JP2023008939A - Method for producing chemical from methane - Google Patents

Abstract

To provide a novel method that uses microorganisms to produce methanol from methane.SOLUTION: A method for producing methanol includes the step of bringing a microorganism that does not grow on methanol but can oxidize methane or its processed product into contact with methane. There are also provided a novel methane monooxygenase derived from the microorganism, and a method for producing a useful chemical from methane by coculturing the microorganisms with methanol-utilizing bacteria.SELECTED DRAWING: None

Description

The present invention provides a method for producing methanol using a microorganism that does not assimilate methanol and can oxidize methane or a processed product thereof, a novel methane oxidase derived from the microorganism, and a combination of the microorganism and a methanol-utilizing bacterium. The present invention relates to a method for producing useful chemicals from methane by culturing.

Methane is a non-edible biogas generated by decomposition of organic matter by various anaerobic microorganisms, and is mainly used for power generation. Methane is one of the greenhouse gases and subject to emission control. Therefore, if useful chemicals can be produced using methane as a raw material, there is a possibility that it will lead to low-cost chemical production with low environmental impact.

Catalytic oxidation of methane includes solid catalysts, molecular catalysts, and biocatalysts (microorganisms), but the activity of biocatalysts is much higher than that of existing solid catalysts and molecular catalysts. Conventionally, methane oxidation by microorganisms has been carried out using microorganisms (methanotrophs) that have the ability to oxidize methane. Methanogenic bacteria express methane monooxygenase and oxidize methane to produce methanol. Since it requires growth, its proliferation is extremely low (Non-Patent Documents 1 and 2). In addition, since methanotrophs usually have pathways for assimilating methanol produced from methane, the production yield of methanol is low.

A method is also known in which methane monooxygenase derived from methanotrophs is introduced into a different host and used as a microbial catalyst (Patent Document 1, etc.). However, since the expressed enzyme does not fold normally, it is not possible to obtain a sufficient amount of the active enzyme. Therefore, it is difficult to use methanotrophs and their methane oxidase to synthesize methanol and useful chemicals. be.

Japanese Patent Application Laid-Open No. 2005-95002

Balasubramanian et al., Nature. 2010 May 6;465(7294):115-119 Culpepper and Rosenzweig, Crit Rev Biochem Mol Biol. Nov-Dec 2012;47(6):483-92.

An object of the present invention is to provide a novel method for producing methanol from methane using microorganisms.

The inventors discovered that propane-utilizing bacteria, which are microorganisms that do not utilize methanol (non-methanol-utilizing bacteria), have the ability to oxidize methane, and succeeded in producing methanol from methane using this ability. bottom.

That is, the present invention provides the following [1] to [18].
[1] A method for producing methanol, comprising a step of contacting a microorganism that does not assimilate methanol and is capable of oxidizing methane, or a processed product thereof, with methane.
[2] The method according to [1], wherein the microorganism is a microorganism that does not assimilate methanol and can assimilate C2-C6 alkanes.
[3] The method according to [1] or [2], wherein the microorganism does not assimilate methanol and has Soluble Di-iron Monooxygenase (SDIMO) or Particulate Methane Monooxygenase (pMMO).
[4] The microorganism belongs to the genus Gordonia, the genus Mycolicibacterium, the genus Mycobacterium, the genus Nocardioides, the genus Pseudonocardia, the genus Rhodococcus, the genus Beijerinckia, the genus Methylibium Microorganisms belonging to the genus Bradyrhizobium, microorganisms belonging to the genus Rhodobacter, microorganisms belonging to the genus Burkholderia, microorganisms belonging to the genus Pseudomonas, and microorganisms belonging to the genus Xanthobacter, [1]-[ 3].
[5] The method according to any one of [1] to [4], wherein the microorganism is a propane-utilizing bacterium.
[6] The method according to any one of [1] to [5], wherein the microorganism expresses at least one of the following a) to l) methane oxidases:
a) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 1-4; methane oxidase, including peptides;
c) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOs: 5-8;
d) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOS:5-8;
e) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 9-12;
f) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOs: 9-12;
g) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 13-16;
h) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOS: 13-16;
i) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 17-19;
j) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each of the amino acid sequences shown in SEQ ID NOS: 17-19;
k) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 20-22;
l) A methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each of the amino acid sequences shown in SEQ ID NOS:20-22.
[7] The microorganism belongs to the genus Gordonia, has a 16S rRNA gene consisting of a nucleotide sequence showing 80% or more identity with the nucleotide sequence shown in SEQ ID NO: 45, and has the ability to oxidize methane. The method according to any one of [1] to [6].
[8] The method of [7], wherein the microorganism is Gordonia sp. TY-5 (accession number: NITE BP-03486).
[9] The microorganism belongs to the genus Mycolicibacterium, has a 16S rRNA gene consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence shown in SEQ ID NO: 46, and has the ability to oxidize methane. The method according to any one of [1] to [6].
[10] The method of [9], wherein the microorganism is Mycolicibacterium sp. TY-6 (accession number: NITE BP-03487).
[11] A transformant comprising the gene encoding the methane oxidase according to any one of a) to l).
[12] The transformant of [11], which is a methanol-assimilating bacterium.
[13] Methanol-utilizing bacteria are microorganisms belonging to the genus Komagataella, microorganisms belonging to the genus Candida, microorganisms belonging to the genus Ogataea, microorganisms belonging to the genus Kuraishia, microorganisms belonging to the genus Pseudomonas, microorganisms belonging to the genus Methylomonas, and microorganisms belonging to the genus Methylobacterium. The transformant according to [12], which is any microorganism selected from microorganisms belonging to the genus Methylorubrum.
[14] described in [13], wherein the methanol-assimilating bacterium is any microorganism selected from Komagataella phaffii (Pichia pastoris), Candida boidinii, Ogataea (Hansenula) polymorpha, Ogataea (Pichia) methanolica, and Ogataea minuta transformant.
[15] A method for producing an organic acid or alcohol, comprising the step of contacting the transformant according to any one of [11] to [14] with methane.
[16] A method for producing an organic acid or alcohol, comprising the step of contacting a microorganism that does not assimilate methanol and can oxidize methane, or a processed product thereof, with methane in the presence of a methanol-assimilating bacterium.
[17] Methanol-utilizing bacteria are microorganisms belonging to the genus Komagataella, microorganisms belonging to the genus Candida, microorganisms belonging to the genus Ogataea, microorganisms belonging to the genus Kuraishia, microorganisms belonging to the genus Pseudomonas, microorganisms belonging to the genus Methylomonas, and microorganisms belonging to the genus Methylobacterium. The method according to [16], wherein the microorganism is any microorganism selected from microorganisms belonging to the genus Methylorubrum.
[18] Described in [16], wherein the methanol-utilizing bacterium is any microorganism selected from Komagataella phaffii (Pichia pastoris), Candida boidinii, Ogataea (Hansenula) polymorpha, Ogataea (Pichia) methanolica, and Ogataea minuta the method of.

