, or may be a table composed of other combinations of components. In the above example, Tables 4 and 5 are used as the tables referred to in Step 5c and Step 5d, respectively, and two tables prepared by selecting necessary items for each step in advance are used. However, one table prepared by combining these may be used. Or the table | surface which consists of a component of another combination may be sufficient. For the selection of the components, for example, in the table used in step 5c, information indicating the relationship between genotype and effective or ineffective in type 1 HCV infected persons is selected, and in step 5d, type 2 HCV infection is selected. What is necessary is just to select the information which shows the relationship between a genotype in a person and a remarkable or ineffective. However, the present invention is not limited to this, and selection of components may be arbitrarily performed by a practitioner.

Moreover, the numerical value as a component described in Tables 4 and 5 used here is an example of a display indicating information in which a genotype and IFN sensitivity or IFN effect are associated with each other. It is not limited to. In other words, if it is a notation that can substantially indicate the correlation between genotype and effective or ineffective, for example, “○”, “×”, and “△” are simplified. A numerical score (for example, 1, 2, 3, 4, 5, etc.) may be used.

  In addition, the type of hepatitis C virus can be determined by a generally known method used for determining the type of hepatitis C virus. For example, a primer can be used to perform a known amplification reaction, for example, a method utilizing a polymerase chain reaction (generally referred to as PCR, hereinafter referred to as PCR). For example, typically reverse transcription PCR, reverse transcription nested PCR, or variations thereof, such as reverse PCR, 5'RACE, 3'RACE can be used. Alternatively, the HCV virus detection method can be performed using a hybridization reaction using any known probe specific for each type of HCV virus.

  Furthermore, the genotype determination method and the like can be performed in the same manner as the above-described method for predicting the effectiveness of interferon therapy from the MxA and MBL genotypes.

Furthermore, the method according to the present invention as described above can also be analyzed using a computer. That is, the present invention is a method for predicting the effectiveness of interferon therapy in an individual to be administered interferon using a computer,
(1) The operator inputs MxA-88 and MxA-123 genotypes, MBL-221 genotypes and MBL collagen-like domain codon 54 genotypes determined using samples from the individual to the computer. To do,
(2) Based on the genotype input in (1), the computer predicts the effectiveness of IFN therapy according to a table in which the genotype and the effectiveness of interferon stored in advance in the storage means of the computer are associated. thing,
(3) The computer indicates the prediction result obtained in (2) to the operator,
A method of predicting the effectiveness of interferon therapy in an individual to be administered interferon using a computer comprising:

  Such a method can be implemented as follows, for example.

  FIG. 6 shows a block diagram of an aspect of an apparatus for carrying out the method of the present invention. Here, all the components are connected by a shared signal path. As shown in FIG. 6, the present embodiment includes a computer 1 having general components as a computer, an input unit 2 for a person to input data to the computer 1, and a display unit 3 for displaying various information. And at least. Further, as a part of a general computer component, at least a processing unit 4 such as a processor or a CPU for controlling the computer or performing various processes, and a storage unit 5 for storing a program, a table, and the like are provided. .

  An example of a method for predicting the effectiveness of interferon therapy in an individual to be administered interferon using a computer will be described below with reference to FIG.

. Here, the processing unit 4 is a main control unit that controls each unit of the computer in an integrated manner, and executes the prediction program stored in the storage unit to predict the effectiveness of the interferon therapy.

  In step 7a, when the operator inputs information on the genotypes of MBL and MxA derived from the individual to be administered with interferon from the input means 2, the input information is recorded in the storage means 5 and the process proceeds to step 7b. To do. Here, the input genotype information may be a specific genotype or raw data, and may be any information representing information on the target genotype.

  In step 7b, the processing means 4 extracts the corresponding IFN sensitivity by reading and searching the table 1 that associates the genotype and the IFN sensitivity stored in advance in the storage means 5 from the recorded information, Control goes to step 7c.

