JP2022106929A - Treatment of AMD with AAV SFLT-1 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a pharmaceutical composition comprising a pharmaceutically effective amount of a vector that comprises a nucleic acid encoding a soluble Fms-related tyrosine kinase 1 (sFlt-1) protein, and to provide the composition and method for preventing or treating ocular neovascularization, such as AMD, in a human subject by subretinal administration to a human subject.

SOLUTION: According to the present invention, there is provided a nucleic acid comprising a sequence encoding a VEGF inhibitor for use in the treatment or prevention of ocular neovascularization in a human subject. The use is direct administration of an effective amount for the human subject of a pharmaceutical composition to one or more subretinal sites in a human subject in need thereof. The pharmaceutical composition comprises the nucleic acid.

SELECTED DRAWING: None

COPYRIGHT: (C)2022,JPO&INPIT

Description

Sequence Listing This application contains a sequence listing that is submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy made on May 1, 2013 is 43016-702.201_SL. It is named txt and has a size of 84,779 bytes.

Age-related macular degeneration (AMD) is one of the leading causes of irreversible visual damage in people over the age of 50. AMD is clinically divided into two types: "atrophic" and "exudative". The exudative form of AMD can develop rapidly and often results in blindness. Pathological changes in the disease can cause severe visual dysfunction. Symptoms of AMD may include, but are not limited to, dysfunction of retinal pigment epithelial (RPE) cells within the macula zone and choroidal neovascularization (CNV). In severe cases, fluid leakage, detachment of the RPE or neuroepithelium, and bleeding from ruptured blood vessels can also occur. Among them is vascular endothelial growth factor (VEGF)
Includes growth factor), VEGF receptor (VEGFR), platelet-derived growth factor (PDGF), hypoxic-inducing factor (HIF), angiopoetin (Ang) and other cytokines, mitogen-activated protein kinase (MAPK), etc. Many cellular factors, but not limited to, have been found to play important roles in the regulation of CNV development.

One treatment currently approved for wet AMD is Lucentis®. Lucentis® is an anti-angiogenic agent that targets all isoforms of vascular endothelial growth factor (VEGF). Clinical studies have shown visual improvement or stability in approximately 95% of patients receiving Lucentis® compared to approximately 60% of patients treated with sham. Lucentis® is the first drug approved to improve vision, but requires intravitreal administration every 4 weeks for optimal visual benefit. Eylea® is another VEGF inhibitor approved to treat wet AMD. Eylea® also requires high frequency intravitreal injections every 4-8 weeks for optimal visual benefit. Intravitreal routes of administration may increase the risk for serious complications such as infectious endophthalmitis and retinal detachment, which increase their cumulative risk with repeated doses. Increased intraocular pressure, traumatic cataracts, and retinal lacerations have also been reported. Finally, if the procedure is delivered by an ophthalmologist, the frequency of procedure should determine the burden on the patient, physician, and healthcare system in general and reduce it to the extent possible. In the art, the limitations of currently available treatments for AMD-secondary CNVs have created a need for alternative methods of addressing the invasiveness of the high frequency treatments and treatment procedures required. Angiogenesis with elevated VEGF can also result in other ocular conditions such as diabetic retinopathy, diabetic macular edema (DME), and retinal vein occlusion (RVO). These diseases result in retinal angiogenesis and visual loss. VEGF inhibitors such as Lucentis® support their efficacy in DME and RVO, but require high frequency intravitreal administration, as in wet AMD, to maintain benefit. do.

The present disclosure provides compositions and methods for treating CNVs such as CNVs found in exudative forms of AMD in human subjects.

In one aspect, the disclosure treats AMD in a human subject, comprising the step of subretinal administration of a pharmaceutically effective amount of a pharmaceutical composition comprising a VEGF inhibitor to a human subject in need of treatment with AMD. The composition and method for this are provided. In one aspect, the pharmaceutical composition comprises a recombinant virus. In another aspect, the VEGF inhibitor is soluble Fms-related tyrosine kinase 1 (sFLT-1: soluble Fms-related tyrosine).
Kinase-1) Contains nucleic acids encoding proteins.

In one aspect, the present disclosure comprises a pharmaceutical composition comprising a pharmaceutically effective amount of a recombinant virus comprising a nucleic acid encoding a soluble Fms-associated tyrosine kinase 1 (sFLT-1) protein in a human requiring treatment with AMD. Provided are compositions and methods for preventing CNV in human subjects with AMD, including the step of subretinal administration to the subject.

In some embodiments, the virus is an adeno-associated virus (AAV), helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus, poxvirus, Sendaivirus (HVJ) -lipocytosis complex, Selected from Moloney mouse leukemia virus, and HIV-based virus. In some embodiments, the AAV capsids or inverted terminal sequences (ITRs) are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, rh10, and these. Selected from the group consisting of hybrids of.

In some embodiments, the recombinant virus is a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter. , CAG promoter, RPE65 promoter, and promoter selected from opsin promoters.

In some embodiments, the recombinant virus comprises an enhancer.

In some embodiments, the recombinant virus comprises an intron or a chimeric intron.

In some embodiments, the recombinant virus comprises an SV40 poly A sequence.

In some embodiments, the recombinant virus comprises a human sFlt-1 protein or a functional fragment thereof.

In some embodiments, the recombinant virus is generated from a plasmid containing an ampicillin resistance marker or a non-ampicillin resistance marker.

In some embodiments, the recombinant virus comprises a bacterial regulatory sequence such as the T7 RNA polymerase promoter.

In some embodiments, the recombinant virus lacks a bacterial regulatory sequence such as the T7 RNA polymerase promoter.

In some embodiments, the recombinant virus comprises a regulatory nucleic acid fragment capable of directing the selective expression of the sFlt-1 protein or functional fragment thereof in ocular cells.

In some embodiments, the pharmaceutical composition comprises from about 1 × 10 ⁶ to about 1 × 10 ¹⁵ recombinant viral vector genomes, from about 1 × 10 ⁷ to about 1 × 10 ¹⁴ recombinant viral vector genomes, about 1 ×. 10 ⁸ to about 1 × 10 ¹³ recombinant viral vector genomes, about 1 × 10 ⁹ to about 3 × 10 ¹² recombinant viral vector genomes, or about 1 × 10 ¹⁰ to about 3 × 10 ¹² recombinant viral vectors Contains the genome.

In some embodiments, the pharmaceutical composition is administered via subretinal injection.

In some embodiments, the method further comprises the step of administering to a human subject a pharmaceutically effective amount of VEGF inhibitor. In some embodiments, the VEGF inhibitor comprises an antibody against VEGF or a functional fragment thereof. In some embodiments, the VEGF inhibitor comprises ranibizumab. In some embodiments, the pharmaceutical composition is administered at least 5, 6, 7, or 8 days after administration of the VEGF inhibitor. In some embodiments, the pharmaceutical composition is administered within 30, 60, or 90 days after administration of the VEGF inhibitor.

In some embodiments, the VEGF inhibitor is administered once prior to administration of the pharmaceutical composition comprising the recombinant virus and once or twice after administration. In some embodiments, the VEGF inhibitor is administered at least twice prior to administration of the pharmaceutical composition and once or twice after administration. In some embodiments, the VEGF inhibitor is administered over a 6-7 week period.

In some embodiments, the VEGF inhibitor is an anti-VEGF antibody such as bevacizumab or ranibizumab. In another aspect, the VEGF inhibitor is a soluble receptor, fusion protein, or fragment thereof, such as aflibercept or sFLT01.

In some embodiments, the AMD is a wet AMD.

In some embodiments, the AMD is an atrophic AMD.

In some embodiments, the human subject is at risk for wet AMD.

In some embodiments, the human subject presents with symptoms of early exudative AMD.

In some embodiments, at least 3, 5, 10, 15, or 20 treatments with different VEGF inhibitors to treat AMD have been pre-administered to the human subject.

In some embodiments, the best corrected visual acuity (BCVA) did not improve after the treatment with ranibizumab.

In some embodiments, after the treatment with ranibizumab, the improvement in maximum corrected visual acuity (BCVA) as measured by the ETDRS (Early Treatment Diabetic Retinopathy Study) text is more than one line.

In some embodiments, the human subject presents with symptoms of early atrophic AMD.

In some embodiments, the treatment is administered at least once every six months.

In some embodiments, the dosing step is performed on the human subject who is 20, 40, 50, 55, or 65 years or older.

In some embodiments, the administration is to the site outside the fovea.

In some embodiments, the administration is to one or more cells in the subretinal space of the central retina.

In some embodiments, the administration is to one or more cells outside the macula.

In some embodiments, the administration is to one or more cells inside the macula.

In some embodiments, the administration is administration to retinal pigment epithelial cells.

In some embodiments, administration does not adversely affect the function of the central retina or the structure of the central retina.

In some embodiments, administration does not increase systemic levels of VEGF inhibitors in human subjects.

In some embodiments, administration does not increase systemic levels of sFlt-1 in human subjects.

In some embodiments, the dosing step is performed simultaneously or sequentially in both eyes.

In some embodiments, the dosing step is performed in one eye.

In some embodiments, if the pair of eyes presents with AMD symptoms, the dosing step is also performed on one eye.

In some embodiments, the dosing step is performed in a human subject resistant to penicillin.

In some embodiments, the dosing step is performed in a human subject sensitive to penicillin.

In some embodiments, the dosing step is performed in a human subject who is allergic to penicillin.

In some embodiments, the dosing step is performed in a human subject who is not allergic to penicillin.

In some embodiments, the dosing step does not cause inflammation of the vitreous as observed by biomicroscopy (BE) and indirect ophthalmoscopic surgery (IOE) after the dosing step.

In some embodiments, the dosing step does not provoke a cytotoxic T cell response.

In some embodiments, the dosing step does not elicit a cytotoxic T cell response, which measures an increase in cytotoxic T cells that exceeds the baseline range by less than 10%.

In some embodiments, the T cells do not exhibit the activated effector phenotype after the dosing step.

In some embodiments, after the dosing step, the best corrected visual acuity (BCVA) as measured by the ETDRS (Diabetic Retinopathy Early Treatment Study) letter improves by 1, 2, 3, 4, or 5 lines or more.

In some embodiments, reduction of angiogenesis is observed using fluorescein angiography (FA) after the dosing step.

In some embodiments, the frequency of administration of ranibizumab is reduced to less than 12 times per year. In some embodiments, the frequency of administration of aflibercept is reduced to less than 6 times per year.

In some embodiments, ranibizumab or aflibercept or other VEGF inhibitor is administered less frequently or no longer.

In some embodiments, the virus comprises an sFLT-1 gene or a functional fragment thereof that has ≥90% sequence homology to the human sFLT-1 gene sequence.

In some embodiments, the virus administered comprises the sFLT-1 gene, a gene variant, or a gene fragment.

In some embodiments, no vector is detected in the tear, blood, saliva, or urine sample of a human subject 7, 14, 21, or 30 days after administration of the pharmaceutical composition.

In some embodiments, the presence of the viral vector is detected by qPCR or ELISA.

In some embodiments, the sFlt-1 protein level in the vitreous of a human subject is about 500-5,000 pg / ml, about 600-4, 7, 14, 21, or 30 days after administration of the pharmaceutical composition. It is 000 pg / ml, about 800-3,000 pg / ml, about 900-2,000 pg / ml, or about 1,000-1800 pg / ml. In some embodiments, it may also be referred to as the sFlt-1 protein concentration in the vitreous of a human subject at 7, 14, 31, 30, 60, 90, 180, 270, and 365 days after administration of the pharmaceutical composition. sFlt-1 protein levels are elevated.

In some embodiments, the human subject does not exhibit clinically significant retinal toxicity, as assessed by continuous eye examination over a period of at least 2 months.