Propane-utilizing bacteria can grow using synthetic media and natural medium components with carbon sources other than methane, which is generally used for microbial culture, and their growth rate is higher than that of methanotrophs. significantly faster in comparison. In addition, since propane-utilizing bacteria do not have a methanol-utilizing pathway, the produced methanol can be accumulated at a high yield. Therefore, according to the present invention, efficient methanol production from methane gas becomes possible.

13 shows detection results of ¹³ C-methanol production by Gordonia sp. TY-5 strain and ΔprmB strain. (A) Standard sample, (B) Gordonia sp. TY-5 strain, (C) ΔprmB strain 13 shows detection results of ¹³ C-methanol production by Mycolicibacterium sp. TY-6 strain. (A) standard sample, (B) Mycolicibacterium sp. TY-6 strain, ⁽ C) no cells, (D) ^{Mycolicibacterium} sp. case) The results of co-culturing methanol production by methane oxidation with the methanol-sensor yeast K. phaffii PMT1305 strain and analyzing the fluorescence intensity of the methanol-sensor yeast are shown. (A) Methanol production by Mycolicibacterium sp. strain TY-6. The fluorescence intensity of the methanol-sensor yeast increased in a methane- and TY-6-strain cell mass-dependent manner. (B) Comparison of methanol production by Mycolicibacterium sp. strain TY-6 and M. miyakonense strain HT12. TY-6 strain methane oxidation reaction is shown to be inhibited by phenylacetylene. Construction of M-pmoCAB expressing strain and methanol production. (A) Construction of EGFP and M-pmoCAB operon expression vectors using pK4 vector, (B) Fluorescence microscope observation of EGFP-expressing strain during LB culture, (C) Methanol production from methane by M-pmoCAB operon-expressing strain

TECHNICAL FIELD The present invention relates to a method for producing methanol using microorganisms that do not assimilate methanol and are capable of oxidizing methane or processed products thereof.

1. Microorganism The microorganism used in the present invention is a microorganism that does not assimilate methanol and can oxidize methane. Conventionally known microorganisms capable of oxidizing methane (methanotrophs) utilize the produced methanol, resulting in poor methanol yields. Since the microorganisms used in the present invention are non-methanol-utilizing bacteria that do not utilize the produced methanol, they can efficiently produce methanol.

The microorganism used in the present invention is a microorganism that does not assimilate methanol and can assimilate C2-C6 alkanes. Alternatively, the microorganism used in the present invention is a microorganism that does not assimilate methanol and has Soluble Di-iron Monooxygenase (SDIMO) or Particulate Methane Monooxygenase (pMMO). Preferably, the microorganism used in the present invention is a propane-utilizing bacterium.

Examples of microorganisms used in the present invention include the genera Gordonia, Mycolicibacterium, Mycobacterium, Nocardioides, Pseudonocardia, Rhodococcus, Beijerinckia, Methylibium, Bradyrhizobium, Rhodobacter, Burkholderia, Pseudomonas, and Xanthobacter. Microorganisms belonging to. Microorganisms may be used singly or in combination of two or more.

As a microorganism belonging to the genus Gordonia, 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, for example, 96% or more, 97% or more of the nucleotide sequence shown in SEQ ID NO: 45 , microorganisms having a 16S rRNA gene consisting of a nucleotide sequence exhibiting a sequence identity of 98% or more, among which Gordonia sp. TY-5 is particularly preferred. Gordonia sp.TY-5 has been internationally deposited on June 22, 2022 at the National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depository (NPOD) under the accession number: NITE BP-03486.

As a microorganism belonging to the genus Mycolicibacterium, 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, for example, 96% or more, 97% of the nucleotide sequence shown in SEQ ID NO: 46 As mentioned above, microorganisms having a 16S rRNA gene consisting of a nucleotide sequence exhibiting a sequence identity of 98% or more, 99% or more are mentioned, and among them, Mycolicibacterium sp. TY-6 is particularly preferable. Mycolicibacterium sp. TY-6 has been internationally deposited on June 22, 2022 with NITE NPOD under accession number NITE BP-03487.

Conventionally known methanotrophs cannot grow on carbon sources other than methane, and require methane to induce methane oxidation activity. In addition to the low cell yield and slow growth rate, the production yield of methanol using methanotrophs was low because the metabolism of the produced methanol was essential for growth. In contrast, the microorganisms used in the present invention do not require the presence of methane to induce methane oxidation activity, and LB medium, propane, and propanol, for example, can induce methane oxidation activity. It has a high bacterial cell yield, can be easily cultured in a general medium, and has a fast growth rate. Furthermore, since methanol metabolism is not required for growth, the yield of methanol can be increased by destroying methanol-metabolizing enzymes, if any.

Microorganisms can be commercially available from ATCC (American Type Culture Collection) or NBRC (NITE Biological Resource Center), or can be collected from nature. In addition, wild-type microorganisms may be used, and microorganisms subjected to mutation or genetic recombination may also be used.

In the present invention, in addition to the cells of microorganisms, processed products thereof may be used. Examples of the treated product include a crushed product obtained by crushing the cells of microorganisms, a product obtained by immobilizing the cells of microorganisms on a carrier, and the like.

Microorganisms expressing enzymes (including recombinant bacteria) may be used as they are, or may be used after freezing, drying, pulverizing, or the like. Specifically, a culture solution obtained by culturing microorganisms can be used as it is, or microbial cells obtained from the culture solution by a fungus collection operation such as centrifugation or a processed product thereof can be used. Examples of treated bacterial cells include bacterial cells treated with acetone, toluene, etc., freeze-dried bacterial cells, crushed bacterial cells, cell extracts, and the like.

In the present invention, sterilized cells, that is, cells whose growth ability has been suppressed or eliminated can be used as the treated cells as long as they have enzymatic activity that catalyzes the methane oxidation reaction.

Immobilization methods include a carrier binding method in which the protein is immobilized by binding it to various insoluble carriers such as cellulose, dextrin, resin beads, activated carbon, silica gel, magnetic particles, and polymer membranes; functional groups in proteins and compounds that react with them; a cross-linking method using chemical bonding with the polymer gel; and an entrapment method in which the enzyme is immobilized in the gel without direct chemical modification by incorporating the enzyme into the polymer gel.

Microorganisms may be recombinant microorganisms. Recombinant microorganisms are produced by inserting a gene into the genome using a known technique such as homologous recombination, or by transforming a host microorganism with an expression vector incorporating a gene encoding methane oxidase, which will be described later. As described above, when wild-type microorganisms are used, Gordonia, Mycolicibacterium, Mycobacterium, Nocardioides, Pseudonocardia, Rhodococcus, Beijerinckia, Methylibium, Bradyrhizobium, Rhodobacter, Burkholderia, Pseudomonas, and Xanthobacter are preferred, but in the case of recombinant microorganisms, the host microorganism is not limited. For example, in the case of bacteria, microorganisms of the genus Escherichia, Rhodococcus, Pseudomonas, Corynebacterium, Bacillus, Streptococcus, Streptomyces, Methylomonas, Methylobacterium, and Methylorubrum can be used. In the case of yeast, the genus Saccharomyces, Candida, Schizosaccharomyces, Komagataella (Pichia), and Ogataea can be used. In the case of filamentous fungi, Aspergillus or the like can be used.