  In step 7c, the processing means 4 determines from the IFN sensitivity determined in step 7b that the process proceeds to step 7d if the sensitivity is resistance, and determines that the process proceeds to step 7f if the sensitivity is easy. To do.

  In step 7d, the processing means 4 reads out the table 2 in which the genotype and the IFN sensitivity stored in advance in the storage means 5 are retrieved from the information recorded in step 7a, thereby obtaining the effect of the corresponding IFN therapy. Extraction predicts the effectiveness of the IFN therapy, and proceeds to step 7e.

  In step 7e, the processing means 4 displays the result predicted in step 7d on the display means 3 and / or records it in the storage means 5 and ends all prediction processes. The display here may be output as an image indicating the effect of the IFN therapy stored in the storage unit 5 in advance. Moreover, you may set the loop which transfers to step 7e from 7e as needed.

  In the above-described method, in step 5a, at least one of MxA-88 and MxA-123 is determined as the MxA genotype. In particular, when the virus type is type 1, determination of MxA-88 is performed. It is desirable to make a prediction by determining that is essential. The configuration of the table used may be changed accordingly.

  The table used here is information that associates genotypes with IFN susceptibility. Each table is a table corresponding to each table number. Each table used in the above method is given as an example. Moreover, the table and table used here should just be what matched each genotype and the effect of IFN.

  Similarly, all the aspects of the present invention described above can be executed by a computer. Moreover, the method according to the present invention described above can be modified as desired without departing from the scope of the present invention, and such a method can be similarly executed by a computer.

Furthermore, a program for executing the method for predicting the effectiveness of interferon therapy in an individual to be administered interferon using the above-mentioned computer is also within the scope of the present invention. Such a program, for example, uses a computer to predict the effectiveness of interferon therapy in an individual to be administered interferon,
(1) Record information on the genotype of MxA-88 and MxA-123, the genotype of MBL-221 and the genotype of codon 54 of the collagen-like domain of MBL determined using the sample derived from the individual Data recording means,
(2) Means for predicting the efficacy of IFN therapy from the genotype recorded in (1) according to a table in which the genotype previously stored in the computer is associated with the effectiveness of interferon, and (3) ( Output means for outputting the prediction result obtained in 2);
It is a program to make it function as.

  In addition, the program uses a computer to predict the effectiveness of interferon therapy in an individual to be administered interferon, the MxA-88 and MxA-123 genotypes determined using samples from the individual, MBL It may function as an input means for inputting information on the genotype of -221 and the genotype of codon 54 of the collagen-like domain of MBL.

In addition, an effectiveness prediction device for predicting the effectiveness of interferon therapy in an individual to be administered interferon,
(1) storage means for storing a table associating genotypes with interferon effectiveness;
(2) Gene of at least one of MxA-88 and MxA-123 genotype, MBL-221 genotype, and codon 54 of collagen-like domain of MBL determined using a sample derived from an individual to be tested An input means for inputting type information;
(3) Prediction means for predicting the effectiveness of IFN therapy based on the genotype input through the input means and the table stored in the storage means;
(4) An effectiveness predicting apparatus comprising a display means for displaying a prediction result of the predicting means is also within the scope of the present invention.

Further, the present invention is a method for predicting the effectiveness of interferon therapy in an individual to be administered interferon using a computer,
(1) Data recording means for MxA-88 and MxA-123 genotypes, MBL-221 genotypes and MBL collagen-like domain genotype codon 54 genotype information determined using samples from the individual To record,
(2) predicting the efficacy of IFN therapy from the genotype recorded in (1) according to a table in which the genotype previously stored in the computer is associated with the effectiveness of interferon,
(3) outputting the prediction result obtained in (2),
A method of predicting the effectiveness of interferon therapy in an individual to be administered interferon using a computer comprising:

Still further, an effectiveness prediction method for predicting the effectiveness of interferon therapy in an individual to be administered interferon,
(1) Input for inputting information on the genotype of MxA-88 and MxA-123, the genotype of MBL-221, and the genotype of codon 54 of the collagen-like domain of MBL determined using a sample derived from the individual Process,
(2) a predicting step of predicting the effectiveness of IFN therapy based on the genotype input in the input step and a table stored in a table in which the effectiveness of the gene type and interferon is stored;
(3) An effectiveness prediction method comprising a display step for displaying a prediction result of the prediction step is also within the scope of the present invention.

