KR20130027093A - Method for predicting susceptibility to cardiovascular disease using snp of klotho genes - Google Patents

Method for predicting susceptibility to cardiovascular disease using snp of klotho genes Download PDF

Info

Publication number
KR20130027093A
KR20130027093A KR1020110088722A KR20110088722A KR20130027093A KR 20130027093 A KR20130027093 A KR 20130027093A KR 1020110088722 A KR1020110088722 A KR 1020110088722A KR 20110088722 A KR20110088722 A KR 20110088722A KR 20130027093 A KR20130027093 A KR 20130027093A
Authority
KR
South Korea
Prior art keywords
cardiovascular disease
base
risk
dna
klotho
Prior art date
Application number
KR1020110088722A
Other languages
Korean (ko)
Other versions
KR101304535B1 (en
Inventor
차민호
임지혜
고미미
이명수
강병갑
Original Assignee
한국 한의학 연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국 한의학 연구원 filed Critical 한국 한의학 연구원
Priority to KR1020110088722A priority Critical patent/KR101304535B1/en
Publication of KR20130027093A publication Critical patent/KR20130027093A/en
Application granted granted Critical
Publication of KR101304535B1 publication Critical patent/KR101304535B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

PURPOSE: A cardiovascular disease prediction method using the single nucleotide polymorphism of Klotho gene is provided to be practically used for the prevention and the early diagnosis of the cardio vascular disease as it verifies genetic factors which causes cardiovascular disease. CONSTITUTION: A marker for prediction of the degree of the cardiovascular disease outbreak danger is selected from rs3631726 with the base rank in a rank number 3 and composed of a polynucleotide or a supplementary polynucleotide thereof with 20-100 continuous DNA rank in which 27th base (744th base from the transcription starting point of the klotho gene) is A or lacked. The cardiovascular disease is selected from the myocardial infarction, angina, atherosclerosis, hypertension, cardiac failure, blood tumor, artery scleroma, embolism, stroke and thrombosis. A probe or a primer is included which can detect the cardiovascular disease pathogenic risk marker for prediction. The kit is the RT-PCR kit or the DNA chip kit. Polynucleotide or its supplementary polynucleotide with 20-100 of continuous DNA rank is included that is selected from rs36217263 with the base rank of the rank number 3 and in which 27th base (744th base from the transcription starting point of the klotho gene) is A or lacked.

Description

Klotho 유전자의 단일염기다형을 이용한 심혈관계 질환 예측 방법{Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes}Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes}

본 발명은 Klotho 유전자의 단일염기다형을 이용한 심혈관계 질환 예측 방법에 관한 것으로, 보다 구체적으로 본 발명은 klotho 유전자의 SNP를 포함하는 심혈관계 질환 발병 위험도 예측용 마커, 상기 마커를 검출할 수 있는 프로브 또는 프라이머를 포함하는 심혈관계 질환 발병 위험도 예측용 키트 및 상기 마커를 검출하는 단계를 포함하는 심혈관계 질환의 발병 위험에 대한 정보를 제공하는 방법에 관한 것이다.
The present invention relates to a cardiovascular disease prediction method using a single base polymorphism of the Klotho gene. More specifically, the present invention provides a marker for predicting the risk of cardiovascular disease, including the SNP of the klotho gene, a probe capable of detecting the marker. Or it relates to a kit for predicting the risk of developing cardiovascular disease comprising a primer and a method for providing information on the risk of developing a cardiovascular disease comprising the step of detecting the marker.

심혈관계 질환은 산업화된 국가 및 한국의 주요 사망 원인 중 하나이다. 심혈관계 질환 중에 중요한 부분을 차지하는 관상동맥질환(coronary artery disease)은 대개 동맥경화에 의해서 심장에 혈액을 공급하는 관상동맥이 막히거나, 좁아져서 심장 근육에 혈액을 충분하게 공급하지 못하여 발생한다. 이러한 심혈관계 질환 발생의 위험요인에는 고혈압, 당뇨, 흡연 그리고 고콜레스테롤혈증(고지혈증), 비만, 운동부족, 스트레스, 여성의 폐경, 유전적 요인으로 알려져 있으며 복합적으로 동반할 경우 질병발생의 위험도 동시에 증가한다. 관상동맥 질환으로 인한 사망률이 1996년과 비교하여 2006년에 약 2.3배의 증가율을 보임으로써 심혈관계 질환 예방이 시급함을 알 수 있다. 하지만 현재 심혈관 질환의 경우, 심장 내부 및 관상동맥을 X-선 및 초음파 촬영하여 진단하려면 발병 후에야 가능하다는 단점이 있다. 그러므로 최근에는 질환의 조기진단 및 개인별 맞춤치료에 질병과 직접 또는 간접적으로 관련 있는 유전적 특성을 활용하는 연구가 활성화되고 있다. Cardiovascular disease is one of the leading causes of death in industrialized countries and in Korea. Coronary artery disease, which is an important part of cardiovascular disease, is usually caused by blockage or narrowing of the coronary arteries that supply blood to the heart by arteriosclerosis, and insufficient blood supply to the heart muscle. Risk factors for cardiovascular disease include hypertension, diabetes, smoking and hypercholesterolemia (hyperlipidemia), obesity, lack of exercise, stress, women's menopause, and genetic factors. do. The mortality rate from coronary artery disease increased by 2.3 times in 2006 compared to 1996, suggesting that cardiovascular disease prevention is urgent. However, current cardiovascular diseases have a disadvantage that they can be diagnosed only after the onset of X-ray and ultrasound imaging of the heart and coronary arteries. Therefore, recently, researches using genetic characteristics that are directly or indirectly related to diseases have been activated for early diagnosis and personalized treatment of diseases.

단일염기다형성은 세포핵 속의 염색체가 갖고 있는 30억 개의 염기 서열 중 개인의 편차를 나타내는 한 개 또는 수십 개의 염기변이를 말한다. 개인 간의 DNA 염기순서를 비교하며 수백 염기 서열을 읽으면 개인과 개인 간의 DNA 상에 존재하는 염기쌍에 차이가 있는 다형성(polymorphism)이 나타난다. 그 중 다른 염기가 동일위치에서 발견되는 다형성을 단일염기다형성(Single Nucleotide Polymorphism, SNP)이라고 한다. 단일염기다형성은 대략 1,000개의 염기마다 1개 꼴로 나타난다. 일반 집단에서 나타나는 대립인자 가운데 소수 빈도의 대립인자가 1% 이상으로 조사될 때를 돌연변이(mutant)가 아닌 단일염기다형성이라고 말한다. 인간의 경우 염기쌍이 약 30억 개이기 때문에 적어도 100만개의 변이를 갖는다. 인간은 99.9% 유전자가 일치하지만 0.1%의 단일염기다형성 차이때문에 키와 피부색 등이 달라지게 된다. 인간마다 머리 색깔, 피부, 키, 눈 색깔 등이 다르고 같은 약을 사용해도 사람마다 반응이 제각각 다르게 나타나는 것도 모두 단일염기다형성 때문이다. Monobasic polymorphism refers to one or dozens of nucleotide variations that represent individual variation among the three billion nucleotide sequences of the chromosome in the cell nucleus. Comparing DNA sequencing between individuals and reading hundreds of sequences reveals polymorphism with differences in base pairs present on DNA between individuals. Polymorphism, in which other bases are found at the same position, is called Single Nucleotide Polymorphism (SNP). Monobasic polymorphism occurs in about 1 in approximately 1,000 bases. When a small number of alleles appear in the general population, more than 1% of alleles are said to be monobasic polymorphisms, not mutants. In humans, there are at least one million mutations because there are about three billion base pairs. In humans, 99.9% of the genes match, but the difference in height and skin color due to 0.1% polymorphism. Each person has different hair color, skin, height, and eye color, and even the same drug causes different reactions for different people.

모든 단일염기다형성가 질병을 일으키는 것은 아니지만, 단일염기다형성은 코딩 영역 서열에 발생하는 경우, 다형성 형태 중 어느 하나에 의하여 결함 있거나 변이된 단백질이 발현되어 치명적 질병을 일으킬 수 있다. 혹은 프로모터와 같은 전사조절부위 염기서열에 있는 단일염기다형성은 발현되는 유전자의 양을 조절할 수 있다. 때문에 단일염기다형성의 패턴을 분석하면 어떤 유전적 형질일 때 어떤 병이 많은지, 같은 병이라도 인종에 따라 발병 원인이 왜 다른지 등에 따라 효과적인 약물을 판단하고 맞춤 의약 및 신약 개발을 할 수 있다. 개인의 다양한 생리작용과 체질의 변화, 발병 가능성을 조기에 진단 및 예측할 수 있으며 환자에 따라 맞는 약을 진단 및 처방하여 종합적 예후 향상을 기대할 수 있다. Not all monobasic polymorphisms cause disease, but when monobasic polymorphism occurs in the coding region sequence, a defective or mutated protein may be expressed by either of the polymorphic forms, resulting in a fatal disease. Alternatively, single nucleotide polymorphisms in the transcriptional regulatory sequence such as promoters can regulate the amount of genes expressed. Therefore, by analyzing the pattern of monobasic polymorphism, it is possible to determine effective drugs and develop customized medicines and new drugs according to which genetic traits have many diseases and why the same disease causes different causes according to race. It is possible to diagnose and predict various physiological functions, changes in constitution, and the possibility of onset of the individual at an early stage, and to improve the overall prognosis by diagnosing and prescribing the appropriate medicine for each patient.

