JP2022162862A - filaggrin and hyaluronic acid production promoter - Google Patents

Abstract

To provide a pharmaceutical, a quasi drug, a cosmetic, a food or a material blended therein, having a filaggrin production promoting action and exhibiting a skin moisturizing effect.SOLUTION: A filaggrin production promoter contains Paeonia lactiflora, a callus induced from Paeonia lactiflora, or extract thereof as an active ingredient.SELECTED DRAWING: None

Description

The present invention relates to a filaggrin production promoter, a hyaluronic acid production promoter and a skin moisturizer.

The stratum corneum of the epidermis is located on the top surface of the skin and has a moisturizing function by suppressing evaporation of water. In addition, it has a barrier function that suppresses invasion of microorganisms and viruses from the outside, ultraviolet rays, and invasive stimuli.

Filaggrin is a kind of basic protein derived from keratohyalin granules in epidermal granule cells, aggregates keratin filaments in the stratum corneum, and plays an important role in constructing the tissue structure of the stratum corneum. Keratohyalin granules in granule cells contain a large amount of profilaggrin, which is a filaggrin precursor, and profilaggrin is degraded to filaggrin through dephosphorylation and the action of proteases.
After filaggrin aggregates keratin fibers in the cytoplasm of corneocytes, it is decomposed into natural moisturizing factors (NMF) in the upper stratum corneum (Non-Patent Document 1). Natural moisturizing factors are composed of amino acids and amino acid derivatives that have a high affinity for water, and are thought to play an important role in retaining moisture in the stratum corneum of the skin. (Non-Patent Document 2).

In addition, in filaggrin-deficient mice, the production of IL-1 is increased and chronic skin inflammation occurs (Non-Patent Document 3), and the rate of filaggrin gene mutation is high in patients with atopic dermatitis, making it difficult to produce filaggrin. has been reported (Non-Patent Document 4). That is, it is known that filaggrin expression is decreased and amino acids in the stratum corneum are decreased in diseases associated with dry skin such as atopic dermatitis. In addition, there is a nuclear localization signal in the N-terminal region of profilaggrin, and it is believed that it translocates into the nucleus of epidermal cells and is involved in the final differentiation control of the epidermis and the formation of barrier function (non-patented). Reference 5).
Therefore, promoting the expression of filaggrin is considered important for promoting the water retention capacity of the skin and normal differentiation of epidermal cells.

In addition, hyaluronic acid constitutes the dermal extracellular matrix together with collagen, elastin, etc., and is located outside of cells such as epidermal cells and fibroblasts, and protects cells, retains tissue moisture, maintains flexibility, and lubricity. It plays an important role in the maintenance of It is known that the amount of hyaluronic acid produced in the skin decreases with aging, and as a result, the moisturizing power of cells decreases, causing symptoms such as dryness, rough skin, spots, and wrinkles. Moreover, in recent years, external factors such as ultraviolet rays have also been considered to be factors that induce a decrease in the amount of hyaluronic acid, and are considered to be factors in dry skin and rough skin. Therefore, promotion of hyaluronic acid production is important for maintaining or improving the moisturizing function of the skin.

Conventionally, various studies have been made on plants and their components that promote the expression of filaggrin and the production of hyaluronic acid. 3) etc. have the effect of promoting the expression of filaggrin, and the black raspberry extract, the Himalayan raspberry extract (Patent Document 4), and the plant body or extract thereof (Patent Document 5) have the effect of promoting hyaluronic acid production. is found.

Peony, which is a perennial plant belonging to the Peonaceae family, has been known as a medicinal plant for a long time, and its roots are said to have analgesic/antispasmodic, astringent, and relaxing effects, and have been used. On the other hand, peony petals are sometimes used for potpourri and herbal teas, but they are not often used because they are often picked and discarded.

JP-A-2002-363054 JP 2017-88538 A JP 2018-35144 A JP 2013-018734 A JP 2012-056919 A

Yayoi Kamata, Aya Taniguchi, Mami Yamamoto, Junko Nomura, Kazuhiko Ishihara, Hidenari Takahara, Toshihiko Hibino, and Atsushi Takeda, Neutral Cysteine Protease Bleomycin Hydrolase Is Essential for the Breakdown of Deiminated Filaggrin into Amino Acids. J Biol Chem. 2009; 284( 19): 12829-12836. L Feng, P Chandar, N Lu, C Vincent, J Bajor, H McGuiness, Characteristic differences in barrier and hygroscopic properties between normal and cosmetic dry skin. II. Depth profile of natural moisturizing factor and cohesivity. Int. J Cosmetic Science, 2014 , 36(3): 231-238. Nathan K. Archer, Jay-Hyun Jo, Steven K. Lee, Dongwon Kim, Barbara Smith, Roger V. Ortines, Yu Wang, Mark C. Marchitto, Advaitaa Ravipati, Shuting S. Cai, Carly A. Dillen, Haiyun Liu, Robert J. Miller, Alyssa G. Ashbaugh, Angad S. Uppal, Michiko Oyoshi, Nidhi Malhotra, Sabine Hoff, Luis A Garza, Heidi H. Kong, Julia A. Segre, Raif S. Geha, and Lloyd S. Miller, Injury , dysbiosis and filaggrin deficiency drive skin inflammation via keratinocyte IL-1α release. J Allergy Clin Immunol. 2019 Apr; 143(4): 1426-1443.e6. W H Irwin McLean, Alan D Irvine, Heritable Filaggrin Disorders: The Paradigm of Atopic Dermatitis. J Invest Dermatol. 2012 Nov;132 Suppl 3:E20-21. M Yamamoto-Tanaka, T Makino, A Motoyama, M Miyai, R Tsuboi, and T Hibino. Multiple pathways are involved in DNA degradation during eratinocyte terminal differentiation. Cell Death Dis. 2014 Apr; 5(4): e1181.

TECHNICAL FIELD The present invention relates to providing pharmaceuticals, quasi-drugs, cosmetics, foods, or materials to be blended therein, which have filaggrin and hyaluronic acid production-enhancing effects and exhibit skin moisturizing effects.