<Polynucleotide for predicting the effectiveness of interferon therapy>
The present invention also provides polynucleotides for predicting the effectiveness of interferon therapy.

  As used herein, “polynucleotide” means a substance in which two or more nucleosides are linked by a phosphate ester bond. “Nucleoside” includes, but is not limited to, deoxyribonucleoside and ribonucleoside. Furthermore, in the present invention, “polynucleotide” also refers to artificially synthesized nucleic acids such as peptide nucleic acids, morpholino nucleic acids, methyl phosphonate nucleic acids, S-oligo nucleic acids and the like.

  In the present specification, the “promoter region” does not refer only to a region directly involved in the transcription initiation reaction such as a TATA box, but affects the efficiency of the transcription initiation reaction in the vicinity or remotely of the region. The sequence including the regulatory sequence provided shall also be referred to. Therefore, it should be noted that the term “promoter region” includes only sequences involved in the transcription initiation reaction, only regulatory sequences, and sequences in which both are linked.

  The polynucleotide may be synthesized to have the desired sequence or prepared from a biological sample. In the case of preparing from a biological sample, after collecting the sample from an individual, usually, an operation of extracting a polynucleotide from the sample may be performed. As a method for extracting a polynucleotide from a biological component, for example, any extraction method other than phenol extraction and ethanol precipitation can be used. When extracting mRNA, it may be applied to an oligo dT column.

  The polynucleotide provided according to the present invention can be used as a probe or primer for determining the base sequence of a polynucleotide of a sample derived from an individual.

  The polynucleotides provided according to the present invention include the following (a) to (o).

  (A) The polynucleotide shown in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.

  (B) A modified polynucleotide in which one or several nucleotides except MxA-88 and MxA-123 are deleted, substituted, or added in the polynucleotide shown in (a).

  Other examples of the modified polynucleotide by addition include the above-mentioned polynucleotides of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 and 8, or fragments of the polynucleotide, promoters, enhancers, upstream activation sequences, silencers , Upstream inhibitory sequence, attenuator, poly A tail, nuclear translocation signal, Kozak sequence, ISRE, drug resistance factor, signal peptide gene, transmembrane region gene, luciferin, green fluorescent protein, phycocyanin, horseradish peroxidase Examples include a polynucleotide in which at least one polynucleotide selected from the group consisting of a marker protein gene, an interferon responsive protein gene, and a non-interferon responsive protein gene is linked.

  (C) Of the nucleotide sequences of the polynucleotides shown in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, and 8, it is MxA-88 that is involved in the effectiveness of interferon therapy and Since each is one nucleotide present in the SNP site of MxA-123, the polynucleotide of the present invention may be a fragment of the polynucleotide containing the SNP site of MxA-88 and / or MxA-123. The fragment represented by (c) can be suitably used as a probe for determining the base sequence of a polynucleotide of a sample derived from an individual.

  Moreover, when using the above-mentioned polynucleotide fragment as a primer or a probe, it is desirable that it is about 8 nucleotides or more and 500 nucleotides or less. More preferably, it is 10 nucleotides or more and 100 nucleotides or less, and particularly when used as a probe, it is preferably 10 nucleotides or more and 15 nucleotides or less for a PNA probe, and 15 or more nucleotides for a DNA probe. If the length of the polynucleotide fragment is too long, it will be difficult to distinguish one nucleotide difference. On the other hand, if the length of the polynucleotide on the substrate is excessively short, it is difficult to determine the base sequence of the polynucleotide contained in the sample.

  In particular, the following polynucleotides (d) to (f) are suitable as a polynucleotide suitable as a probe for determining the genotype of MxA-88.