한편, 단일염기다형성 마커를 이용한 심혈관질환의 발병 위험성을 진단하는 방법이 알려져 있다. 예를 들면, 미국특허출원공개 제2007/0072821호에는 핵산 내의 단일염기다형성의 하나 이상의 대립인자를 검출하여 이의 존재 또는 부존재가 개체의 급성 관상 동맥 질환 발병(coronary event)에 대한 변경된 위험 또는 스타틴 처리에 반응할 가능성과 연관된 방법이 개시되어 있다. 또한, 한국공개특허 제2010/0049989에는 관상동맥 질환의 발병과 연관성을 갖는 단일염기다형성 마커 폴리뉴클레오티드, 그를 포함하는 마이크로어레이, 키트 및 상기 폴리뉴클레오티드 중의 단일염기다형성 뉴클레오티드를 결정하여 관상동맥 질환 발병의 변경된 위험도를 갖는 대상을 확인하는 방법을 개시하고 있고, 한국공개특허 제2006/0119737에는 심혈관 질환 진단용 다중 단일염기다형성, 그를 포함하는 마이크로어레이 및 키트를 통한 심혈관 질환 진단방법에 대해 개시하고 있다.
Meanwhile, a method of diagnosing the risk of developing cardiovascular disease using a single nucleotide polymorphism marker is known. For example, U.S. Patent Application Publication No. 2007/0072821 discloses the detection of one or more alleles of monobasic polymorphisms in a nucleic acid and the presence or absence thereof alters the risk or statin treatment of an individual's acute coronary disease. Methods associated with the possibility of responding to are disclosed. In addition, Korean Patent Publication No. 2010/0049989 discloses a single nucleotide polymorphism marker polynucleotide, a microarray including the same, a kit, and a single nucleotide polymorphism nucleotide in the polynucleotide, which is associated with the development of coronary artery disease. Disclosed is a method for identifying a subject having a changed risk, and Korean Patent Laid-Open Publication No. 2006/0119737 discloses a method for diagnosing cardiovascular disease through multiple monobasic polymorphisms for diagnosing cardiovascular disease, a microarray including the same, and a kit.

한편, Klotho는 인슐린에 대한 감도를 통해 몇 가지 제어 기능을 제공하는 유형-I 막 관통 단백질로 다양한 노화 표현형의 억제 효과를 나타내는 것으로 알려져 있는데(H. Kurosu et al., Science, 2005), 상기 Klotho를 암호화하는 유전자는 염색체 13q12에 위치해 있고, 5개의 엑손으로 구성되어 있으며, 인간 klotho 유전자 안의 10개 이상의 돌연변이 또는 단일염기다형성이 존재하는 것으로 보고되었다.
Klotho, on the other hand, is a type-I membrane-penetrating protein that provides several control functions through its sensitivity to insulin, and is known to have an inhibitory effect on various aging phenotypes (H. Kurosu et al., Science, 2005). The gene coding for is located on chromosome 13q12, consists of five exons and has been reported to have more than 10 mutations or monobasic polymorphisms in the human klotho gene.

이러한 배경하에서, 본 발명자들은 Klotho를 암호화하는 유전자에 존재하는 SNP 중에서 심혈관계 질환과 직접적으로 관련성이 있는 SNP를 규명하기 위하여 예의 연구노력한 결과, Klotho를 암호화하는 유전자에 존재하는 SNP 중에서 rs36217263이 심혈관계 질환의 발명 위험성과 관련이 있어 이를 마커로서 사용할 경우 심혈관계 질환의 발병 위험도를 예측할 수 있음을 확인하고, 본 발명을 완성하였다.
Under these backgrounds, the present inventors have made extensive efforts to identify SNPs that are directly related to cardiovascular diseases among the SNPs present in the Klotho-encoding gene. It was confirmed that the risk of developing a cardiovascular disease can be predicted by using it as a marker because it is related to the risk of invention of the disease, and the present invention was completed.

본 발명의 하나의 목적은 klotho 유전자의 단일염기다형성(SNP) 부위를 포함하는 심혈관계 질환 발병 위험도 예측용 마커를 제공하는 것이다.One object of the present invention is to provide a marker for predicting the risk of developing cardiovascular disease, including a single nucleotide polymorphism (SNP) region of the klotho gene.

본 발명의 다른 목적은 상기 마커를 검출할 수 있는 프로브 또는 프라이머를 포함하는 심혈관계 질환 발병 위험도 예측용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for predicting the risk of developing cardiovascular disease, including a probe or a primer capable of detecting the marker.

본 발명의 또 다른 목적은 상기 마커를 검출하는 단계를 포함하는 심혈관계 질환의 발병 위험에 대한 정보를 제공하는 방법을 제공하는 것이다.
Still another object of the present invention is to provide a method for providing information on the risk of developing a cardiovascular disease comprising detecting the marker.

상기 목적을 달성하기 위한 하나의 양태로서, klotho 유전자의 단일염기다형성(SNP) 부위를 포함하는 심혈관계 질환 발병 위험도 예측용 마커를 제공한다. 상기 마커는 SNP가 아닌 유전자에서 27 번째 염기(klotho 유전자의 전사시작점으로부터 -744번째 염기)인 A가 결실된 서열번호 3의 염기서열을 갖는 rs36217263에서 선택되며, 20-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드로 구성된다.
As one aspect for achieving the above object, there is provided a marker for predicting the risk of cardiovascular disease, including a single nucleotide polymorphism (SNP) region of the klotho gene. The marker is selected from rs36217263 having the nucleotide sequence of SEQ ID NO: 3, which is deleted from the 27th base (-744th base from klotho gene transcription point) in a non-SNP gene, and has a sequence of 20-100 consecutive DNA sequences. Consisting of polynucleotides or complementary polynucleotides thereof.

rs36217263:5'-gggtattctgagagatctaatcaaagtagagtgctggtttgaaattattaa-3'(서열번호 3)
rs36217263: 5'-gggtattctgagagatctaatcaaagtagagtgctggtttgaaattattaa-3 '(SEQ ID NO: 3)

본 발명에서 용어, "단일염기다형성(SNP, single nucleotide polymorphism)"이란 하나의 단일염기가 변화하여 하나의 유전자 좌위(locus)에 두 가지 이상의 대립유전자(allele)가 존재하는 유전자를 의미하는데, 이러한 SNP는 선택된 집단에서 1% 이상, 더욱 바람직하게는 10% 또는 20% 이상의 발생빈도를 나타내는 두 가지 이상의 대립유전자를 가진다. As used herein, the term "single nucleotide polymorphism (SNP)" refers to a gene in which two or more alleles exist at one locus by changing a single base. SNPs have two or more alleles that exhibit a frequency of at least 1%, more preferably at least 10% or 20%, in a selected population.

본 발명에서 용어, "대립유전자(allele)"는 상동염색체의 동일한 유전자좌위에 존재하는 한 유전자의 여러 타입을 말한다. 대립유전자는 다형성을 나타내는데 사용되기도 하며, 예컨대, SNP는 두 종류의 대립인자(biallele)를 갖는다.The term "allele " in the present invention refers to various types of genes that exist on the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example SNPs have two kinds of bialleles.

본 발명에서 용어, "SNP ID"란 1998년부터 SNP 정보를 축적하기 시작한 NCBI가 초기에 등록되는 모든 SNP에 대하여 부여한 독립된 표지자인 rs-ID를 의미한다.In the present invention, the term "SNP ID" refers to rs-ID, which is an independent marker assigned to all SNPs registered by the NCBI, which began accumulating SNP information since 1998.

본 발명의 진단용 마커를 이용하여 진단한 수 있는 심혈관계 질환은 전체 심혈관계 질환을 대상으로 하므로, 특정질환에 제한되지는 않으나, 바람직하게는 심근경색증, 협심증, 죽상경화증, 고혈압, 심부전, 동맥류, 동맥경화증, 색전증, 뇌졸중, 혈전증 등이 될 수 있다.Cardiovascular disease that can be diagnosed using the diagnostic marker of the present invention is not limited to a specific disease, because it is a whole cardiovascular disease, preferably myocardial infarction, angina pectoris, atherosclerosis, hypertension, heart failure, aneurysm, Arteriosclerosis, embolism, stroke, thrombosis and the like.

본 발명자들은 정상인 중년 한국인의 심혈관계 질환 진단용 마커를 개발하기 위하여 노화와 동맥경화와 관련이 있는 klotho 유전자의 다형성을 이용하였다. klotho 유전자의 다형성과 혈청 지질 중, 총 콜레스테롤, LDL 콜레스테롤 및 트리글리세라이드 수준과의 상관관계를 연구하였다. 혈청 지질은 대사 증후군을 포함하는 많은 질환의 지표이고, 특히 총 콜레스테롤과 LDL-콜레스테롤의 증가는 고콜레스테롤혈증, 동맥경화증, 관동맥심질환, 뇌졸중 등의 심혈관계 질환을 초래 할 수 있다. The present inventors used a polymorphism of the klotho gene associated with aging and atherosclerosis to develop a marker for diagnosing cardiovascular disease in normal middle-aged Koreans. The correlation between the polymorphism of the klotho gene and total cholesterol, LDL cholesterol and triglyceride levels in serum lipids was studied. Serum lipids are an indicator of many diseases, including metabolic syndrome, and in particular, an increase in total cholesterol and LDL-cholesterol can lead to cardiovascular diseases such as hypercholesterolemia, arteriosclerosis, coronary heart disease, and stroke.