2. Methanol production from methane (1) Methane The methane (methane gas) used in the present invention is not particularly limited. may be methane generated by decomposition of .

In the present invention, methanol is produced by contacting the microorganism or its treated product with methane and recovering the produced methanol. The method of contacting methane with microorganisms is not particularly limited, and microorganisms may be added to methane, or methane may be added to a culture solution of microorganisms.

The contact of the microorganism or its treated product with methane may be continuous or batch, and can be appropriately selected according to the amount and type of methane.

The amount of the microorganism or its treated product to be added is not limited, and can be appropriately set according to the amount and quality of methane to be treated. Moreover, the microorganisms may be added at once at the start of the reaction, or may be added several times. When adding multiple times, it may be added at a constant pace, or may be added as appropriate while observing the reaction rate with methane.

(2) Cultivation process Typically, microorganisms or their treated products are cultured in the presence of methane to oxidize methane to methanol.

The medium to be used is preferably sterilized before being used for culture. The method of sterilizing the medium is not limited as long as it is a method that can render the medium sterile without the presence of proliferative microorganisms or the like. Examples thereof include sterilization methods such as autoclaving (autoclave; for example, heat sterilization at 121° C. for 20 minutes) and filtration sterilization (for example, filtration through a filter with a pore size of 0.45 μm or 0.2 μm). If there is a concern that the medium components may react with each other during heat sterilization, one or more medium components may be sterilized separately from the other medium components and mixed after sterilization.

Any medium may be used as long as it contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by the microorganism and allows the microorganism to be cultured.

Carbon sources include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch, organic acids such as acetic acid, propionic acid, gluconic acid and succinic acid, and alcohols such as ethanol and propanol.

Nitrogen sources include complex medium components derived from natural products (microorganisms, plants, animal milk, animal meat, etc.); ammonium salts of inorganic acids or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate; ammonia; Amino acids, nitrogen compounds, and the like can be used.

Inorganic salts include monopotassium phosphate, dipotassium phosphate, potassium iodide, potassium nitrate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, calcium carbonate, Calcium chloride, disodium molybdate, ammonium molybdenum heptamolybdate, ferric ammonium citrate, cobalt chloride, nickel chloride, boric acid and the like.

Ingredients other than the above ingredients can also be added to the medium, if necessary. For example, antifoaming agents such as vitamins, chelating agents, etc. may be added to prevent foaming of the medium during culture. A component that promotes the expression of methane oxidase in microorganisms can also be added. The component that induces the expression of methane oxidase may be appropriately selected depending on the microbial species.

For the medium, known medium such as LB medium, YT medium and YNB medium can be used as a basal medium. A synthetic medium such as AY medium (Table 1) can also be used. Among these, AY medium is preferred.

The culture temperature is not limited as long as the microorganisms used in the present invention grow and proliferate sufficiently. For example, it can be 10°C to 45°C, preferably 15°C to 40°C, more preferably 20°C to 37°C. The temperature can also be changed during culturing if desired. Microorganisms can be cultured at a high concentration by setting the culture temperature to 10° C. or higher. By setting the culture temperature to 45° C., it is possible to suppress a decrease in the culture speed.

The pH of the medium during culture is also not limited as long as the microorganisms used in the present invention grow and proliferate sufficiently. For example, the pH of the medium can be 3-9, preferably 3.5-8.5, more preferably 5-8. This is because the microorganisms can be cultured at a high density in a short period of time by culturing at a pH within this range.

An inorganic or organic acid or alkaline solution can be used for pH control during culture. Acids are preferably inorganic acids such as sulfuric acid, phosphoric acid, hydrochloric acid and nitric acid. Examples of alkalis include potassium hydroxide, sodium hydroxide and ammonia.

It is also possible to aerate the medium during cultivation. For example, when culturing the microorganisms used in the present invention at a high concentration, it is preferable to aerate a gas containing oxygen at a higher concentration. The concentration of oxygen contained in the gas to be aerated can be appropriately selected according to the type of microorganisms to be cultured and the culture conditions. It can be 90% v/v or more. This is because the growth of microorganisms is promoted by aerating a gas containing 90% v/v or more of oxygen.

The amount of aeration can also be appropriately selected according to the culture conditions including the size of the culture tank and the type of microorganisms to be cultured. can be 0.8-8 vvm (1.6-16 L/min), more preferably 1-5 vvm (2-10 L/min). Microorganisms can be cultured at a high concentration by setting the ventilation rate to 0.6 vvm or more. The reason why the ventilation rate is set to 10 vvm or less is that even if the ventilation rate is further increased, it is difficult to obtain the above effect.

The pressure during culture is not particularly limited. Cultivation can be performed at atmospheric pressure or, if necessary, under pressure. The pressure can be, for example, 0 to 0.5 MPa, preferably 0.01 to 0.3 MPa, and more preferably 0.02 to 0.2 MPa. Since the dissolved oxygen concentration in the medium is increased by pressurizing, the microorganism can be cultured at a higher concentration.

In the present invention, the culture solution can be cultured while being stirred, if necessary. The stirring speed can also be appropriately selected according to the culture conditions and the type of microorganism. For example, it can be 10 to 2500 rpm, preferably 20 to 2000 rpm, more preferably 30 to 1500 rpm.

The culture time is not limited as long as methane is sufficiently oxidized. For example, about 5 to 120 hours, preferably 10 to 100 hours, more preferably 15 to 80 hours, and even more preferably 20 to 60 hours. Also, there is no particular limitation on the end time of culturing, and the culturing may be ended after the desired concentration (amount) of microorganisms is obtained.

In addition, in the present invention, pre-culture of microorganisms and their processed products can be performed as necessary. Appropriate pre-culture can ensure the amount of cells required as seeds for the main culture.

The medium used for the pre-culture is not particularly limited as long as it does not inhibit the culture of microorganisms in the main culture. For example, the same carbon source, nitrogen source, and inorganic salts as in the medium for main culture can be contained, and other components can be added as necessary. The culture temperature, pH, pressure, and culture time during the pre-culture may be any conditions as long as they do not interfere with the growth of the microorganisms in the main culture.

The produced methanol may be recovered, isolated and purified, or directly subjected to the next reaction.

3. Microbial Preparation The microorganisms used in the present invention can be used as a microbial preparation for oxidizing methane. If necessary, the microorganism or its treated product is washed, concentrated, or added with additives such as preservatives and stabilizers to obtain a microbial preparation.

