KR101304535B1 - Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes - Google Patents

Abstract

The present invention is a cardiovascular disease diagnostic marker comprising the SNP of the klotho gene, a cardiovascular disease diagnostic composition comprising a means for identifying the marker, a cardiovascular disease diagnostic kit comprising the composition and cardiovascular disease using the kit To provide information on the likelihood of developing By using the SNP of the klotho gene of the present invention, genetic predisposition to develop cardiovascular disease can be identified early, and thus, it can be widely used for prevention and early diagnosis of cardiovascular disease.

Description

Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes}

The present invention relates to a cardiovascular disease prediction method using a single base polymorphism of the Klotho gene. More specifically, the present invention provides a marker for predicting the risk of cardiovascular disease, including the SNP of the klotho gene, a probe capable of detecting the marker. Or it relates to a kit for predicting the risk of developing cardiovascular disease comprising a primer and a method for providing information on the risk of developing a cardiovascular disease comprising the step of detecting the marker.

Cardiovascular disease is one of the leading causes of death in industrialized countries and in Korea. Coronary artery disease, which is an important part of cardiovascular disease, is usually caused by blockage or narrowing of the coronary arteries that supply blood to the heart by arteriosclerosis, and insufficient blood supply to the heart muscle. Risk factors for cardiovascular disease include hypertension, diabetes, smoking and hypercholesterolemia (hyperlipidemia), obesity, lack of exercise, stress, women's menopause, and genetic factors. do. The mortality rate from coronary artery disease increased by 2.3 times in 2006 compared to 1996, suggesting that cardiovascular disease prevention is urgent. However, current cardiovascular diseases have a disadvantage that they can be diagnosed only after the onset of X-ray and ultrasound imaging of the heart and coronary arteries. Therefore, recently, researches using genetic characteristics that are directly or indirectly related to diseases have been activated for early diagnosis and personalized treatment of diseases.

Monobasic polymorphism refers to one or dozens of nucleotide variations that represent individual variation among the three billion nucleotide sequences of the chromosome in the cell nucleus. Comparing DNA sequencing between individuals and reading hundreds of sequences reveals polymorphism with differences in base pairs present on DNA between individuals. Polymorphism, in which other bases are found at the same position, is called Single Nucleotide Polymorphism (SNP). Monobasic polymorphism occurs in about 1 in approximately 1,000 bases. When a small number of alleles appear in the general population, more than 1% of alleles are said to be monobasic polymorphisms, not mutants. In humans, there are at least one million mutations because there are about three billion base pairs. In humans, 99.9% of the genes match, but the difference in height and skin color due to 0.1% polymorphism. Each person has different hair color, skin, height, and eye color, and even the same drug causes different reactions for different people.

Not all monobasic polymorphisms cause disease, but when monobasic polymorphism occurs in the coding region sequence, a defective or mutated protein may be expressed by either of the polymorphic forms, resulting in a fatal disease. Alternatively, single nucleotide polymorphisms in the transcriptional regulatory sequence such as promoters can regulate the amount of genes expressed. Therefore, by analyzing the pattern of monobasic polymorphism, it is possible to determine effective drugs and develop customized medicines and new drugs according to which genetic traits have many diseases and why the same disease causes different causes according to race. It is possible to diagnose and predict various physiological functions, changes in constitution, and the possibility of onset of the individual at an early stage, and to improve the overall prognosis by diagnosing and prescribing the appropriate medicine for each patient.

Meanwhile, a method of diagnosing the risk of developing cardiovascular disease using a single nucleotide polymorphism marker is known. For example, U.S. Patent Application Publication No. 2007/0072821 discloses the detection of one or more alleles of monobasic polymorphisms in a nucleic acid and the presence or absence thereof alters the risk or statin treatment of an individual's acute coronary disease. Methods associated with the possibility of responding to are disclosed. In addition, Korean Patent Publication No. 2010/0049989 discloses a single nucleotide polymorphism marker polynucleotide, a microarray including the same, a kit, and a single nucleotide polymorphism nucleotide in the polynucleotide, which is associated with the development of coronary artery disease. Disclosed is a method for identifying a subject having a changed risk, and Korean Patent Laid-Open Publication No. 2006/0119737 discloses a method for diagnosing cardiovascular disease through multiple monobasic polymorphisms for diagnosing cardiovascular disease, a microarray including the same, and a kit.

