JP2812726B2 - Antigen structures of major histocompatibility complex class I antigens with specific carrier molecules, their preparation and use - Google Patents

Abstract

Antigen constructs which result from linkage of major histocompatibility complex (MHC) Class I antigens to specific carrier molecules are described. The linkage takes place at the N or C terminus by covalent bonding or, in the case of non-covalent bonding, e.g. via avidin-biotin bridging. The specific carrier molecules bind selectively to target cells and are preferably monoclonal antibodies. Genetic engineering processes for the production of such constructs are indicated. Antigen constructs according to the invention are used for damaging or eliminating target cells. <IMAGE>

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to antigen constructs created by linking a major histocompatibility complex (MHC) class I antigen to a specific carrier molecule.

Tissue rejection is the strongest known immune response that occurs through T cells. These responses are caused by allogenic differences in class I and class II MHC antigens between allogeneic individuals. In organ transplantation, for example, it exists in donor (donor) tissue
Any allogeneic genotyping factor of MHC antigens (allogen
ic determinants) are also recognized as foreign by the recipient's (specific) allospecific T cells. A T cell immune response response is elicited and rejection occurs unless immunosuppressive therapy has been initiated or if such therapy is not found to be inadequate.

In addition, MHC class I antigens are found in all nucleated (nucleat
ed) It is known to be a glycoprotein expressed on the surface of cells. These heavy chain and the heavy chain and non-covalently associated (associate) to have beta ₂ encoded by MHC class I gene - microglobulin, light chain, consisting of. The extracellular portion of the heavy chain is folded into three domains. The first two of these domains (alpha ₁ and alpha ₂ ) show significant polymorphism when comparing the amino acid sequences of previously known class I MHC antigens from various individuals, It has an allogeneic determinant, which aids in the presentation of antigen. The third extracellular domain has a more conserved sequence. beta ₂ - association of microglobulin is essential for transport to the cell surface of correct folding and molecular heavy chain.

The isolation and characterization of murine mutant MHC class I antigen allows for alpha
Only a few amino acid differences in the ₁ and alpha ₂ regions have been shown to cause rejection (Nathenso
n et al .: Ann. Rev. Immunol., 1986, 4, 471-502). Furthermore, even in humans, slight differences between donor and recipient have been shown to cause transplant rejection (J. Da.
usset, FT Rapaport, L. Legrand, J. Colombani, A. Mar
celli-Barge: Skin allograftsurvival in 238 human s
ubjects: Role of specific relationships at the four
gene sites of the first and the second HL-A loc
i, Histocompatibility Testing (1970) 381-397, Ter
asaki PI (editor)). The above studies use the specific inducibility and strength of cellular immune responses in tissue rejection to damage or destroy selected target cells.

A target cell-specific carrier, such as, preferably, a monoclonal antibody (mAb), as well as a polyclonal antibody or molecule that binds to a receptor on the cell, can be converted to an allogeneic MHC without adversely altering this allogeneic determinant. It has been found that it can be attached to the N- or C-terminus of a class I molecule. By using this target cell-specific carrier, MHC class I molecules are specifically transported to the target cells, thereby activating allospecific T cells and allowing allospecific cytotoxic T cells to Destroy. Target cell-specific carriers retain MHC class I while retaining allogeneic determinants
One explanation that is well bonded to the N or C terminus of the molecule, the alpha ₁ and alpha ₂ N-terminus of the MHC class I molecules is towards the cells located in the region sites, allogeneic allogeneic determinants is that which is located alpha ₁ and alpha ₂ region sites which faces away from the cells (Figure 1, FIG. 34).