The inventors of the present invention have made studies in view of the above problems, and found that peony petals or extracts thereof and callus extracts derived from peony have excellent filaggrin and hyaluronic acid production promoting effects, which are natural for the skin. They found that it is useful for promoting production of moisturizing factor (NMF) and improving skin moisturizing ability.

That is, the present invention relates to the following 1) to 7).
1) A filaggrin production promoter containing, as an active ingredient, peony, callus derived from peony, or an extract thereof.
2) A hyaluronic acid production promoter containing, as an active ingredient, peony, callus derived from peony, or an extract thereof.
3) A skin moisturizing agent containing peony, callus derived from peony, or an extract thereof as an active ingredient.
4) A food for promoting filaggrin production containing peony, callus derived from peony, or an extract thereof as an active ingredient.
5) A food for promoting the production of hyaluronic acid containing, as an active ingredient, peony, callus derived from peony, or an extract thereof.
6) A skin-moisturizing food containing peony, callus derived from peony, or an extract thereof as an active ingredient.
7) The agent of any one of 1) to 3), wherein the extract is a hot water extract or ethanol-water extract of peony petals, or an ethanol-water extract of callus derived from peony, or 4) to 6) Any food.

According to the filaggrin production promoter, hyaluronic acid production promoter, or skin moisturizing agent of the present invention, by promoting the production of filaggrin or hyaluronic acid, the amount of natural moisturizing factor of the skin is increased, and the skin moisturizing ability is improved. can be done. Therefore, according to the present invention, it is possible to provide pharmaceuticals, quasi-drugs, cosmetics, foods, or materials to be blended therein that are useful for improving diseases or conditions associated with dry skin.

Reversed-phase chromatograms of peony petal and callus extracts. PE: petal hot water extract, P30: petal 30% ethanol extract, CE: callus hot water extract, C30: callus 30% ethanol extract. Skin water content and transepidermal water loss (TEWL) in UV-irradiated hairless mice administered peony petals and hot water extract. PW: petals, PE: petal hot water extract. Wrinkle score of UV-irradiated hairless mouse dorsal skin by administration of peony petals and hot water extract. [A] Photograph of dorsal skin of hairless mouse, [B] Wrinkle score, PW: petal, PE: petal hot water extract. HE and immunostaining images of UV-irradiated hairless mouse dorsal skin treated with peony petals and hot water extract. [A] HE-stained image, [B] Anti-laminin immunostained image, [C] Anti-filaggrin immunostained image. PW: petals, PE: petal hot water extract. Effect of administration of peony petals and hot water extract on epidermal thickness of back skin of UV-irradiated hairless mice. PW: petals, PE: petal hot water extract. Filaggrin gene expression level of epithelial cell HaCaT to which peony petal hot water extract and constituents were added. [A] petal hot water extract (PE), [B] pentagalloylglucose (PGG), paeoniflorin (PF). Western blotting pattern of epidermal cell culture medium using anti-filagrin antibody. PC: positive control (ginsenoside). Effect of peony petal extract and callus extract on filaggrin gene expression in epidermal cells. PE: petal hot water extract, P30: petal 30% ethanol extract, CE: callus culture hot water extract, C30: callus 30% ethanol extract. Effect of peony petal extract and callus extract on hyaluronic acid production of epidermal cells. PE: petal hot water extract, P30: petal 30% ethanol extract, CE: callus hot water extract.

In the present invention, the term "peony" refers to Paeonia lactiflora (scientific name: Paeonia lactiflora) of the Peonaceae family.
In the present invention, peony can be used as a whole plant, leaf, stem, bud, petal, bud, root, rhizome, seed, etc., or a combination of these, preferably petal, bud, leaf, and stem. , more preferably petals. Peonies can be suitably used either in a dried state (naturally dried, freeze-dried, etc.) or in a fresh state. In addition, the peony can be appropriately pulverized before use.

The term “callus derived from peony” refers to an amorphous tissue mass produced by repeated cell division by culturing peony tissue or cells.
Cultivation is carried out, for example, by adding kinetin, zeatin, 6-benzyladenine (6-BA), iso Cytokinins such as pentenyl adenine, 1-phenyl-3-(1,2,3-thiadiazol-5-yl)urea (TDZ), and indoleacetic acid (IAA), 2,4-dichlorophenoxyacetic acid (2,4-D ), naphthaleneacetic acid, 2,3,6-trichlorophenoxybenzoic acid, in the presence of auxins such as picloram, pH 5.6-5.8, 22-24 ° C., in the dark place by stationary culture or shaking culture. It can be carried out.
The callus to be extracted may be fresh or dried, or may be crushed by a crusher.

Either a polar solvent or a non-polar solvent can be used as a solvent for extracting peony or callus derived from peony. Specific examples of solvents include water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; Esters; Chain and cyclic ethers such as tetrahydrofuran and diethyl ether; Polyethers such as polyethylene glycol; Hydrocarbons such as squalane, hexane, cyclohexane and petroleum ether; Aromatic hydrocarbons such as toluene; , dichloroethane, and other halogenated hydrocarbons; supercritical carbon dioxide; pyridines; other oils, such as oils and fats, waxes, and other organic solvents; and mixtures thereof. Suitable examples include water, alcohols, preferably ethanol, and alcohol (preferably ethanol)-water mixtures.

The amount of the extraction solvent to be used is not particularly limited as long as it is a condition in which sufficient extraction efficiency can be obtained. 5 to 30 times the mass.
The extraction conditions are not particularly limited as long as sufficient extraction efficiency is obtained. The extraction temperature is preferably above 0° C. and below the boiling point of the solvent used, and the higher the extraction temperature, the shorter the extraction time. The extraction period (time) is preferably 10 minutes to 1 day when the extraction is performed by heating to 40°C or higher, for example, 12 to 24 hours at 40 to 50°C and 2 to 12 hours at 50 to 60°C. , 60-70 for 10 minutes to 2 hours.
In addition, the extraction means is not particularly limited, but for example, usual means such as solid-liquid extraction, liquid-liquid extraction, immersion, decoction, leaching, reflux extraction, pressurized heating extraction, distillation, supercritical extraction, etc. can be used. can.