이런 콜레스테롤의 축척을 초래하는 심혈관계 질환 진단용 마커임을 다음과 같은 입증을 통해 확인하였다. 본 발명자들은 다형성 마커를 발굴하였다. 정상인 중년 한국인을 선별하였고(실시예 1), 그들의 klotho 유전자로부터 5개의 단일염기다형성을 발굴하였고(실시예 2-1), 이 다형성의 대립형질 빈도와 콜레스테롤 수치와의 상관관계를 밝혔다(실시예 2-2). 그 결과 2개의 다형성인 klotho 유전자의 전사시작점에서 -744번째 염기 A가 결실되는 SNP(klotho rs36217263 g. A>del) 및 klotho 유전자의 전사시작점에서 +38816번째 염기 C가 T로 치환되는 SNP(klotho rs3752472 g. C>T)가 심혈관계 위험성과 유의적으로 연관되었다는 것을 밝혔다(표 3).
It was confirmed through the following proof that it is a marker for diagnosing cardiovascular diseases causing the accumulation of such cholesterol. We have discovered polymorphic markers. Normal middle-aged Koreans were selected (Example 1), five single nucleotide polymorphisms were identified from their klotho genes (Example 2-1), and the correlation between allele frequency of this polymorphism and cholesterol level was determined (Example 2-2). As a result, SNP (klotho rs36217263 g. A> del) is deleted at the start of transcription of the two polymorphic klotho genes (klotho rs36217263 g. A> del) and SNP at which the +38816 base C is replaced by T at the start of transcription of the klotho gene. rs3752472 g.C> T) was found to be significantly associated with cardiovascular risk (Table 3).

본 발명의 다른 실시양태에 의하면, 본 발명은 상기 심혈관계 질환 발병 위험도 예측용 마커를 검출할 수 있는 프로브 또는 프라이머를 포함하는 심혈관계 질환 발병 위험도 예측용 키트를 제공한다.
According to another embodiment of the present invention, the present invention provides a kit for predicting the risk of developing cardiovascular disease, comprising a probe or a primer capable of detecting the marker for predicting the risk of developing the cardiovascular disease.

본 발명의 용어, ‘프로브’란 목적하는 유전자의 표적부위와 상보적으로 결합할 수 있는 염기서열 및 상기 염기서열에 결합된 표지물질로 구성된 유전자단편, 상기 유전자단편의 변이체 등을 의미하는데, 상기 프로브를 사용하면 시료에 상기 표적부위가 존재하는지의 여부를 직접적으로 확인할 수 있다. 본 발명에서, 상기 프로브는 rs36217263에 표적부위인 A 염기가 존재하는지 또는 상기 표적부위가 결실되었는지를 확인하기 위하여 사용될 수 있다.As used herein, the term 'probe' refers to a gene fragment consisting of a base sequence capable of complementarily binding to a target site of a gene of interest and a labeling substance bound to the base sequence, a variant of the gene fragment, and the like. Probes can be used to directly determine whether the target site is present in the sample. In the present invention, the probe may be used to determine whether the target site A base is present in rs36217263 or the target site is deleted.

본 발명의 용어, ‘프라이머’란 PCR을 통하여 목적하는 유전자의 일부 영역을 증폭하기 위하여, 목적하는 유전자 영역의 말단부위에 상보적으로 결합할 수 있는 유전자단편, 상기 유전자단편의 변이체 등을 의미하는데, 대체로 15 내지 30 뉴클레오티드로 구성된다. 상기 프라이머는 목적하는 유전자 영역과 완전하게 상보적일 필요는 없으나, 상기 영역과 혼성화 할 정도로 충분히 상보적이어야 한다. 상기 프라이머를 사용하면, 목적하는 유전자 영역의 염기서열 결정, 목적하는 유전자 영역의 클로닝 등에 활용할 수 있다. 본 발명에서, 상기 프라이머는 rs36217263를 포함하는 유전자단편을 증폭시키고, 증폭된 유전자단편의 염기서열을 확인함으로써, rs36217263에 표적부위인 A 염기가 존재하는지 또는 상기 표적부위가 결실되었는지를 확인하는데 사용될 수 있다.As used herein, the term 'primer' refers to a gene fragment capable of complementarily binding to a terminal region of a desired gene region, a variant of the gene fragment, etc., in order to amplify a region of a desired gene through PCR. Usually consists of 15 to 30 nucleotides. The primer need not be completely complementary to the gene region of interest, but should be sufficiently complementary to hybridize with the region. If the primer is used, it can be used for determining the base sequence of the gene region of interest, cloning the gene region of interest. In the present invention, the primer can be used to confirm whether the target site A or the target site is deleted in the rs36217263 by amplifying the gene fragment containing rs36217263 and confirming the nucleotide sequence of the amplified gene fragment. have.

상기 프로브 또는 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
The probe or primer can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, "capsulation", substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonate, phosphoester, Phosphoramidate, carbamate, and the like) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.).

한편 상기 키트의 형태는 특별히 이에 제한되지 않으나, klotho 유전자의 SNP, 바람직하게는 rs36217263을 검출할 수 있는 RT-PCR 키트, DNA 칩 키트 등이 될 수 있다. 예를 들어, 본 발명의 키트는 시료에서 발현된 klotho 유전자의 rs36217263을 분석하기 위하여, 시료에 포함된 klotho mRNA로부터 cDNA를 합성하고, 합성된 cDNA를 증폭시킨 다음, 증폭된 cDNA의 염기서열을 확인할 수 있는 RT-PCR 키트가 될 수 있다. 상기 RT-PCR 키트는 klotho 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 RT-PCR 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다. On the other hand, the form of the kit is not particularly limited, but may be an RT-PCR kit, DNA chip kit, etc., capable of detecting the SNP of the klotho gene, preferably rs36217263. For example, the kit of the present invention synthesizes cDNA from klotho mRNA contained in the sample, amplifies the synthesized cDNA, and then identifies the nucleotide sequence of the amplified cDNA in order to analyze the rs36217263 of the klotho gene expressed in the sample. Can be an RT-PCR kit. The RT-PCR kit includes RT-PCR test tubes or other appropriate containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases in addition to individual primer pairs specific for the klotho gene. And enzymes such as reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also include primer pairs specific for the gene used as a quantitative control.

또 다른 예로서, 본 발명의 키트는 시료에서 발현된 klotho 유전자의 rs36217263을 분석하기 위하여, 시료에 포함된 klotho 유전자의 rs36217263에 직접적으로 결합할 수 있는 프로브를 포함하는 DNA 칩 키트가 될 수 있다. 상기 DNA 칩 키트는 상기 rs36217263에 해당하는 klotho 유전자의 전사시작점에서 -744번째 염기(A)가 존재하는 유전자단편과 상보적으로 결합할 수 있는 프로브 및 상기 -744번째 염기(A)가 결실된 유전자 단편과 상보적으로 결합할 수 있는 프로브 중의 어느 하나만을 포함하거나 또는 상기 두가지 프로브를 모두 포함하는 기판을 포함할 수 있고, 상기 기판은 상기 프로브 이외에도, 별도의 정량 대조군 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다. 아울러, 상기 DNA 칩 키트에 시료를 가하여 rs36217263을 분석하는 방법은 공지된 방법에 의하여 수행될 수 있는데, 예를 들어, 핵산 시료를 형광 물질 예를 들면 Cy3 및 Cy5와 같은 물질을 포함하는 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지한 다음, 상기 DNA 칩 상에 혼성화하고 상기 표지 물질로부터 발생하는 신호를 검출함으로써 혼성화 결과를 검출할 수 있다.
As another example, the kit of the present invention may be a DNA chip kit including a probe capable of directly binding to rs36217263 of the klotho gene included in the sample to analyze the rs36217263 of the klotho gene expressed in the sample. The DNA chip kit includes a probe capable of complementarily binding to a gene fragment in which the -744th base (A) is present at the transcription start point of the klotho gene corresponding to rs36217263 and the gene in which the -744th base (A) is deleted. It may include a substrate comprising only one of the probes that can bind complementarily to the fragment or both of the probes, and the substrate, in addition to the probe, the cDNA corresponding to a separate quantitative control gene or fragment thereof It may include. In addition, a method of analyzing rs36217263 by adding a sample to the DNA chip kit may be performed by a known method. For example, a nucleic acid sample may be detected by a fluorescent signal, for example, a detectable signal including a substance such as Cy3 and Cy5. The hybridization results can be detected by labeling with a labeling substance capable of generating the hybridization, and then hybridizing on the DNA chip and detecting a signal generated from the labeling substance.

본 발명의 또 다른 실시양태에 의하면, 본 발명은서열번호 3의 염기서열을 갖는 rs36217263에서 선택되며, 27 번째 염기(klotho 유전자의 전사시작점으로부터 -744번째 염기)가 A이거나 결실된, 20-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 포함하는 심혈관계 질환 발병 위험도 예측용 마이크로어레이를 제공한다.
According to another embodiment of the invention, the invention is selected from rs36217263 having the nucleotide sequence of SEQ ID NO: 3, wherein the 27th base (-744th base from the transcription start point of the klotho gene) is A or deleted; A microarray for predicting the risk of developing cardiovascular disease comprising a polynucleotide consisting of two consecutive DNA sequences or a complementary polynucleotide thereof is provided.

본 발명의 또 다른 실시양태에 의하면, 본 발명은 상기 마커 또는 키트를 이용하여 심혈관계 질환 발병 위험에 대한 정보를 제공하는 방법을 제공한다. 구체적으로, 본 발명의 심혈관계 질환 발병 위험에 대한 정보를 제공하는 방법은 (a) 검체로부터 DNA를 수득하는 단계; (b) 상기 수득한 DNA로부터 서열번호 3의 27번째 염기(klotho 유전자의 전사시작점으로부터 -744번째 염기)의 다형성 부위를 증폭하거나 프로브와 혼성화하는 단계; 및 (c) 상기 증폭된 또는 혼성화된 다형성 부위의 염기를 확인하고, 이에 따라 심혈관계 질환 발병 위험도를 분석하는 단계를 포함한다. 이때, 상기 서열번호 3의 27번째 염기가 A인 경우 심혈관계 질환의 발병 위험도가 낮은 것으로 판단하고, 상기 서열번호 3의 27번째 염기가 결실된 경우 심혈관계 질환의 발병 위험도가 높은 것으로 판단한다.
According to another embodiment of the present invention, the present invention provides a method of providing information on risk of developing cardiovascular disease using the marker or kit. Specifically, the method for providing information on the risk of developing a cardiovascular disease of the present invention comprises the steps of (a) obtaining DNA from a sample; (b) amplifying or hybridizing the polymorphic site of the 27th base of SEQ ID NO: 3 (the -744th base from the transcription start point of the klotho gene) from the obtained DNA; And (c) identifying the base of the amplified or hybridized polymorphic site and thus analyzing the risk of developing cardiovascular disease. In this case, when the 27th base of SEQ ID NO: 3 is A, it is determined that the risk of developing cardiovascular disease is low, and when the 27th base of SEQ ID NO: 3 is deleted, the risk of developing cardiovascular disease is determined to be high.