Klotho, on the other hand, is a type-I membrane-penetrating protein that provides several control functions through its sensitivity to insulin, and is known to have an inhibitory effect on various aging phenotypes (H. Kurosu et al., Science, 2005). The gene coding for is located on chromosome 13q12, consists of five exons and has been reported to have more than 10 mutations or monobasic polymorphisms in the human klotho gene.

Under these backgrounds, the present inventors have made extensive efforts to identify SNPs that are directly related to cardiovascular diseases among the SNPs present in the Klotho-encoding gene. It was confirmed that the risk of developing a cardiovascular disease can be predicted by using it as a marker because it is related to the risk of invention of the disease, and the present invention was completed.

One object of the present invention is to provide a marker for predicting the risk of developing cardiovascular disease, including a single nucleotide polymorphism (SNP) region of the klotho gene.

Another object of the present invention is to provide a kit for predicting the risk of developing cardiovascular disease, including a probe or a primer capable of detecting the marker.

Still another object of the present invention is to provide a method for providing information on the risk of developing a cardiovascular disease comprising detecting the marker.

As one aspect for achieving the above object, there is provided a marker for predicting the risk of cardiovascular disease, including a single nucleotide polymorphism (SNP) region of the klotho gene. The marker is selected from rs36217263 having the nucleotide sequence of SEQ ID NO: 3, which is deleted from the 27th base (-744th base from klotho gene transcription point) in a non-SNP gene, and has a sequence of 20-100 consecutive DNA sequences. Consisting of polynucleotides or complementary polynucleotides thereof.

rs36217263: 5'-gggtattctgagagatctaatcaaagtagagtgctggtttgaaattattaa-3 '(SEQ ID NO: 3)

As used herein, the term "single nucleotide polymorphism (SNP)" refers to a gene in which two or more alleles exist at one locus by changing a single base. SNPs have two or more alleles that exhibit a frequency of at least 1%, more preferably at least 10% or 20%, in a selected population.

The term "allele " in the present invention refers to various types of genes that exist on the same locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

In the present invention, the term "SNP ID" refers to rs-ID, which is an independent marker assigned to all SNPs registered by the NCBI, which began accumulating SNP information since 1998.

Cardiovascular disease that can be diagnosed using the diagnostic marker of the present invention is not limited to a specific disease, because it is a whole cardiovascular disease, preferably myocardial infarction, angina pectoris, atherosclerosis, hypertension, heart failure, aneurysm, Arteriosclerosis, embolism, stroke, thrombosis and the like.

The present inventors used a polymorphism of the klotho gene associated with aging and atherosclerosis to develop a marker for diagnosing cardiovascular disease in normal middle-aged Koreans. The correlation between the polymorphism of the klotho gene and total cholesterol, LDL cholesterol and triglyceride levels in serum lipids was studied. Serum lipids are an indicator of many diseases, including metabolic syndrome, and in particular, an increase in total cholesterol and LDL-cholesterol can lead to cardiovascular diseases such as hypercholesterolemia, arteriosclerosis, coronary heart disease, and stroke.

It was confirmed through the following proof that it is a marker for diagnosing cardiovascular diseases causing the accumulation of such cholesterol. We have discovered polymorphic markers. Normal middle-aged Koreans were selected (Example 1), five single nucleotide polymorphisms were identified from their klotho genes (Example 2-1), and the correlation between allele frequency of this polymorphism and cholesterol level was determined (Example 2-2). As a result, SNP (klotho rs36217263 g. A> del) is deleted at the start of transcription of the two polymorphic klotho genes (klotho rs36217263 g. A> del) and SNP at which the +38816 base C is replaced by T at the start of transcription of the klotho gene. rs3752472 g.C> T) was found to be significantly associated with cardiovascular risk (Table 3).

According to another embodiment of the present invention, the present invention provides a kit for predicting the risk of developing cardiovascular disease, comprising a probe or a primer capable of detecting the marker for predicting the risk of developing the cardiovascular disease.