In some embodiments, there are no signs of inflammation in the surface, anterior segment, or vitreous in human subjects for at least 2 months.

In some embodiments, the human subject does not require salvage with a VEGF inhibitor at least 120 days after administration of the recombinant virus. In some embodiments, the human subject does not require salvage with a VEGF inhibitor at least 180 days or at least 210 days after said administration of the recombinant virus. In some embodiments, the human subject does not require salvage with a VEGF inhibitor for at least 270 days after administration of the recombinant virus. In some embodiments, the human subject does not require salvage with a VEGF inhibitor for at least 365 days after administration of the recombinant virus.

In some embodiments, evidence of loss of vision, elevated IOP, retinal detachment, or any intraocular or systemic immune response is found in the human subject at least 180 days or at least 210 days after said administration of the recombinant virus. I can't. In some embodiments, there is no evidence of loss of vision, elevated IOP, retinal detachment, or any intraocular or systemic immune response in the human subject at least 365 days after administration of the recombinant virus.

In another aspect, the disclosure is a pharmaceutical composition comprising from about 1 × 10 ⁶ to about 1 × 10 ¹⁵ recombinant viruses, each of which is a soluble Fms-related tyrosine kinase 1 (sFlt-). 1) Provided is a pharmaceutical composition containing a nucleic acid encoding a protein.

In some embodiments, the present disclosure is a method for treating or preventing ocular angiogenesis in a human subject, treating a pharmaceutically effective amount of a pharmaceutical composition comprising a nucleic acid encoding sFLT-1. Provided is a method comprising the step of administering to one or more subretinal sites of a human subject in need.

In some embodiments, the disclosure is selected from the group consisting of age-related macular degeneration (AMD), wet AMD, atrophic AMD, retinal neovascularization, choroidal neovascularization, and diabetic retinopathy. Provide human subjects who have or are suspected of having a condition. In some cases, human subjects include proliferative diabetic retinopathy, retinal vein occlusion, central retinal vein occlusion, branched retinal vein occlusion, diabetic retinopathy, diabetic retinal ischemia, ischemic retinopathy, And have or are suspected of having one or more conditions selected from the group consisting of diabetic retinopathy.

In some embodiments, the present disclosure is a pharmaceutical composition comprising a recombinant virus in which the virus is an adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus. , Poxvirus, Sendaivirus (HVJ) -liploid complex, Moloney mouse leukemia virus, and HIV-based virus.

In some embodiments, the present disclosure describes the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the MMT promoter, the EF-1 alpha promoter, the UB6 promoter, the chicken beta-actin promoter, the CAG promoter, the RPE65 promoter, And provide a sFLT-1 encoding nucleic acid operably linked to a promoter selected from the group consisting of the opsin promoter.

In some embodiments, the present disclosure provides an sFLT-1 nucleic acid in which sFLT-1 encodes at least one dimerization domain. In some cases, the sFLT-1 nucleic acid does not contain prokaryotic regulatory sequences. Optionally, the sFLT-1 nucleic acid contains a prokaryotic regulatory sequence.

In some aspects, the disclosure provides a pharmaceutical composition comprising a virus or plasmid.

In some embodiments, the present disclosure provides administration of a single or multiple treatments with a VEGF inhibitor to a human subject. Optionally, the VEGF inhibitor is administered within 30, 90, or 180 days after administration of the pharmaceutical composition. Optionally, the pharmaceutical composition of the present disclosure and the VEGF inhibitor are administered at least at 24 hour intervals.

In some embodiments, the present disclosure provides a pharmaceutical composition administered to a human subject at least 55 years of age.

In some embodiments, the present disclosure provides administration of the pharmaceutical composition to the outside of the fovea.

In some embodiments, the disclosure discloses that the highest corrected visual acuity (BCVA) in a human subject, as measured by the ETDRS (Diabetic Retinopathy Early Treatment Study) character, is at least 1, 2, 3 after administration of the pharmaceutical composition. Offers improvement of 4, or 5 lines.

In some aspects, the disclosure provides that after administration of the pharmaceutical composition, the reduction in maximum corrected visual acuity (BCVA) as measured by ETDRS (Diabetic Retinopathy Early Treatment Study) is less than 15 letters. ..

In some embodiments, the present disclosure comprises a condition in which the pharmaceutical composition is administered to one eye, a condition in which the pharmaceutical composition is administered sequentially to two eyes, and a condition in which the pharmaceutical composition is administered to two eyes simultaneously. Provided is administration of a pharmaceutical composition under conditions selected from the group consisting of.

In some embodiments, the present disclosure provides that the reduction in angiogenesis observed by fluorescein angiography (FA) follows administration of the pharmaceutical composition.

In some embodiments, the present disclosure provides that in human subjects at least 1 week after injection, there are no signs of inflammation on the surface, anterior eye, or vitreous.

In some embodiments, the present disclosure presents signs of inflammation in the surface, anterior segment, or vitreous in human subjects 1 week or 3, 6, 9, or 12 months after administration of the pharmaceutical composition. Offer not to.

In some embodiments, the present disclosure provides that a human subject does not require remedies for at least 30, 60, 90, 120, 180, 270, or 365 days after administration of the pharmaceutical composition.

In some embodiments, the present disclosure provides that a human subject does not undergo visual acuity loss, elevated IOP, retinal detachment, intraocular or systemic immune response after administration of the pharmaceutical composition.

In some embodiments, the present disclosure provides that an increase in anti-AAV cytotoxic T cell response is not measured after the administration step.

In some aspects, the disclosure provides that the virus is not detected in blood, saliva, or urine samples of human subjects 3, 7, 14, 21, or 30 days after administration of the pharmaceutical composition.

In some embodiments, the present disclosure is in the vitreous of a human subject 7, 14, 21, 30, 60, 90, 120, 150, 180, 270, or 365 days after administration of the pharmaceutical composition to the human subject. The sFLT-1 protein level of is about 500-5,000 pg / ml.

In some embodiments, the present disclosure provides a human subject to be treated with one or more treatments with a VEGF inhibitor prior to administration of the pharmaceutical composition.

In some embodiments, the present disclosure provides a human subject as resistant to treatment with a VEGF inhibitor.

In some embodiments, the present disclosure provides a human subject who has not been pre-treated with a VEGF inhibitor prior to administration of the pharmaceutical composition.

In some embodiments, the present disclosure provides administration of a pharmaceutical composition to a human subject at a frequency of less than 3 times per year.

In some embodiments, the disclosure provides that administration of the pharmaceutical composition reduces the frequency of administration of additional VEGF inhibitor treatments in human subjects.

In some embodiments, the present disclosure is a vitreous body of a human subject when measured 7, 14, 21, 30, 60, 90, 120, 150, 180, 270, or 365 days after administration of the pharmaceutical composition. It provides an increase in the concentration of sFLT-1 protein in.

In some embodiments, the disclosure provides a human subject from which the vitreous gel has been removed prior to administration of the pharmaceutical composition, or within a day or week thereof.

In some embodiments, the present disclosure provides pharmaceutical compositions that are administered using a vitrectomy system smaller than 20 gauge.

In some embodiments, the present disclosure provides pharmaceutical compositions that are administered using a vitrectomy system that does not require suturing.

In some embodiments, the present disclosure provides a pharmaceutical composition administered using a cannula chip smaller than 39 gauge.

In some embodiments, the present disclosure provides pharmaceutical compositions that are followed by gas / liquid exchange within the vitreous cavities.

In some embodiments, the present disclosure provides that the central retinal thickness of a subject does not increase by more than 50 microns, 100 microns, or 250 microns within 12 months after treatment with the pharmacological agent.

In some embodiments, the present disclosure provides that geographic atrophy does not progress in an affected eye of a human subject as compared to an affected eye of an untreated human subject.

In some aspects, the disclosure provides a pharmaceutical composition comprising a recombinant virus or plasmid containing a nucleic acid comprising at least one promoter sequence operably linked to an sFLT-1 transgene sequence. Optionally, the pharmaceutical compositions of the present disclosure include a promoter sequence separated by a sequence greater than 300 base pairs and an sFLT-1 transgene sequence. Optionally, the pharmaceutical compositions of the present disclosure include a promoter sequence separated by a UTR sequence and an sFLT-1 transgene sequence. In some cases, the UTR sequence contains at least 10 base pairs. Optionally, the pharmaceutical composition comprises at least three linker sequences, each containing at least 50 base pairs.

In some embodiments, the present disclosure provides a pharmaceutical composition in which the sFlt-1 nucleic acid encodes at least one dimerization domain.

In some embodiments, the present disclosure comprises SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, a promoter sequence selected from the group consisting of SEQ ID NO: 340, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, and SEQ ID NO: 47; SEQ ID NO: 102, SEQ ID NO: A sequence encoding a VEGF inhibitor selected from the group consisting of 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, and SEQ ID NO: 108; SEQ ID NO: 48, SEQ ID NO: 115, SEQ ID NO: 116, Intron sequence consisting of SEQ ID NO: 117, SEQ ID NO: 118, and SEQ ID NO: 119; SEQ ID NO: 91, SEQ ID NO: 2, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: A UTR sequence selected from the group consisting of No. 98, SEQ ID NO: 99, SEQ ID NO: 100, and SEQ ID NO: 101; and SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, And a pharmaceutical composition comprising a termination sequence selected from the group consisting of SEQ ID NO: 55.

In some embodiments, the disclosure is a unit dose pharmaceutical composition comprising a recombinant virus having a vector genome of 1 × 10 ⁶ to 1 × 10 ¹⁵ , wherein the recombinant virus operably ligates to a promoter. Provided is a unit dose pharmaceutical composition comprising a nucleic acid encoding sFLT-1. Optionally, a unit dose of the pharmaceutical composition comprises a vector genome of ^1x10 10-3x10 ¹² .

In some embodiments, the disclosure is a method of producing a recombinant virus intracellularly, comprising at least one promoter sequence, an ITR sequence, and a UTR sequence operatively linked to an sFLT-1 transgene sequence. Provided is a method comprising the step of introducing a nucleic acid into a cell and the step of purifying a recombinant virus. In some cases, the UTR sequence is a human UTR sequence. In some cases, the nucleic acid sequence does not contain a beta-lactam antibiotic resistant sequence. In some cases, when measured 72 hours after transduction of HEK293 cells with a multiplicity of infection (MOI), the recombinant virus contains ^100-10,000 pg of sFLT-1 protein. Produce in the range of / mL. In some cases, the recombinant virus inhibits the growth of human umbilical vascular endothelial cells (HUVEC).

In some embodiments, the present disclosure is a cell for producing a recombinant viral vector, at least one promoter polynucleotide sequence operably linked to an sFLT-1 transduction gene sequence, an ITR polynucleotide sequence, and. A cell containing a UTR polynucleotide sequence is provided.

In some embodiments, the present disclosure is a nucleic acid comprising a sequence encoding sFLT-1 for use in the treatment or prevention of ocular angiogenesis in humans, wherein said use requires it. The pharmaceutical composition provides a nucleic acid comprising said nucleic acid, comprising the step of directly administering an effective amount of the pharmaceutical composition to the human subject to one or more subretinal sites in the subject.

In some embodiments, the present disclosure provides nucleic acids for use in which the sFLT-1 is a VEGF inhibitor and the treatment or reduction of the potential for ocular angiogenesis results in VEGF inhibition. ..

In some embodiments, the present disclosure discloses that the pharmaceutical composition adjusts the level of the sFLT-1 protein in the vitreous of a human subject at least 72 hours after administration of the pharmaceutical composition to the human subject. Provided are nucleic acids for use that can be elevated relative to the level of the sFLT-1 protein in the human vitreous previously.