Microorganisms can be freeze-dried by adding trehalose, sodium glutamate, skimmed milk, etc. as freeze-drying protective agents as necessary. The freeze-dried cells can be used as they are or mixed with various additives as microbial preparations.

The microbial formulations of the invention may be liquid (suspension) or solid. When the microbial preparation is used as a liquid, the microbial preparation can be used as it is or after adding additives such as preservatives and stabilizers after culturing the microorganisms to a desired concentration. In addition, after culturing microorganisms to a desired concentration, if necessary, they are separated, washed, purified, concentrated, etc., or further suspended in an aqueous solution containing a buffer solution etc. It can be used as a microbial preparation.

When a microbial preparation is used as a solid, after culturing the microorganisms to a desired concentration, trehalose, sodium glutamate, skimmed milk, etc. are added as a lyoprotectant as necessary, followed by lyophilization. The freeze-dried cells can be used as they are or mixed with various additives as microbial preparations.

4. Methane oxidase and use thereof (1) Methane oxidase The present invention also provides methane oxidase derived from the microorganism. The methane oxidase of the present invention is an enzyme classified as Soluble Di-iron Monooxygenase (SDIMO) or Particulate Methane Monooxygenase (pMMO). SDIMO is characterized by being composed of 3 to 5 subunits, and the active center is coordinated with a diatomic iron ion. In addition, pMMO is a membrane-bound enzyme, and multiple copper ions are coordinated to the active center.

The methane oxidase of the present invention includes an enzyme (Gordonia sp. TY-5 Prm) composed of four subunits having the amino acid sequences shown in SEQ ID NOS: 1-4, each shown in SEQ ID NOS: 5-8. An enzyme composed of four subunits having an amino acid sequence (Mycolicibacterium sp. TY-6 Prm), an enzyme composed of four subunits having amino acid sequences shown in SEQ ID NOS: 9-12 (Mycolicibacterium sp. TY-6 Prm). -6 Smo1), an enzyme composed of four subunits having the amino acid sequences shown in SEQ ID NOS: 13-16 (Mycolicibacterium sp. TY-6 Smo2), having the amino acid sequences shown in SEQ ID NOS: 17-19. An enzyme composed of three subunits (Mycolicibacterium sp. TY-6 Smo) and an enzyme composed of three subunits having the amino acid sequences shown in SEQ ID NOs: 20 to 22 (Mycolicibacterium sp. TY-6 Pmo). Among these, Gordonia sp. TY-5 Prm, Mycolicibacterium sp. TY-6 Prm, Mycolicibacterium sp. TY-6 Smo1, Mycolicibacterium sp. TY-6 Smo2, and Mycolicibacterium sp. and Mycolicibacterium sp. TY-6 Pmo is an enzyme classified as pMMO. The table below summarizes the SEQ ID NOs of the amino acid sequences and base sequences of the subunits of the four enzymes.

The methane oxidase of the present invention is an amino acid sequence obtained by deleting, inserting, substituting and/or adding one or several amino acids in the above amino acid sequences (SEQ ID NOS: 1 to 22), as long as it has the activity of oxidizing methane. It may be a polypeptide composed of subunits having

Here, "several" means, for example, 1 to 40, 1 to 20, preferably 1 to 20, 1 to 10, more preferably 1 to 5, 1 to 4, particularly preferably 3 2 or less. In order to introduce deletions etc. into the amino acid sequence, a kit for mutagenesis using site-directed mutagenesis, such as QuikChangeTMSite-Directed Mutagenesis Kit (Stratagene) is used by known techniques such as the Kunkel method and the gapped duplex method. , GeneTailor™ Site-Directed Mutagenesis System (Invitrogen), TakaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc.: Takara Bio), and the like can be used. Alternatively, an entire gene having a sequence containing a deletion or the like may be artificially synthesized.

The methane oxidase of the present invention has 80% or more, preferably 90% or more, more preferably 95% or more, for example, 96% of the above amino acid sequences (SEQ ID NOs: 1 to 22), as long as it has methane-oxidizing activity. % or more, 97% or more, 98% or more, more preferably 99% or more, more preferably 99.5% or more, particularly preferably 99.9% or more may

Here, the term "sequence identity" means that the two amino acid sequences to be compared are aligned so that as many residues as possible are matched, and the number of matched residues is divided by the total number of residues. It is expressed as a percentage. In the above alignment, gaps are appropriately inserted in one or both of the two sequences to be compared, if necessary. Such sequence alignment can be performed using well-known programs such as BLAST, FASTA, and CLUSTALW. When gaps are inserted, the above total number of residues is the number of residues with one gap counted as one residue. If the total number of residues counted in this way differs between the two sequences being compared, the % identity is calculated by dividing the number of matching residues by the total number of residues in the longer sequence. .

(2) Methane oxidase gene The present invention also provides a gene encoding the methane oxidase. For example, the gene encoding the methane oxidase of the present invention includes a gene (Gordonia sp. TY-5 Prm) containing each base sequence shown in SEQ ID NOS: 23-26 or composed of the sequences, SEQ ID NOS: 27- A gene (Mycolicibacterium sp. TY-6 Prm) containing each nucleotide sequence shown in 30 or composed of each sequence, containing each nucleotide sequence shown in SEQ ID NOS: 31 to 34 or composed of each sequence gene (Mycolicibacterium sp. TY-6 Smo1), gene (Mycolicibacterium sp. TY-6 Smo2) containing each nucleotide sequence shown in SEQ ID NOS: 35-38 or composed of each sequence (Mycolicibacterium sp. TY-6 Smo2), SEQ ID NOS: 39-41 A gene (Mycolicibacterium sp. TY-6 Smo) containing each nucleotide sequence shown in or composed of each sequence, containing each nucleotide sequence shown in SEQ ID NOS: 42 to 44 or composed of each sequence Genes can be mentioned (Mycolicibacterium sp. TY-6Pmo).

The gene encoding the methane oxidase of the present invention has a nucleotide sequence that hybridizes under stringent conditions to the complementary strand of the nucleotide sequence of the gene (SEQ ID NOS: 23-44), and is genus Gordonia and Mycolicibacterium. , Mycobacterium, Nocardioides, Pseudonocardia, Rhodococcus, Beijerinckia, Methylibium, Bradyrhizobium, Rhodobacter, Burkholderia, Pseudomonas, and Xanthobacter.

As stringent conditions, for example, a DNA-immobilized nylon membrane is treated with 6×SSC (1×SSC is a solution of 8.76 g of sodium chloride and 4.41 g of sodium citrate dissolved in 1 liter of water), 1% Conditions for hybridization in a solution containing SDS, 100 μg/ml salmon sperm DNA, 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, and 0.1% Ficoll, incubating with the probe at 65° C. for 20 hours can be mentioned, but are not limited to these. A person skilled in the art would be able to set hybridization conditions by taking into consideration other conditions such as probe concentration, probe length, reaction time, etc. in addition to conditions such as buffer salt concentration and temperature. can be done. Washing conditions after hybridization include, for example, "2×SSC, 0.1% SDS, 42° C." and "1×SSC, 0.1% SDS, 37° C."; more stringent conditions include, for example, Conditions such as “1×SSC, 0.1% SDS, 65° C.” and “0.5×SSC, 0.1% SDS, 50° C.” can be mentioned.