본 발명의 용어, "검체"란 심혈관계 질환의 발병을 예측하기 위한 대상 인간으로, DNA의 수득은 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료로부터 DNA를 수득할 수 있으나, 이에 제한되지는 않는다.
As used herein, the term "sample" is a subject human for predicting the development of a cardiovascular disease, wherein obtaining DNA is obtained from a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine. It may be, but is not limited thereto.

본 발명의 심혈관계 질환의 발병가능성에 대한 정보를 제공하는 방법에 있어서, DNA 또는 mRNA로부터 rs36217263의 서열을 확인하는 단계는 특별히 이에 제한되지 않으나, 검체로부터 수득한 DNA 중에서 rs36217263를 포함하는 DNA 부위를 증폭시킨 다음, 증폭된 DNA 부위의 염기서열을 확인함에 의하여 수행하거나, 검체로부터 수득한 mRNA로부터 cDNA를 합성하고 합성된 cDNA중에서 rs36217263를 포함하는 DNA 부위를 증폭시킨 다음, 증폭된 DNA 부위의 염기서열을 확인함에 의하여 수행하거나 또는 검체로부터 수득한 DNA를 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지하고 표지된 DNA를 klotho 유전자의 rs36217263에 직접적으로 결합할 수 있는 프로브를 포함하는 DNA 칩에 가하여 혼성화시킨 다음 그 결과를 분석함에 의하여 수행할 수 있으며, 그 외 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화 기법(dynamic allele-specifichybridization, DASH), PCR 연장 분석, SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예를 들면, Sequenom의 MassARRAY 시스템), 미니-시퀀싱(mini-sequencing) 방법, Bio-Plex 시스템(BioRad), CEQ and SNPstream 시스템(Beckman), Molecular Inversion Probe 어레이 기술(예를 들면, Affymetrix GeneChip), 및 BeadArray Technologies(예를 들면, Illumina GoldenGate 및 Infinium 분석법) 등이 사용될 수 있다.
In the method for providing information on the incidence of the cardiovascular disease of the present invention, the step of identifying the sequence of rs36217263 from DNA or mRNA is not particularly limited, but DNA region comprising rs36217263 in the DNA obtained from the sample After amplification, it is carried out by confirming the nucleotide sequence of the amplified DNA site, or synthesizes cDNA from mRNA obtained from the sample, amplifies the DNA site including rs36217263 in the synthesized cDNA, and then sequence of the amplified DNA site. DNA obtained from the sample or hybridized by labeling the DNA obtained from the sample with a labeling substance capable of generating a detectable signal and adding the labeled DNA to a DNA chip comprising a probe capable of directly binding to rs36217263 of the klotho gene. By analyzing the results and then allele specific Allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis, SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method, Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies ( For example, Illumina GoldenGate and Infinium assays) can be used.

아울러, 심혈관계 질환의 발병가능성에 대한 정보를 제공함에 있어서 오차의 발생확율을 감소시키기 위하여, 상기 rs36217263 이외의 다른 SNP의 서열을 확인하고, 이로부터 심혈관계 질환의 발병가능성을 판정하는 단계를 추가로 포함할 수 있다. 이때, 사용되는 SNP는 특별히 이에 제한되지 않으나, 서열번호 4의 염기서열을 갖는 rs3752472에서 선택되며, 27번째 염기(klotho 유전자의 전사시작점으로부터 +38816번째 염기)를 포함하는 염기서열을 사용함이 바람직하다.
In addition, in order to reduce the probability of error in providing information on the incidence of cardiovascular disease, the step of identifying the sequence of other SNPs other than the rs36217263, from which to determine the onset of cardiovascular disease It can be included as. In this case, the SNP to be used is not particularly limited thereto, but is selected from rs3752472 having a nucleotide sequence of SEQ ID NO: 4, and it is preferable to use a nucleotide sequence including a 27th base (+38816 base from the transcription start point of the klotho gene). .

rs3752472:5'-gcttccctcctttacctgaaaatcagtccctagaagggacatttccctgtga-3'(서열번호 4)
rs3752472: 5'-gcttccctcctttacctgaaaatcagtccctagaagggacatttccctgtga-3 '(SEQ ID NO: 4)

상기 DNA 또는 mRNA로부터 검체의 유전자에 존재하는 rs3752472의 서열을 확인하는 방법은 특별히 이에 제한되지 않으나, 검체로부터 수득한 DNA 중에서 rs3752472를 포함하는 DNA 부위를 증폭시킨 다음, 증폭된 DNA 부위의 염기서열을 확인함에 의하여 수행하거나, 검체로부터 수득한 mRNA로부터 cDNA를 합성하고 합성된 cDNA중에서 rs3752472를 포함하는 DNA 부위를 증폭시킨 다음, 증폭된 DNA 부위의 염기서열을 확인함에 의하여 수행하거나 또는 검체로부터 수득한 DNA를 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지하고 표지된 DNA를 klotho 유전자의 rs3752472에 직접적으로 결합할 수 있는 프로브를 포함하는 DNA 칩에 가하여 혼성화시킨 다음 그 결과를 분석함에 의하여 수행할 수 있다.The method of confirming the sequence of rs3752472 present in the gene of the sample from the DNA or mRNA is not particularly limited, but amplifies the DNA region including rs3752472 in the DNA obtained from the sample, and then the nucleotide sequence of the amplified DNA region is amplified. DNA obtained from a sample by synthesizing a cDNA from mRNA obtained from a sample, amplifying a DNA region containing rs3752472 in the synthesized cDNA, and then confirming a nucleotide sequence of the amplified DNA region, or a DNA obtained from a sample. Can be performed by labeling with a labeling substance capable of generating a detectable signal, hybridizing the labeled DNA to a DNA chip containing a probe capable of directly binding to rs3752472 of the klotho gene, and then analyzing the result. .

상기 확인된 rs3752472의 서열로부터 심혈관계 질환의 발병가능성을 판정하는 단계는 특별히 이에 제한되지 않으나, 검체로부터 수득한 DNA 또는 mRNA로부터 검체의 유전자에 존재하는 rs3752472의 서열을 확인하여, 상기 rs3752472의 서열이 C인 경우에는 심혈관계 질환의 발병가능성이 낮은 것으로 판정하고, 상기 rs3752472의 서열이 T인 경우에는 심혈관계 질환의 발병가능성이 높은 것으로 판정함에 의하여 수행된다.
Determining the incidence of cardiovascular disease from the identified sequence of rs3752472 is not particularly limited, but the sequence of rs3752472 is identified by checking the sequence of rs3752472 present in the gene of the sample from DNA or mRNA obtained from the sample. In the case of C, it is determined that the incidence of cardiovascular disease is low, and in the case where the sequence of rs3752472 is T, the incidence of cardiovascular disease is high.

본 발명의 klotho 유전자의 SNP를 이용하면, 심혈관계 질환이 발병할 수 있는 유전적 소인을 조기에 확인할 수 있으므로, 심혈관계 질환의 예방 및 조기진단에 널리 활용될 수 있을 것이다.
By using the SNP of the klotho gene of the present invention, genetic predisposition to develop cardiovascular disease can be identified early, and thus, it can be widely used for prevention and early diagnosis of cardiovascular disease.

도 1의 A는 5개의 klotho 유전자의 단일염기다형성의 위치를 나타내는 그림이고, 도 1의 B는 5개의 klotho 유전자의 단일염기다형성 사이의 연관 불균형 계수를 나타낸 표이다.
도 2의 A는 간세포주 HepG2에서 klotho 유전자의 단일염기다형성 중 -744A/del 단일염기다형성의 프로모터 어쎄이 결과를 나타내는 그림이고, 도 2의 B는 인간 배아신장 293 세포에서 klotho 유전자의 단일염기다형성 중 -744A/del 단일염기다형성의 프로모터 어쎄이 결과를 나타내는 그림이다.
도 3은 간세포주 HepG2안에서 klotho 억제제 여부로 인한 phospho HMG CoA 환원효소의 발현양의 차이를 보여주는 웨스턴 블랏 결과를 나타내는 그림이다.
FIG. 1A is a diagram showing the positions of single nucleotide polymorphisms of five klotho genes, and FIG.
FIG. 2A is a diagram showing the promoter assay result of -744A / del monobasic polymorphism during mononucleotide polymorphism of klotho gene in hepatocyte line HepG2, and FIG. 2B is the monobasic polymorphism of klotho gene in human embryonic kidney 293 cells. Figure shows the promoter assay results of -744A / del monobasic polymorphism.
Figure 3 is a diagram showing the Western blot results showing the difference in the expression of phospho HMG CoA reductase due to the presence of a klotho inhibitor in the hepatocyte line HepG2.