In some embodiments, the present disclosure states that the nucleic acid comprising sFLT-1 is an adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus, poxvirus, Sendaivirus. (HVJ) -provides nucleic acids for use, including recombinant viruses selected from the group consisting of liposome complexes, Moloney mouse leukemia virus, and HIV-based viruses.

In some embodiments, the present disclosure states that the nucleic acid encoding sFLT-1 is a cytomegalovirus (CMV) promoter, a roussian sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-. Provided are nucleic acids for use that are operably linked to a promoter selected from the group consisting of the actin promoter, the CAG promoter, the RPE65 promoter, and the opsin promoter.

In some embodiments, the present disclosure provides nucleic acids for use in which the nucleic acid is packaged by a virus or is plasmid DNA.

In some embodiments, the present disclosure provides nucleic acids for use. The use further comprises administration of one or more additional VEGF inhibitors to human subjects in need of treatment or reduction, and optionally said additional VEGF inhibitor is ranibizumab or bevacizumab.

In some aspects, the disclosure provides nucleic acids for use that include the step of administering the pharmaceutical composition to a human subject at least 50, 55, or 65 years old.

In some embodiments, the present disclosure provides nucleic acids for use that include the step of administering the pharmaceutical composition outside the fovea.

In some embodiments, the present disclosure is the highest corrected visual acuity (BCVA) in a human subject in need of treatment, as measured by the ETDRS (Diabetic Retinopathy Early Treatment Study) letter after administration of an effective amount of the pharmaceutical composition. Provides nucleic acids for use that improve at least 1, 2, 3, 4, or 5 lines.

In some embodiments, the disclosure is a use in which administration of a pharmaceutical composition is performed at least once every 3, 6, 9, 12, 18, or 24 months in a human subject in need of treatment. Provide nucleic acid for.

In some embodiments, the present disclosure administers the pharmaceutical composition in human subjects less than three times a year, or reduces the frequency of administration of additional VEGF inhibitor treatments in human subjects. Provide nucleic acids for use performed as often as possible.

In some embodiments, the present disclosure provides a unit dose pharmaceutical composition comprising a vector genome of approximately 1x10 ^{6-1x10 15} or ^1x10 10-3x10 ¹² . In some embodiments, the recombinant virus comprises a nucleic acid encoding sFLT-1 or a functional fragment thereof operably linked to a promoter.