For detailed procedures of the hybridization method, see Molecular Cloning, A Laboratory Manual 2nd. (Cold Spring Harbor Laboratory Press (1989)), Current Protocols in Molecular Biology (John Wiley & Sons (1987-1997)), and the like.

The gene encoding the methane oxidase of the present invention has 80% or more, preferably 90% or more, more preferably 95%, for example, 96%, 97%, A gene having a nucleotide sequence with a sequence identity of 98% or more, and a gene of the genus Gordonia, Mycolicibacterium, Mycobacterium, Nocardioides, Pseudonocardia, Rhodococcus, Beijerinckia, Methylibium, Bradyrhizobium, Rhodobacter, Burkholderia Genes (DNA) from microorganisms belonging to the genera Pseudomonas and Xanthobacter are also included.

(3) Expression vector and transformant The present invention also provides a vector and a transformant containing the gene encoding the methane oxidase.

Vectors that can be used include plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA, and the like. A gene encoding a methane oxidase must be incorporated into a vector so that it can be expressed in a transformed host organism.

In addition to the methane oxidase gene, a promoter, terminator, enhancer, splicing signal, poly(A) addition signal, selectable marker, ribosome binding sequence (SD sequence) and the like can be ligated to the vector. Selectable markers include, for example, kanamycin resistance gene, dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene and the like.

The host that can be used for the transformant of the present invention is not particularly limited as long as it can express methane oxidase. Cells and the like can be used.

(4) Method for producing methanol using methane oxidase The present invention also provides a method for producing methanol, comprising the step of contacting the methane oxidase (polypeptide) of the present invention or the transformant of the present invention with methane. . The reaction of methane oxidase or transformant with methane can be carried out according to "2. Production of methanol from methane".

4. Co-Culture System with Methanol-Assimilating Bacteria The present invention also provides a method for co-cultivating a microorganism that does not assimilate methanol and is capable of oxidizing methane with a methanol-utilizing bacterium. The method can be carried out, for example, by the method described in "1. Method for producing methanol", in which the microorganism or the treated material is brought into contact with methane in the presence of the methanol-assimilating bacteria.

Alternatively, in the method for producing methanol using the methane oxidase of the present invention or the transformant of the present invention, the methane oxidase or transformant may be brought into contact with methane in the presence of a methanol-utilizing bacterium.

Examples of methanol-utilizing bacteria include methanol-utilizing yeast such as Komagataella phaffii (Pichia pastoris), Candida boidinii, Ogataea (Hansenula) polymorpha, Ogataea (Pichia) methanolica, and Ogataea minuta; Methanol-assimilating bacteria belonging to the genera Sporobolomyces, Methylomonas methanica, Methylacidphilum, Methylococcus, Methylosinus, Pseudomonas and the like can be mentioned. Among them, Komagataella phaffii (Pichia pastoris), Candida boidinii, Ogataea (Hansenula) polymorpha, Ogataea (Pichia) methanolica, Ogataea minuta and Pseudomonas are preferred, and Komagataella phaffii (Pichia pastoris) is particularly preferred.

By placing a fluorescent protein-encoding sequence under the control of a methanol-inducible promoter in methanol-assimilating bacteria, the cells can be used as a methanol sensor that generates a fluorescent protein in response to the concentration of methanol (Takeya et al. al., Appl Microbiol Biotechnol. 2018 Aug;102(16):7017-7027). Alternatively, as will be described later, if an enzyme system that produces methanol as a useful chemical is incorporated into a methanol-assimilating bacterium, it becomes possible to produce useful chemicals through the production of methanol from methane.

5. Production of Useful Substances from Methane Introduction of a biosynthetic pathway for target substances into microorganisms (including methanol-utilizing bacteria) used in the method for producing methanol and the co-culture system with methanol-utilizing bacteria of the present invention. , it becomes possible to produce useful substances from the generated methanol. For example, by incorporating glycerol dehydratase, aldehyde dehydrogenase, CoA transferase, 3-HPCoA dehydratase, and CoA hydrolase into a methanol-assimilating bacterium, it becomes possible to synthesize acrylic acid via glycerol.

EXAMPLES The present invention will be specifically described below with reference to Examples, but the present invention is not limited to these Examples.

Example 1: Confirmation of methane oxidation ability of TY-5 strain
5 mL LB medium (1% yeast extract, 0.5% tryptone, 1% NaCl), and cultured with shaking at 28°C and 180 rpm for 3 days. For culturing the ΔprmB strain, kanamycin was added to the LB medium to a final concentration of 50 μg/mL. The OD ₆₁₀ of this culture solution was measured, added to 50 mL LB medium prepared in a 500 mL baffled flask so that OD ₆₁₀ = 0.05, and cultured with shaking at 28°C and 180 rpm for 24 hours. 50 mL of the culture solution was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of AY medium (Table 1), and then suspended in 2 mL of AY medium. A suspension of Gordonia sp. TY-5 strain and ΔprmB strain thus prepared was added to 50 mL of AY medium (containing 1% 2-propanol as a carbon source) prepared in a 500 mL baffled flask. It was added so that OD ₆₁₀ =7, and cultured with shaking at 28°C and 120 rpm for 24 hours. For culturing the ΔprmB strain, kanamycin was added to the AY medium to a final concentration of 50 μg/mL. 50 mL of the culture medium was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of AY medium, and suspended in AY medium to OD ₆₁₀ =10.

1 mL of each of the Gordonia sp. TY-5 and ΔprmB strain cell suspensions was weighed into two 5-mL vials, and the screw caps with butyl rubber stoppers were tightly closed. Using syringes with 25 G, 16 mm needles, one of the two was filled with ¹³ H ₄ and the other with 5.4 mL of N ₂ . The reaction was carried out by shaking the vial at 30° C. and 120 rpm for 6 hours. After 6 hours, decant the entire cell suspension into a 1.5 mL Eppendorf tube, centrifuge at 8,000 x g, 5 min, 4°C, weigh 100 μL of the supernatant into a screw vial, and use GC/MS. ¹³ C-methanol was detected under the following conditions (Fig. 1).

In the TY-5 strain (B), the same peak as in the standard sample (A) was observed, confirming the production of ¹³ C-methanol. From this, it was clarified that TY-5 has methane oxidation activity. On the other hand, in the prmB gene disruption strain (ΔprmB strain) (C), which encodes the propane oxidase subunit PrmB, no ¹³ C-methanol peak was observed, indicating that the ΔprmB strain has no methane oxidation activity. It was suggested that it has methane oxidation activity.