In humans, rejection is almost 100% likely to occur using just two different MHC class I molecules selected, such as HLA B27w and HLA B27k, due to the marked polymorphism of the MHC class I antigen. It can happen. HLA
B27w and HLA B27k are two subtypes of serologically defined HLA B27 specificity determined by cytotoxic T lymphocytes. Caucasoid popu
lation), about 7% is HLA B27w and about 1% is HLA
Express B27k. For example, the use of both HLA B27 subtypes in allogenization according to the present invention allows treatment of almost 100% of Caucasians. However, according to the present invention, provided that the above resistance does not result in activation of allospecific T cells and subsequent damage or destruction of target cells in the relevant recipient, any desired specific carrier may be used. It is also possible to link MHC class I antigens. Target cells, for example, such as tumor cells,
It may be considered an unwanted and / or pathogenic cell in a living organism. The antigen constructs of the present invention are therefore suitable for treating tumors. However, it is also possible to use the MHC class I antigen constructs of the invention to treat other diseases caused by cells or their products, the elimination of which has a favorable effect. The action of the hybrid molecules described in example groups I and II stems from the fact that, due to the specificity of the antibody part, they can bind to antigens on cells.
Allogeneic MHC by the HLA B27 portion of the fusion molecule
This results in masking the surface of target cells with Class I molecules. These allogeneic class I molecules are then recognized by syngeneic allospecific cytotoxic T cells, resulting in the destruction of target cells by allospecific cytotoxic T cells. Therefore, the present invention relates to the following.

a) MHC class I antigen linked at the N- or C-terminus to a specific carrier, wherein the linkage may preferably be covalent, but non-covalent, such as a biotin-avidin bridge. The specific carrier selectively binds to the target cell and is preferably a monoclonal antibody, but may also be a polyclonal antibody, but most commonly a receptor binding molecule that binds to a particular cell receptor. Good.

b) Method for preparing MHC class I antigen construct.

c) Use of the MHC class I antigen construct according to a) and b) for damaging or eliminating target cells.

The present invention is as further described in the following examples and claims, which do not limit the invention.

The following Examples 1-17 detail the constructs of the present invention and illustrate the nitrophenol (NP) specific mouse mAb B / 1.
-8V _H gene (1), human IgG CF (ab ') ₂ gene (2) and HLA B27w gene (3). (1) and (2) are here examples of specific carrier moieties,
In this case, it is mAb for NP. On the other hand, (3) represents an HLA class I antigen.

The above structure, after a suitable transformation, the human beta ₂ - include microglobulin and immunoglobulin light chain, the V gene forms a NP binding site with V _H B / 1-8.
For example, mouse myeloma cells J558L (VTOi, SLMor
rison, LAHerzenberg, P. Berg: Immunoglobulin gene
expression in transformed Iymphoid cells.Proc.Nat
USA 1983, 80, 825) and are expressed and secreted by myeloma cells. Specific or selective through exchange of heavy chain _VH gene and use of appropriate light chain
It is possible to provide a mAb / HLA B27w fusion product with the desired specificity in which the mAb is present.

Example I Examples 1-13 show that the monoclonal antibody has an HLA at the 3 'end.
Fig. 3 shows the construction of an HLA B27 / mAb fusion gene having a B27 portion.

A) Preparation of mAb C gene part (IgG ₃ C gene) Example 1 A human IgG ₃ C gene was converted to a human gene bank of EMBL3 phage (A.-M. Frischauf, H. Lehrach, A. Proustka, N. Murra).
y: Lambda replacement vectors carrying polylinker s
equences.J. Mol. Biol. 1983, 170, 827-842 and GH
A. Seemann, RSRein, CSBrown, HLPloegh: Gene co
nversion-like mechanisms may generate polymorphis
m in human class I genes.The EMBO Journal 1986,
5, 547-552) and 3.1 kb Hind II.
It was subcloned into plasmid vector pUC19 as an I / SphI fragment (clone 54.1.24) (second
Figure).

Unless otherwise noted, all methods used in this example and in the following examples are H. Lehrach and A.-M. Frischauf: Labor.
atory Manual EMBL (1982), Heidelberg, T. Maniati
s, EFFritsch, and J. Sambrook: Molecular Clonin
g, A laboratory mannual (1982), Cold Spring Harbo
Adopted from r Laboratory.

Example 2 A 54.1.24 clone was completely digested with HindIII and partially digested with PstI. As a result, among others, C _H1 exons and 1,
A restriction fragment containing two or three hinge exons is obtained. These fragments cut out from the agarose gel and cloned into pUC19 vector cleaved with Hind III and Pst I (FIG. 3), then, prosulfuron bromide clones containing C _H1 and three hinge exons (F (ab ') ₂ 3H) BamH I and Asp71
After cutting at 8, the cleavage site was filled in with T4 ligase and religated (FIG. 4). This deletes the pUC19 polylinker between the XbaI and SstI cleavage sites.