In some embodiments, the present disclosure is a method for treating or preventing angiogenesis of the eye in a human subject, treating a pharmaceutical composition comprising a pharmaceutically effective amount of a nucleic acid encoding a VEGF inhibitor. Provided is a method comprising the step of administering to one or more subretinal sites of a human subject in need. In some embodiments, the VEGF inhibitor is an anti-VEGF antibody or functional fragment thereof. In some embodiments, the VEGF inhibitor is a soluble receptor, fusion protein, or functional fragment thereof.
In certain embodiments, for example, the following is provided:
(Item 1)
A nucleic acid comprising a sequence encoding a VEGF inhibitor for use in the treatment or prevention of ocular angiogenesis in a human subject, the use of which is one or more subretinal sites in a human subject in need thereof. A nucleic acid comprising the nucleic acid, comprising the step of directly administering an effective amount of the pharmaceutical composition to the human subject.
(Item 2)
The nucleic acid for use according to item 1, wherein the VEGF inhibitor is an anti-VEGF antibody or a functional fragment thereof.
(Item 3)
The nucleic acid for use according to item 1, wherein the VEGF inhibitor is a soluble receptor, fusion protein, or fragment thereof.
(Item 4)
A nucleic acid containing a sequence encoding sFLT-1 for use in the treatment or prevention of ocular angiogenesis in a human subject, the use of which is one or more subretinal sites in a human subject in need thereof. A nucleic acid comprising the nucleic acid, comprising the step of directly administering an effective amount of the pharmaceutical composition to the human subject.
(Item 5)
The nucleic acid for use according to item 4, wherein sFLT-1 is a VEGF inhibitor and said treatment or reduction of the potential for ocular angiogenesis results in VEGF inhibition.
(Item 6)
The pharmaceutical composition measures the level of sFLT-1 protein in the vitreous of a human subject at least 72 hours after administration of the pharmaceutical composition to the human subject, and in the human vitreous before administration. The nucleic acid for use according to item 4, which can be elevated relative to the level of the sFLT-1 protein.
(Item 7)
The nucleic acid containing sFLT-1 is an adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus, poxvirus, Sendaivirus (HVJ) -lipocytosis complex, Moloney. The nucleic acid for use according to any of the above items, comprising a recombinant virus selected from the group consisting of mouse leukemia virus and HIV-based virus.
(Item 8)
Item 7. The recombinant virus is AAV selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof. Nucleic acid for use.
(Item 9)
The nucleic acid encoding sFLT-1 is a cytomegalovirus (CMV) promoter, a laus sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, and an RPE65 promoter. , And a promoter for use according to any of the above items, which is operably linked to a promoter selected from the group consisting of opsin promoters.
(Item 10)
Nucleic acid for use according to any of the above items, which is a plasmid or is delivered by a viral vector.
(Item 11)
The use further comprises administration of one or more additional VEGF inhibitors to the human subject in need of treatment or reduction, and the additional VEGF inhibitors are optionally ranibizumab, bevacizumab, or afliber. A nucleic acid for use according to any of the above items, which is a septo.
(Item 12)
The nucleic acid for use according to any of the above items, wherein the use comprises the step of administering the pharmaceutical composition to a human subject at least 55 years old.
(Item 13)
The nucleic acid for use according to any of the above items, wherein the use comprises the step of administering the pharmaceutical composition to the outside of the fovea.
(Item 14)
The highest corrected visual acuity (BCVA) of the human subject in need of treatment, as measured by ETDRS (Diabetic Retinopathy Early Treatment Study) text, is at least 1, 2 after the administration of an effective amount of the pharmaceutical composition. A nucleic acid for use according to any of the above items, which improves 3, 4, or 5 lines.
(Item 15)
The nucleic acid for use according to any of the above items, wherein the administration of the pharmaceutical composition reduces the frequency of administration of other anti-VEGF therapies.
(Item 16)
The nucleic acid of item 15, wherein said administration of other anti-VEGF therapies is less than once every 3 months, less than once every 6 months, or less than once a year.
(Item 17)
The nucleic acid for use according to any of the above items, wherein the administration of the pharmaceutical composition is performed in the human less than three times a year.
(Item 18)
A unit-dose pharmaceutical composition comprising a recombinant virus, wherein the unit comprises a vector genome of at least 1 × 10 ¹⁰ to 3 × 10 ¹² , wherein the recombinant virus is operably linked to a promoter. A unit dose comprising a nucleic acid encoding 1 in which the unit dose can increase the level of the sFLT-1 protein in the vitreous of a human subject at least 7 days after administration to the human subject. Pharmaceutical composition.
(Item 19)
A pharmaceutical composition comprising a recombinant virus or plasmid, wherein each recombinant virus or plasmid comprises a nucleic acid, wherein the nucleic acid comprises an sFLT-1 transgene sequence operably linked to a promoter sequence. However, a pharmaceutical composition capable of increasing the level of the sFLT-1 protein in the vitreous body of a human subject at least 7 days after administration to the human subject.
(Item 20)
The pharmaceutical composition according to item 19, wherein the promoter sequence and the sFLT-1 transgene sequence are separated by a sequence exceeding 300 base pairs.
(Item 21)
The pharmaceutical composition according to item 19, wherein the promoter sequence and the sFLT-1 transgene sequence are separated by a UTR sequence.
(Item 22)
The following order:
a. SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: A promoter sequence selected from the group consisting of 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32;
b. A sequence encoding a VEGF inhibitor selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108 or SEQ ID NO: 122;
c. An intron sequence consisting of SEQ ID NO: 48, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119 or SEQ ID NO: 120;
d. Consists of SEQ ID NO: 91, SEQ ID NO: 2, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, and SEQ ID NO: 101. UTR sequences selected from the group; and e. A pharmaceutical composition comprising a nucleic acid element in a termination sequence selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55.
(Item 23)
The following order:
a. An ITR sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO: 59;
b. A linker sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 63, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 77, and SEQ ID NO: 84;
c. SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, A promoter sequence selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 and SEQ ID NO: 47;
d. A linker sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 87;
e. An intron sequence consisting of SEQ ID NO: 48, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119 and SEQ ID NO: 120;
f. A linker sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 82, and SEQ ID NO: 89;
g. Consists of SEQ ID NO: 91, SEQ ID NO: 2, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, and SEQ ID NO: 101. UTR sequences selected from the group; as well as h. A sequence encoding a VEGF inhibitor selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108 and SEQ ID NO: 122;
i. Consists of SEQ ID NO: 91, SEQ ID NO: 2, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, and SEQ ID NO: 101. UTR sequence selected from the group;
j. A linker sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 86;
k. A termination sequence selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55;
l. A linker sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 80, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90; and m. A pharmaceutical composition comprising a nucleic acid element in an ITR sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, and SEQ ID NO: 59.
(Item 24)
A method of producing a recombinant virus in a cell
a. A step of introducing into a cell a nucleic acid containing at least one promoter sequence, ITR sequence, and UTR sequence operably linked to the sFLT-1 transgene sequence.
b. A method comprising the step of purifying the recombinant virus.
(Item 25)
A cell for producing a recombinant viral vector, comprising at least one promoter polynucleotide sequence, an ITR polynucleotide sequence, and a UTR polynucleotide sequence operably linked to an sFLT-1 transduction gene sequence.
(Item 26)
A method for treating or preventing ocular angiogenesis in a human subject, the pharmaceutical composition comprising a pharmaceutically effective amount of a nucleic acid encoding a VEGF inhibitor, one or more of the human subjects in need of treatment. A method comprising the step of administering to the subretinal region of the.
(Item 27)
26. The method of item 26, wherein the VEGF inhibitor is an anti-VEGF antibody against VEGF or a functional fragment thereof.
(Item 28)
26. The method of item 26, wherein the VEGF inhibitor is a soluble receptor, fusion protein, or functional fragment thereof.
(Item 29)
A method for treating or preventing ocular angiogenesis in a human subject, the pharmaceutical composition comprising a pharmaceutically effective amount of a nucleic acid encoding sFLT-1, one or more of the human subjects in need of treatment. A method comprising the step of administering to the subretinal region of the.
(Item 30)
Does the human subject have one or more conditions selected from the group consisting of age-related macular degeneration (AMD), wet AMD, atrophic AMD, retinal neovascularization, choroidal neovascularization, and diabetic retinopathy? , Or suspected of having, item 29.
(Item 31)
The human subjects are proliferative diabetic retinopathy, retinal vein occlusion, central retinal vein occlusion, branched retinal vein occlusion, diabetic retinopathy, diabetic retinal ischemia, ischemic retinopathy, and diabetes. 29. The method of item 29, which has or is suspected of having one or more conditions selected from the group consisting of retinal edema.
(Item 32)
The pharmaceutical composition comprises adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus, poxvirus, Sendaivirus (HVJ) -liploid complex, Moloney mouse leukemia virus, 29. The method of item 29, comprising a recombinant virus selected from the group consisting of and HIV-based viruses.
(Item 33)
The nucleic acid encoding sFLT-1 is a cytomegalovirus (CMV) promoter, a rousal sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, and an RPE65 promoter. 29. The method of item 29, which is operably linked to a promoter selected from the group consisting of, and opsin promoters.
(Item 34)
29. The method of item 29, wherein the sFLT-1 nucleic acid encodes at least one dimerization domain.
(Item 35)
29. The method of item 29, wherein the nucleic acid does not contain a prokaryotic regulatory sequence.
(Item 36)
29. The method of item 29, wherein the nucleic acid contains a prokaryotic regulatory sequence.
(Item 37)
29. The method of item 29, wherein the nucleic acid is a plasmid or is delivered by a virus.
(Item 38)
29. The method of item 29, further comprising administering to the human subject one or more treatments with a VEGF inhibitor.
(Item 39)
38. The method of item 38, wherein the VEGF inhibitor is administered within 30, 90, or 180 days after administration of the pharmaceutical composition.
(Item 40)
38. The method of item 38, wherein the pharmaceutical composition and the VEGF inhibitor are administered at least at 24 time intervals.
(Item 41)
29. The method of item 29, wherein the pharmaceutical composition is administered to a human subject at least 55 years old.
(Item 42)
29. The method of item 29, wherein the administration is performed outside the fovea.
(Item 43)
The highest corrected visual acuity (BCVA) of the human subject as measured by ETDRS (Diabetic Retinopathy Early Treatment Study) text is improved by at least 1, 2, 3, 4, or 5 lines after the administration of the pharmaceutical composition. , Item 29.
(Item 44)
29. The method of item 29, wherein the highest corrected visual acuity (BCVA) as measured by ETDRS (Diabetic Retinopathy Early Treatment Study) is reduced by less than 15 characters after the administration of the pharmaceutical composition.
(Item 45)
The administration of the pharmaceutical composition is carried out under the condition that the pharmaceutical composition is administered to one eye, the condition that the pharmaceutical composition is sequentially administered to two eyes, and the condition that the pharmaceutical composition is administered to two eyes at the same time. 29. The method of item 29, which is performed under conditions selected from the group consisting of conditions.
(Item 46)
29. The method of item 29, wherein the reduction of angiogenesis when observed by fluorescein angiography (FA) follows the administration of the pharmaceutical composition.
(Item 47)
29. The method of item 29, wherein there are no signs of inflammation on the surface, anterior eye, or vitreous in the human subject at least 1 week after injection.
(Item 48)
29. The method of item 29, wherein the human subject does not require remedies for at least 30, 60, 90, 120, 180, 270, or 365 days after administration of the pharmaceutical composition.
(Item 49)
32. The method of item 32, wherein no increase in anti-AAV cytotoxic T cell response is measured after the administration step.
(Item 50)
32. The method of item 32, wherein the virus is not detected in any of the blood, saliva, or urine samples of the human subject 3, 7, 14, 21, or 30 days after administration of the pharmaceutical composition.
(Item 51)
7, 14, 21, 30, 60, 90, 120, 150, 180, 270, or 365 days after administration of the pharmaceutical composition to the human subject, the sFLT-1 protein level in the vitreous of the human subject. 29. The method of item 29, wherein is about 500-5,000 pg / ml.
(Item 52)
29. The method of item 29, wherein the human subject has been treated with a VEGF inhibitor one or more times prior to said administration of the pharmaceutical composition.
(Item 53)
29. The method of item 29, wherein the human subject has not been previously treated with a VEGF inhibitor prior to said administration of the pharmaceutical composition.
(Item 54)
29. The method of item 29, wherein the administration of the pharmaceutical composition is performed in the human subject less than three times a year.
(Item 55)
29. The method of item 29, wherein the administration of the pharmaceutical composition reduces the frequency of administration of additional VEGF inhibitor treatments in the human subject.
(Item 56)
The sFLT-1 protein in the vitreous of the human subject when measured 7, 14, 21, 30, 60, 90, 120, 150, 180, 270, or 365 days after the administration of the pharmaceutical composition. 29. The method of item 29, wherein the concentration of.
(Item 57)
29. The method of item 29, wherein the vitreous gel of the human subject has been removed prior to the administration of the agent or within one week of the administration.
(Item 58)
29. The method of item 29, wherein the pharmacological agent is administered using a vitrectomy system smaller than 20 gauge.
(Item 59)
29. The method of item 29, wherein the pharmacological agent is administered using a cannula chip smaller than 39 gauge.
(Item 60)
29. The method of item 29, wherein the central retinal thickness of the subject does not increase by more than 50 microns, 100 microns, or 250 microns within 12 months after treatment with the pharmacological agent.
(Item 61)
29. The method of item 29, wherein geographic atrophy does not progress in the affected eye of the human subject.
(Item 62)
29. The method of item 29, wherein the human subject has susceptibility or allergy to penicillin.
(Item 63)
29. The method of item 29, wherein the systemic level of the VEGF inhibitor in a human subject is not increased.
(Item 64)
Contains a recombinant virus or plasmid containing a nucleic acid comprising at least one promoter sequence operably linked to the sFLT-1 transgene sequence, wherein the promoter sequence and the sFLT-1 transgene sequence exceed 300 base pairs. A pharmaceutical composition separated by a sequence.
(Item 65)
Contains a recombinant virus or plasmid containing a nucleic acid containing at least one promoter sequence operably linked to the sFLT-1 transgene sequence, the promoter sequence and the sFLT-1 transgene sequence separated by a UTR sequence. The pharmaceutical composition.
(Item 66)
65. The pharmaceutical composition of item 65, wherein the UTR sequence comprises at least 10 base pairs.
(Item 67)
66. The pharmaceutical composition of item 66, wherein the nucleic acid comprises at least three linker sequences, each containing at least 50 base pairs.
(Item 68)
A unit-dose pharmaceutical composition comprising a recombinant virus of a vector genome of 1 × 10 ¹⁰ to 3 × 10 ¹² , wherein the recombinant virus comprises a nucleic acid encoding sFLT-1 operably linked to a promoter. , Unit dose pharmaceutical composition.
(Item 69)
A method of producing a recombinant virus in a cell
a. A step of introducing into a cell a nucleic acid containing at least one promoter sequence, ITR sequence, and UTR sequence operably linked to the sFLT-1 transgene sequence.
b. A method comprising the step of purifying the recombinant virus.
(Item 70)
69. The method of item 69, wherein the nucleic acid sequence does not contain a beta-lactam antibiotic resistant sequence.
(Item 71)
When measured 72 hours after transduction into HEK293 cells with a multiplicity of infection of 1 × 10 ⁴ to 1 × 10 ⁶ , the recombinant virus produced the sFLT-1 protein in the range of 100 to 10,000 pg / mL. 69. The method of item 69, which is produced in.
(Item 72)
69. The method of item 69, wherein the recombinant virus inhibits the growth of human umbilical vein endothelial cells (HUVEC).
(Item 73)
A cell for producing a recombinant viral vector, comprising at least one promoter polynucleotide sequence, an ITR polynucleotide sequence, and a UTR polynucleotide sequence operably linked to an sFLT-1 transduction gene sequence.
(Item 74)
29, wherein there are no signs of inflammation on the surface, in the anterior segment, or in the vitreous in the human subject 1 week or 3, 6, 9, or 12 months after administration of the pharmaceutical composition. the method of.
(Item 75)
29. The method of item 29, wherein the human subject does not experience any loss of vision, elevated IOP, retinal detachment, intraocular or systemic immune response after administration of the pharmaceutical composition.
(Item 76)
29. The method of item 29, wherein the human subject is resistant to treatment with a VEGF inhibitor.
(Item 77)
29. The method of item 29, wherein the pharmacological agent is administered using a vitrectomy system that does not require suturing.
(Item 78)
29. The method of item 29, wherein the gas / liquid exchange in the vitreous cavity is performed after the administration of the pharmacological agent.
(Item 79)
A method for treating or reducing ocular angiogenesis in human subjects.