이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예Example 1: 실험 대상의 선정 및 특징 파악 1: Selection of test subject and understanding of characteristics

대상체는 대전한방병원과 원광한방병원에서 모집하였다. 당뇨병(type-2 당뇨병), 고지혈증(dyslipidemia), 관동맥심질환 및 간/신장 기능 장애를 갖는 대상체는 유전적 인자를 찾는데서 제외하였다. 대상체가 의학적 약물을 복용할 경우, 대사 증후군에 영향을 주므로 역시 제외하였다. 최종적으로 223명 남성과 286명 여성 중 491명을 대상으로 분석하였고, 대상체의 평균 나이는 62.15살이었다. 대상체들의 전반적인 임상적/신체적 특징은 하기의 표 1에 기술하였다. 본 연구는 대상체에게 사전 동의를 구한 후 진행하였고, 각 병원과 한국한의학연구원에서 승인하였다.
Subjects were recruited from Daejeon Oriental Medicine Hospital and Wonkwang Oriental Medicine Hospital. Subjects with diabetes (type-2 diabetes), dyslipidemia, coronary heart disease and liver / kidney dysfunction were excluded from finding genetic factors. If the subject took medical medication, it also excluded metabolic syndrome as it affected. Finally, 491 of 223 males and 286 females were analyzed. The average age of the subjects was 62.15 years. The overall clinical / physical characteristics of the subjects are described in Table 1 below. This study was conducted after obtaining prior consent from the subjects, and was approved by each hospital and Korea Institute of Oriental Medicine.

Figure pat00001
Figure pat00001

실시예Example 2:  2: KlothoKlotho 유전자 상에On genes 존재하는 단일염기다형성  Monobasic polymorphisms present 마커Marker 동정 Sympathy

실시예Example 2-1:  2-1: RTRT -- PCRPCR 분석 및 단일염기다형성 동정 Analysis and Identification of Monobasic Polymorphism

Taqman 기법을 이용하여 klotho 유전자의 5개의 단일염기다형성 유전자형 분석을 수행하였다. Taqman? 유전자형 마스터 키트(Applied Biosystems)로 PCR을 수행하였다. 게놈 DNA 10ug에 프로브 프라이머 1pmol, PCR 프라이머 각 2pmol 및 2?master mix를 가하여 전체 용량이 20ul되게 PCR 혼합액을 제조하였다. 이어, 상기 혼합액을 95℃ 30초, 68℃ 2분에서 60회 반응하여 PCR을 수행하였다. PCR에 사용된 PCR 프라이머와 프로브 프라이머의 구체적인 염기서열은 하기 표 2 및 표 3에 기재하였다.
Five monobasic polymorphism genotyping of the klotho gene was performed using Taqman technique. Taqman? PCR was performed with genotype master kit (Applied Biosystems). 1 pmol of the probe primer, 2 pmol of each of the PCR primers and 2 master mix were added to 10 ug of genomic DNA to prepare a PCR mixture solution with a total volume of 20 ul. Subsequently, the mixture was reacted 60 times at 95 ° C. for 30 seconds and 68 ° C. for 2 minutes to perform PCR. Specific base sequences of the PCR primers and probe primers used for PCR are described in Tables 2 and 3 below.

SNP 유전형 분석용 PCR 프라이머PCR primers for SNP genotyping SNPSNP 프라이머 염기서열(5-3)Primer Sequence (5-3) 서열번호SEQ ID NO: rs36217263rs36217263 정방향Forward ttcaccagggtattctgagagatctttcaccagggtattctgagagatct 55 역방향Reverse gggttttgctctcccttttactgttgggttttgctctcccttttactgtt 66 rs1207568rs1207568 정방향Forward cctggagcggcttcgtcctggagcggcttcgt 77 역방향Reverse gggcccggcaggatgggcccggcaggat 88 rs3752472rs3752472 정방향Forward gatagagaaaaatggcttccctccttgatagagaaaaatggcttccctcctt 99 역방향Reverse caagcaaagtcacagggaaatgtccaagcaaagtcacagggaaatgtc 1010 rs7323281rs7323281 정방향Forward cccgtagcacctcactgtcccgtagcacctcactgt 1111 역방향Reverse tgtttctcatcaagcctaacttaatgacttgtttctcatcaagcctaacttaatgact 1212 rs564481rs564481 정방향Forward agccccagatcgctttactcagccccagatcgctttactc 1313 역방향Reverse cagtccagggagaagcgaaaacagtccagggagaagcgaaaa 1414 rs648202rs648202 정방향Forward gcctgccctttctcccaaaagcctgccctttctcccaaaa 1515 역방향Reverse ccagccagccaatgtcaaattcccagccagccaatgtcaaattc 1616

SNP 유전형 분석용 프로브 프라이머Probe primer for SNP genotyping SNPSNP 프로브 염기서열(5-3)Probe Sequence (5-3) 서열번호SEQ ID NO: rs36217263rs36217263 VICVIC ccagcactcta-ctttgaccagcactcta-ctttga 1717 FAMFAM cagcactctatctttgacagcactctatctttga 1818 rs1207568rs1207568 VICVIC ccgaccaactttccccgacccgaccaactttccccgac 1919 FAMFAM cgaccaacttttcccgaccgaccaacttttcccgac 2020 rs3752472rs3752472 VICVIC acctgaaaatcagcccctagacctgaaaatcagcccctag 2121 FAMFAM cctgaaaatcagtccctagcctgaaaatcagtccctag 2222 rs7323281rs7323281 VICVIC agctagaaccaatacattatagctagaaccaatacattat 2323 FAMFAM ctagaaccaacacattatctagaaccaacacattat 2424 rs564481rs564481 VICVIC tgtgtaacgtgcatttctgtgtaacgtgcatttc 2525 FAMFAM tgtgtaacatgcatttctgtgtaacatgcatttc 2626 rs648202rs648202 VICVIC caaaactctctcggccacccaaaactctctcggccacc 2727 FAMFAM caaaactctctcagccacccaaaactctctcagccacc 2828

PCR 증폭 후에 대립유전자의 대립형질변별(allelic discrimination)도 같은 기계에서 수행하였다(ABI 7900HT). 플레이트를 읽는 동안 SDS v2.4 소프트웨어로 흡광을 측정하여 계산하였고, 각 웰로부터의 신호에서 기반된 Rn 값을 표지하였다. 그 후 자동 또는 수동 대립유전자 호출(call)로 플레이트를 분석하였다(도 1의 A). 도 1의 A는 5개의 klotho 유전자의 단일염기다형성의 위치를 나타내는 그림이다. After PCR amplification, allelic discrimination of alleles was also performed on the same machine (ABI 7900HT). Absorption was calculated by measuring SDS v2.4 software while reading the plate and labeled based on the Rn value in the signal from each well. Plates were then analyzed by automatic or manual allele call (A in FIG. 1). 1A is a diagram showing the position of the single nucleotide polymorphism of five klotho genes.

Real time PCR로 대상체의 프로모터와 코딩영역 위치에 있는 염색체 13q12 위치에 존재하는 klotho 유전자의 단일염기다형성 유전자형 분석으로 5개를 분류하여 코딩엑손은 검정 블락, 3‘UTR은 흰 블락으로 그 위치를 도 1의 A에 나타내고 각각의 특징을 하기의 표 4에 나타내었다. 5개의 단일염기다형성 rs36217263; 프로모터, rs1207568; 프로모터, rs3752472; 엑손 3, rs564481; 엑손 4 및 rs648202; 엑손 4이었다.
Real-time PCR was used to classify five genes by single-nucleotide polymorphism genotyping of the klotho gene at the chromosome 13q12 at the promoter and coding region. The coding exons were identified as black blocks and 3'UTRs as white blocks. It is shown in A of 1 and each characteristic is shown in Table 4 below. Five monobasic polymorphisms rs36217263; Promoter, rs1207568; Promoter, rs3752472; Exon 3, rs564481; Exon 4 and rs648202; Exon 4 was.

Figure pat00002
Figure pat00002

한편, 프로모터 지역의 2개의 단일염기다형성 중, A가 삽입/결실된 것과, G가 A로 변화한 것을 검색하고, 엑손 지역의 3개의 단일염기다형성 중, 이중 표현형이 있는 것으로, +38816 위치의 염기 C가 T로 변이되면서 아미노산이 프롤린(P)에서 세린(S)으로 바뀐, 비동의 다형성(nonsynonymous polymorphism)을 검색하였다.
On the other hand, among two single nucleotide polymorphisms in the promoter region, A was inserted / deleted and G changed to A, and among the three single nucleotide polymorphisms in the exon region, there was a double phenotype, Nonsynonymous polymorphism was searched for the amino acid from proline (P) to serine (S) as the base C was changed to T.

국제 합맵 프로젝트(HapMap project)로부터 나타낸 모든 klotho 유전자의 단일염기다형성은 하디바인베르크평형(Hardy-Weinverg Equilibrium, HWE)을 만족하여(p>0.01) 개체간의 집단 내 각 위치의 평형성(equilibrium)을 갖는 것을 확인할 수 있었다. Klotho 다형성 중 5개의 단일염기다형성의 각기 두 대립형질 사이에서 발생할 수 있는 모든 쌍의 연관 불평형(Linkage disequilibrium, LD) 계수(coefficients)는 r2<0.5이었고, 이는 한국인 대상체에 대해서 이 단일염기다형성 서로간의 연관성이 없다는 것을 의미하는 것으로 분석되었다(도 1의 B). 도 1의 B는 5개의 klotho 유전자의 단일염기다형성 사이의 연관 불균형 계수를 나타낸 표이다.The single nucleotide polymorphism of all klotho genes from the HapMap project satisfies the Hardy-Weinverg Equilibrium (HWE) (p> 0.01) with equilibrium of each position in the population between individuals. I could confirm that. All pairwise linkage disequilibrium (LD) coefficients that could occur between each of the two alleles of the five monobasic polymorphisms of the Klotho polymorphism were r2 <0.5, which is true for Korean subjects. It was analyzed to mean no association (FIG. 1B). FIG. 1B is a table showing the linkage disequilibrium coefficients between single nucleotide polymorphisms of five klotho genes.