The extract of the present invention is preferably a hot water extract of peony petals, an ethanol-water extract of peony petals, and an ethanol-water extract of callus derived from peony.
The extraction water used for hot water extraction is not particularly limited, and tap water, well water, distilled water, deionized water, ultrapure water (for example, milli-Q purified by ultrapure water equipment Milli-Q) Q water) and the like can be mentioned.
In this case, the extraction temperature is 40°C to 100°C, more preferably 60°C to 98°C, more preferably 80°C to 95°C. °C to 200°C.
In addition, the extraction time can be appropriately set in consideration of the extraction temperature, extraction scale, etc., and is, for example, 30 minutes to 12 hours, preferably 1 hour to 5 hours, more preferably 2 hours to. 4 hours can be mentioned. Alternatively, the residue from the first extraction may be used for the second extraction, and the first liquid and the second liquid may be combined to obtain the extract used in the present invention.
In the hot water extraction, the volume ratio of water (hot water) to the mass of dry petals is not particularly limited as long as it is a condition that allows extraction of the active ingredient that provides the effects of the present invention. For example, a ratio of 2 to 100 mL of hot water, preferably 5 to 50 mL of hot water, more preferably 5 to 20 mL of hot water to 1 g of dry petals of peony can be mentioned.

In addition, the ethanol-water mixture used for ethanol-water extraction can be used by mixing at any ratio, but preferably an aqueous solution with an ethanol ratio of 20 to 90% (v/v% at 20 ° C. ), more preferably a 30-80% aqueous solution.

The above-mentioned extract can be used as it is, but after diluting, concentrating or freeze-drying the extract, it can be prepared into a powder or paste before use.

In addition, it is preferable to use the extract after removing inert contaminants by known techniques such as liquid-liquid partition, solid-liquid partition, filtration membrane, activated carbon, adsorption resin, and ion-exchange resin. In addition, the extract may be used after being subjected to deodorization, decoloration, or the like by a known method, if necessary. In addition, the extract can be used after further purification using known techniques and methods.

As shown in the examples below, peony petals or extracts thereof and extracts of callus derived from peony have the effect of significantly promoting filaggrin gene expression in epidermal cells and increasing the protein content thereof. It also promotes the production of hyaluronic acid in epidermal cells.
Therefore, peony, callus derived from peony, or an extract thereof can be a filaggrin production promoter and production of hyaluronic acid. Profilagrin, a precursor of filaggrin, is degraded by enzymes such as prostasin to become filaggrin, and filaggrin is further degraded in the stratum corneum of the skin, and natural moisturizing factor (NMF) plays an important role in retaining moisture in the skin. ), which is one of the components of (Non-Patent Document 1). Therefore, the hot water extract of peony petals can promote the production of natural moisturizing factors through the action of promoting filaggrin production, thereby exerting a skin moisturizing effect. Thus, peony, callus derived from peony, or extracts thereof can be skin moisturizers.
Such filaggrin production promoters, hyaluronic acid production promoters, and skin moisturizers are useful for treating diseases or conditions associated with dry skin, such as rough skin, dry skin wrinkles, atopic dermatitis, ichthyosis, and senile xerosis. It is useful for improving disease.

The filaggrin production promoter, hyaluronic acid production promoter, and skin moisturizing agent are used for promoting filaggrin production, for promoting hyaluronic acid production, for promoting natural moisturizing factor production, for skin moisturizing, and for rough skin and dry skin. It can be used as a drug, quasi-drug, cosmetic or food for improving wrinkles and diseases such as atopic dermatitis, ichthyosis, and senile xerosis, or as a material or formulation for blending into these. can.
In addition, the above foods (also called “foods for promoting filaggrin production”, “foods for promoting hyaluronic acid production”, and “foods for skin moisturizing”) are labeled to that effect as necessary in addition to general food and drink. Foods, functional foods, foods for the sick, foods for specified health uses, foods with function claims, and supplements are included.

Here, “stimulation of filaggrin production” means that filaggrin production in the body is promoted and the amount of filaggrin is increased by, for example, promoting gene expression of filaggrin.
In addition, "hyaluronic acid production promotion" means that the ability of skin epidermal cells to produce hyaluronic acid is promoted to increase the amount of hyaluronic acid.

The pharmaceutical or quasi-drug containing peony, callus derived from peony, or an extract thereof can be administered in any dosage form. Administration can be oral or parenteral. Dosage forms for oral administration include solid dosage forms such as tablets, coated tablets, granules, powders, capsules, and liquid dosage forms such as elixirs, syrups and suspensions, Dosage forms for parenteral administration include injection, infusion, topical, external preparation, transdermal, transmucosal, nasal, enteral, inhalation, suppository, bolus, patch and the like. Preferably, the drug or quasi-drug may be in the form of an external skin preparation.

The pharmaceutical or quasi-drug may contain peony, callus derived from peony, or an extract thereof alone or in combination with a pharmaceutically acceptable carrier. Examples of such carriers include excipients, coating agents, binders, extenders, disintegrants, lubricants, diluents, osmotic pressure adjusters, pH adjusters, dispersants, emulsifiers, preservatives, stabilizers. , antioxidants, colorants, ultraviolet absorbers, moisturizers, thickeners, lubricants, activity enhancers, anti-inflammatory agents, bactericides, perfumes, flavoring agents, flavoring agents and the like. In addition, the drug or quasi-drug may contain other active ingredients or pharmacological ingredients as long as the pharmacological effects of the peony, the callus derived from the peony, or the extract thereof are not lost.