Example 2: Confirmation of methane oxidation ability of TY-6 strain
A loopful of Mycolicibacterium sp. TY-6 strain was inoculated into 5 mL LB medium prepared in a test tube and cultured with shaking at 28° C. and 180 rpm for 5 days. The OD ₆₁₀ of this culture solution was measured, added to 50 mL LB medium prepared in a 500 mL baffled flask so that OD ₆₁₀ = 0.1, and cultured with shaking at 28°C and 180 rpm for 22 hours. 50 mL of the culture solution was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of AY medium, and suspended in AY medium to OD ₆₁₀ =15. 1 mL of each of the cell suspensions was put into two 5-mL vials, and the screw caps with butyl rubber stoppers were tightly closed. Using syringes with 25 G, 16 mm needles, one of the two was filled with ¹³ CH ₄ and the other with 5.4 mL of N ₂ . The reaction was carried out by shaking the vial at 30° C. and 120 rpm for 2 hours. After 2 hours, decant the entire cell suspension into a 1.5 mL Eppendorf tube, centrifuge at 8,000 x g, 5 min, 4°C, weigh 100 μL of the supernatant into a screw vial, and use GC/MS. 13C-methanol was detected under the same conditions as in Fig. 1 (Fig. 2).

When the TY-6 strain cell suspension was reacted with ¹³ C-methane as a substrate (B), the same peak as the standard sample (A) was observed, confirming the production of ¹³ C-methanol. From this, it was clarified that TY-6 has methane oxidation activity. On the other hand, when ¹³ C-methane was used as a substrate for the reaction in AY medium without cells (C), or when N ₂ was added instead of ¹³ C-methane (D), ¹³ No C-methanol peak was observed.

Comparative example: bacterial reaction by methanotrophs
The methanotroph Methylovulum miyakonense HT12 strain was shaken at 28℃, 180 rpm for 4 days in 100 mL NMS medium (150 mL gas phase air was extracted and 150 mL methane was sealed) prepared in a 500 mL medium bottle. cultured. The OD ₆₁₀ of this culture solution was measured, added to 100 mL NMS medium prepared in a 500 mL medium bottle so that OD ₆₁₀ = 0.3, and cultured with shaking at 28°C and 180 rpm for 16 hours. 50 mL of the culture medium was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of NMS medium, and suspended in NMS medium to OD ₆₁₀ =5. 1 mL of this cell suspension was put into a 5 mL vial, and a screw cap with a butyl rubber stopper was tightly closed. 5.4 mL of CH ₄ was encapsulated using a syringe with a 25 G, 16 mm needle. The reaction was carried out by shaking the vial at 30° C. and 120 rpm for 2 hours. After 1 hour, decant the entire cell suspension into a 1.5 mL Eppendorf tube, centrifuge at 8,000 x g, 5 min, 4°C, weigh 100 μL of the supernatant into a screw vial, and add GC-2014 (Shimadzu). was used to detect methanol under the conditions previously reported (Biosci. Biotechnol. Biochem., 84, 1062-1068, 2020), but no accumulation of methanol was observed.

Example 3: Co-culture system with methanol-assimilating bacteria
A loopful of Mycolicibacterium sp. TY-6 strain was inoculated into 5 mL LB medium prepared in a test tube and cultured with shaking at 28° C. and 180 rpm for 5 days. The OD ₆₁₀ of the obtained culture solution was measured, added to 50 mL LB medium prepared in a 500 mL baffled flask so that OD ₆₁₀ = 0.1, and cultured with shaking at 28°C and 180 rpm for 22 hours. 50 mL of the culture was centrifuged at 8,000×g, 5 min, 4°C to harvest the cells, washed twice with 20 mL of YNB medium (0.67% nitrogen-based yeast w/o amino acids), and OD ₆₁₀ = 0.8. / 1.0 / 5 was suspended in YNB medium.

Known methanol sensor yeast strain K. phaffii PMT1305 (Appl. Microbiol. Biotechnol. 102, 7017-7207, 2018) 1 in 5 mL YPD medium (1% yeast extract, 2% peptone, 2% glucose) prepared in a test tube A platinum loop was inoculated and cultured with shaking at 28°C and 180 rpm for 40 hours. The OD ₆₁₀ of the obtained culture solution was measured, added to 50 mL YPD medium prepared in a 500 mL baffled flask so that OD ₆₁₀ = 0.04, and cultured with shaking at 28°C and 180 rpm for 16 hours. 50 mL of the culture solution was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of YNB medium, and then suspended in YNB medium to OD ₆₁₀ =0.02.

A cell suspension of K. phaffii PMT1305 strain prepared to OD ₆₁₀ = 0.02 was dispensed into eight 25-mL vials at 2.5 mL each. Add 2.5 mL of Mycolicibacterium sp. strain TY-6 cell suspension prepared to OD ₆₁₀ = 0.8/1.0/5 to each of the two vials, and tightly close the screw caps with butyl rubber stoppers. rice field. Using syringes with 25 G, 16 mm needles, one of the two was filled with ¹³ CH ₄ and the other with 5 mL of N ₂ . The reaction was carried out by shaking the vial at 28° C. and 120 rpm for 6 hours. After 6 hours, 70 µL of each reaction solution was weighed into a FACS tube (Corning #352002) and diluted 5-fold with 280 µL of PBS buffer (phosphate buffered saline). This sample was subjected to flow cytometry (FCM) analysis to measure the fluorescence intensity of K. phaffii PMT1305 strain. FCM analysis was performed using FACSAria IIIu (manufactured by BD Biosciences) according to a previous report (Appl. Microbiol. Biotechnol. 102, 7017-7207, 2018). It was evaluated as a geometric mean (Geo Mean).

Methane oxidation by Mycolicibacterium sp. strain TY-6 was examined in coculture with the methanol-sensor yeast K. phaffii PMT1305, which expresses a fluorescent protein (Venus-PTS1) under the control of a methanol-inducible promoter. As a result of analyzing the fluorescence intensity of the sensor yeast by FCM, the fluorescence intensity of the methanol sensor yeast increased in a methane- and TY-6 strain cell mass-dependent manner (Fig. 3(A)). This result indicates that K. phaffii synthesizes a protein (Venus-PTS1) using methanol produced by methane oxidation by strain TY-6, and one-pot protein production using methane. It provides new means.

Similar to the method in Fig. 3(A), a cell suspension of K. phaffii strain PMT1305 suspended in YNB medium to _OD610 = 0.02 and a cell suspension suspended in YNB medium to _OD610 = 5 were prepared. A turbid cell suspension of Mycolicibacterium sp. strain TY-6 was prepared.