도 1의 B에서 보듯이, 정상인 한국인 중년 대상체 내에 하디바인베르크평형(Hardy-Weinverg Equilibrium, HWE)을 만족하여 유전자 분석 결과에 오류가 없다는 것을 증명할 수 있었고, 서로간의 연관성 없이 서로 독립적으로 존재하는 5개의 단일염기다형성을 발견하였다.
As shown in B of FIG. 1, it was possible to prove that there was no error in the genetic analysis result by satisfying the Hardy-Weinverg Equilibrium (HWE) in a normal Korean middle-aged subject, and exist independently of each other without being related to each other. Monobasic polymorphism was found in dogs.

실시예Example 2-2: 단일염기다형성과 혈액 내 콜레스테롤 지수와의 연관성 분석 2-2: Analysis of association between monobasic polymorphism and cholesterol index in blood

실시예 2-1에서 얻은 5개의 단일염기다형성 중, 혈청 지질과 통계학적으로 유의미함을 알아보기 위해 통계분석을 수행하였다. Of the five monobasic polymorphisms obtained in Example 2-1, statistical analysis was performed to determine the statistical significance with serum lipids.

구체적으로, 대조군 대상체 안에서의 단일염기다형성 평형을 결정하기 위하여 하디바인베르크평형(HWE)을 P값≥0.05로 수행하였다. 일배체형(haplotype)과 그들의 빈도(frequency)는 알고리즘(HapAnalyzer, http://hap.ngri.go.kr)을 사용하여 추론하였다. 데이터는 SAS소프트웨어(SAS institute Inc.)로 통계학적으로 분석하였다. 연속적변이(continuous variable)는 성별, 나이, 흡연, 음주 및 고혈압으로 보정된 일반 선형 모델 분석에 의해 구하였고, 통계적 유의도(statistical significance)는 p<0.05로 설정하였다. Specifically, Hardyweinberg equilibrium (HWE) was performed with a P value ≧ 0.05 to determine monobasic polymorphism equilibrium in control subjects. Haplotypes and their frequencies were inferred using an algorithm (HapAnalyzer, http://hap.ngri.go.kr). Data was statistically analyzed with SAS software (SAS institute Inc.). Continuous variables were obtained by general linear model analysis corrected for sex, age, smoking, drinking, and hypertension, and statistical significance was set to p <0.05.

상기 분석에 따라, 각각의 5개의 단일염기다형성과 각각의 혈청 지질(serum lipid) 수준을 비교한 것을 하기의 표 5에 나타내었다.
According to the above analysis, each of the five monobasic polymorphisms and the respective serum lipid levels are shown in Table 5 below.

Figure pat00003
Figure pat00003

상기 표 5에서 혈청 지질은 각각 총 콜레스테롤, 트리글리세라이드, HDL-콜레스테롤 및 LDL-콜레스테롤을 포함한다. 60세 이하 연령의 한국인 중, 성별, 나이, 흡연, 음주 및 고혈압으로 보정된 혈청 지질과 klotho 다형성의 공분산(covariance) 분석에 관해 나타내었다. 대상체의 수(평균 ± 표준편차) 및 3개의 대안 모델(공우성, 우성, 열성)의 P값을 나타내었다. 고딕체로 나타낸 수치는 P값이 0.05 이하로서 통계적으로 중요한 연관성이 있음을 의미한다. 상기 표 3에서 C/C, C/R 및 R/R은 동형접합체를 일반적인(common, C) 대립형질로, 이형접합체 및 동형접합체를 희귀한(rare,R) 대립형질로 각각 나눈 값을 의미하고, ND는 수가 너무 작아서 통계적으로 분석할 수 없는 값을 의미한다.Serum lipids in Table 5 include total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol, respectively. Covariance analysis of serum lipids and klotho polymorphism corrected for sex, age, smoking, drinking and hypertension among Koreans under 60 years of age was presented. The number of subjects (mean ± standard deviation) and P values of three alternative models (gong, dominant, recessive) are shown. Gothic values indicate a statistically significant association with P values of 0.05 or less. In Table 3, C / C, C / R, and R / R refer to values obtained by dividing homozygotes into common (common, C) alleles, heterozygotes, and homozygotes into rare (Rare, R) alleles, respectively. ND means a value that is too small for statistical analysis.

상기 표 5에서 보듯이, 통계분석으로 rs36217263의 혈청 지질과 연관성을 통계학적으로 유의미함을 알 수 있었고, rs3752472도 연관성의 경향이 있었다. 성별, 나이, 흡연, 음주 및 고혈압으로 보정된 AA타입의 대상체와 rs36217263(-744A>del)의 대상체를 비교했을 때, rs36217263(-744A>del)의 대상체의 총콜레스테롤 수준과 LDL-콜레스테롤 수준이 매우 증가하였으며, 각각 우성 모델(dominant model) 중 p=0.005 및 p=0.032인 통계학적으로 유의미한 값을 가진다. 또한 혈청 트리글리세라이드도 rs36217263(-744A>del)의 대상체의 경우 증가하는 경향을 보임을 알 수 있었다(p=0.065). 다른 단일염기다형성인 rs3752472(=C38816T)의 경우, 성별, 나이, 흡연, 음주 및 고혈압으로 보정된 CC타입과 비교했을 때, rs3752472(=C38816T)의 대상체의 LDL-콜레스테롤이 증가하는 경향을 나타내었다(p=0.056).
As shown in Table 5, the statistical analysis showed that the association with the serum lipids of rs36217263 was statistically significant, rs3752472 also tended to be related. When comparing subjects of type rs36217263 (-744A> del) to those of type AA corrected for sex, age, smoking, drinking, and hypertension, the total cholesterol and LDL-cholesterol levels of subjects of rs36217263 (-744A> del) The number increased significantly, with statistically significant values of p = 0.005 and p = 0.032 in the dominant model, respectively. Serum triglycerides also showed a tendency to increase in the subjects of rs36217263 (-744A> del) (p = 0.065). For other monobasic polymorphisms, rs3752472 (= C38816T), there was a tendency to increase LDL-cholesterol in subjects of rs3752472 (= C38816T) compared to CC type corrected for sex, age, smoking, drinking and hypertension. (p = 0.056).

이 결과로 klotho 유전자의 기능상의 단일염기다형성이 중년의 대상체에서 혈청 콜레스테롤의 증가에 영향을 줄 수 있음을 알 수 있었다. 구체적으로, 실시예 2-1에서 찾은 5개의 klotho 유전자의 단일염기다형성 중 두 종류의 rs36217263(-744A>del)와 rs3752472(=C38816T)의 경우 혈청 콜레스테롤의 증가에 영향을 줄 수 있음을 발견하였다. 그 중에서 통계학적으로 더 유의미한 값을 가지는 klotho 유전자의 rs36217263(-744A>del) 단일염기다형성을 발견하였다. 이러한 결과는 rs36217263 단일염기다형성을 마커로 사용하여 동맥경화증과 같은 심혈관계 질환의 발명 위험도를 예측할 수 있음을 나타내는 것으로 분석되었다.
As a result, it was found that the functional monobasic polymorphism of the klotho gene may influence the increase of serum cholesterol in middle-aged subjects. Specifically, it was found that two types of rs36217263 (-744A> del) and rs3752472 (= C38816T) among the single nucleotide polymorphisms of the five klotho genes found in Example 2-1 may affect the increase of serum cholesterol. . Among them, rs36217263 (-744A> del) single nucleotide polymorphism of klotho gene was found. These results indicate that rs36217263 single nucleotide polymorphism can be used as a marker to predict the risk of invention of cardiovascular diseases such as atherosclerosis.

실시예Example 3: 프로모터 분석 3: promoter analysis

Klotho 유전자의 프로모터 활성에 대한 프로모터 위치의 rs36217263(-744A>del) 다형성 효과를 증명하기 위해 프로모터 리포터 분석을 수행하였다.
A promoter reporter assay was performed to demonstrate the rs36217263 (-744A> del) polymorphic effect of promoter location on promoter activity of Klotho gene.

구체적으로, -800부터 -1의 위치의 klotho 프로모터 지역을 하기의 프라이머를 이용하여 PCR로 증폭시켜서 준비하였다.
Specifically, the klotho promoter region of -800 to -1 position was prepared by amplification by PCR using the following primers.

정방향 프라이머 5'-gcacagattacctgctaagt-3'(서열번호 1)Forward primer 5'-gcacagattacctgctaagt-3 '(SEQ ID NO: 1)

역방향 프라이머 5'-ccgaagcttgggagccaggctccggggccc-3'(서열번호 2)
Reverse primer 5'-ccgaagcttgggagccaggctccggggccc-3 '(SEQ ID NO: 2)

그런 다음, rs36217263(-744A>del)과 -744A의 게놈 DNA를 PCR을 이용해 증폭한 klotho 프로모터 지역을 luciferase(Luc) 유전자를 포함하는 pGL3-기본 벡터 안으로 삽입하였다.(벡터이름이 도면과 본문이 다르오니 확인 부탁드립니다.) 루시퍼라제 어쎄이는 듀얼-루이퍼라제 리포터 어쎄이 시스템(Dual-Luciferase Reporter Assay System)과 루미노메터 GLO/Max 루미노메터(Luminometor GLO/Max luminometer)를 사용하여 형질주입 48시간 후에 수행하였다. 해당값은 기본(basal) 프로모터의 발현양과 비교하여 도 2에 나타내었다.
Then, the klotho promoter region, which was amplified by PCR with genomic DNA of rs36217263 (-744A> del) and -744A, was inserted into the pGL3-basic vector containing the luciferase (Luc) gene. Luciferase Assay is transfected using Dual-Luciferase Reporter Assay System and Luminometer GLO / Max Luminometer 48 It was performed after hours. The corresponding values are shown in FIG. 2 compared to the expression level of the basal promoter.