  (D) a fragment of the polynucleotide of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 comprising the SNP site of MxA-88, comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: A fragment comprising a polynucleotide having a sequence represented by SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 corresponding to positions 441 to 456 (namely, the ISRE).

  (E) A fragment of the polynucleotide of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 containing the SNP site of MxA-88, corresponding to positions 449-459 of SEQ ID NO: 1 to SEQ ID NO: 4 A fragment comprising the polynucleotide of SEQ ID NOs: 17, 18, 19, and 20. In particular, (e) includes a base sequence having a length approximately equal to the SNP and having the same length in the front and rear, so that the base sequence is determined with high accuracy. In order to perform detection with higher accuracy, a fragment containing a polynucleotide corresponding to positions 447 to 461 of SEQ ID NO: 1 to SEQ ID NO: 4 is preferable. Similarly, when such a fragment is used as a probe, it preferably contains the corresponding SNP site at approximately the center.

Furthermore, the preferred polynucleotide of the present invention may be (f) a complementary strand of the polynucleotide shown in (d) to (e) above.

  For example, the complementary strands of the sequences represented by SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12 (that is, the ISRE) are sequences represented by SEQ ID NOs: 21, 22, 23, and 24.

  The complementary strands of the sequences represented by SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20 are sequences represented by SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, respectively.

  Moreover, the following (g) and (h) are mentioned as a suitable polynucleotide as a probe for determining the genotype of MxA-123.

  (G) The polynucleotides of SEQ ID NOs: 13, 14, 15, and 16 corresponding to SEQ ID NOs: 415 to 425, which are fragments of SEQ ID NOs: 5, 6, 7, and 8 containing the SNP site of MxA-123. Containing fragment.

SEQ ID NO: 13 is “tgctgaaggtg”, which is the nucleotide sequence of positions 415 to 425 of SEQ ID NO: 5, and the genotype of MxA-123 is adenine;
SEQ ID NO: 14 is “tgctgcaggtg”, which is the base sequence at positions 415 to 425 of SEQ ID NO: 6, and the genotype of MxA-123 is cytosine;
SEQ ID NO: 15 is “tgctgtaggtg”, which is the base sequence at positions 415 to 425 of SEQ ID NO: 7, and the genotype of MxA-123 is thymine;
SEQ ID NO: 16 is “tgctggaggtg”, which is the nucleotide sequence of positions 415 to 425 of SEQ ID NO: 8, and the genotype of MxA-123 is guanine.

  The above (g) preferably includes a base sequence of approximately the same length before and after the SNP as the center, whereby the base sequence is determined with high accuracy.

Further preferred polynucleotides are (h) a complementary strand of the polynucleotide shown in (g) above.

It may be.

  Moreover, the following (i)-(t) is mentioned as a polynucleotide suitable for using in order to determine the genotype of MBL-221 and codons 52, 54, and 57. When the polynucleotide fragments shown in the following (i) to (t) are used as primers or probes, it is desirable that they are about 8 nucleotides or more and 500 nucleotides or less. More preferably, it is 10 nucleotides or more and 100 nucleotides or less, and particularly when used as a probe, it is preferably 10 nucleotides or more and 15 nucleotides or less for a PNA probe, and 15 or more nucleotides for a DNA probe. If the length of the polynucleotide fragment is too long, it will be difficult to distinguish one nucleotide difference. On the other hand, if the length of the polynucleotide on the substrate is excessively short, it is difficult to determine the base sequence of the polynucleotide contained in the sample.

  (I) A polynucleotide fragment of SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, comprising the SNP site of MBL-221, comprising SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 A fragment comprising a polynucleotide having a sequence corresponding to positions 418 to 432.

  (J) Polynucleotide fragments of SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 including the SNP site of MBL-221, wherein SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 A fragment comprising a polynucleotide having a sequence corresponding to positions 421 to 430.

  (K) The complementary strand according to (i) and (j) above.