As used herein, the term 'probe' refers to a gene fragment consisting of a base sequence capable of complementarily binding to a target site of a gene of interest and a labeling substance bound to the base sequence, a variant of the gene fragment, and the like. Probes can be used to directly determine whether the target site is present in the sample. In the present invention, the probe may be used to determine whether the target site A base is present in rs36217263 or the target site is deleted.

As used herein, the term 'primer' refers to a gene fragment capable of complementarily binding to a terminal region of a desired gene region, a variant of the gene fragment, etc., in order to amplify a region of a desired gene through PCR. Usually consists of 15 to 30 nucleotides. The primer need not be completely complementary to the gene region of interest, but should be sufficiently complementary to hybridize with the region. If the primer is used, it can be used for determining the base sequence of the gene region of interest, cloning the gene region of interest. In the present invention, the primer can be used to confirm whether the target site A or the target site is deleted in the rs36217263 by amplifying the gene fragment containing rs36217263 and confirming the nucleotide sequence of the amplified gene fragment. have.

The probe or primer can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

On the other hand, the form of the kit is not particularly limited, but may be an RT-PCR kit, DNA chip kit, etc., capable of detecting the SNP of the klotho gene, preferably rs36217263. For example, the kit of the present invention synthesizes cDNA from klotho mRNA contained in the sample, amplifies the synthesized cDNA, and then identifies the nucleotide sequence of the amplified cDNA in order to analyze the rs36217263 of the klotho gene expressed in the sample. Can be an RT-PCR kit. The RT-PCR kit includes RT-PCR test tubes or other appropriate containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases in addition to individual primer pairs specific for the klotho gene. And enzymes such as reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also include primer pairs specific for the gene used as a quantitative control.

As another example, the kit of the present invention may be a DNA chip kit including a probe capable of directly binding to rs36217263 of the klotho gene included in the sample to analyze the rs36217263 of the klotho gene expressed in the sample. The DNA chip kit includes a probe capable of complementarily binding to a gene fragment in which the -744th base (A) is present at the transcription start point of the klotho gene corresponding to rs36217263 and the gene in which the -744th base (A) is deleted. It may include a substrate comprising only one of the probes that can bind complementarily to the fragment or both of the probes, and the substrate, in addition to the probe, the cDNA corresponding to a separate quantitative control gene or fragment thereof It may include. In addition, a method of analyzing rs36217263 by adding a sample to the DNA chip kit may be performed by a known method. For example, a nucleic acid sample may be detected by a fluorescent signal, for example, a detectable signal including a substance such as Cy3 and Cy5. The hybridization results can be detected by labeling with a labeling substance capable of generating the hybridization, and then hybridizing on the DNA chip and detecting a signal generated from the labeling substance.

According to another embodiment of the invention, the invention is selected from rs36217263 having the nucleotide sequence of SEQ ID NO: 3, wherein the 27th base (-744th base from the transcription start point of the klotho gene) is A or deleted; A microarray for predicting the risk of developing cardiovascular disease comprising a polynucleotide consisting of two consecutive DNA sequences or a complementary polynucleotide thereof is provided.

According to another embodiment of the present invention, the present invention provides a method of providing information on risk of developing cardiovascular disease using the marker or kit. Specifically, the method for providing information on the risk of developing a cardiovascular disease of the present invention comprises the steps of (a) obtaining DNA from a sample; (b) amplifying or hybridizing the polymorphic site of the 27th base of SEQ ID NO: 3 (the -744th base from the transcription start point of the klotho gene) from the obtained DNA; And (c) identifying the base of the amplified or hybridized polymorphic site and thus analyzing the risk of developing cardiovascular disease. In this case, when the 27th base of SEQ ID NO: 3 is A, it is determined that the risk of developing cardiovascular disease is low, and when the 27th base of SEQ ID NO: 3 is deleted, the risk of developing cardiovascular disease is determined to be high.

As used herein, the term "sample" is a subject human for predicting the development of a cardiovascular disease, wherein obtaining DNA is obtained from a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine. It may be, but is not limited thereto.