A method comprising the step of subretinal administration of a pharmaceutically effective amount of a pharmaceutical composition comprising a recombinant virus comprising a nucleic acid encoding a VEGF inhibitor to a human subject in need of treatment.
(Item 80)
A method for treating or reducing ocular angiogenesis in human subjects.
A method comprising the step of subretinal administration of a pharmaceutically effective amount of a pharmaceutical composition comprising a recombinant virus comprising a nucleic acid encoding a soluble Fms-associated tyrosine kinase 1 (sFLT-1) protein to a human subject in need of treatment. ..
(Item 81)
A pharmaceutical composition comprising a pharmaceutically effective amount of a recombinant virus comprising a nucleic acid encoding a soluble Fms-related tyrosine kinase 1 (sFLT-1) protein, a method for preventing ocular angiogenesis in human subjects. , A method comprising the step of subretinal administration to a human subject.
(Item 82)
A method for treating or reducing choroidal angiogenesis in human subjects with AMD.
A pharmaceutically effective amount of a pharmaceutical composition comprising a recombinant virus containing a nucleic acid encoding a soluble Fms-associated tyrosine kinase 1 (sFLT-1) protein is subretinally administered to a human subject in need of treatment with AMD. How to include.
(Item 83)
A method for preventing choroidal neovascularization in human subjects with atrophic AMD, comprising a recombinant virus containing a pharmaceutically effective amount of a nucleic acid encoding a soluble Fms-related tyrosine kinase 1 (sFLT-1) protein. A method comprising the step of subretinal administration of a pharmaceutical composition to a human subject.
(Item 84)
The viruses are adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus, poxvirus, Sendaivirus (HVJ) -lipocytosis complex, Moloney mouse leukemia virus, and HIV. The method of item 79, 80, 81, 82, or 83, selected from the base virus.
(Item 85)
Items 79, 80, 81, 82, or items, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof. 83.
(Item 86)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus is generated from a plasmid containing a kanamycin resistance marker.
(Item 87)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus is generated from a plasmid containing an ampicillin resistance marker.
(Item 88)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus is generated from a plasmid containing the T7 RNA polymerase promoter sequence.
(Item 89)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus is generated from a plasmid that does not contain the T7 RNA polymerase promoter sequence.
(Item 90)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises an ampicillin resistance marker.
(Item 91)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises a T7 RNA polymerase promoter sequence.
(Item 92)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus does not contain a T7 RNA polymerase promoter sequence.
(Item 93)
The recombinant virus is derived from the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the MMT promoter, the EF-1 alpha promoter, the UB6 promoter, the chicken beta-actin promoter, the CAG promoter, the RPE65 promoter, and the opsin promoter. The method of item 79, 80, 81, 82, or 83, comprising the promoter of choice.
(Item 94)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises an enhancer.
(Item 95)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises a chimeric intron.
(Item 96)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises an SV40 poly A sequence.
(Item 97)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises a human sFLT-1 protein or a functional fragment thereof.
(Item 98)
The method of item 79, 80, 81, 82, or 83, wherein the recombinant virus comprises a regulatory nucleic acid fragment capable of directing the selective expression of the sFLT-1 protein in ocular cells.
(Item 99)
The method of item 79, 80, 81, 82, or 83, wherein the pharmaceutical composition comprises from about 1 × 10 ⁶ to about 1 × 10 ¹⁵ recombinant viruses.
(Item 100)
The method of item 79, 80, 81, 82, or 83, wherein the pharmaceutical composition comprises from about ^1x107 to about 1x10 ¹⁴ recombinant viruses.
(Item 101)
The method of item 79, 80, 81, 82, or 83, wherein the pharmaceutical composition comprises from about ^1x108 to about 1x10 ¹³ recombinant viruses.
(Item 102)
The method of item 79, 80, 81, 82, or 83, wherein the pharmaceutical composition comprises from about 1 × 10 ⁹ to about 1 × 10 ¹² recombinant viruses.
(Item 103)
The method of item 79, 80, 81, 82, or 83, wherein the pharmaceutical composition comprises from about 1 × 10 ¹⁰ to about 1 × 10 ¹² recombinant viruses.
(Item 104)
The method of item 79, 80, 81, 82, or 83, wherein the pharmaceutical composition is administered via subretinal injection.
(Item 105)
The method of item 79, 80, 81, 82, or 83, further comprising administering to the human subject a pharmaceutically effective amount of a VEGF inhibitor.
(Item 106)
105. The method of item 105, wherein the VEGF inhibitor comprises an antibody against VEGF or a functional fragment thereof.
(Item 107)
105. The method of item 105, wherein the VEGF inhibitor comprises ranibizumab.
(Item 108)
105. The method of item 105, wherein the pharmaceutical composition is administered within 90 days of administration of the VEGF inhibitor.
(Item 109)
The method of item 105, wherein the pharmaceutical composition is administered at least 5, 6, 7, or 8 days after administration of the VEGF inhibitor.
(Item 110)
105. The method of item 105, wherein the VEGF inhibitor is administered at least once prior to administration of the pharmaceutical composition.
(Item 111)
105. The method of item 105, wherein the VEGF inhibitor is administered at least once after administration of the pharmaceutical composition.
(Item 112)
105. The method of item 105, wherein the VEGF inhibitor is administered at least twice within 90 days of administration of the VEGF inhibitor.
(Item 113)
105. The method of item 105, wherein the VEGF inhibitor is administered over a period of 6-7 weeks.
(Item 114)
82. The method of item 82, wherein the AMD is a wet AMD.
(Item 115)
81. The method of item 81, wherein the human subject is at risk of developing age-related macular degeneration.
(Item 116)
81. The method of item 81, wherein the human subject presents with symptoms of early age-related macular degeneration.
(Item 117)
80 or 82. The method of item 80 or 82, wherein the human subject is pretreated with a different VEGF inhibitor for treating AMD.
(Item 118)
81. The method of item 81 or 83, wherein the treated eye of the human subject has not been pretreated with a different VEGF inhibitor for treating AMD.
(Item 119)
80 or 82. The method of item 80 or 82, wherein at least 5 treatments with a VEGF inhibitor to treat AMD have been pre-administered to said human subject.
(Item 120)
80 or 82. The method of item 80 or 82, wherein at least 10 treatments with a VEGF inhibitor to treat AMD have been pre-administered to said human subject.
(Item 121)
80 or 82. The method of item 80 or 82, wherein at least 15 treatments with a VEGF inhibitor to treat AMD have been pre-administered to said human subject.
(Item 122)
80 or 82. The method of item 80 or 82, wherein at least 20 treatments with a VEGF inhibitor for treating AMD have been pre-administered to said human subject.
(Item 123)
Maximum corrected visual acuity (BCVA) as measured by ETDRS (Diabetic Retinopathy Early Treatment Study) letters decreased by less than 15 letters after the treatment with the pharmaceutical composition, items 79, 80, 81, 82, or 83. The method described in.
(Item 124)
28, item 79, 80, 81, 82, or 83, wherein the highest corrected visual acuity (BCVA) as measured by ETDRS (Diabetic Retinopathy Early Treatment Study) text was improved by less than two lines after the treatment with ranibizumab. Method.
(Item 125)
The method of item 79, 80, 81, 82, or 83, wherein the human subject is at risk of developing atrophic age-related macular degeneration.
(Item 126)
The method of item 79, 80, 81, 82, or 83, wherein the human subject presents with symptoms of early atrophic age-related macular degeneration.
(Item 127)
The method of item 79, 80, 81, 82, or 83, wherein the procedure is administered less than once per 12 months.
(Item 128)
The method of item 79, 80, 81, 82, or 83, wherein the procedure is administered less than once every 6 months.
(Item 129)
The method of item 79, 80, 81, 82, or 83, wherein the procedure is administered less than once per 18 months.
(Item 130)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject over 20 years of age.
(Item 131)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject over 40 years of age.
(Item 132)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject over 50 years of age.
(Item 133)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject 65 years or older.
(Item 134)
38. The method of item 79, 80, 81, 82, or 83, wherein said administration is to a site that does not include the fovea.
(Item 135)
38. The method of item 79, 80, 81, 82, or 83, wherein said administration is in the central retina adjacent to the fovea.
(Item 136)
80. The method of item 80, wherein the administration is to one or more cells in the subretinal space of the central retina.
(Item 137)
The method of item 79, 80, 81, 82, or 83, wherein the administration is to one or more cells in the subretinal space outside the macula.
(Item 138)
The method of item 79, 80, 81, 82, or 83, wherein said administration is to one or more cells in the subretinal space inside the macula.
(Item 139)
The method of item 79, 80, 81, 82, or 83, wherein the administration is administration to retinal pigment epithelial cells.
(Item 140)
The method of item 79, 80, 81, 82, or 83, wherein the administration does not adversely affect the function of the central retina or the structure of the central retina.
(Item 141)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed simultaneously in both eyes.
(Item 142)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed sequentially in both eyes.
(Item 143)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in one eye.
(Item 144)
The method of item 79, 80, 81, 82, or 83, wherein the dosing step is performed in one eye if the pair of eyes presents with AMD symptoms.
(Item 145)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject resistant to penicillin.
(Item 146)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject sensitive to penicillin.
(Item 147)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject who is allergic to penicillin.
(Item 148)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject who is not allergic to penicillin.
(Item 149)
3, 7, 14, 21, or 30 days after administration of the pharmaceutical composition, the vector is not detected in any of the blood, saliva, or urine samples of the human subject, items 79, 80, 81, 82, Or the method according to 83.
(Item 150)
149. The method of item 149, wherein the presence of the viral vector is detected by qPCR or ELISA.
(Item 151)
7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, 365 days after administration of the pharmaceutical composition, the sFLT-1 protein level in the vitreous of the human subject was about 500 to. 5,000 pg / ml, item 79, 80, 81, 82, or 83.
(Item 152)
7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, or 365 days after administration of the pharmaceutical composition, the sFLT-1 protein level in the vitreous of the human subject was about 600. 4,000 pg / ml, item 79, 80, 81, 82, or 83.
(Item 153)
7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, 365 days after administration of the pharmaceutical composition, the sFLT-1 protein level in the vitreous of the human subject was about 800 to. 3,000 pg / ml, item 79, 80, 81, 82, or 83.
(Item 154)
7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, 365 days after administration of the pharmaceutical composition, the sFLT-1 protein level in the vitreous of the human subject was about 900 to. 2,000 pg / ml, item 79, 80, 81, 82, or 83.
(Item 155)
7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, 365 days after administration of the pharmaceutical composition, the sFLT-1 protein level in the vitreous of the human subject was about 1, 000 to 1,800 pg / ml, item 79, 80, 81, 82, or 83.
(Item 156)
7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, 365 days after administration of the pharmaceutical composition, the sFLT-1 protein level in the vitreous of the human subject was about 4, The method of item 79, 80, 81, 82, or 83, which is 00 to 1,000 pg / ml.
(Item 157)
38. The method of item 79, 80, 81, 82, or 83, wherein the human subject does not show clinically significant retinal toxicity when evaluated by continuous eye examination over a period of at least 2 months.
(Item 158)
The method of item 79, 80, 81, 82, or 83, wherein there are no signs of inflammation on the surface, anterior segment, or vitreous in the human subject for a period of at least 2 months.
(Item 159)
The method of item 79, 80, 81, 82, or 83, wherein the human subject does not require remedies for at least 120 days after administration.
(Item 160)
No evidence of loss of vision, elevated IOP, retinal detachment, or any intraocular or systemic immune response in the human subject for at least 120 days after said administration, items 79, 80, 81, 82. , Or the method according to 83.
(Item 161)
The method of item 79, 80, 81, 82, or 83, wherein no inflammation of the vitreous is observed by biomicroscopy (BE) and indirect ophthalmoscopic examination (IOE) after the administration step.
(Item 162)
The method of item 79, 80, 81, 82, or 83, wherein the cytotoxic T cell response does not follow the administration step.
(Item 163)
The method of item 79, 80, 81, 82, or 83, wherein the cytotoxic T cell response within 10% of the normal range does not follow the administration step.
(Item 164)
ETDRS (Early Treatment Study for Diabetic Retinopathy) The method of item 79, 80, 81, 82, or 83, wherein the best corrected visual acuity (BCVA) as measured by letters improves after the administration step.
(Item 165)
The method of item 79, 80, 81, 82, or 83, wherein BCVA improves by one or more lines.
(Item 166)
38. The method of item 79, 80, 81, 82, or 83, wherein BCVA improves at least two lines.
(Item 167)
38. The method of item 79, 80, 81, 82, or 83, wherein BCVA improves at least 3 lines or more.
(Item 168)
38. The method of item 79, 80, 81, 82, or 83, wherein BCVA improves at least 4 lines or more.
(Item 169)
38. The method of item 79, 80, 81, 82, or 83, wherein BCVA improves by at least 5 lines.
(Item 170)
38. The method of item 79, 80, 81, 82, or 83, wherein reduction of angiogenesis when observed by fluorescein angiography (FA) follows the administration step.
(Item 171)
The method of item 79, 80, 81, 82, or 83, wherein the frequency of administration of other anti-VEGF therapies is reduced.
(Item 172)
38. The method of item 79, 80, 81, 82, or 83, wherein the frequency of administration of other anti-VEGF therapies is less than once a month.
(Item 173)
38. The method of item 79, 80, 81, 82, or 83, wherein the frequency of administration of other anti-VEGF therapies is less than 3 months.
(Item 174)
38. The method of item 79, 80, 81, 82, or 83, wherein the frequency of administration of other anti-VEGF therapies is less than 6 months.
(Item 175)
The method of item 79, 80, 81, 82, or 83, wherein the frequency of administration of other anti-VEGF therapies is less than one year.
(Item 176)
Approximately 1 × 10 ⁶ to 1 × 10 A unit-dose pharmaceutical composition comprising ¹⁵ recombinant viruses, wherein each recombinant virus is a nucleic acid encoding a soluble Fms-related tyrosine kinase 1 (sFLT-1) protein. A unit dose of a pharmaceutical composition comprising.
(Item 177)
176. The unit dose pharmaceutical composition according to item 176, comprising from about 1 × 10 ¹⁰ to about 3 × 10 ¹² recombinant viruses.
(Item 178)
176. The unit dose pharmaceutical composition according to item 176, comprising from about ^1x107 to about 1x10 ¹⁴ recombinant viruses.
(Item 179)
176. The unit dose pharmaceutical composition according to item 176, comprising from about 1 × 10 ⁸ to about 1 × 10 ¹³ recombinant viruses.
(Item 180)
176. The unit dose pharmaceutical composition according to item 176, comprising from about 1 × 10 ⁹ to about 1 × 10 ¹² recombinant viruses.
(Item 181)
176. The unit dose pharmaceutical composition according to item 176, comprising from about 1 × 10 ¹⁰ to about 1 × 10 ¹² recombinant viruses.
(Item 182)
176. The unit dose pharmaceutical composition according to item 176, wherein the sFLT-1 protein comprises a human sFLT-1 protein or a functional fragment thereof.
(Item 183)
The viruses are adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, simple herpesvirus, lentivirus, poxvirus, Sendaivirus (HVJ) -lipocytosis complex, Moloney mouse leukemia virus, and HIV. 176. The unit dose pharmaceutical composition of item 176, selected from the base virus.
(Item 184)
176. The unit dose pharmaceutical composition according to item 176, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof. thing.
(Item 185)
The recombinant virus is derived from the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the MMT promoter, the EF-1 alpha promoter, the UB6 promoter, the chicken beta-actin promoter, the CAG promoter, the RPE65 promoter, and the opsin promoter. 176. The unit dose pharmaceutical composition according to item 176, comprising the promoter of choice.
(Item 186)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus comprises an enhancer.
(Item 187)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus comprises an intron.
(Item 188)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus comprises SV40 poly A.
(Item 189)
176. The unit dose pharmaceutical composition of item 176, wherein the recombinant virus comprises a regulatory nucleic acid fragment capable of directing the selective expression of the sFLT-1 protein in ocular cells.
(Item 190)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus is formulated with a surfactant.
(Item 191)
168. The unit dose pharmaceutical composition according to item 168, wherein the recombinant virus is produced using the producer cloning method.
(Item 192)
168. The unit dose pharmaceutical composition according to item 168, wherein the recombinant virus is produced using recombinant baculovirus.
(Item 193)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus is produced using Ad-AAV.
(Item 194)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus is produced using HEK293 cells.
(Item 195)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus is produced using insect cells.
(Item 196)
176. The unit dose pharmaceutical composition according to item 176, wherein the recombinant virus is produced using a herpes helper virus.
(Item 197)
A pharmaceutical composition comprising a recombinant AAV gene delivery vector that directs the expression of a pharmaceutically effective amount of an anti-angiogenic factor, a method of treating, reducing or preventing ocular angiogenesis or macular edema in a human subject. A method comprising the step of subretinal administration such that administration of the vector inhibits angiogenesis or macular edema in a human subject.
(Item 198)
The method of item 79, 80, 81, 82, or 83, wherein the administration step is performed in the human subject who has no history of infection with either hepatitis B or hepatitis C.
(Item 199)
The sFLT-1 protein level in the vitreous of the human subject when measured 7, 14, 21 or 30, 60, 90, 120, 150, 180, 270, or 365 days after administration of the pharmaceutical composition. 79, 80, 81, 82, or 83, wherein the amount increases.