  (L) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 including the SNP sites of the codons 52, 54 and 57 Fragments of the polynucleotides of SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide having a sequence corresponding to positions 868 to 885 of these sequences. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56.

  (M) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: including the SNP site of the codons 52 and 54 A fragment of the polynucleotide of SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide having a sequence corresponding to positions 868 to 876 of these sequences. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56.

  (N) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 41, including the SNP sites of the codons 54 and 57 A fragment of the polynucleotide of SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide having a sequence corresponding to positions 874 to 885 of these sequences. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56.

  (O) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42 including the SNP site of the codon 54 Fragments of the polynucleotides of SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide having a sequence corresponding to positions 874 to 876 of these sequences. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56. In particular, a fragment containing positions 869 to 880 is desirable.

  (P) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42 including the SNP site of the codon 52 Fragments of the polynucleotides of SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide having a sequence corresponding to positions 868 to 870 of these sequences. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56. In particular, a fragment containing positions 864 to 873 is desirable.

  (Q) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42 including the SNP site of the codon 57 Fragments of the polynucleotides of SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide having a sequence corresponding to positions 883 to 885 of these sequences. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56. In particular, a fragment containing positions 880 to 890 is desirable.

  (R) SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42 including the SNP site of the codon 54 Fragments of the polynucleotides of SEQ ID NO: 43 and SEQ ID NO: 44, comprising a polynucleotide comprising position 875 of said sequence in which the SNP of the codon 54 is present. For example, a fragment comprising the polynucleotide shown in SEQ ID NO: 45 to SEQ ID NO: 56.

  (S) The polynucleotide fragment shown in the above (i) to (m), which is 11 to 30 in length.

  (T) A modified polynucleotide comprising the polynucleotide fragment shown in the above (i) to (m), wherein one or several nucleotides excluding the polymorphic site are deleted, substituted or added.

  Examples of the modified polynucleotide by addition include the promoter or enhancer, upstream activation sequence, silencer, upstream inhibitory sequence, attenuator to the polynucleotide or polynucleotide fragment described in any of (f) to (n) above. , Poly A tail, nuclear translocation signal, Kozak sequence, ISRE, drug resistance factor, signal peptide gene, transmembrane region gene, luciferin, green fluorescent protein, phycocyanin, horseradish peroxidase marker gene, interferon responsiveness Examples include a polynucleotide obtained by linking at least one polynucleotide selected from the group consisting of a protein gene and a non-interferon-responsive protein gene.

  In addition, “n” in the base sequence described in the sequence listing is arbitrarily selected from A, T, C and G.

<Base sequence detection chip>
The present invention also provides a base sequence detection chip comprising the polynucleotide or fragment. Such a base sequence detection chip is also within the scope of the present invention.

  According to an aspect of the present invention, a base sequence detection chip comprising the above-described polynucleotide or fragment is provided. These include, for example, a fluorescence detection DNA chip and a current detection type DNA chip, but are not limited thereto. If a virus is detected by using a base sequence detection chip in which the polynucleotide or its complementary strand is used as a probe, the detection method can be simplified and made efficient. The base sequence detection chip can be prepared by the following procedure.

(A) Fabrication of fluorescence detection base sequence detection chip Substrates a polynucleotide according to the above-described embodiment of the present invention or a polynucleotide fragment having a partial sequence thereof, or a polynucleotide having a sequence complementary thereto Immobilize to. As the substrate, any conventionally used substrate such as a glass substrate and a silicon substrate can be used. The fixing means can be fixed using means known per se to those skilled in the art, such as means using a spotter or the like, means using a general semiconductor technology, and the like.

(B) Production of current detection type base sequence detection chip A polynucleotide according to the above-described aspect of the present invention or a polynucleotide fragment having a partial sequence thereof, or a polynucleotide having a sequence complementary thereto. It is immobilized on a substrate, for example, an electrode substrate, by covalent bond, ionic bond, physical adsorption or chemical adsorption. An example of the current detection type DNA chip is a gene detection device of Patent No. 2573443 registered on October 24, 1996, but is not limited thereto. This document is incorporated herein by reference.