In the method for providing information on the incidence of the cardiovascular disease of the present invention, the step of identifying the sequence of rs36217263 from DNA or mRNA is not particularly limited, but DNA region comprising rs36217263 in the DNA obtained from the sample After amplification, it is carried out by confirming the nucleotide sequence of the amplified DNA site, or synthesizes cDNA from mRNA obtained from the sample, amplifies the DNA site including rs36217263 in the synthesized cDNA, and then sequence of the amplified DNA site. DNA obtained from the sample or hybridized by labeling the DNA obtained from the sample with a labeling substance capable of generating a detectable signal and adding the labeled DNA to a DNA chip comprising a probe capable of directly binding to rs36217263 of the klotho gene. By analyzing the results and then allele specific Allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis, SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method, Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies ( For example, Illumina GoldenGate and Infinium assays) can be used.

In addition, in order to reduce the probability of error in providing information on the incidence of cardiovascular disease, the step of identifying the sequence of other SNPs other than the rs36217263, from which to determine the onset of cardiovascular disease It can be included as. In this case, the SNP to be used is not particularly limited thereto, but is selected from rs3752472 having a nucleotide sequence of SEQ ID NO: 4, and it is preferable to use a nucleotide sequence including a 27th base (+38816 base from the transcription start point of the klotho gene). .

rs3752472: 5'-gcttccctcctttacctgaaaatcagtccctagaagggacatttccctgtga-3 '(SEQ ID NO: 4)

The method of confirming the sequence of rs3752472 present in the gene of the sample from the DNA or mRNA is not particularly limited, but amplifies the DNA region including rs3752472 in the DNA obtained from the sample, and then the nucleotide sequence of the amplified DNA region is amplified. DNA obtained from a sample by synthesizing a cDNA from mRNA obtained from a sample, amplifying a DNA region containing rs3752472 in the synthesized cDNA, and then confirming a nucleotide sequence of the amplified DNA region, or a DNA obtained from a sample. Can be performed by labeling with a labeling substance capable of generating a detectable signal, hybridizing the labeled DNA to a DNA chip containing a probe capable of directly binding to rs3752472 of the klotho gene, and then analyzing the result. .

Determining the incidence of cardiovascular disease from the identified sequence of rs3752472 is not particularly limited, but the sequence of rs3752472 is identified by checking the sequence of rs3752472 present in the gene of the sample from DNA or mRNA obtained from the sample. In the case of C, it is determined that the incidence of cardiovascular disease is low, and in the case where the sequence of rs3752472 is T, the incidence of cardiovascular disease is high.

By using the SNP of the klotho gene of the present invention, genetic predisposition to develop cardiovascular disease can be identified early, and thus, it can be widely used for prevention and early diagnosis of cardiovascular disease.

FIG. 1A is a diagram showing the positions of single nucleotide polymorphisms of five klotho genes, and FIG.
FIG. 2A is a diagram showing the promoter assay result of -744A / del monobasic polymorphism during mononucleotide polymorphism of klotho gene in hepatocyte line HepG2, and FIG. 2B is the monobasic polymorphism of klotho gene in human embryonic kidney 293 cells. Figure shows the promoter assay results of -744A / del monobasic polymorphism.
Figure 3 is a diagram showing the Western blot results showing the difference in the expression of phospho HMG CoA reductase due to the presence of a klotho inhibitor in the hepatocyte line HepG2.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: Selection of test subject and understanding of characteristics

Subjects were recruited from Daejeon Oriental Medicine Hospital and Wonkwang Oriental Medicine Hospital. Subjects with diabetes (type-2 diabetes), dyslipidemia, coronary heart disease and liver / kidney dysfunction were excluded from finding genetic factors. If the subject took medical medication, it also excluded metabolic syndrome as it affected. Finally, 491 of 223 males and 286 females were analyzed. The average age of the subjects was 62.15 years. The overall clinical / physical characteristics of the subjects are described in Table 1 below. This study was conducted after obtaining prior consent from the subjects, and was approved by each hospital and Korea Institute of Oriental Medicine.

Example  2: Klotho On genes  Monobasic polymorphisms present Marker  Sympathy

Example  2-1: RT - PCR  Analysis and Identification of Monobasic Polymorphism

Five monobasic polymorphism genotyping of the klotho gene was performed using Taqman technique. PCR was performed with Taqman® Genotype Master Kit (Applied Biosystems). 1 pmol of the probe primer, 2 pmol of each of the PCR primers and 2 master mix were added to 10 ug of genomic DNA to prepare a PCR mixture solution with a total volume of 20 ul. Subsequently, the mixture was reacted 60 times at 95 ° C. for 30 seconds and 68 ° C. for 2 minutes to perform PCR. Specific base sequences of the PCR primers and probe primers used for PCR are described in Tables 2 and 3 below.