The cosmetic containing the peony, the callus derived from the peony, or the extract thereof of the present invention may contain the peony, the callus derived from the peony, or the extract thereof alone, or may contain the peony, the callus derived from the peony, or the extract thereof. It may be contained in combination with a carrier. Examples of such carriers include excipients, coating agents, binders, extenders, disintegrants, lubricants, diluents, osmotic pressure adjusters, pH adjusters, dispersants, emulsifiers, preservatives, stabilizers. , antioxidants, colorants, ultraviolet absorbers, moisturizers, thickeners, lubricants, activity enhancers, anti-inflammatory agents, bactericides, perfumes, flavoring agents, flavoring agents and the like. In addition, as long as the pharmacological action of the present invention is not lost, the cosmetic may include other active ingredients and cosmetic ingredients, such as moisturizing agents, whitening agents, UV protection agents, cell activators, cleansing agents, keratolytic agents, and makeup. Components (for example, makeup base, foundation, face powder, powder, blush, lipstick, eye makeup, eyebrow, mascara, etc.) and the like may be contained. Forms for cosmetics include creams, milky lotions, lotions, suspensions, gels, powders, packs, sheets, patches, sticks, cakes, and any other form that can be used for cosmetics. Preferably, the cosmetics may be skin moisturizing cosmetics.

In addition, the forms of the above-mentioned foods containing the peony of the present invention, callus derived from the peony, or extracts thereof include soft drinks, tea-based drinks, coffee drinks, fruit juice drinks, carbonated drinks, jelly, wafers, biscuits, In addition to various foods such as bread, noodles, sausages and other foods and drinks and nutritional foods, nutritional supplement compositions in the same form as the above-described oral administration preparations (solid preparations such as tablets, capsules, lozenges, etc.) is mentioned. Among these, tablets and capsules are preferred.
Various forms of foods can be prepared by adding the peonies of the present invention, callus derived from peonies or extracts thereof alone or in combination with other food ingredients, solvents, softeners, oils, emulsifiers, preservatives, flavoring agents, stabilizers. agents, colorants, antioxidants, moisturizers, thickeners and the like can be appropriately combined.

The above pharmaceuticals, quasi-drugs, cosmetics or foods are peony, callus derived from peony, or extracts thereof, and optionally the carrier and/or other active ingredients or pharmacological ingredients in combination. It can be manufactured by the method. The content of peony, callus derived from peony, or extract thereof in the drug, quasi-drug, cosmetic, or food is preferably 0.00001% by mass or more, more preferably, based on the total mass of the formulation as a dry matter It is 0.001% by mass or more, preferably 10% by mass or less, and more preferably 1% by mass or less.

In addition, the dosage of the above medicines and foods may vary according to the subject's condition, body weight, sex, age or other factors, but the daily dosage per adult is usually derived from peony, peony. The callus or extract thereof (dry matter) is preferably 0.6 g or more, more preferably 1 g or more, and preferably 12 g or less, more preferably 6 g or less. The above formulation can be administered according to any dosage regimen, but is preferably administered once to several times a day and administered continuously for several weeks to several months.
Subjects for administration include humans who require or desire moisturizing of the skin, i.e., diseases or conditions associated with dry skin, such as rough skin, dry skin wrinkles, atopic dermatitis, ichthyosis, and senile dry skin. Examples include patients with diseases such as dysentery and humans who are highly likely to develop the disease.

EXAMPLES The present invention will be described in more detail below based on examples, but the present invention is not limited to these.
<Manufacturing example>
1. Preparation of peony petal extract (1) Preparation of hot water extract of peony petals After freeze-drying the peony petals (FREEZE DRYER FDU-830: manufactured by Tokyo Rikaki Co., Ltd.), they were pulverized into powder using an electric mill. . 20 ml of milli-Q water was added to 40 g of the pulverized petals and extracted twice at 80° C. for 2 hours. After filtration with gauze again, the extracts obtained by these two extractions were combined and freeze-dried. 5.66 g of the lyophilized product after extraction was obtained from 40.0 g of petals. After freeze-drying, it was pulverized in an agate mortar and used as a peony petal hot water extract (PE).

(2) Preparation of ethanol extract of peony petals To 10 g of the freeze-dried and pulverized lyophilized petals in the same manner as in (1), 20 ml of 30% ethanol was added, and extraction was performed at room temperature for 2 hours while applying ultrasonic waves. After removing ethanol and concentrating the filtrate obtained by filtering with gauze with an evaporator, Milli-Q water was added so that the volume was the same as before concentration, and freeze-drying was performed. After freeze-drying, the powder was ground in an agate mortar to obtain a 30% ethanol extract (P30).

2. Preparation of peony solid culture callus and its extract (1) Concentration 0.25% PVP (polyvinyl pyrolidone), 3% sucrose, 0.8% with the addition of 1 mg/L 2,4-D and 1 mg/L TDZ On an agar medium, petals of buds of a 5-year-old hybrid strain (cultivated without pesticides) of medicinal Chinese peony of Tsukuba Botan Orchard were placed. Callus was prepared by culturing in a dark place at a temperature of 24° C. and a humidity of 60%.
(2) After removing the obtained callus from the medium, it was lightly removed with filter paper and freeze-dried. This freeze-dried product was ground in an agate mortar to form a powder, and extracted with hot water and 30% ethanol in the same manner as in 1 above to prepare a callus hot water extract (CE) and a callus 30% ethanol extract (C30). did.