  As a probe to be immobilized on one base sequence detection chip, in addition to the above-described probes of the base sequences derived from the MXA gene and MBL gene, a probe for detecting the type of a viral gene is immobilized on one chip. May be. Thereby, the genotype of the affected virus can also be detected at the same time. Examples of the probe for detecting the type of viral gene include a nucleotide sequence corresponding to HCV-RNA, a fragment thereof or a complementary sequence thereof. For example, probes that specifically detect the genotypes of hepatitis C virus type 1 (SEQ ID NO: 57 “cgctcaatgcctggagat”), type 2 (SEQ ID NO: 58 “cactctatgcccggccat”), type 3 (SEQ ID NO: 59 “cgctcaatacccagaaat”). What is necessary is just to use according to the genotype to detect. That is, those having base sequences corresponding to SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 or their complementary sequences shown in the sequence listing, respectively, can be used.

  When using a probe capable of detecting a genotype, a plurality of probes corresponding to different genotypes can be immobilized on the substrate at the same time for detection with high accuracy.

  In order to detect the genotype of pathogenic microorganisms in the sample material, a PCR reaction was previously performed on the genes of the pathogenic microorganisms in the sample material using primers characteristic of the genotype, and then the universal probe was immobilized. It is also possible to detect with a chip.

  In the case of hepatitis C, the sense strand having the nucleotide sequence shown in SEQ ID NO: 60 (“cgcgcgactaggaagacttc”) or SEQ ID NO: 61 (“cgcgcgacgcgcaaaacttc”) is used, and the antisense strand is SEQ ID NO: 62 for type 1a. ("Tgccttggggataggctgac") SEQ ID NO: 63 ("gagccatcctgcccacccca") for type 1b, SEQ ID NO: 64 ("gccccatgaagggcgagaac") for type 2a, SEQ ID NO: 65 ("accctcgtttccgtacagag") for type 2b PCR reaction may be performed using the nucleotide sequence of No. 66 (“gctgagcccaggaccggtct”), and the universal probe having the nucleotide sequence of SEQ ID No. 67 (“aggaagacttccgagcggtc”) may be used. The first probe is preferably a probe that detects not only the presence or absence of the pathogenic microorganism in a sample material but also a genetic mutation of the pathogenic microorganism.

  According to the embodiment of the present invention, if detection is performed using a probe comprising a polynucleotide and a base sequence detection chip, the detection can be performed easily and efficiently.

[Example]
1. Outline DNA and RNA were extracted from blood collected from 159 HCV-infected patients and used as samples for analysis. Virus typing was performed using RNA fractionation, and SNP analysis of MxA gene and MBL gene was performed using DNA. Then, the relationship between the therapeutic effect of IFNα and the genotype of the polymorphism present in the virus type, MxA and MBL was examined.

2. Patients A sample of 159 HCV-infected patients, who were proven to have chronic hepatitis C by histochemical examination of the liver, was used for this study. All patients have informed consent to be the subject of this study. Patients with normal blood alanine aminotransferase and negative HCV RNA during the 6-month follow-up period after IFNα therapy were determined to be fully effective. On the other hand, patients in whom HCV RNA was detected during the follow-up period or alanine aminotransferase showed a high level were markedly ineffective.