IB) Preparation of HLA B27 gene Example 3 The HLA B27w gene was isolated from a genomic gene bank cloned into the EMBL3 bacteriophage (A.-M. Characterization was performed by sequence analysis. (A. Maxam, W. Gilbert: Sequencing end-1ab
eled DNA with base specific chemical cleavage.Met
h. Enzymol. 1980, 65, 499-560, and F. Sanger, S. Ni
cklen, ARCoulson: DNA sequencing with chain termi
nating inhibitors.Proc.Natl.Acad.Sci.USA 1977, 7
4, 5463-5471i) (Fig. 5).

Next, the HLA B27w gene was replaced with the restriction enzymes SstI and BglI.
Digested with I and subcloned into pUC19 at the SstI and BamHI cleavage sites. Subfragments A, B and C
A plasmid clone containing (FIG. 5) was isolated.

Example 4 Plasmid with subfragment A was cut completely with SstI and partially cut with SmaI and after fractionation on agarose gel, fragment A '(FIG. 6) was cut with HincII and SstI. And cloned into the pUC19 plasmid.

Example 5 The plasmid containing subfragment B was digested with XbaI and the resulting XbaI insert (B ') was cloned into the XbaI cut pUC19 plasmid (FIG. 7).

Example 6 A plasmid carrying subfragment C was completely digested with HindIII and partially digested with SstI, resulting in a fragment (C ') linked to fragment A in the HLA B27w gene.
Was isolated after fractionation on an agarose gel and
It was cloned into a Bluescript KS ⁺ plasmid vector (Stratagene, LaJolla, CA, USA) cut with II and SstI (FIG. 8).

Example 7 Single-stranded phage was converted from KS ⁺ plasmid vector C 'to VCS
-M13 helper phage (Stratagene, catalog # 20025
Prepared and purified by infection according to 1) (Stratagen
e: Bluescript Exo / Mung DNA sequencing system: Instru
ction Manual). Synthetic oligonucleotide (I = 5'CC
TTACCTCATCTCAGG3 ') was hybridized with these single strands and the remaining second strand was synthesized using Klenow polymerase. XL blue bacteria were transformed with the double-stranded plasmid thus produced, and a single-stranded phage was re-created from the resulting plasmid clone by infection with helper phage, and the nucleotide sequence was changed to oligonucleotide primer II (5). 'TGAGGGCTCCTGCTT
3 ') (F. Sanger et al., Supra). A clone was identified in which the codon TGG (amino chain 274) at the 3 'end of the alpha 3 exon was mutated to a stop codon (TGA) (C ") (FIG. 9).

Example 8 The plasmid containing fragment A 'was cut with SstI and plasmid clone C "was completely digested with HindIII.
The fragment was partially cut with SstI, fractionated on an agarose gel, and ligated to the C ″ fragment isolated and obtained. After ligation at 14 ° C. for 30 minutes, the non-ligated end was filled in with T4 polymerase. Plasmid D (FIG. 10), in which fragment A 'is linked to fragment C "via the SstI cleavage site in the alpha2 exon, was created. Identified.

Example 9 A plasmid containing fragment D was digested with XbaI, fragment B ′ excised from plasmid B ′ with XbaI and purified after fractionation on an agarose gel.
(FIG. 11). Nucleotide sequence analysis (17)
Plasmid (E) in which the B 'fragment is ligated to fragment D in the correct 5'-3' position.
Was identified.

C) modified HLA B27w gene IgG3CF (ab ') ₂ 3H
Example 10 Fragment E was excised from plasmid E by cleavage with EcoRI and HindIII, the ends were filled in with T4 polymerase and purified after fractionation on agarose gel. Next, the purified fragment E was cleaved, and IgG3F whose Xba I end was filled in with T4 polymerase.
(Ab ') and plasmid containing a ₂ 3H fragment was ligated (Figure 12). A restriction map was generated to identify clones containing plasmid F. This is a qualified HLA
'At the position direction F (ab' B27w gene is correct 5'-3) ₂ 3
It is fused to the H gene.