PCR primers for SNP genotyping SNP Primer Sequence (5-3) SEQ ID NO: rs36217263 Forward ttcaccagggtattctgagagatct 5 Reverse gggttttgctctcccttttactgtt 6 rs1207568 Forward cctggagcggcttcgt 7 Reverse gggcccggcaggat 8 rs3752472 Forward gatagagaaaaatggcttccctcctt 9 Reverse caagcaaagtcacagggaaatgtc 10 rs7323281 Forward cccgtagcacctcactgt 11 Reverse tgtttctcatcaagcctaacttaatgact 12 rs564481 Forward agccccagatcgctttactc 13 Reverse cagtccagggagaagcgaaaa 14 rs648202 Forward gcctgccctttctcccaaaa 15 Reverse ccagccagccaatgtcaaattc 16

Probe primer for SNP genotyping SNP Probe Sequence (5-3) SEQ ID NO: rs36217263 VIC ccagcactcta-ctttga 17 FAM cagcactctatctttga 18 rs1207568 VIC ccgaccaactttccccgac 19 FAM cgaccaacttttcccgac 20 rs3752472 VIC acctgaaaatcagcccctag 21 FAM cctgaaaatcagtccctag 22 rs7323281 VIC agctagaaccaatacattat 23 FAM ctagaaccaacacattat 24 rs564481 VIC tgtgtaacgtgcatttc 25 FAM tgtgtaacatgcatttc 26 rs648202 VIC caaaactctctcggccacc 27 FAM caaaactctctcagccacc 28

After PCR amplification, allelic discrimination of alleles was also performed on the same machine (ABI 7900HT). Absorption was calculated by measuring SDS v2.4 software while reading the plate and labeled based on the Rn value in the signal from each well. Plates were then analyzed by automatic or manual allele call (A in FIG. 1). 1A is a diagram showing the position of the single nucleotide polymorphism of five klotho genes.

Real-time PCR was used to classify five genes by single-nucleotide polymorphism genotyping of the klotho gene at the chromosome 13q12 at the promoter and coding region. The coding exons were identified as black blocks and 3'UTRs as white blocks. It is shown in A of 1 and each characteristic is shown in Table 4 below. Five monobasic polymorphisms rs36217263; Promoter, rs1207568; Promoter, rs3752472; Exon 3, rs564481; Exon 4 and rs648202; Exon 4 was.

On the other hand, among two single nucleotide polymorphisms in the promoter region, A was inserted / deleted and G changed to A, and among the three single nucleotide polymorphisms in the exon region, there was a double phenotype, Nonsynonymous polymorphism was searched for the amino acid from proline (P) to serine (S) as the base C was changed to T.

The single nucleotide polymorphism of all klotho genes from the HapMap project satisfies the Hardy-Weinverg Equilibrium (HWE) (p> 0.01) with equilibrium of each position in the population between individuals. I could confirm that. All pairwise linkage disequilibrium (LD) coefficients that could occur between each of the two alleles of the five monobasic polymorphisms of the Klotho polymorphism were r2 <0.5, which is true for Korean subjects. It was analyzed to mean no association (FIG. 1B). FIG. 1B is a table showing the linkage disequilibrium coefficients between single nucleotide polymorphisms of five klotho genes.

As shown in B of FIG. 1, it was possible to prove that there was no error in the genetic analysis result by satisfying the Hardy-Weinverg Equilibrium (HWE) in a normal Korean middle-aged subject, and exist independently of each other without being related to each other. Monobasic polymorphism was found in dogs.

Example  2-2: Analysis of association between monobasic polymorphism and cholesterol index in blood

Of the five monobasic polymorphisms obtained in Example 2-1, statistical analysis was performed to determine the statistical significance with serum lipids.