3. HCV and SNP typing cDNA was prepared from RNA extracted from blood, and a portion thereof was amplified by PCR, and the nucleotide sequence of the HCV gene was determined (K. Chayama et al., J. Gastroenterol. Hepatol). .8, 40-44, 1993). In addition, SNP analysis of MxA and MBL genes was performed using DNA extracted from blood. A 599 bp fragment of the MxA gene promoter region was amplified by PCR, and SNP analysis was performed by determining the nucleotide sequence (M. Hijikata, Y. Ohta and S. Mishiro, Intervirology 43, 124-127, 2000). . SNPs are present at nucleotide positions -88 and -123 in the MxA gene promoter region. In MBL, there are two SNPs that affect IFNα, namely MBL-221 and codon 54. Therefore, the genotypes of MxA-88, MxA-123, MBL-221 and codon 54 were determined. First, DNA corresponding to each was amplified by PCR. Next, MxA-88 and MxA-123 fragments were analyzed by sequence specific priming PCR, and MBL-221 and codon 54 fragments were analyzed with or without restriction enzyme cleavage. The type was identified (M. Matsushita et al., J. Hepatology 29, 695-700, 1998).

4). Results (1) The type of hepatitis C virus and the therapeutic effect of IFNα Table 3 shows the results of analyzing the relationship between the type of virus infected by the patient and the therapeutic effect of IFNα (Table 3).

  As shown in Table 3, out of 159 infected persons, there were 103 infected persons whose HCV gene was type 1, and all of them were type 1b. The therapeutic effect of IFNα was completely effective in 18 of them and ineffective in the remaining 85. There were 55 type 2 infected persons infected with either type 2a or 2b. Of the therapeutic effects of IFNα, 34 were completely effective and the remaining 21 were ineffective. The remaining one was infected with both types of HCV, and the therapeutic effect of IFNα was ineffective.

(2) When the genotype of each SNP is used independently and predicting About the genotype of MBL, there were 85 hepatitis C patients who showed XB type, which is a genotype for predicting IFN resistance. Of those, 65 were actually ineffective with IFN treatment. Therefore, the coincidence rate between the predicted value and the actual value was 76%. In addition, 74 patients with hepatitis C showed the YA type, which is a genotype predicting IFN susceptibility. Of these, 32 were actually effective in IFN treatment. Therefore, the coincidence rate between the predicted value and the actual value was 43%.

  Regarding the genotype of MxA-88, there were 75 hepatitis C patients who showed G / G homozygos, a genotype that predicts IFN resistance. Of these, 59 were actually ineffective with IFN treatment. Therefore, the concordance rate between the predicted value and the actual value was 79%. In addition, 84 hepatitis C patients showed G / T heterozygous or T / T homozygous genotypes predicting IFN susceptibility. Of these, 36 were actually effective in IFN treatment. Therefore, the coincidence rate between the predicted value and the actual value was 43%.

  Regarding the genotype of MxA-123, there were 91 hepatitis C patients who showed C / C homozygos, a genotype predicting IFN resistance. Of those, 70 were actually ineffective with IFN treatment. Therefore, the coincidence rate between the predicted value and the actual value was 77%. In addition, there were 68 patients with hepatitis C who showed C / A heterozygous or A / A homozygous genotype predicting IFN susceptibility. Of these, 31 were actually effective in IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 46%.

(2) Comprehensive prediction according to the present invention The results of predicting IFN resistance according to the present invention are shown below. There were 39 patients with hepatitis C in which MBL was XB type, MxA-88 was G / G homo, and MxA-123 was C / C homo. Of these, 32 were actually ineffective with IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 87%.

  The results of predicting IFN resistance according to the present invention are shown below. That is, there were 39 hepatitis C patients in which MBL was XB type and MxA-88 was G / G homo. Of those, 34 were actually ineffective with IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 87%. If the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

  The results of predicting IFN resistance according to the present invention are shown below. That is, there were 44 patients with hepatitis C in which MBL was XB type and MxA-123 was C / C homo. Of those, 39 were actually ineffective with IFN treatment. Therefore, the concordance rate between the predicted value and the actual value was 89%. If the prediction is performed according to the present invention, the prediction accuracy is remarkably improved as compared with the conventional method.

  On the other hand, the results of predicting IFN susceptibility according to the present invention are shown below. 27 hepatitis C patients whose MBL genotype is YA type, MxA-88 is G / T heterozygous or T / T homozygous, and MxA-123 is C / A heterozygous or A / A homozygous Met. Of those, 16 were actually effective in IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 59%.