Example 11 Fragment F was cut with HindIII and EcoRI to position the linker in front of the 5 'end of fragment F. Hind III and Xba I ends were filled in with T4 polymerase, cut with Sst I, and the Sst I end was cloned into pUC19 that had been filled in with T4 polymerase. Using restriction enzyme analysis, pUC1 from fragment F
A clone containing plasmid G having 9 polylinker 5 'was identified (FIG. 13).

Example 12 Plasmid G was cut with Hind III and EcoR I to give Ig
The insert containing the GF (ab ') ₂ HLA B27w fusion gene was isolated and digested with HindIII and EcoRI Bluescript KS ⁺ plasmid vector (Stratagene: Bluescript Exo / Mung D
NA sequencing system: Instruction Manual) (Fig. 14).

Example 13 The plasmid H resulting from this cloning was then
Is cut with BamHI and the insert is inserted into the eukaryotic expression vector pEV.
_H (T. Simon, K. Rajepsky: Nucl. Acids Res. 1988, 16, 34
Cloned in 5). This vector contains the IgG H promoter / enhancer sequence and the _VH gene from the NP-specific mouse mAb B / 1-8 that had been cut with BamHI. (Figure 15) (MNNeuberger: EMBO J
ournal 1983, 2, 1375-1378). Using restriction enzyme analysis, the IgG 3F (ab ') ₂ HLA B27w fusion gene was correct 5'
Plasmid I cloned behind the _VH gene in the -3 'position was identified.

Here, the mAb / HLA B27w fusion gene has intact 5 'and 3' ends which contain all the signals required for expression in eukaryotic cells. As described in the introduction, the structure, the human beta ₂ - include microglobulin and immunoglobulin light chain, the V gene
Forming the NP binding site with V _H B / 1-8. It is expressed and secreted in any myeloma cells. This includes
For example, mouse myeloma cells J558L (VTOi, SL Morri
son, LA Herzenberg, P. Berg: Proc. Natl. Acad. Sci. USA
1883, 80, 825).

II Examples 14-17 demonstrate that HLA at the 5 'end of the monoclonal antibody
Fig. 4 shows the construction of an HLA B27 / mAb fusion gene fused to the B27 portion.

A) Preparation of HLA B27 gene Example 14 HLA B27w gene was cloned in EMBL3 bacteriophage genomic gene bank (Frischauf
Et al., Supra and GHASeemann et al., Supra) and characterized by restriction mapping and nucleotide sequence analysis (Maxam et al., Supra and Sanger).
Et al.) (FIG. 5).

The HLA B27w gene was then replaced with the restriction enzymes SstI and Bgl
It was digested with II and subcloned into pUC19 at the SstI and BamHI cleavage sites. Plasmid clones containing subfragments A, B and C (FIG. 5) were isolated.

The plasmid containing HLA B27 subclone C was partially cut with PstI. Protruding 3 'end of Pst I cleavage site is dGT
P was added and removed with T4 polymerase and religated with T4 ligase. Restriction enzyme analysis was used to identify plasmid clone C, which did not contain a PstI cleavage site in the intron between alpha2 and alpha3 exons (FIG. 16).

Plasmid clone C1 was partially digested with Sst I, Hind III
And the C1 'fragment is isolated and
It was cloned into a double-stranded M13mp18 vector cut with I and Hind III. The M13 clone C1 'with the C1' fragment was identified by nucleic acid sequencing of the insert (No.
17).

Bio-Rad Muta-Gene M13 Mutagenesis Kit (mutag
Single chain phage containing uracil was isolated from C1'M13mp18 phage in bacterial strain CJ236 according to the instructions for use of the Enesis kit. Oligonucleotides having the sequence 5'GCGCGCTGGAGCGTCTC3 '(oligonucleotide III) were hybridized with these single-stranded phages and the second strand was synthesized with the addition of T4 polymerase, dNTPs and T4 ligase.

Clone C2 mutated after infection with bacterial strain MV1190
Was identified by restriction enzyme analysis of M13mp18 double-stranded DNA and confirmed by nucleic acid sequence analysis (FIG. 18). Mutagenesis resulted in disruption of the Pst I restriction site in the alpha2 exon without altering the reading frame or the encoded amino acid sequence.