프로모터 리포터 분석은 간세포주인 HepG2 및 인간 배아 신장 293 세포에서 수행하였다. 먼저, 간세포주인 HepG2 관련 프로모터 활성은 -744A 타입과 비교 했을 때 rs36217263(-744A>del)에서 상당히 감소(흡광도의 감소를 통해 판단가능)하였다(도 2의 A). rs36217263(-744A>del)의 다향성 프로모터 활성은 인간 배아(embryonic) 신장 293 세포(도 2의 B) 안에서도 같은 양상을 보였다. 이 결과는 rs36217263(-744A>del) 타입 대상체들이 -744A타입보다 낮은 klotho 발현 수준을 갖는 것을 나타내었다.
Promoter reporter assays were performed on the hepatocyte lines HepG2 and human embryonic kidney 293 cells. First, hepG2-associated promoter activity of hepatocytes was significantly reduced (determined by the decrease in absorbance) in rs36217263 (-744A> del) as compared to the -744A type (FIG. 2A). The multidirectional promoter activity of rs36217263 (-744A> del) showed the same pattern in human embryonic kidney 293 cells (B of FIG. 2). This result indicated that rs36217263 (-744A> del) type subjects had lower klotho expression levels than the -744A type.

상기 결과로 부터, klotho 유전자의 단일염기다형성 중, 통계학적으로 더 유의미한 수치를 가지고 콜레스테롤 수치의 증가에 영향을 주는 rs36217263(-744A>del)의 경우, 낮은 klotho 발현 수준을 갖는 것을 알 수 있었고, 실시예 3과 관련하여 klotho의 활성 감소가 콜레스테롤 수준의 증가를 야기한다는 것을 알 수 있었다.
From the above results, it was found that rs36217263 (-744A> del), which has a statistically significant value among the single nucleotide polymorphisms of the klotho gene, influences the increase of cholesterol level, has a low klotho expression level. In connection with Example 3, it can be seen that the decrease in the activity of klotho causes an increase in cholesterol levels.

실시예Example 4:  4: 웨스턴Western 블랏Blot 분석 analysis

Klotho 활성의 감소가 콜레스테롤 수준의 증가를 야기함을 확증하기 위해, klotho 억제제인 D-saccharic acid 1,4-lactone으로, HMG-CoA 환원 효소의 활성과 발현수준의 변화를 각각 분석하였다.In order to confirm that the decrease of Klotho activity caused the increase of cholesterol level, the activity and expression level of HMG-CoA reductase were analyzed with klotho inhibitor D-saccharic acid 1,4-lactone, respectively.

HMG-CoA 환원 효소는 간세포주인 HepG2 세포안의 콜레스테롤 합성의 주요 효소이다. HMG-CoA 환원 효소의 mRNA 수준은 인슐린 단독 혹은 인슐린과 D-saccharic acid 1,4-lactone을 같이 처리한 경우에 따라 다르지 않았다.HMG-CoA reductase is a major enzyme in cholesterol synthesis in HepG2 cells, a hepatocyte line. The mRNA levels of HMG-CoA reductase did not differ between insulin alone or in combination with insulin and D-saccharic acid 1,4-lactone.

그러나, 세포에 인슐린 단독으로 처리했을 때보다, 인슐린(1㎍)과 D-saccharic acid 1,4-lactone(100μM)을 같이 처리한 경우, HMG-CoA 환원 효소의 활성형인 포스포-HMG-CoA 환원효소(p-HMGCR)가 증가함을 웨스턴 블랏 결과로 알 수 있었다(도 3). 이때, β-액틴은 내부 대조군으로 사용하였다. 도 3은 간세포주 HepG2안에서 klotho 억제제 여부로 인한 phospho HMG CoA 환원효소의 발현양의 차이를 보여주는 웨스턴 블랏 결과를 나타내는 그림이다.However, when treated with insulin (1 μg) and D-saccharic acid 1,4-lactone (100 μM) together with cells, the phospho-HMG-CoA, an active form of HMG-CoA reductase, was treated. Western blot results showed an increase in reductase (p-HMGCR) (FIG. 3). In this case, β-actin was used as an internal control. Figure 3 is a diagram showing the Western blot results showing the difference in the expression of phospho HMG CoA reductase due to the presence of a klotho inhibitor in the hepatocyte line HepG2.

도 3에서 보듯이, klotho의 수준의 감소나 활성의 감소가 HMG-CoA 환원효소의 활성을 조절하여 콜레스테롤 합성이 증가할 수 있음을 알 수 있었다.
As shown in Figure 3, it can be seen that the decrease in klotho level or the decrease in activity may increase cholesterol synthesis by controlling the activity of HMG-CoA reductase.

상술한 바를 종합하면, klotho 유전자 중, rs36217263(-744A>del) 타입 유전자형을 갖는 SNP는 콜레스테롤이 더 많이 축적되어 동맥경화, 심근경색 등의 심혈관계 질환을 일으킬 위험도가 상대적으로 높음을 확인하였으므로, 본 발명의 rs36217263(-744A>del)은 동맥경화, 심근경색 등의 심혈관계 질환의 예측에 있어서 유용한 DNA 표지로 사용될 수 있음을 알 수 있었다.In summary, the SNP having the rs36217263 (-744A> del) type genotype among the klotho genes was found to have a relatively high risk of developing more cholesterol and causing cardiovascular diseases such as atherosclerosis and myocardial infarction. Rs36217263 (-744A> del) of the present invention was found to be useful as a DNA marker useful in predicting cardiovascular diseases such as atherosclerosis and myocardial infarction.

<110> Korea Institute of Oriental Medicine <120> Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes <130> PA110488/KR <160> 28 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 1 gcacagatta cctgctaagt 20 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 2 ccgaagcttg ggagccaggc tccggggccc 30 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 <400> 3 gggtattctg agagatctaa tcaaagtaga gtgctggttt gaaattatta a 51 <210> 4 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 <400> 4 gcttccctcc tttacctgaa aatcagtccc tagaagggac atttccctgt ga 52 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 PCR primer F <400> 5 ttcaccaggg tattctgaga gatct 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 PCR primer R <400> 6 gggttttgct ctccctttta ctgtt 25 <210> 7 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 PCR primer F <400> 7 cctggagcgg cttcgt 16 <210> 8 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 PCR primer R <400> 8 gggcccggca ggat 14 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 PCR primer F <400> 9 gatagagaaa aatggcttcc ctcctt 26 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 PCR primer R <400> 10 caagcaaagt cacagggaaa tgtc 24 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 PCR primer F <400> 11 cccgtagcac ctcactgt 18 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 PCR primer R <400> 12 tgtttctcat caagcctaac ttaatgact 29 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs564481 PCR primer R <400> 13 agccccagat cgctttactc 20 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs564481 PCR primer R <400> 14 cagtccaggg agaagcgaaa a 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs648202 PCR primer F <400> 15 gcctgccctt tctcccaaaa 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs648202 PCR primer R <400> 16 ccagccagcc aatgtcaaat tc 22 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 probe primer VIC <400> 17 ccagcactct actttga 17 <210> 18 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 probe primer FAM <400> 18 cagcactcta tctttga 17 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 probe primer VIC <400> 19 ccgaccaact ttccccgac 19 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 probe primer FAM <400> 20 cgaccaactt ttcccgac 18 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 probe primer VIC <400> 21 acctgaaaat cagcccctag 20 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 probe primer FAM <400> 22 cctgaaaatc agtccctag 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 probe primer VIC <400> 23 agctagaacc aatacattat 20 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 probe primer FAM <400> 24 ctagaaccaa cacattat 18 <210> 25 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs564481 probe primer VIC <400> 25 tgtgtaacgt gcatttc 17 <210> 26 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs564481 probe primer FAM <400> 26 tgtgtaacat gcatttc 17 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs648202 probe primer VIC <400> 27 caaaactctc tcggccacc 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs648202 probe primer FAM <400> 28 caaaactctc tcagccacc 19 <110> Korea Institute of Oriental Medicine <120> Method for predicting susceptibility to cardiovascular disease          using SNP of klotho genes <130> PA110488 / KR <160> 28 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 1 gcacagatta cctgctaagt 20 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 2 ccgaagcttg ggagccaggc tccggggccc 30 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 <400> 3 gggtattctg agagatctaa tcaaagtaga gtgctggttt gaaattatta a 51 <210> 4 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 <400> 4 gcttccctcc tttacctgaa aatcagtccc tagaagggac atttccctgt ga 52 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 PCR primer F <400> 5 ttcaccaggg tattctgaga gatct 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 PCR primer R <400> 6 gggttttgct ctccctttta ctgtt 25 <210> 7 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 PCR primer F <400> 7 cctggagcgg cttcgt 16 <210> 8 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 PCR primer R <400> 8 gggcccggca ggat 14 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 PCR primer F <400> 9 gatagagaaa aatggcttcc ctcctt 26 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 PCR primer R <400> 10 caagcaaagt cacagggaaa tgtc 24 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 PCR primer F <400> 11 cccgtagcac ctcactgt 18 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 PCR primer R <400> 12 tgtttctcat caagcctaac ttaatgact 29 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs564481 PCR primer R <400> 13 agccccagat cgctttactc 20 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs564481 PCR primer R <400> 14 cagtccaggg agaagcgaaa a 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs648202 PCR primer F <400> 15 gcctgccctt tctcccaaaa 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs648202 PCR primer R <400> 16 ccagccagcc aatgtcaaat tc 22 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 probe primer VIC <400> 17 ccagcactct actttga 17 <210> 18 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs36217263 probe primer FAM <400> 18 cagcactcta tctttga 17 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 probe primer VIC <400> 19 ccgaccaact ttccccgac 19 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs1207568 probe primer FAM <400> 20 cgaccaactt ttcccgac 18 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 probe primer VIC <400> 21 acctgaaaat cagcccctag 20 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs3752472 probe primer FAM <400> 22 cctgaaaatc agtccctag 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 probe primer VIC <400> 23 agctagaacc aatacattat 20 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs7323281 probe primer FAM <400> 24 ctagaaccaa cacattat 18 <210> 25 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs564481 probe primer VIC <400> 25 tgtgtaacgt gcatttc 17 <210> 26 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs564481 probe primer FAM <400> 26 tgtgtaacat gcatttc 17 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs648202 probe primer VIC <400> 27 caaaactctc tcggccacc 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs648202 probe primer FAM <400> 28 caaaactctc tcagccacc 19