  The results of predicting IFN susceptibility according to the present invention are shown below. That is, there were 38 hepatitis C patients whose MBL was YA type and MxA-88 was G / T heterozygous or T / T homozygous. Of those, 21 were actually effective at IFN treatment. Therefore, the concordance rate between the predicted value and the actual value was 55%.

  On the other hand, the results of predicting IFN susceptibility according to the present invention are shown below. That is, there were 27 hepatitis C patients whose MBL was YA type and MxA-123 was C / A hetero or A / A homo. Of those, 16 were actually effective in IFN treatment. Therefore, the agreement rate between the predicted value and the actual value was 59%.

5. Discussion In both the prediction of treatment resistance and the prediction of treatment sensitivity, the prediction accuracy is greatly improved when MBL, MxA-88, and MxA-123 are used in combination rather than using each genotype alone. . At the same time, it was also suggested that the prediction of interferon treatment effect by genotypes of these gene polymorphisms can be more sensitive to the “case where the effect cannot be expected” than the “case where the effect can be expected”. .

  From these results, the present invention is capable of excluding “prone patients” from the candidates for interferon, which is an expensive drug requiring long-term administration, strong side effects, and expensive drugs. Main effectiveness is demonstrated.

  According to the embodiment of the present invention, it is possible to predict the effectiveness of interferon treatment in hepatitis C patients with higher accuracy than before.

Schematic of genetic map showing SPN site and genotype of MxA gene. Schematic of genetic map showing SPN site and genotype of MBL gene. 6 is a flowchart illustrating an example of a method according to the present invention. 6 is a flowchart illustrating another example of a method according to the present invention. 6 is a flowchart illustrating another example of a method according to the present invention. 1 is a block diagram illustrating an embodiment according to the present invention. 6 is a flowchart illustrating a further example of a method according to the present invention.

Claims (4)

  Predicting the effectiveness of interferon therapy in an individual to be administered interferon, which is a DNA probe comprising a polynucleotide consisting of 15 to 30 consecutive sequences selected from SEQ ID NO: 5 so as to contain MxA-123 or its complementary strand Nucleic acid probe.   The effectiveness of interferon therapy in an individual to be administered interferon, which is a DNA probe comprising a polynucleotide consisting of 15 to 30 consecutive sequences selected from SEQ ID NO: 6 so as to contain MxA-123 or its complementary strand Nucleic acid probe for prediction.   A base sequence detection chip comprising the nucleic acid probe according to claim 1 and the nucleic acid probe according to claim 2 for predicting the effectiveness of interferon therapy in an individual to be administered with interferon. The base sequence detection chip according to claim 3, further comprising a nucleic acid probe for detecting the MxA-88 genotype described in (1) below and / or an MBL gene described in (2) below. Base sequence chip comprising a nucleic acid probe for detecting the genotypes of codons 52, 54 and 57 of the collagen-like domain and / or a nucleic acid probe for detecting the genotype of MBL-221 described in (3) below ;
(1) A polynucleotide represented by a sequence selected from the group consisting of SEQ ID NOs: 9 and 10 and SEQ ID NOs: 21 and 22 as the nucleic acid probe provided for detecting the MxA-88 genotype A nucleic acid probe comprising:
(2) A set of nucleic acid probes comprising the polynucleotides shown in SEQ ID NOs: 45 to 56 or their complements, wherein the nucleic acid probe for detecting the genotypes of codons 52, 54 and 57 of the collagen-like domain of the MBL gene A set of nucleic acid probes comprising a polynucleotide that is a strand;
(3) A nucleic acid probe for detecting the genotype of MBL-221 is a nucleic acid probe comprising a polynucleotide represented by the sequence of positions 418 to 432 of SEQ ID NO: 29 or a complementary strand thereof and position 418 of SEQ ID NO: 30 A set of nucleic acid probes consisting of a nucleic acid probe comprising a polynucleotide represented by the sequence at position 432 or a complementary strand thereof.

Images