The single-stranded phage was then transformed into M13 in bacterial strain CJ236.
Produced from clone C2, oligonucleotide IV (oligonucleotide IV = 5'GGGGACGGTGGAATTCGAAGACGGCTC
3 ′). The second strand was synthesized by adding T4 polymerase, T4 ligase and dNTP. Bacterial strain MV
After transformation with 1190, the M13mp18 clone C2 'was identified by restriction analysis and the correct mutation was confirmed by nucleic acid sequence analysis (FIG. 19). As a result of this mutagenesis, EcoR I and Asu I were present in the TM exon of the HLA B27 gene.
An I cleavage site was introduced and amino acid 279 was converted from glutamine to asparagine (FIG. 20).

Example 15 Plasmid clone with subfragment B
digested with aI and the resulting XbaI insert (B ') was digested with XbaI
(P. 19)
Figure).

The plasmid clone having fragment A was
Fully cut with I and partially cut with SmaI and religated.
Restriction enzyme analysis was used to identify clone A ', which lacks a portion of the pUC19 polylinker (FIG. 21).

Plasmid clone A 'was partially digested with SstI, and the fragment obtained by digesting plasmid clone C2 with SstI was ligated to a C2 fragment obtained by fractionation on an agarose gel followed by isolation. Plasmid D1 in which fragment A is linked to fragment C2 via the SstI cleavage site of the alpha 2 exon using restriction mapping.
The 5 'end of the identified HLA B27w gene (FIG. 22) is thus completed.

Construction of the linker: Two oligonucleotides were synthesized: The two oligonucleotides were hybridized together. As a result, one end has an EcoR I restriction enzyme cleavage site and the other end has a Pst I restriction enzyme cleavage site,
A double-stranded DNA fragment was obtained. These fragments are digested with EcoR I and Pst I to obtain EcoR I and Pst
It was cloned into the pUC19 plasmid vector cut with I (FIG. 23). Plasmid clone L was identified by restriction analysis and confirmed by nucleotide sequence analysis.

The immunoglobulin V gene was synthesized using oligonucleotides by the method of PT Jones et al (PT Jones, PEDear, J. Foot
e, MS Neuberger, G. Winter: Nature 1986, 321, 552). It contained a Pst I restriction site in the 5 'region of the clone and was cloned as a Hind III / Bam HI fragment into the M13mp8 vector, which had been destroyed by cutting the Pst I cleavage site, removing protruding ends and religating. (Fig. 24).

II B) Preparation of the mAb C Gene Portion Example 16 The human IgG3C gene was isolated from the human gene bank of EMBL3 phage (Frischauf et al., Supra and Seemann et al., Supra) and obtained Hind III / 3.1 kb in size. It was subcloned into the plasmid vector pUC19 as a SphI fragment (clone 54.1.24) (FIG. 2).

Plasmid clone 54.1.24 was cut with Hind II and Asp718, the overhanging end of the Asp718 cleavage site was removed with T4 polymerase and religated with T4 ligase. Using restriction enzyme analysis and nucleic acid sequencing, Sph I, Pst I, Sst I and EcoR I at the restriction enzyme cleavage site 3 'of the human IgG 3C gene
A clone 54.1.24 Delta Pol, which no longer contained any other, was identified (FIG. 25).

Plasmid clone 54.1.24 Delta Pol was replaced with Bgl II and
Digested with Sph I. Overhanging ends were removed with T4 polymerase and religated with T4 ligase. Using restriction enzyme analysis and nucleic acid sequencing was now identified a clone I containing only CH ₁ exon of the human IgG 3C gene (Figure 26).

Plasmid clone I was cut with PstI and the protruding ends were removed with T4 polymerase. Cut with Xba I and then T4
The B 'insert, which had been filled in with polymerase and made blunt ended, was ligated to the resulting blunt end. Using restriction enzyme analysis and nucleic acid sequencing, comprising a 3 'end of the human IgG ₃ C _H 1 exon and HLA class I gene, clone K
(FIG. 27).

Plasmid clone K was cut with HindIII and EcoRI to remove the protruding ends, and the insert was ligated into an SstI-cut pUC19 plasmid, also blunt-ended. A clone L with a polylinker of the pUC19 vector 5 'from the C _H1 exon was identified (FIG. 28).