Specifically, Hardyweinberg equilibrium (HWE) was performed with a P value ≧ 0.05 to determine monobasic polymorphism equilibrium in control subjects. Haplotypes and their frequencies were inferred using an algorithm (HapAnalyzer, http://hap.ngri.go.kr). Data was statistically analyzed with SAS software (SAS institute Inc.). Continuous variables were obtained by general linear model analysis corrected for sex, age, smoking, drinking, and hypertension, and statistical significance was set to p <0.05.

According to the above analysis, each of the five monobasic polymorphisms and the respective serum lipid levels are shown in Table 5 below.

Serum lipids in Table 5 include total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol, respectively. Covariance analysis of serum lipids and klotho polymorphism corrected for sex, age, smoking, drinking and hypertension among Koreans under 60 years of age was presented. The number of subjects (mean ± standard deviation) and P values of three alternative models (gong, dominant, recessive) are shown. Gothic values indicate a statistically significant association with P values of 0.05 or less. In Table 3, C / C, C / R, and R / R refer to values obtained by dividing homozygotes into common (common, C) alleles, heterozygotes, and homozygotes into rare (Rare, R) alleles, respectively. ND means a value that is too small for statistical analysis.

As shown in Table 5, the statistical analysis showed that the association with the serum lipids of rs36217263 was statistically significant, rs3752472 also tended to be related. When comparing subjects of type rs36217263 (-744A> del) to those of type AA corrected for sex, age, smoking, drinking, and hypertension, the total cholesterol and LDL-cholesterol levels of subjects of rs36217263 (-744A> del) The number increased significantly, with statistically significant values of p = 0.005 and p = 0.032 in the dominant model, respectively. Serum triglycerides also showed a tendency to increase in the subjects of rs36217263 (-744A> del) (p = 0.065). For other monobasic polymorphisms, rs3752472 (= C38816T), there was a tendency to increase LDL-cholesterol in subjects of rs3752472 (= C38816T) compared to CC type corrected for sex, age, smoking, drinking and hypertension. (p = 0.056).

As a result, it was found that the functional monobasic polymorphism of the klotho gene may influence the increase of serum cholesterol in middle-aged subjects. Specifically, it was found that two types of rs36217263 (-744A> del) and rs3752472 (= C38816T) among the single nucleotide polymorphisms of the five klotho genes found in Example 2-1 may affect the increase of serum cholesterol. . Among them, rs36217263 (-744A> del) single nucleotide polymorphism of klotho gene was found. These results indicate that rs36217263 single nucleotide polymorphism can be used as a marker to predict the risk of invention of cardiovascular diseases such as atherosclerosis.

Example  3: promoter analysis

A promoter reporter assay was performed to demonstrate the rs36217263 (-744A> del) polymorphic effect of promoter location on promoter activity of Klotho gene.

Specifically, the klotho promoter region of -800 to -1 position was prepared by amplification by PCR using the following primers.

Forward primer 5'-gcacagattacctgctaagt-3 '(SEQ ID NO: 1)

Reverse primer 5'-ccgaagcttgggagccaggctccggggccc-3 '(SEQ ID NO: 2)

Then, the klotho promoter region, which was amplified by PCR with genomic DNA of rs36217263 (-744A> del) and -744A, was inserted into the pGL3-basic vector containing the luciferase (Luc) gene. Luciferase Assay is transfected using Dual-Luciferase Reporter Assay System and Luminometer GLO / Max Luminometer 48 It was performed after hours. The corresponding values are shown in FIG. 2 compared to the expression level of the basal promoter.

Promoter reporter assays were performed on the hepatocyte lines HepG2 and human embryonic kidney 293 cells. First, hepG2-associated promoter activity of hepatocytes was significantly reduced (determined by the decrease in absorbance) in rs36217263 (-744A> del) as compared to the -744A type (FIG. 2A). The multidirectional promoter activity of rs36217263 (-744A> del) showed the same pattern in human embryonic kidney 293 cells (B of FIG. 2). This result indicated that rs36217263 (-744A> del) type subjects had lower klotho expression levels than the -744A type.

From the above results, it was found that rs36217263 (-744A> del), which has a statistically significant value among the single nucleotide polymorphisms of the klotho gene, influences the increase of cholesterol level, has a low klotho expression level. In connection with Example 3, it can be seen that the decrease in the activity of klotho causes an increase in cholesterol levels.