Incorporation by Reference All publications, patents, and patent applications referred to herein are specifically and individually indicated that each individual publication, patent, or patent application is incorporated by reference. To the same extent as in the case, it is incorporated herein by reference.

The novel features of this disclosure are detailed in the appended claims. A better understanding of the features and benefits of the present disclosure will be obtained by reference to the following detailed description, and accompanying drawings, which illustrate exemplary embodiments in which the principles of the present disclosure are utilized.

FIG. 1 illustrates a schematic representation of an exemplary plasmid. FIG. 2 shows rAAV. Demonstrates the expression, secretion, and biological activity of sFLT-1 from cells transduced with sflt-1. (A) Ad. 293 cells transduced with sFlt-1 (lane 1), rAAV. D407 cells transduced with sFlt-1 (lane 2), rAAV. 293 cells transduced with sFlt-1 (lane 3), and AAV. Western blot analysis of conditioned medium derived from gfp transduced D407 cells (lane 4). (B) rAAV. Inhibition of VEGF-induced HUVEC growth by conditioned medium derived from cells transduced with sFlt-1. HUVEC was prepared in starvation medium (column 1), in medium containing recombinant VEGF (column 2), medium containing VEGF, and rAAV. In 40 μL of conditioned medium (column 3) derived from 293 cells transduced with sFlt-1, VEGF-containing medium and rAAV. In 80 μL of conditioned medium derived from 293 cells transduced with sFlt-1 (column 4), and medium containing VEGF and rAAV. The cells were cultured in 80 μL of conditioned medium (column 5) derived from 293 cells transduced with gfp. (Regarding the difference between rAAV.sFlt-1 added to VEGF and VEGF alone, ^** P <0.02, ^** P <0.005) FIG. 3A shows rAAV. sFlt-1 (Monkey 8514, Monkey 8530, Monkey 8523, Monkey 8524, and Monkey 999), rAAV. In the vitreous of monkeys injected with gfp (monkey 8297 and monkey 8532), monkeys injected with recombinant sFlt-1 protein (monkey 8294) in both eyes, and monkeys not injected with control (control). A graph showing human sFlt-1 (hsFlt-1: human sFlt-1) expression is illustrated. Controls and monkeys 8294 and monkey 999 were euthanized 3 months after injection, monkey 8524 was euthanized 9 months after injection, and monkey 8297, monkey 8532, monkey 8514, monkey 8530, and monkey 8523 were injected. He was euthanized 12 months later. ^* Is rAAV. Significantly higher (P <0.05) sFLT-1 protein levels are displayed in sFlt-1 injected eyes. FIG. 3B shows rAAV. Monkeys injected with sFlt-1 (999, 8524, 8523, 8530, and 8514), rAAV. Graphs showing hsFLT-1 levels in monkeys injected with gfp (8297 and 8532), monkeys injected with recombinant sFlt-1 protein (8294), and non-injected (control) monkeys are illustrated. FIG. 4: A population of immune cell subsets in the mouse eye. The graph shows the immune cell subset population at different time points after injection. FIG. 5: Immune cell subset population in mouse spleen. The graph shows the immune cell subset population at different time points after injection. FIG. 6 illustrates a schematic comparing Ki67 responses within CD4 + T cells in different mice at different time points after injection. 7A-7D depict a variety of exemplary origins of replication sequences. 7A-7D depict a variety of exemplary origins of replication sequences. 7A-7D depict a variety of exemplary origins of replication sequences. 7A-7D depict a variety of exemplary origins of replication sequences. 8A-8F depict sequences of various exemplary promoters. 8A-8F depict sequences of various exemplary promoters. 8A-8F depict sequences of various exemplary promoters. 8A-8F depict sequences of various exemplary promoters. 8A-8F depict sequences of various exemplary promoters. 8A-8F depict sequences of various exemplary promoters. 9A-9C depict a variety of exemplary intron, polyA sequences, and sequences of the ITR region. 9A-9C depict a variety of exemplary intron, polyA sequences, and sequences of the ITR region. 9A-9C depict a variety of exemplary intron, polyA sequences, and sequences of the ITR region. 9D-9F depict sequences of various exemplary linker sequences. 9D-9F depict sequences of various exemplary linker sequences. 9D-9F depict sequences of various exemplary linker sequences. 9G-9H depict sequences of various exemplary UTR sequences. 9G-9H depict sequences of various exemplary UTR sequences. 10A-10C depict sequences encoding a variety of exemplary anti-VEGF proteins. 10A-10C depict sequences encoding a variety of exemplary anti-VEGF proteins. 10A-10C depict sequences encoding a variety of exemplary anti-VEGF proteins. FIG. 11A illustrates the amino acid sequence of sFLT-1. FIG. 11B illustrates the amino acid sequence of domain 2 of sFLT-1, which is a functional fragment of sFLT-1. FIG. 11C illustrates the nucleic acid sequence encoding domain 2 of sFLT-1. 12A-12B depict the sequences of various exemplary antibiotic resistance genes. 12A-12B depict the sequences of various exemplary antibiotic resistance genes. FIG. 13 shows the PK of one exemplary composition (rAAV.sFlt-1), which, after 6-8 weeks, rAAV. The PK in which sFlt-1 reaches optimal anti-VEGF expression is illustrated. RBZ is standard care with anti-VEGF such as ranibizumab. "RBZ Relief" means remedy. FIG. 14 illustrates a patient's ophthalmic assessment. Inflammation was assessed by biomicroscopy (BE) and indirect ophthalmoscopic examination (IOE). Unrem: No manifestation. 15A and 15B illustrate visual acuity results. 15A and 15B illustrate visual acuity results. FIG. 16 illustrates a measurement of retinal thickness in a patient who has already received 24 Lucentis injections. FIG. 17 illustrates qPCR (detected number of copies) for biodistribution: sFLT-1 sequence. FIG. 18 illustrates AAV capsids measured by biodistribution: ELISA, AAV titers in units of capsids per mL. FIG. 19 illustrates the in vivo distribution of sFLT-1 as measured by ELISA. Human sFLT-1 concentration (pg / mL) is shown. 20A and 20B show low dose rAAV. sFlt-1 (R1, R2, R4) or high dose rAAV. The OCT assessment of patients receiving sFlt-1 (R5, R6, and R8) is illustrated. 20A and 20B show low dose rAAV. sFlt-1 (R1, R2, R4) or high dose rAAV. The OCT assessment of patients receiving sFlt-1 (R5, R6, and R8) is illustrated. 21A and 21B show rAAV. The visual acuity results of a human subject treated with sFlt-1 are illustrated in contrast to the visual acuity results of an untreated control patient. 21A and 21B show rAAV. The visual acuity results of a human subject treated with sFlt-1 are illustrated in contrast to the visual acuity results of an untreated control patient. 22A and 22B show rAAV. 1 year after treatment. The visual acuity results of a human subject treated with sFlt-1 are illustrated in contrast to the visual acuity results of an untreated control patient. 22A and 22B show rAAV. 1 year after treatment. The visual acuity results of a human subject treated with sFlt-1 are illustrated in contrast to the visual acuity results of an untreated control patient. FIG. 23 shows rAAV. A weekly table of human subjects receiving Lucentis salvage injection (re-administration of VEGF inhibitor) in a clinical study of sFlt-1 is presented. FIG. 24 shows rAAV. In clinical studies on sFlt-1, rAAV. Visual acuity and SD-OCT images for human subjects treated with sFlt-1 are visualized weekly. 25A and 25B illustrate data on the production of human sFlt-1 protein in human fetal kidney 293 (HEK293) cells detected by ELISA. rAAV. sFlt-1 was produced using plasmid transfection in HEK293 cells. The second construct, rAAV (bv). sFlt-1 was produced using recombinant baculovirus in Sf9 insect cells. The sFlt-1 protein concentration was measured by ELISA after 72 hours with various MOIs. 25A and 25B illustrate data on the production of human sFlt-1 protein in human fetal kidney 293 (HEK293) cells detected by ELISA. rAAV. sFlt-1 was produced using plasmid transfection in HEK293 cells. The second construct, rAAV (bv). sFlt-1 was produced using recombinant baculovirus in Sf9 insect cells. The sFlt-1 protein concentration was measured by ELISA after 72 hours with various MOIs.

The present disclosure relates to a human subject by subretinal administration of a pharmaceutical composition comprising a pharmaceutically effective amount of a vector comprising a nucleic acid encoding a soluble Fms-related tyrosine kinase 1 (sFlt-1) protein. , AMD and the like are provided for compositions and methods for the prevention or treatment of ocular angiogenesis.

In the following, some aspects of the present disclosure will be described with reference to the application of examples for illustration. It should be understood that a number of specific details, relevance, and methods are provided to provide a full understanding of this disclosure. However, one of ordinary skill in the art will readily recognize that the present disclosure may be carried out without one or more of the specific details, or may be carried out in other ways. This disclosure is not limited by the exemplary ordering of actions or events, as some actions may occur in different order and / or in synchronicity with other actions or events. Moreover, not all exemplified acts or events are required to implement the method in accordance with this disclosure.

The terminology of the present disclosure is intended only to describe specific cases and is not intended to limit the methods and compositions of the present disclosure.

Unless otherwise indicated, the compositions and methods of the present disclosure described herein are within the skill of those skilled in the art, including molecular biology (including recombinant techniques), cell biology, and biochemistry. Traditional techniques and descriptions of chemistry, immunochemistry, and ophthalmology can be incorporated. Such conventional techniques include methods for observing and analyzing vision in the retina or subject, cloning and propagation of recombinant viruses, formulation of pharmaceutical compositions, and biochemical purification and immunochemistry. Specific examples of suitable techniques are given by reference to the examples herein. But, of course, equivalent conventional procedures can also be used. All of these conventional techniques and descriptions are incorporated herein by reference in their entirety for all purposes, edited by Green et al., "Genome Analysis: A Laboratory Manual Series" (I-IV). Volume) (1999); Weiner et al., "Genetic Variation: A Laboratory Manual"(2007); Dieffenbach, Dveksler, "PCR Primer: A Laboratory Manual"(2003); Bowtell and Sambrook, "DNA Microarrays:" A Molecular Cloning Manual (2003); Mount, Bioinformatics: Sequence and Genome Analysis (2004); Sambrook and Russell, Condensed Protocols from Molecular Cloning: A Laboratory Manual (2006); and Sambrook and Russell, "Molecular Cloning: A Laboratory Manual" (2002) (all by Cold Spring Harbor Laboratory Press); Stryer, L., "Biochemistry" (4th edition), WH Freeman, NY (1995); Gait, "Oligonucleotide Synthesis" : A Practical Approach ”, IRL Press, London (1984); Nelson and Cox,“ Lehninger, Principles of Biochemistry ”, 3rd Edition, WH Freeman Pub., New York (2000); and Berg et al.,“ Biochemistry ”, It can be found in standard laboratory manuals such as the 5th edition, WH Freeman Pub., New York (2002). Prior to describing the Composition, Research Tools, and Methods, the disclosure is not limited to the specific methods, compositions, goals, and uses described, as they can, of course, vary. Please understand that. In addition, the terminology used herein is intended to describe only certain aspects and is intended to limit the scope of the present disclosure, which is limited solely by the appended claims. It should also be understood that it is not something to do.