Plasmid clone L was cut with EcoR I and Hind III, the insert was purified and the KS ⁺ vector cut with Hind III and EcoR I (Stratagene: Bluescript Exo / Mung DN
A Sequencing System). Pst of this vector
The I cleavage site was previously destroyed by cleavage with Pst I, T4 polymerase treatment and religation. Clone M
Was identified (FIG. 29). By BamH I cleaved from this clone can be cut out human C _H 1 exon containing HLA class I3 'terminus.

Example 17 Double-stranded DNA was prepared from M13mp8 clone V and
Cut. KS ⁺ clone M was cut with BamHI and insert M was purified. The M fragment was ligated to clone V cut with BamHI and nucleic acid sequencing was used to identify the M13 clone N containing the intact IgG3 gene (No. 3).
0 figure).

Double-stranded DNA was prepared from M13 clone N, cut with EcoRI and the insert was purified. The plasmid clone D ₁ Ec
It was cut with oRI and ligated with fragment N. Fragment N is a phage clone O that is cloned in the correct position direction clone D ₁ was isolated (Figure 31).

Plasmid clone O was completely digested with Pst I and EcoR
After partial digestion with I, the fragment was ligated with EcoRI and PstI to a linker fragment cut out from the plasmid vector L. Plasmid clone P contains the complete HLA B27w mAb fusion gene (FIGS. 32, 33). This fusion gene, if expressing cells also comprising an immunoglobulin light chain, a human cell, either alone or mouse cells, with human beta ₂ microglobulin gene can be expressed secretion.

[Brief description of the drawings]

FIG. 1 is an illustration depicting MHC class I antigens and target cells. In the figure, α1, α2, and α3 indicate the regions of the class I MHC antigen chain. The arrow indicates the allo determinant (a
CM refers to the cell membrane and C refers to the cell. 2 to 33 are explanatory diagrams illustrating the construction of the HLA fusion gene of the present invention. In the figures, EcoRI and the like represent specific restriction endonucleases or the corresponding cleavage sites, and the bar-marked characters represent restriction enzyme cleavage sites that were destroyed by religation after embedding. TM stands for transmembrane region. 3′NT is 3 ′ non-translated, IgH p / E is immunoglobulin heavy chain promoter / enhancer, * is incomplete digestion, DS-DN
A represents double-stranded DNA, and SS-DNA represents single-stranded DNA. FIG. 34 is an explanatory diagram illustrating the mechanism of action of the antigen construct. In the figure, s.CTL is syngeneic cytotoxic Tlymphocyte, and TcR is T-
Cell receptor, a. MHC class I is allogeneic MHC
The class I antigen, taa, is a tumor-associated antigen (tumor-associa).
ted antigen) and atc are common genotype tumor cells (s
yngeneic tumor cell).

Continuation of the front page (51) Int.Cl. ⁶ Identification code FI C07K 16/46 C07K 16/46 C12P 21/00 C12P 21/00 C // (C12P 21/00 C12R 1:91) (56) Reference 1 , J. et al. Exp. Med. 161 [5] (1985) p935-952 2, EMBO j. 5 [3] (1986) p. 547-552 (58) Fields surveyed (Int. Cl. ⁶ , DB name) BIOSIS (DIALOG) WPI (DIALOG)

Claims (7)

(57) [Claims] 1. The T cell stimulating major histocompatibility complex (MH)
C) An antigen construct comprising a class I antigen, wherein T
An antigenic construct having an allo-epitope for activating cells, binding to a specific carrier molecule at its C- or N-terminus, wherein said specific carrier molecule is a CD4 region or a monoclonal antibody. 2. The antigen construct according to claim 1, wherein the monoclonal antibody is truncated at the constant part of the heavy chain. 3. The method according to claim 1, wherein the MHC class I antigen is HLA B27w or HLA B27.
The antigen construct according to claim 1, which is k. 4. The antigen construct of claim 1, wherein the MHC class I antigen is covalently linked to a carrier molecule. 5. The antigen structure according to claim 1, wherein the MHC class I antigen is bound to a carrier molecule via avidin / biotin. 6. The antigen construct according to claim 1, which is prepared by genetic manipulation by fusing DNA encoding the antigen construct. 7. The method according to claim 1, comprising fusing the necessary part of the gene in the form of their DNA, providing appropriate regulatory sequences thereto, and expressing the gene in an appropriate expression system.
3. The method for producing an antigen structure according to item 1.