3. Component Analysis by Reversed-Phase Chromatography (1) Method 10 mg of each extract powder prepared in 1 and 2 above was suspended in 10 ml of 50% methanol and shaken for 30 minutes to prepare a concentration of 10 mg/mL. The same amount of 50% methanol was added to the residue, followed by extraction and filtration in the same manner. All the filtrates were combined and passed through a 0.45 μm filter (DISMIC-03CP, manufactured by ADVANTEC) to obtain a sample solution. In addition, pentagalloyl glucose standard (1,2,3,4,6-Penta-O-galloyl-β-D-glucopyranose, manufactured by Wako Pure Chemical Industries, Ltd.) and paeoniflorin standard (manufactured by Wako Pure Chemical Industries, Ltd.) was dissolved in 50% methanol at 0.1 mg/mL to prepare a standard solution. The sample solution and standard solution were analyzed by HPLC LC-8020II (manufactured by Tosoh Corporation). Analysis conditions are as follows.
・Liquid sending: Flow rate 1 ml/min
- Mobile phase: (A) acetonitrile, (B) 0.1% phosphoric acid aqueous solution - Gradient conditions: 0-5 min, 10-15% A, 5-40 min, 15-30% A, 40-45 min, 30-70 % A, 45-46 min, 70-80% A, 50-55 min, 80-10% A, 55-65 min, 10% A
・Column: TSKgel ODS-80TsQA
・Measurement temperature: 40°C
・Detection wavelength: 280 nm
・Injection volume: 10 μl

(2) Results It has been reported that peony petals are rich in pentagalloylglucose, which is a polyphenol.
Figure 1 shows the reverse-phase HPLC patterns of hot water and 30% ethanol extracts of peony petals and callus (PE: hot water extract of peony petals, CE: hot water extract of callus; P30: 30% ethanol extraction of peony petals. C30: callus 30% ethanol extract).
A peak was confirmed at the same retention time as the pentagalloylglucose (PGG) and paeoniflorin (PF) standards. The PGG and PF contents in the sample were determined from the peak areas. PGG content in peony petals is 0.896 mg/100 mg dry weight, PF content is 0.092 mg/100 mg dry weight, PGG content in hot water extract is 0.799 mg/100 mg dry weight, PF content is 0.152 mg /100 mg dry weight.

<Test example>
Methods and results of pharmacological tests on peony petal extract and callus extract are shown below.
All parameters were checked for normality and homoscedasticity. If the test between two independent groups followed a normal distribution and had equal variances, a Student t-test was performed. One-way analysis of variance was performed for multigroup tests with normality. Statistical processing was performed by Tukey-Kramer's test between groups with differences between levels.

Test Example 1 Effect of ingestion of peony petals and hot water extract on photoaging model 1 . Methods (1) Photoaging Skin Model Animals were bred in an animal breeding room with a 12-hour light-dark cycle, a temperature of 22.8±2° C., and a humidity of 52±10% using a dehumidifier and a humidifier. Solid feed for general breeding was used as feed, and each group was group-housed in one cage under free feeding and drinking. After preliminary breeding for 3 days, the mice were divided into groups so that their body weight, skin water content and skin water loss (TEWL) were equal, and the main test was started 2 days after the grouping. A 0.5% tragacanth gum solution was used as a solvent, and the administration sample was adjusted to 1 mg/100 μl, and administered to 100 mg/kg body weight.
The test groups were UV (-) control group (n = 7), UV (+) control group (n = 7), UV (+) peony petal hot water extract administration (PE) group (n = 7), UV (+) A group (n=7) administered with the frozen powder of peony petals (PW).
The ultraviolet irradiation method was performed according to the method of Tanaka et al. The test substance solution was orally administered with a gastric tube once a day during the test period. In parallel, ultraviolet irradiation was performed three times a week. Lump GL20SE (manufactured by SANKYO DENKI) was used as a UVB lamp for irradiating ultraviolet rays, and three of these lamps were installed in parallel and used as an irradiator. This lamp mainly emits light with wavelengths between 280 and 350 nm, with a maximum at 306 nm. The irradiation intensity was measured using a digital UV intensity meter UV-340 (manufactured by AS ONE). Irradiation is carried out by placing mice in 10 individual cages of 10 cm long, 6 cm wide and 4 cm high. Since the irradiation intensity differs depending on the position of each individual cage, the position is rotated each time for each group to control the difference in irradiation intensity. alleviated. Irradiation was performed three times a week, and the irradiation time was gradually increased from 1 minute in the first week to a maximum of 3 minutes and 45 seconds in order to prevent erythema formation. The irradiation period was 6 weeks, and the total irradiation dose was 1.39 J/cm ² .
Dissection was performed 30 minutes after oral administration of the test substance, and after photographing the skin of the back, blood was collected from the inferior vena cava under anesthesia with sevofrene (registered trademark) inhalation anesthetic (Maruishi Pharmaceutical Co., Ltd.) and euthanized. The skin was harvested.
Corneometer CM825 (manufactured by Courge+Khazaka electronic GmBH) was used to measure skin moisture content at the time of grouping and twice a week during the test.
Transepidermal water loss was measured using a Tewameter TM300 (manufactured by COURAGE+KHAZAKA electronic GMBH) on the day before dissection.
Before dissection, the dorsal skin of hairless mice was photographed with an OLYMPUS CAMEDIA DIGITAL CAMERA C-3040 ZOOM under anesthesia with Sevofurene (registered trademark) inhalation anesthetic (Maruishi Pharmaceutical Co., Ltd.). Visual scoring of wrinkles was based on visual criteria (Inomata et al., J Invest Dermatol. 2003 Jan;120(1):128-34.), and 8 test non-participants who were not informed of group division The images were shown at random in 1, and wrinkles were evaluated in five stages of 0, 2, 4, 6, and 8.

(2) Analysis of Skin Tissue Under anesthesia with Sevofurene (registered trademark) inhalation anesthetic (Maruishi Pharmaceutical Co., Ltd.), blood was collected from the heart, and then skin tissue was collected. Using a biopsy trepan (8 mm diameter, manufactured by Kai Industries Co., Ltd.), a hole was made in the upper midline of the back to collect skin for pathological analysis, and filter paper (filter paper for Kiriyama funnel, No. 4, 21 φ m / m (manufactured by Kiriyama Seisakusho Co., Ltd.), and immediately placed in a bottle filled with a fixing solution (Tissue Techyufix, manufactured by Kashima Chemical Co., Ltd.) for fixation. Subsequently, the skin of the entire back is collected, placed on a cutter plate with the stratum corneum side down, and the subcutaneous tissue is removed using the bladeless side of a scalpel (disposable scalpel No. 12, manufactured by AS ONE Co., Ltd.). did. Skin tissues were immediately frozen in liquid nitrogen and stored at -80°C until analysis.
The skin collected and fixed at the time of dissection was embedded in paraffin, excised, sliced, and subjected to hematoxylin & eosin (HE) staining and immunohistochemical staining according to a conventional method to prepare each tissue specimen.