The singular forms "al (a)", "al (an)", and "that" as used herein also include the plural, unless the context specifically indicates otherwise. Intended. In addition, the terms "inclusion", "inclusions", "having", "has", "with", or variants thereof. However, to the extent used in the detailed description and / or claims, such terms are intended to be inclusive in a manner similar to the term "comprising".

In the present specification, the range may be expressed as "about" one specific value and / or "about" another specific value. In other cases, such a range includes from one particular value to / or another particular value. Similarly, when expressing a value as an approximation by using the prefix "about", it will be understood that a particular value makes another case. It will also be further understood that each endpoint of the range is significant in relation to the other endpoints and independently of the other endpoints. As used herein, the term "about" refers to the range of the stated number plus 15% or the stated number minus 15%, within the context of a particular usage. For example, about 10 would include the range 8.5-11.5. The term "about" also refers to typical errors or inaccuracies in measuring values.

I. AMD
AMD is a major cause of blindness in patients over the age of 50 and is characterized by progressive degeneration of the photoreceptors in the macula, the outside of the retina, and the retinal pigment epithelium. The end-stage "exudative" form of AMD (neovascular or exudative form), although less common, frequently causes rapid and often substantive loss of central vision in patients. sell. In the exudative form of AMD, choroidal angiogenesis is formed and develops into a network of blood vessels that can grow subcutaneously in the retinal pigment epithelium and within the retinal pigment epithelium. This is accompanied by plasma leakage and / or bleeding into the subretinal space, so if this occurs within the macula, severe and sudden loss of central vision may be seen.

Unless otherwise specified, the term "AMD" may be atrophic AMD or exudative AMD. The present disclosure envisions the treatment or prevention of AMD, exudative AMD, and / or atrophic AMD.

As already known in the art, AMD has been shown to have no single cause. This highly complex disease can result from a variety of contributions, including but not limited to age, genetic predisposition, and environment, or combinations thereof. For example, in humans, established epidemiological risk factors may include, but are not limited to, smoking, diet, females, Caucasians, and family history of AMD. Since AMD is rare in individuals younger than 50 years, the only unavoidable risk factor is the age at which multiple cellular changes associated with normal aging are involved in the pathogenesis of AMD.

The pathogenic complexity of AMD is reflected in the relative poorness of effective therapies, preventive strategies, and suitable animal models for studying them. Due to the complexity and incomplete characterization of the disease, the modeling of AMD in animals is incomplete. This is partly due to the anatomical differences between the retinas of animals and the retinas of primates, as well as the long time required for the disease to develop. Evidence from human molecular genetic and animal studies supports the idea that changes in homeostasis of multiple mechanisms that contribute to normal photoreceptor-RPE physiology can induce disease. At least at the molecular level, the disease can be searched for in animal models and, in some cases, even in patients whose genetic deficiency is not a major cause of AMD in humans.

Previous genetic studies as well as in-depth pathological analysis have revealed that simple genetic patterns for AMD are not common in a variety of AMD animal models, and that no single pathology is common. In the art, non-human primate models are known to better approximate CNV in humans than mouse or rat models, but are fundamental in the anatomy and histology of non-human primate retinas. Differences result in different species-specific pathologies, and fundamental differences in genetics still result in different species-specific pathologies.

In addition, and as described herein, laser photocoagulation can be used to induce one AMD-like symptom in animal models, CNV. In some cases, laser treatment breaks Bruch's membrane and elicits a fibrovascular proliferative response derived from the choroid. This response is the basis for modeling choroidal angiogenesis in late AMD and was developed in rhesus monkeys and cynomolgus monkeys.

An argon laser is used to keep the spots microscopic and guide with sufficient power to break the Bruch film. This is visible as a bubble on the fundus ophthalmoscope at the time of photocoagulation. Photocoagulation induces thrombus formation of choroidal vessels, followed by reendothelium after 48 hours, and growth of new vessels into the subretinal space up to 1 week. Since the newly formed blood vessels are highly permeable, the development of new blood vessels can be monitored by fluorescein angiography to assess vascular leakage.

Spontaneous regression of new blood vessels (pointed to by reduced fluorescein leakage) begins after about 3-7 weeks and then gradually progresses (over about 2-13 months) until the leakage no longer appears at the site.

The degree of new vascular growth compared to scarring with low vascularization can be variable in all models and is affected by species, location of damage within the retina, and laser beam intensity. The variability inherent in treatment differences between species further supports the idea that one animal model does not adequately capture AMD in humans.

Therapies for AMD have changed over the past few years with the availability of aptamers, antibodies, and soluble receptor decoys that bind to the protein VEGF. VEGF proteins or VEGF ligands have been shown to stimulate the formation of new blood vessels (ie, angiogenesis) through binding to intracellular receptors, including VEGF receptors. As is known in the art, anti-VEGF agents can prevent to some extent the angiogenesis and angiogenesis that occur in wet AMD. Intraocular injections of Macugen® or Lucentis® or Eylea® (anti-VEGF agent) are expensive, and in most cases Eylea® is every 4-6 weeks. Alternatively, the procedure should be repeated every 8 weeks. Lucentis, for example, is a VEGF antibody fragment that costs about $ 1950 per injection per month. Avastin (VEGF antibody) is used unapproved, and Eylea (VEGF trap) costs about $ 1850 per injection and is administered every two months. All of these medications share the common problem of reduced pharmacokinetic profile and therefore require repeated ocular injections.

Practical, economically feasible and long-lasting treatment strategies are needed in the art. The present disclosure provides novel therapeutic agents that address some of these needs.

The present disclosure is delivered by any suitable vector (eg, a recombinant viral system) to the retina of a human subject who has or is suspected of having AMD or related neovascular retinal disease. Provided are anti-VEGF molecules such as sFLT-1. In some cases, sFLT-1 can be a strong and directly binding protein for VEGF. In some cases, sFLT-1 can also block or inhibit VEGF activity.

For example, sFLT-1 (further described herein) known in the art has been observed to bind to a dimer of VEGF protein at Kd = 10 pM.

The present invention also provides compositions and methods for rAAV-mediated gene delivery to the eye. For AAV-based systems, long-term gene expression has been observed in the canine eye (> 8 years). Expression of sFLT-1 mRNA in the retina has been maintained for at least 18 months. Three human trials of Leber congenital amaurosis were conducted, which confirmed the safety of AAV-based delivery systems in the context of retinal degenerative diseases such as LCA.

II. VEGF and Fms-related tyrosine kinase 1 (sFLT-1) protein A. VEGF
Vascular Endothelial Growth Factor (referred to herein as "VEGF" or "VEGF Ligand") is a potent endothelial cell-specific mitogen that plays a key role in physiological angiogenesis. In some cases, VEGF activity results from the binding of VEGF ligand to one or more intracellular VEGF receptors. Binding of a VEGF ligand to a VEGF receptor can exert a number of downstream cellular and biochemical effects, including but not limited to intracellular angiogenesis. VEGF is involved in virtually any type of angiogenic or neovascular disorder, including disorders associated with cancer, ischemia, and inflammation. In addition, VEGF is ischemic retinopathy, intraocular angiogenesis, age-related macular degeneration (AMD), exudative AMD, atrophic AMD, retinal angiogenesis, diabetic retinopathy, diabetic retinal ischemia, diabetic It is also involved in eye diseases including, but not limited to, retinal edema, proliferative diabetic retinopathy, retinal vein occlusion, central retinal vein occlusion, and branch retinal vein occlusion. In addition, anti-VEGF treatments, including the compositions and methods of the present disclosure, described herein can be used in one or more of these diseases described herein.

Recent data suggest that VEGF is a major angioplastic growth factor in the pathogenic mechanism of the exudative form of AMD.

VEGF, a 46 kDa homodimer glycopeptide, expresses a number of different ocular cell types including, but not limited to, pigment epithelial cells, pericytes, vascular endothelial cells, glial cells, and ganglion cells. Let me. In some cases, VEGF is expressed in special spatial and temporal patterns during retinal development. In some cases, human isoforms of VEGF may contain proteins of 206, 189, 183, 165, 148, 145, and 121 amino acids per monomer, while the major human VEGF isoforms are VEGF121, VEGF165, Includes, but is not limited to, VEGF189, and VEGF206. These proteins are produced by alternative splicing of VEGF mRNA and differ in their ability to bind heparin and specific VEGF receptors or VEGF co-receptors (neuropyrin). The domain encoded by exons 1-5 of the VEGF gene contains the information required for recognition of the known VEGF receptors KDR / FLK-1 and FLT-1. This domain is present in all VEGF isoforms. VEGF acts through these receptors, which are high-affinity receptor tyrosine kinases, resulting in increased endothelial cell proliferation, migration, and vascular permeability.

VEGF is one of several factors involved in the complex process of angioplasty and has extremely high specificity for vascular endothelial cells. VEGF is a regulator of physiological angiogenesis in processes such as embryogenesis, skeletal growth, and reproductive function, but also pathological angiogenesis associated with diseases such as cancer, placental disorders, and other conditions. Is also involved. The potential biological effects of VEGF can be mediated by the specific fms-like transmembrane receptors FLT-1 and FLK-1 / KDR. In some cases, these naturally occurring VEGF binding partners influence the binding of VEGF to the VEGF receptor, which can modulate the activation of the VEGF receptor and subsequent pathways downstream. Is.

In the context of cancer, multiple VEGF inhibitors, including humanized monoclonal antibodies to VEGF (rhuMab VEGF), anti-VEGFR-2 antibodies, small molecules that inhibit signal transduction by VEGFR-2, and soluble VEGF receptors It shows some therapeutic properties.

In the context of intraocular angiogenic diseases such as diabetic retinopathy, retinal vein occlusion, or age-related macular degeneration, some VEGF antagonists show therapeutic effects despite their need for high-frequency administration. ing.

B. Anti-VEGF
The recombinant viruses of the present disclosure are VEGF-binding proteins or their functions disclosed in US Pat. Nos. 5,712,380, 5,861,484, and 7,071,159. Fragments, as well as sequences encoding anti-VEGF proteins, including, but not limited to, VEGF-binding fusion proteins disclosed in US Pat. No. 7,635,474. The anti-VEGF protein may also include the sFLT-1 protein described herein.

The recombinant virus or plasmid of the present disclosure comprises an anti-VEGF containing the naturally occurring protein sFlt-1, described in US Pat. No. 5,861,484, and the sequence set forth by SEQ ID NO: 109. It may contain a sequence encoding a protein. Recombinant viruses or plasmids of the present disclosure are also VEGF-binding fusion proteins disclosed in US Pat. No. 7,635,474, as well as the sequence set forth in Domain 2 or SEQ ID NO: 121 of sFlt-1. It also includes, but is not limited to, functional fragments thereof, including, but not limited to, constructs of the like. The anti-VEGF protein may also include the sFLT-1 protein described herein. These sequences can be expressed from the DNA encoding such sequences using the genetic code, standard techniques understood by those of skill in the art. As can be perceived by those skilled in the art, due to the degeneracy of the genetic code, anti-VEGF protein sequences can be easily expressed from several different DNA sequences.