The methanotroph Methylovulum miyakonense HT12 strain (Int. J. Syst. Evol. Microbiol., 61, 810-815, 2011) was incubated at 28°C in 100 mL NMS medium (Table 4) prepared in a 500 mL medium bottle. Shaking culture was carried out at 180 rpm for 4 days. The OD ₆₁₀ of the resulting culture solution was measured, added to 100 mL NMS medium prepared in a 500 mL medium bottle so that OD ₆₁₀ = 0.3, and cultured with shaking at 28°C and 180 rpm for 16 hours. 50 mL of the culture medium was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of YNB medium, and then suspended in YNB medium to OD ₆₁₀ =5.

A cell suspension of K. phaffii PMT1305 strain prepared to OD ₆₁₀ = 0.02 was added to six 25 mL vials at 2.5 mL each. 2.5 mL of YNB medium, 2.5 mL of _{Mycolicibacterium sp. strain TY-6 cell suspension prepared to OD 610 =} 5, and M 2.5 mL of the cell suspension of miyakonense HT12 strain was added to each, and the screw caps with butyl rubber stoppers were tightly closed. Using syringes with 25 G, 16 mm needles, one of the two was filled with ¹³ CH ₄ and the other with 5 mL of N ₂ . The reaction was carried out by shaking the vial at 28° C. and 120 rpm for 6 hours. After 6 hours, 70 µL of each reaction solution was weighed into a FACS tube and diluted 5-fold with 280 µL of PBS buffer. This sample was subjected to flow cytometry (FCM) analysis, and the fluorescence intensity of K. phaffii PMT1305 strain was measured in the same manner as in FIG. 3(A) (FIG. 3(B)).

Methanol is rapidly consumed by methanotrophs by their own methanol metabolism, and it is thought that methanol used by coexisting methanolic yeast does not accumulate sufficiently in the reaction solution. In Fig. 3(B), in order to confirm this, the reaction was performed under the co-culture of the methanotroph M. miyakonense HT12 strain and the methanol sensor yeast K. phaffii PMT1305 strain. was analyzed by FCM. As a result, the fluorescence intensity during the methane addition reaction was the same as that during the nitrogen addition reaction. found to be unavailable.

Example 4: Effects of pMMO inhibitors
A loopful of Mycolicibacterium sp. TY-6 strain was inoculated into 5 mL LB medium prepared in a test tube and cultured with shaking at 28° C. and 180 rpm for 5 days. The OD ₆₁₀ of this culture solution was measured, added to 50 mL LB medium prepared in a 500 mL baffled flask so that OD ₆₁₀ = 0.1, and cultured with shaking at 28°C and 180 rpm for 24 hours. 50 mL of the culture solution was centrifuged at 8,000×g, 5 min, 4° C. to collect the cells, washed twice with 20 mL of AY medium, and suspended in AY medium to OD ₆₁₀ =11.1. 900 µL of this cell suspension was weighed out into 5 mL vials. Phenylacetylene was dissolved in 0.1% DMSO solution so that the phenylacetylene concentrations were 500 μM, 1.5 mM, and 4.5 mM. The stoppered screw cap was tightly closed. At this time, the concentration in each reaction solution is TY-6 cell OD ₆₁₀ = 10, 0.01% DMSO, 0, 50, 150, or 450 µM phenylacetylene. Using a syringe with a 25 G, 16 mm injection needle, a vial containing 5.4 mL of CH ₄ was shaken at 28° C. and 120 rpm for 2 hours for reaction. After 2 hours, decant the whole cell suspension into a 1.5 mL Eppendorf tube, centrifuge at 8,000 x g, 5 min, 4°C, weigh 100 μL of the supernatant into a screw vial, and perform gas chromatography (Shimadzu GC -2014) was used to detect methanol by the method described in Biosci. Biotechnol. Biochem. 84, 1062-1068, 2020.

In a report by Lontoh et al. (Environ. Microbiol. 2, 485-494, 2000), the methane oxidation activity of sMMO was inhibited by more than 90% in the presence of 100 μM phenylacetylene, while the methane oxidation activity of pMMO was inhibited by more than 100 μM. reported that it is not completely inhibited even in the presence of phenylacetylene. Therefore, in order to investigate whether the methane oxidation activity of the TY-6 strain is due to the sMMO type or the pMMO type enzyme, the inhibition mode by phenylacetylene was examined. As a result, as shown in FIG. 4, phenylacetylene concentration-dependent decrease in methane oxidation activity was observed, suggesting that sMMO-type methane oxidase is involved in the methane oxidation activity of the TY-6 strain. Furthermore, methane oxidation activity was detected even with the addition of 150 μM phenylacetylene, suggesting that the methane oxidation activity of the TY-6 strain also involved pMMO-type methane oxidase.

Example 5: Methane oxidation by M-pmoCAB
In order to examine whether the pMMO type M-pmoCAB (SEQ ID NOS: 20-22) among the methane oxidase candidates of the TY-6 strain has methane oxidation activity, the Pmo-encoding gene operon (M-pmoCAB) was examined. We constructed a TY-6 strain that highly expresses , and examined whether the methane oxidation activity is improved. First, an M-pmoCAB expression vector was constructed according to the following procedure.

A DNA fragment obtained by cleaving the shuttle vector pK4 (Mycrobiology 138, 1003-1010, 1992) with KpnI and XbaI, the SmoX promoter region (P _M-smoX ) using the genomic DNA of the TY-6 strain as a template, primers pK4-PsmoX Fw and Using a 780 bp fragment amplified with KOD ONE using PsmoX-EGFP Rev and a plasmid in which an EGFP fragment derived from pEGFP (Clontech) was inserted into the NcoI/XhoI sites of the shuttle vector pTipRT1 (Hokkaido System Science) as templates, EGFP Fw and Three gene fragments of 893 bp fragments obtained by amplifying egfp with KOD ONE using EGFP-pK4 Rev as primers were ligated using NEBuilder to construct pM-smoX-EGFP (SEQ ID NO: 47). This pM-smoX-EGFP was transformed into the TY-6 strain to construct an EGFP-expressing strain.

primer sequence
pK4-PsmoX Fw: ATTCGAGCTCGGTACttggcccaccgcgac (SEQ ID NO: 48)
PsmoX-EGFP Rev: GCCCTTGCTCACCATgacacagaactccttcgtttcg (SEQ ID NO: 49)
EGFP Fw: ATGGTGAGCAAGGGCGAG (SEQ ID NO: 50)
EGFP-pK4 Rev: ggcttgccatcgactACGGCGCCGGTATCG (SEQ ID NO: 51)

Next, using pM-smoX-EGFP as a template, PM-smoX Rv and EGFP_terminator Fw as primers, a 3408 bp fragment was amplified by KOD ONE for portions other than egfp, and PM-smoX-M using the TY-6 strain genome as a template. A 3173 bp fragment obtained by amplifying M-pmoCAB with KOD ONE using -pmoC Fw and M-pmoB-EGFP terminator Rv as primers was ligated using NEBuilder to construct pM-smoX-M-pmoCAB (SEQ ID NO: 52). (Fig. 5(A)). This pM-smoX-M-pmoCAB was transformed into the TY-6 strain to construct an M-pmoCAB expression strain. A strain in which pK4 was transformed into TY-6 was used as a control (Empty Vector, EV) strain.