Claims (12)

서열번호 3의 염기서열을 갖는 rs36217263에서 선택되며, 27 번째 염기(klotho 유전자의 전사시작점으로부터 -744번째 염기)가 A이거나 결실된, 20-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드로 이루어진 심혈관계 질환 발병 위험도 예측용 마커.
A polynucleotide consisting of 20-100 contiguous DNA sequences selected from rs36217263 having the nucleotide sequence of SEQ ID NO: 3, wherein the 27th base (-744th base from the transcription start point of the klotho gene) is A or deleted or a complement thereof Marker for predicting the risk of cardiovascular disease consisting of polynucleotides.
제1항에 있어서,
상기 심혈관계 질환은 심근경색증, 협심증, 죽상경화증, 고혈압, 심부전, 동맥류, 동맥경화증, 색전증, 뇌졸중 및 혈전증으로 구성된 군으로부터 선택되는 것인 마커.
The method of claim 1,
The cardiovascular disease is a marker selected from the group consisting of myocardial infarction, angina pectoris, atherosclerosis, hypertension, heart failure, aneurysm, arteriosclerosis, embolism, stroke and thrombosis.
제1항 또는 제2항의 심혈관계 질환 발병 위험도 예측용 마커를 검출할 수 있는 프로브 또는 프라이머를 포함하는 심혈관계 질환 발병 위험도 예측용 키트.
A kit for predicting the risk of developing cardiovascular disease, comprising a probe or a primer capable of detecting the marker for predicting the risk of developing the cardiovascular disease of claim 1.
제3항에 있어서,
상기 키트는 RT-PCR 키트 또는 DNA 칩 키트인 것인 심혈관계 질환 발병 위험도 예측용 키트.
The method of claim 3,
The kit is RT-PCR kit or DNA chip kit kit for predicting the risk of developing cardiovascular disease.
서열번호 3의 염기서열을 갖는 rs36217263에서 선택되며, 27 번째 염기(klotho 유전자의 전사시작점으로부터 -744번째 염기)가 A이거나 결실된, 20-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 포함하는 심혈관계 질환 발병 위험도 예측용 마이크로어레이.
A polynucleotide consisting of 20-100 contiguous DNA sequences selected from rs36217263 having the nucleotide sequence of SEQ ID NO: 3, wherein the 27th base (-744th base from the transcription start point of the klotho gene) is A or deleted or a complement thereof Microarray for predicting the risk of developing cardiovascular disease, including polynucleotide.
(a) 검체로부터 DNA를 수득하는 단계;
(b) 상기 수득한 DNA로부터 서열번호 3의 27번째 염기(klotho 유전자의 전사시작점으로부터 -744번째 염기)의 다형성 부위를 증폭하거나 프로브와 혼성화하는 단계; 및
(c) 상기 증폭된 또는 혼성화된 다형성 부위의 염기를 확인하고, 이에 따라 심혈관계 질환 발병 위험도를 분석하는 단계를 포함하는, 심혈관계 질환 발병 위험에 대한 정보를 제공하는 방법.
(a) obtaining DNA from a specimen;
(b) amplifying or hybridizing the polymorphic site of the 27th base of SEQ ID NO: 3 (the -744th base from the transcription start point of the klotho gene) from the obtained DNA; And
(c) identifying the base of the amplified or hybridized polymorphic site, and thus analyzing the risk of developing cardiovascular disease, thereby providing information about the risk of developing cardiovascular disease.
제6항에 있어서,
(c) 단계에서 확인된 서열번호 3의 27번째 염기가 A인 경우 심혈관계 질환의 발병 위험도가 낮은 것으로 판단하는 것인 방법.
The method according to claim 6,
If the 27th base of SEQ ID NO: 3 identified in step (c) is A is to determine the risk of developing cardiovascular disease.
제6항에 있어서,
(c) 단계에서 확인된 서열번호 3의 27번째 염기가 결실된 경우 심혈관계 질환의 발병 위험도가 높은 것으로 판단하는 것인 방법.
The method according to claim 6,
If the 27th base of SEQ ID NO: 3 identified in step (c) is deleted is determined to have a high risk of cardiovascular disease.
제6항에 있어서,
상기 심혈관계 질환은 심근경색증, 협심증, 죽상경화증, 고혈압, 심부전, 동맥류, 동맥경화증, 색전증, 뇌졸중 및 혈전증으로 구성된 군으로부터 선택되는 것인 방법.
The method according to claim 6,
Said cardiovascular disease is selected from the group consisting of myocardial infarction, angina pectoris, atherosclerosis, hypertension, heart failure, aneurysm, arteriosclerosis, embolism, stroke and thrombosis.
제6항에 있어서,
서열번호 4의 염기서열을 갖는 rs3752472에서 선택되며, 27번째 염기(klotho 유전자의 전사시작점으로부터 +38816번째 염기)를 확인하고, 이에 따라 심혈관계 질환 발병 위험도를 분석하는 단계를 추가로 포함하는 것인 방법.
The method according to claim 6,
Selected from rs3752472 having the nucleotide sequence of SEQ ID NO: 4, further comprising the step of identifying the 27th base (+38816 base from the transcription start point of the klotho gene) and thus analyzing the risk of developing cardiovascular disease Way.
제10항에 있어서,
상기 서열번호 4의 27번째 염기가 C인 경우 심혈관계 질환의 발병 위험도가 낮은 것으로 판단하는 것인 방법.
The method of claim 10,
If the 27th base of SEQ ID NO: 4 is C is to determine that the risk of developing cardiovascular disease is low.
제10항에 있어서,
상기 서열번호 4의 27번째 염기가 T인 경우 심혈관계 질환의 발병 위험도가 높은 것으로 판단하는 것인 방법.
The method of claim 10,
If the 27th base of SEQ ID NO: 4 T is determined that the risk of developing a cardiovascular disease.
KR1020110088722A 2011-09-01 2011-09-01 Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes KR101304535B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110088722A KR101304535B1 (en) 2011-09-01 2011-09-01 Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110088722A KR101304535B1 (en) 2011-09-01 2011-09-01 Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes

Publications (2)

Publication Number Publication Date
KR20130027093A true KR20130027093A (en) 2013-03-15
KR101304535B1 KR101304535B1 (en) 2013-09-09

Family

ID=48178120

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110088722A KR101304535B1 (en) 2011-09-01 2011-09-01 Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes

Country Status (1)

Country Link
KR (1) KR101304535B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102207352B1 (en) * 2017-09-29 2021-01-26 서울대학교산학협력단 klotho knock-out porcine Models for klotho deficiency disease and the Use thereof

Also Published As

Publication number Publication date
KR101304535B1 (en) 2013-09-09

Similar Documents

Publication Publication Date Title
US20070148661A1 (en) LSAMP Gene Associated With Cardiovascular Disease
KR101546058B1 (en) SNP markers for metabolic syndrome and use thereof
JP2004024036A (en) Method for diagnosing risk to myocardial infarction
Ruppert et al. Identification of a missense mutation in the melusin-encoding ITGB1BP2 gene in a patient with dilated cardiomyopathy
KR102543907B1 (en) A genetic marker for evaluating risk of periodontitis
KR101304535B1 (en) Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes
JP5578536B2 (en) Genetic risk detection method for hypertension
JP5686333B2 (en) Genetic risk detection method for myocardial infarction
JP5033392B2 (en) Genetic risk detection method for type 2 diabetes
US20030032099A1 (en) Methods for predicting susceptibility to obesity and obesity-associated health problems
JP5904501B2 (en) Method for detecting type 2 diabetes
KR101992952B1 (en) Composition, kit for predicting the risk of developing cardiovascular disease related to Cholesterol efflux capacity, and method using the same
US20090192135A1 (en) Human Niemann Pick C1-Like 1 Gene (NPC1L1) Polymorphisms and Methods of Use Thereof
US8236497B2 (en) Methods of diagnosing cardiovascular disease
JP2008000096A (en) Evaluation method of urolithiasis onset risk and kit for evaluation of urolithiasis onset risk
KR101617612B1 (en) SNP Markers for hypertension in Korean
KR101546069B1 (en) SNP markers for metabolic syndrome and use thereof
CN105765077B (en) Detection method for determining risk of anti-thyroid drug-induced agranulocytosis and kit for determination
KR101543774B1 (en) SNP markers for abdominal obesity and use thereof
JP5416962B2 (en) How to determine the risk of developing photosensitivity to drugs
JP4998874B2 (en) Determination method of inflammatory diseases
KR101092580B1 (en) Polymorphic markers of VCAN for predicting susceptibility to gastric cancer and the prediction method using the same
JP5489146B2 (en) Genetic risk detection method for obesity
KR20110011306A (en) Markers for the diagnosis of susceptibility to lung cancer using telomere maintenance genes and method for predicting and analyzing susceptibility to lung cancer using the same
WO2013035861A1 (en) Method for determining susceptibility to age-related macular degeneration, primer pair, probe, age-related macular degeneration diagnostic kit, therapeutic agent for age-related macular degeneration, and screening method for therapeutic agent for age-related macular degeneration

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160808

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20170703

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20180704

Year of fee payment: 6