<HE staining>
After deparaffinization and washing with water, staining was performed with Carracci's hematoxylin solution for 5 minutes. Then, it was lightly fractionated with a 70% hydrochloric acid alcohol solution. After washing with tap water, it was immersed in hot water for 10 minutes, immersed in an eosin staining solution for 5 minutes, dehydrated in several baths with 100% alcohol, cleared with xylene, and sealed.
The entire field of view of these specimens was observed, and photographs of representative sites were taken with an OLYMPUS CAMEDIA DIGITAL CAMERA C-3040 ZOOM. Using the HE-stained specimen, the distance from the basal layer to the upper granular layer was regarded as the epidermis and measured with Image J image processing software. Three visual fields were photographed per animal, and the thickness of the epidermis was measured at 10 points for each photograph. The average value of the three photographs was calculated, and the value was taken as the skin thickness of the individual.
<Immunohistological staining>
In order to observe laminin, which is a component of the basement membrane of the skin, and filaggrin, which is a component of the epidermis, immunostaining using an enzyme antibody method was performed. Sections with a thickness of 3 μm were prepared from the paraffin block, deparaffinized, and then subjected to antigen retrieval treatment by digestion with Proteinase K (manufactured by Sigma). Subsequently, after performing endogenous peroxidase inhibition treatment with 3% hydrogen peroxide/methanol and blocking treatment with 1% goat serum, the primary antibody diluted with 1% goat serum (rabbit-derived anti-laminin polyclonal antibody, ab11575, Engelbreth- Holm-Swarm sarcoma, Abcam, 100-fold dilution; Rabbit-derived anti-filaggrin polyclonal antibody, GTX37695, GeneTex, 200-fold dilution) was used to react at room temperature for 1 hour. After washing with PBS(−), 4 drops of HRP-labeled secondary antibody (goat-derived anti-rabbit IgG antibody; Simple stain MAX PO, manufactured by Nichirei Bio) was added dropwise and allowed to react at room temperature for 30 minutes. After washing, staining was performed by reacting a chromogenic substrate (ImmPact DAB, manufactured by Vector). After counterstaining with Mayer's hematoxylin (manufactured by Muto Kagaku Co., Ltd.), washing with water, dehydration in several tanks with 100% alcohol, clearing with xylene, and encapsulation with marinol were carried out.

2. Results During the study period, no abnormal changes in body weight were observed due to intake of the test substance. Weekly, skin hydration was measured over time. In the second week of UV irradiation, the UV (-) control group was 63.19 ± 2.89 CM units, while the UV (+) control group was 52.60 ± 1.26 CM units, UV (+) The water content of the control group was significantly lower than that of the UV(-) control group (p<0.05 Tukey-Kramer's test). From week 3 to week 7, the water content of the UV (+) control group was significantly lower than that of the UV (-) control group (p<0.01, p<0.05 Tukey-Kramer's test). , it was confirmed that a photoaging model was formed by UV irradiation. 61.18±1.30 CM units in the UV (−) control group, 44.74±1.58 CM units in the UV (+) control group and 55.97±1.58 CM units in the UV (+) PW group at 6 weeks. 28 CM units and 54.11±1.52 CM units in the UV(+) PE group. As shown in FIG. 2 [A], at the time of dissection, a significant reduction in water content was suppressed in the UV(+) PW group and the UV(+) PE group compared to the UV(+) control group (p <0.01 Tukey-Kramer's test). Ingestion of frozen pulverized peony petals and its hot water extract ameliorated skin hydration, which decreases due to UV exposure.
As shown in FIG. 2 [B], the TEWL of the UV(+) group was significantly higher than that of the UV(−) control group in the measurement at the time of dissection (p<0.01, p<0.01). 05 Tukey-Kramer's test). In contrast, the TEWL of the UV(+) PW group and the UV(+) PE group decreased slightly. Therefore, it was suggested that the ingestion of frozen pulverized peony petals and its hot water extract may improve the barrier function of skin damaged by UV exposure.
FIG. 3 shows a photograph of the back skin of the UV-irradiated hairless mouse and the results of scoring the wrinkles. The score was calculated from the reference dorsal skin and was 0.71 ± 0.18 in the UV (-) control group, whereas the UV (+) control group was 6.18 ± 0.36, UV (+) PW group 4.68±0.56, UV(+) PE group 4.54±0.70. Although no statistically significant difference was obtained between the UV irradiation groups, wrinkle formation was slightly suppressed by ingestion of the frozen pulverized peony petals and its hot water extract.
FIG. 4 shows histological images of the dorsal skin of UV-irradiated hairless mice administered with the frozen pulverized peony petals and its hot water extract. [A] shows an HE-stained image, [B] shows an anti-laminin immunohistochemical staining image, and [C] shows an anti-filagrin immunohistochemical staining image.
When the epidermal thickness was measured from the HE staining image, the UV (-) control group was 15.52 ± 1.24 µm, the UV (+) control group was 43.04 ± 2.67 µm, and the UV (+) PW group was 33.25. ±2.04 μm, UV(+) PE group 32.34±1.71 μm. (Fig. 5). A significant increase in epidermal thickening was observed in the UV irradiation group compared to the UV(-) control group (p<0.01 Tukey-Kramer's test). In addition, the UV (+) PW group and the UV (+) PE group had significantly lower epidermal thickness than the UV (+) control group (p<0.01, p<0.05 Tukey-Kramer's test ). Due to UV exposure, stratification of epidermal cells above the basement membrane, loss of nuclei, and stratification and detachment of the stratum corneum are observed. On the other hand, ingestion of the frozen pulverized peony petals and its hot water extract reduced the stratification of epidermal cells on the basement membrane, and exfoliation of the keratin was also suppressed.
Laminin staining mainly stains the basement membrane. In the UV(−) control group, the basement membrane indicated by the arrow can be clearly observed, but it can be confirmed that it has disappeared due to exposure to ultraviolet rays. In contrast, staining of the basement membrane is observed in the UV(+) PE group.
In filaggrin staining, the entire epithelial tissue is stained in the UV(-) control group. On the other hand, in the UV(+) control group exposed to ultraviolet rays, the upper stratum corneum is stained thickly. In the UV(+) PW group and the UV(+) PE group, the upper stratum corneum was stained in the same manner as the UV(+) control group, but only the upper part was stained.
From the above results, ingestion of the frozen pulverized peony petals and its hot water extract inhibits epidermal thickening due to UV exposure, repairs the damaged basement membrane, and accumulates filaggrin, a water-retaining factor, in the upper stratum corneum.