Example  4: Western Blat  analysis

In order to confirm that the decrease of Klotho activity caused the increase of cholesterol level, the activity and expression level of HMG-CoA reductase were analyzed with klotho inhibitor D-saccharic acid 1,4-lactone, respectively.

HMG-CoA reductase is a major enzyme in cholesterol synthesis in HepG2 cells, a hepatocyte line. The mRNA levels of HMG-CoA reductase did not differ between insulin alone or in combination with insulin and D-saccharic acid 1,4-lactone.

However, when treated with insulin (1 μg) and D-saccharic acid 1,4-lactone (100 μM) together with cells, the phospho-HMG-CoA, an active form of HMG-CoA reductase, was treated. Western blot results showed an increase in reductase (p-HMGCR) (FIG. 3). In this case, β-actin was used as an internal control. Figure 3 is a diagram showing the Western blot results showing the difference in the expression of phospho HMG CoA reductase due to the presence of a klotho inhibitor in the hepatocyte line HepG2.

As shown in Figure 3, it can be seen that the decrease in klotho level or the decrease in activity may increase cholesterol synthesis by controlling the activity of HMG-CoA reductase.

In summary, the SNP having the rs36217263 (-744A> del) type genotype among the klotho genes was found to have a relatively high risk of developing more cholesterol and causing cardiovascular diseases such as atherosclerosis and myocardial infarction. Rs36217263 (-744A> del) of the present invention was found to be useful as a DNA marker useful in predicting cardiovascular diseases such as atherosclerosis and myocardial infarction.

Attach an electronic file to a sequence list

Claims (12)

delete delete In rs36217263 having the nucleotide sequence of SEQ ID NO: 3, the 27th base (-744th base from the transcription start point of klotho gene) as the SNP is A or deleted and consists of 20-51 consecutive DNA sequences containing the 27th position A kit for predicting the risk of developing cardiovascular disease in Korean, comprising a probe or a primer capable of detecting a marker for predicting the risk of developing a cardiovascular disease consisting of a polynucleotide or a complementary polynucleotide thereof.
The method of claim 3,
The kit is RT-PCR kit or DNA chip kit kit for predicting the risk of developing cardiovascular disease.
In rs36217263 having the nucleotide sequence of SEQ ID NO: 3, the 27th base (-744th base from the transcription start point of the klotho gene) in which the SNP is A or deleted and consists of 20-51 consecutive DNA sequences containing the 27th position Microarray for predicting the risk of developing cardiovascular disease in Korean, comprising a polynucleotide or a complementary polynucleotide thereof.
(a) obtaining DNA from a specimen;
(b) amplifying or hybridizing the polymorphic site of the 27th base of SEQ ID NO: 3 (the -744th base from the transcription start point of the klotho gene) from the obtained DNA; And
(c) identifying the base of the amplified or hybridized polymorphic site and thus analyzing the risk of developing cardiovascular disease, thereby providing information on the risk of developing cardiovascular disease in Korean.
The method according to claim 6,
If the 27th base of SEQ ID NO: 3 identified in step (c) is A, the risk of developing cardiovascular disease is judged to be lower than when the 27th base is deleted.
The method according to claim 6,
When the 27th base of SEQ ID NO: 3 identified in step (c) is deleted, the risk of developing cardiovascular disease is determined to be higher than that of the 27th base A.
The method according to claim 6,
Said cardiovascular disease is selected from the group consisting of myocardial infarction, angina pectoris, atherosclerosis, hypertension, heart failure, aneurysm, arteriosclerosis, embolism, stroke and thrombosis.
The method according to claim 6,
Identifying the 27th base (+38816 base from the transcription start point of the klotho gene) which is the SNP position in rs3752472 having the nucleotide sequence of SEQ ID NO: 4, and accordingly analyzing the risk of developing cardiovascular disease Way.
The method of claim 10,
If the 27th base of SEQ ID NO: 4 is C, the risk of developing cardiovascular disease is determined to be lower than the 27th base T.
The method of claim 10,
If the 27th base of SEQ ID NO: 4 is T, the risk of developing a cardiovascular disease is determined to be higher than when the 27th base is C.

Images