primer sequence
PM-smoX Rv: gacacagaactccttcgtttcg (SEQ ID NO: 53)
PM-smoX-M-pmoC Fw: aaggagttctgtgtcatgagtacaagtcaaatcgaacagc (SEQ ID NO: 54)
EGFP_terminator Fw: CTCGAGCATCACCATCACC (SEQ ID NO: 55)
M-pmoB-EGFP terminator Rv: ATGGTGATGCTCGAGctaatgggttccgtattccgg (SEQ ID NO: 56)

As shown in FIG. 5(B), it was confirmed by expressing EGFP that _PM-smoX can be used for high gene expression in LB medium. When the M-pmoCAB operon was highly expressed under the control of P _M-smoX , the methane oxidation activity (methanol production) was improved compared to the EV strain (Fig. 5(C)). It was strongly suggested that the -pmoCAB operon encodes methane oxidase.

INDUSTRIAL APPLICABILITY The present invention can be used for microbiological production of useful chemicals such as acrylic acid using methane as a raw material.

All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety.

SEQ ID NO: 47: pM-smoX-EGFP
SEQ ID NO:48: pK4-PsmoX Fw
SEQ ID NO: 49: PsmoX-EGFP Rev
SEQ ID NO: 50: EGFP Fw
SEQ ID NO: 51: EGFP-pK4 Rev
SEQ ID NO: 52: pM-smoX-M-pmoCAB
SEQ ID NO: 53: PM-smoX Rv
SEQ ID NO: 54: PM-smoX-M-pmoC Fw
SEQ ID NO: 55: EGFP_terminator Fw
SEQ ID NO: 56: M-pmoB-EGFP terminator Rv

Claims (18)

A method for producing methanol, comprising a step of contacting a microorganism that does not assimilate methanol and is capable of oxidizing methane, or a processed product thereof, with methane. The method according to claim 1, wherein the microorganism is a microorganism that does not assimilate methanol and is capable of assimilating C2-C6 alkanes. 2. The method according to claim 1, wherein the microorganism is a microorganism that does not assimilate methanol and has Soluble Di-iron Monooxygenase (SDIMO) or Particulate Methane Monooxygenase (pMMO). The microorganism belongs to the genus Gordonia, the genus Mycolicibacterium, the genus Mycobacterium, the genus Nocardioides, the genus Pseudonocardia, the genus Rhodococcus, the genus Beijerinckia, the genus Methylibium , a microorganism belonging to the genus Bradyrhizobium, a microorganism belonging to the genus Rhodobacter, a microorganism belonging to the genus Burkholderia, a microorganism belonging to the genus Pseudomonas, and a microorganism belonging to the genus Xanthobacter. 2. The method according to claim 1, wherein the microorganism is a propane-utilizing bacterium. The method according to claim 1, wherein the microorganism expresses at least one of the following a) to l) methane oxidases:
a) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 1-4; methane oxidase, including peptides;
c) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOs: 5-8;
d) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOS:5-8;
e) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 9-12;
f) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOs: 9-12;
g) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 13-16;
h) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOS: 13-16;
i) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 17-19;
j) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each of the amino acid sequences shown in SEQ ID NOS: 17-19;
k) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 20-22;
l) A methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each of the amino acid sequences shown in SEQ ID NOS:20-22. Claim 1, wherein the microorganism belongs to the genus Gordonia, has a 16S rRNA gene consisting of a nucleotide sequence showing 80% or more identity with the nucleotide sequence shown in SEQ ID NO: 45, and has the ability to oxidize methane. The method described in . 8. The method according to claim 7, wherein the microorganism is Gordonia sp. TY-5 (accession number: NITE BP-03486). Claims that the microorganism belongs to the genus Mycolicibacterium, has a 16S rRNA gene consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence shown in SEQ ID NO: 46, and has the ability to oxidize methane. Item 1. The method according to item 1. 10. The method according to claim 9, wherein the microorganism is Mycolicibacterium sp. TY-6 (accession number: NITE BP-03487). A transformant containing a gene encoding a methane oxidase according to any one of a) to l) below:
a) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 1-4; methane oxidase, including peptides;
c) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOs: 5-8;
d) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOS:5-8;
e) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 9-12;
f) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOs: 9-12;
g) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 13-16;
h) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each amino acid sequence shown in SEQ ID NOS: 13-16;
i) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 17-19;
j) a methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each of the amino acid sequences shown in SEQ ID NOS: 17-19;
k) a methane oxidase comprising a polypeptide having each amino acid sequence shown in SEQ ID NOS: 20-22;
l) A methane oxidase comprising a polypeptide having an amino acid sequence having 80% or more identity with each of the amino acid sequences shown in SEQ ID NOS:20-22. 12. The transformant according to claim 11, which is a methanol-assimilating bacterium. Methanol-utilizing bacteria include microorganisms belonging to the genus Komagataella, microorganisms belonging to the genus Candida, microorganisms belonging to the genus Ogataea, microorganisms belonging to the genus Kuraishia, microorganisms belonging to the genus Pseudomonas, microorganisms belonging to the genus Methylomonas, microorganisms belonging to the genus Methylobacterium, and microorganisms belonging to the genus Methylorubrum. 13. The transformant according to claim 12, which is any microorganism selected from microorganisms belonging to the genus. 14. The transformant according to claim 13, wherein the methanol-assimilating bacterium is any microorganism selected from Komagataella phaffii (Pichia pastoris), Candida boidinii, Ogataea (Hansenula) polymorpha, Ogataea (Pichia) methanolica, and Ogataea minuta. body. A method for producing an organic acid or alcohol, comprising the step of contacting the transformant according to any one of claims 11 to 14 with methane. A method for producing an organic acid or alcohol, comprising a step of contacting a microorganism that does not assimilate methanol and can oxidize methane, or a processed product thereof, with methane in the presence of a methanol-assimilating bacterium. Methanol-utilizing bacteria include microorganisms belonging to the genus Komagataella, microorganisms belonging to the genus Candida, microorganisms belonging to the genus Ogataea, microorganisms belonging to the genus Kuraishia, microorganisms belonging to the genus Pseudomonas, microorganisms belonging to the genus Methylomonas, microorganisms belonging to the genus Methylobacterium, and microorganisms belonging to the genus Methylorubrum. 17. The method according to claim 16, wherein the microorganism is any microorganism selected from genus microorganisms. 17. The method according to claim 16, wherein the methanol-utilizing fungus is any microorganism selected from Komagataella phaffii (Pichia pastoris), Candida boidinii, Ogataea (Hansenula) polymorpha, Ogataea (Pichia) methanolica, and Ogataea minuta.

Images