Test Example 2 Filaggrin production-promoting action and hyaluronic acid production-promoting action of peony petal hot water extract1. Cells and Cell Culture Method As human epidermal keratinocytes, human keratinocyte cell line Item Number 300493 (cell line service, HaCaT) was used. The growth medium includes DMEM medium (Dulbecco's Modified Eagle's Medium, high glucose'; manufactured by SIGMA)/10% fetal bovine serum (FBS, manufactured by SIGMA)/1% PSN Antibiotic Microstructure (manufactured by GIBCO). It was used. The supplement medium includes DMEM medium (Dulbecco's Modified Eagle's Medium, no phenol, high glucose; manufactured by SIGMA) / 1% sodium pyruvate solution (manufactured by SIGMA) / 1% L-glutaine (manufactured by GIBCO) It was used. Cells were cultured at 37° C. in 5% CO ₂ in a CO ₂ incubator (MCO-17AIC; manufactured by SANKYO).
The sample, pentagalloyl glucose (PGG) and paeoniflorin (PF) were each dissolved in dimethyl sulfoxide (DMSO) at 0.5% and filtered using a 0.20 μm cellulose acetate membrane filter (manufactured by ADVANTEC). After that, it was stored frozen at -20°C until use. The DMSO solution of each sample was adjusted to a final concentration of 0.2% in the medium for supplementation. Supplementary medium containing 0.2% DMSO was used as a control. HaCaT was grown to 80 to 90% coverage of the well, then the growth medium was removed, washed once with PBS (-), supplement medium containing the sample was added, and 3 , and cultured for 12 to 24 hours.

2. Gene Expression Analysis Using Quantitative Real-Time RT-PCR HaCaT was seeded in a 12-well plate at 1.2×10 ⁵ cells/well and cultured for 24 hours. After washing once with PBS, the medium was replaced with supplemental medium containing the sample. 12 h to 24 h after the addition, the cells were dissolved by adding 500 μL of cell lysate (TRIzol Reagent) and collected. After adding 100 μL of chloroform to the cell lysate and stirring well, the mixture was allowed to stand at room temperature for 3 minutes and centrifuged at 13,000 rpm and 4° C. for 15 minutes. 200 μL of the upper layer was collected in another 1.5 mL tube, 250 μL of isopropyl alcohol was added, and after stirring, the mixture was allowed to stand at room temperature for 10 minutes. After that, it was centrifuged at 13,000 rpm and 4° C. for 10 minutes, and the supernatant was removed by decantation, followed by air drying. After adding 500 μL of 70% ethanol and stirring, centrifuging at 12,000 rpm, 4° C. for 5 minutes, the supernatant was removed by decantation and air-dried.

cDNA synthesis was performed using Prime Script PT-PCR kit (manufactured by Takara Bio Inc.). Reagents were adjusted to 6 b μL of RNase Free Water, 0.5 μL of Random 6mers, 2 μL of 5×Prime Script Buffer, and 0.5 μL of Prime Script RT Enzyme Mix per sample. 1 μL of sample RNA solution was added thereto, and a reverse transcription reaction was performed using a thermal climber. The reaction program was set as 37°C for 15 minutes → 85°C → 4°C∞. After completion of the reaction, the mixture was diluted 2-fold with Easy Dilution and stored at -80°C until use.
Real-time PCR was performed using the intercalator method using TB GreenI. TB Green Prime Mix TaqTM (reagent containing Taq DNA Polymerase, dNTP mixture, Mg ² + and TB Green I: manufactured by Takara Bio Inc.) in a reaction tube (0.2 mL Hit-8-Tube: manufactured by Takara Bio Inc.)12. 5 μL of sterilized water, 9.5 μL of sterilized water, 0.5 μL each of sense and antisense primers (manufactured by Takara Bio Inc.) of 10 mol/μL, and 2 μL of cDNA (however, the cDNA solution after the reverse transcription reaction was diluted 2-fold) was mixed. The solution was adjusted. PCR reaction was performed using Thermal Cycler Dice Real Time System TP800 (manufactured by Takara Bio Inc.). The reaction conditions were 95° C. for 5 seconds (pressure reduction)→58° C. for 30 seconds→annealing in 40 cycles. After completion of the reaction, the relative gene expression levels were analyzed using dedicated analysis software (Thermal Cycler Dice Real Time System TP800 Software Ver. 1.02A). A standard curve method was used to determine relative expression levels, and the gene expression levels of each sample were standardized with co-amplified GADPH (glyceraldehyde-3-phosphate dehydrogenase). The primers used are shown below.
・FLG-Forward: CAAGCAGAGAAACACGTAATGAGG (SEQ ID NO: 1)
・FLG-Reverse: CGCACTTGCTTTACAGATATCAGA (sequence number 2)
・GAPDH-Forward: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 3)
・GAPDH-Reverse: TGGTGAAGACGCCAGTGGA (sequence number 4)

3. Method for measuring hyaluronic acid (HA) in culture supernatant HaCaT cells were seeded in a 24-well plate (manufactured by IWAKI) at ⁴ x 104 cells/well and cultured for 48 hours. Addition of each sample was performed in triplicate, and the culture supernatant was collected after 48 hours.
Hyaluronic acid (HA) was quantified as follows according to the method of Haserodt et al. (Sarah Haserodt et al., Glycobiology. 2011 Feb;21(2):175-83.). 100 μL/well of Hyalurnic Acid Binding Protein (HABP, manufactured by Funakoshi Co., Ltd.) diluted 2000-fold with 1×PBS was added to a 96-well ELISA plate (manufactured by IWAKI) and allowed to stand at 4° C. overnight. The next day, after washing twice with PBS-Tween (0.1% Tween 20 (manufactured by Wako Pure Chemical Industries, Ltd.), 200 μL of Block Ace (registered trademark) (manufactured by Megmilk Snow Brand Co., Ltd.) solution diluted to 1% with 1×PBS. /well and allowed to react for 2 hours at 37° C. After washing once with PBS-Tween, HA standard coating solution (HANa 1000 μg/mL (Wako Pure Chemical Industries, Ltd.) 0.5% Block Ace (R) solution diluted to 1000 ng/ml) was added at 50 μL/well and allowed to stand at 37° C. for 1 hour, washed with PBS-Tween three times, and diluted with 0.5% Blockace (registered trademark) solution. Samples and standard HA solutions (1000, 250, 62.5, 15.625, 3.90625, 0.5% Block Ace (registered trademark) solution containing 0 ng/mL HA) were added at 50 μL/well, and 50 μL/well of biotin-bound HABP solution (manufactured by Funakoshi Co., Ltd.) diluted to 0.125 mg/ml with 0.5% Block Ace (registered trademark) solution was added from the top, and reacted at room temperature for 1 hour. After washing three times with Tween, 50 μL/well of HRP-bound streptavidin solution (manufactured by Thermo Scientific) diluted to 0.050 μg/ml with 0.5% Block Ace (registered trademark) solution was added and the plate was heated at 37° C. for 30 minutes. After washing 5 times with PBS-Tween, 50 μL/well of tetramethylbenzidine (TMB) reagent (manufactured by Nacalai Techs Co., Ltd.) was added, shielded from light with aluminum foil and allowed to stand at room temperature for 30 minutes for color development. 50 μL/well of 1N H ₂ SO ₄ solution was added to stop the reaction, and immediately thereafter, the absorbance at ABS 450 nm/630 nm was measured using a microplate reader (Infinite M200, manufactured by TECAN) All measurements were performed in duplicate. The calculation method was to create a logarithmic curve from the absorbance of the standard and determine the concentration of the sample.

4. Results (1) A peony petal hot water extract (PE) was added to HaCaT cells, the cells were collected 12 hours and 24 hours after the addition, and the gene expression of filaggrin (FLG) was analyzed (Fig. 6 [A] ). After 12 and 24 hours, addition of PE significantly increased the filaggrin expression level compared to the control (p<0.01 Student t test). In addition, PGG and PF were added, and FLG gene expression was analyzed 12 hours after the addition (Fig. 6 [B]). Addition of 10 μM of PGG significantly increased the expression level compared to the control (p<0.01 Tukey-Kramer's test). Addition of PF did not change the gene expression level of FLG.

(2) HaCaT cell proteins were extracted and filaggrin proteins were analyzed by Western blotting (Fig. 7). A dark band near 50 kDa and multiple bands on the higher molecular side were confirmed. A faint band that appears to be a filaggrin monomer was confirmed at around 35 kDa. β-actin was also detected as a loading control to confirm equal protein expression. As a result of Western blotting, multiple bands were confirmed in the range of 25 kDa to 120 kDa. This is probably because not only the filaggrin monomer (37 kDa) but also profilaggrin and the N-terminal protein of profilagrin are detected when the anti-filaggrin antibody is used.
It was confirmed that the filaggrin band at 37 kDa became darker with the addition of PE than with the control. However, with the addition of PGG and PF, the background was dirty and it was difficult to determine the density of the bands.
Hot water extracts of peony petals or callus cultures (PE, CE) and 30% ethanol extracts of peony petals or callus cultures (P30, C30) were added and cells were harvested 12 hours and 24 hours after addition. and analyzed the gene expression of filaggrin (FLG) (Fig. 8). Twelve hours after the addition, PE, P30 and C30 showed an increase in FLG gene expression level compared to the control. It was the highest with C30 addition. Even after 24 hours, addition of PE, P30 and C30 increased the gene expression level of FLG.

(3) An increase in expression of filaggrin was confirmed by the addition of the peony petal extract and pentagalloyl glucose, but the concentration of pentagalloyl glucose contained in the PE sample (10 μg/ml) added this time was about 0.1 μM. be. Therefore, it is considered that the increase in filaggrin expression due to the addition of peony petals is not only due to pentagalloyl glucose in the sample. It is conceivable that the expression of filaggrin was promoted by a component other than pentagalloylglucose or by an interaction between pentagalloylglucose and another component.

(4) The amount of hyaluronic acid produced was increased by adding hot water extracts (PE, CE) of peony petals or callus cultures, and 30% ethanol extract of peony petals (P30). (Fig. 9).

Claims (7)

A filaggrin production promoter containing a peony, a callus derived from the peony, or an extract thereof as an active ingredient. A hyaluronic acid production promoter comprising a peony, a callus derived from the peony, or an extract thereof as an active ingredient. A skin moisturizing agent containing peony, callus derived from peony, or an extract thereof as an active ingredient. A food for promoting the production of filaggrin containing peony, callus derived from peony, or an extract thereof as an active ingredient. A food for promoting the production of hyaluronic acid, comprising a peony, a callus derived from the peony, or an extract thereof as an active ingredient. A skin-moisturizing food comprising a peony, a callus derived from the peony, or an extract thereof as an active ingredient. The agent according to any one of claims 1 to 3, wherein the extract is a hot water extract or ethanol-water extract of peony petals, or an ethanol-water extract of callus derived from peony. The food according to any one of items 4 to 6.

Images