As used herein, "sFlt-1 protein" refers to at least 90% of a naturally occurring human sFLT-1 sequence such that the sFlt-1 protein or sFlt-1 polypeptide binds to VEGF and / or VEGF receptor. Refers to a polypeptide sequence having the above homology or a functional fragment thereof. Homology refers to the conserved% of alignment residues between two sequences. Spontaneously occurring human sFLT-1 proteins include, but are not limited to, sequences containing, but not limited to, functional fragments, insertions, deletions, substitutions, pseudogenes, pseudogenes, splice variants, or artificially optimized sequences. Can include any suitable variant of. In some cases, the "sFLT-1 protein" is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 relative to the naturally occurring human sFLT-1 protein sequence. It can be%, 99%, 99.9%, 99.99%, or 100% homologous. In some cases, "sFLT-1 protein" is up to about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, relative to the naturally occurring human sFLT-1 protein sequence. It can be 98%, 99%, 99.9%, 99.99%, or 100% spatially homologous. In some cases, "sFLT-1 protein" is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% of the conformation of naturally occurring human sFLT-1 protein. , 98%, 99%, 99.9%, 99.99%, or 100% homology. In some cases, "sFLT-1 protein" is up to about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 relative to the conformation of naturally occurring human sFLT-1 protein. %, 98%, 99%, 99.9%, 99.99%, or 100% can be spatially homologous.

In addition, sFLT-1, a soluble cleavage form of the VEGF receptor FLT-1, is the only known endogenous specific inhibitor of VEGF. In nature, sFLT-1 is produced by alternative mRNA splicing and lacks the membranous proximal immunoglobulin-like domain, the transmembrane region, and the intracellular tyrosine kinase domain. Structurally, both the FLT-1 protein and the sFLT-1 protein can contain multiple functional domains. In some variants, the FLT and sFLT proteins generally share 6 linking domains; 3 domains involved in protein dimerization; and 3 domains involved in the binding of ligands such as VEGF.

sFLT-1 is a soluble cleavage form of FLT-1 and is endogenously expressed. As used herein, "soluble" FLT-1 or sFLT-1 refers to FLT-1 which is not confined to the cell membrane. Unbound sFLT-1 can be liberated and diffused intracellular or in solution.

sFLT-1 is the only known endogenous specific inhibitor of VEGF. This interaction is specific and can compete with 100-fold excess of unlabeled VEGF. In some cases, the angiogenesis-suppressing activity of sFLT-1 is due to two mechanisms: i) isolation of VEGF to which it binds with high affinity, and ii) transmembrane of VEGF receptors FLTt-1 and FLK-1 / KDR. It can result from inhibition of VEGF by the formation of an inactive heterodimer with an isoform. As is known in the art, in vitro binding assays indicate that sFLT-1 binds to VEGF with high affinity and also inhibits VEGF-driven proliferation of human umbilical cord vascular endothelial cells. In animal models for cancer, sFLT-1 inhibits tumor growth. In some cases, excess VEGF in the extracellular space can be blocked from binding to the VEGF receptor and then activating it, so sFLT-1 is in a sub-stoichiometric or dominant-negative fashion. Can work. These properties of sFLT-1 are described in Kendall and Thomas, 1993, Proc Natl Acad Sci., Vol. 90: 10705-10709, which are incorporated herein by reference in their entirety. As is known in the art, functional fragments of sFLT-1 can be used in place of full-length proteins. More specifically, using a VEGF binding domain (domain 2), or alternative, domain 2 from sFLT-1, plus domain 3 from sFLT1, KDR, or another family member, VEGF. Can be combined with and inactivated. Such functional fragments are described in Wiesmann et al., 1997, Cell, Vol. 91: 695-704, which is incorporated herein by reference in its entirety. The terms "sFLT-1" and "functional fragment of sFLT-1" are synonymous and are used interchangeably herein.

III. Vectors and Recombinant Viruses The compositions and methods of the present disclosure provide delivery of nucleic acids encoding anti-VEGF (eg, sFLT-1 protein) to cells in human subjects or patients in need thereof. In some cases, delivery of nucleic acids may be referred to as gene therapy.

The compositions and methods of the present disclosure provide any suitable method for delivering an anti-VEGF nucleic acid (eg, sFLT-1). In some cases, delivery of nucleic acids can also be carried out using any suitable "vector" (sometimes also referred to as "gene delivery" or "gene transfer vehicle"). A vector, delivery vehicle, gene delivery vehicle, or gene transfer vehicle may refer to any suitable macromolecular or molecular complex containing a polynucleotide delivered to a target cell. In some cases, the target cell can be any cell to which the nucleic acid or gene is delivered. The polynucleotide delivered may include a coding sequence of interest in gene therapy, such as the sFLT-1 gene.

For example, suitable vectors include viral vectors such as adenovirus, adeno-associated virus (AAV), and retroviruses, liposomes, and other lipid-containing complexes that can mediate the delivery of polynucleotides to target cells. And other polymeric complexes may be included, but not limited to these.

In some cases, the vector may be an organic molecule or an inorganic molecule. In some cases, the vector may be a small molecule (ie, <5 kD) or a macromolecule (ie> 5 kD). For example, the vector may include, but is not limited to, an inert molecule, a biologically inactive molecule such as a metal particle. In some cases, the vector can be gold particles.

In some cases, the vector may contain a biologically active molecule. For example, the vector can include polymerized macromolecules such as dendrimers.

Optionally, the vector may include a recombinant viral vector that incorporates one or more nucleic acids. Nucleic acids described herein may refer to polynucleotides. Nucleic acids and polynucleotides can be used interchangeably. In some cases, the nucleic acid may contain DNA or RNA. In some cases, the nucleic acid may contain DNA for expressing sFLT-1 or RNA for expressing sFLT-1. In some cases, RNA nucleic acids may include, but are not limited to, transcripts, introns, untranslated regions, termination sequences, etc. of the gene of interest (eg, sFLT-1). In other cases, the DNA nucleic acid can include, but is not limited to, sequences such as hybrid promoter gene sequences, strong constitutive promoter sequences, genes of interest (eg, sFLT-1), untranslated regions, termination sequences, and the like. In some cases, combinations of DNA and RNA can also be used.

As used herein, the term "expression construct" is any type of gene construct containing a nucleic acid or polynucleotide encoding a gene product, part or all of the sequence-encoding nucleic acid. Means that it contains a gene construct capable of transcribing. Transcripts can be translated into proteins. In some cases, the transcript may or may not be partially translated. In certain embodiments, expression involves both transcription of the gene and translation of the mRNA into the gene product. In another aspect, expression involves only transcription of the nucleic acid encoding the gene of interest.

In one aspect, the disclosure provides a recombinant virus, such as an adeno-associated virus (rAAV), as a vector that mediates the expression of sFLT-1.

In some cases, the viral vectors of the present disclosure can be measured as pfu (plaque forming units). Optionally, the pfu of the recombinant virus or viral vector of the compositions and methods of the present disclosure can be from about ¹⁰⁸ to about 5 × 10 ¹⁰ pfu. In some cases, the recombinant viruses of the present disclosure are at least about 1 × 10 ⁸ , 2 × 10 ⁸ , 3 × 10 ⁸ , 4 × 10 ⁸ , 5 × 10 ⁸ , 6 × 10 ⁸ , 7 × 10 ⁸ , 8 ×. 10 ⁸ , 9 × 10 ⁸ , 1 × 10 ⁹ , 2 × 10 ⁹ , 3 × 10 ⁹ , 4 × 10 ⁹ , 5 × 10 ⁹ , 6 × 10 ⁹ , 7 × 10 ⁹ , 8 × 10 ⁹ , 9 × 10 ⁹ , 1 × 10 ¹⁰ , 2 × 10 ¹⁰ , 3 × 10 ¹⁰ , 4 × 10 ¹⁰ , and 5 × 10 ¹⁰ pfu. In some cases, the recombinant viruses of the present disclosure may be up to about 1 × 10 ⁸ , 2 × 10 ⁸ , 3 × 10 ⁸ , 4 × 10 ⁸ , 5 × 10 ⁸ , 6 × 10 ⁸ , 7 × 10 ⁸ , 8. × 10 ⁸ , 9 × 10 ⁸ , 1 × 10 ⁹ , 2 × 10 ⁹ , 3 × 10 ⁹ , 4 × 10 ⁹ , 5 × 10 ⁹ , 6 × 10 ⁹ , 7 × 10 ⁹ , 8 × 10 ⁹ , 9 × 10 ⁹ , 1 × 10 ¹⁰ , 2 × 10 ¹⁰ , 3 × 10 ¹⁰ , 4 × 10 ¹⁰ , and 5 × 10 ¹⁰ pfu.

In some cases, the viral vectors of the present disclosure can be measured as vector genomes. In some cases, the recombinant virus of the present disclosure is a vector genome of 1 × 10 ¹⁰ to 3 × 10 ¹² . In some cases, the recombinant virus of the present disclosure is a vector genome of 1 × 10 ⁹ to 3 × 10 ¹³ . In some cases, the recombinant virus of the present disclosure is a vector genome of 1 × 10 ⁸ to 3 × 10 ¹⁴ . In some cases, the recombinant viruses of the present disclosure are at least about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ , 1 ×. 10 ⁸ , 1x10 ⁹ , 1x10 ¹⁰ , 1x10 ¹¹ , 1x10 ¹² , 1x10 ¹³ , 1x10 ¹⁴ , 1x10 ¹⁵ , 1x10 ¹⁶ , 1x10 ¹⁷ , and 1 × 10 ¹⁸ vector genomes. In some cases, the recombinant virus of the present disclosure is a vector genome of 1 × 10 ⁸ to 3 × 10 ¹⁴ . In some cases, the recombinant viruses of the present disclosure may be up to about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ , 1 × 10 ⁸ , 1 × 10 ⁹ , 1 × 10 ¹⁰ , 1 × 10 ¹¹ , 1 × 10 ¹² , 1 × 10 ¹³ , 1 × 10 ¹⁴ , 1 × 10 ¹⁵ , 1 × 10 ¹⁶ , 1 × 10 ¹⁷ , and. It is a 1 × 10 ¹⁸ vector genome.

In some cases, the viral vectors of the present disclosure can be measured using multiplicity of infection (MOI). In some cases, MOI may refer to the ratio or multiple of a vector or viral genome to cells capable of delivering nucleic acids. In some cases, the MOI can be ^1x106 . In some cases, the MOI can be ^1x105 to ^1x107 . In some cases, the MOI can be 1 × 10 ⁴ to 1 × 10 ⁸ . In some cases, the recombinant viruses of the present disclosure are at least about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ , 1 ×. 10 ⁸ , 1x10 ⁹ , 1x10 ¹⁰ , 1x10 ¹¹ , 1x10 ¹² , 1x10 ¹³ , 1x10 ¹⁴ , 1x10 ¹⁵ , 1x10 ¹⁶ , 1x10 ¹⁷ , and 1 × 10 ¹⁸ MOI. In some cases, the recombinant virus of the present disclosure is a MOI of 1 × 10 ⁸ to 3 × 10 ¹⁴ . In some cases, the recombinant viruses of the present disclosure may be up to about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ , 1 × 10 ⁸ , 1 × 10 ⁹ , 1 × 10 ¹⁰ , 1 × 10 ¹¹ , 1 × 10 ¹² , 1 × 10 ¹³ , 1 × 10 ¹⁴ , 1 × 10 ¹⁵ , 1 × 10 ¹⁶ , 1 × 10 ¹⁷ , and. It has a MOI of 1 × 10 ¹⁸ .

In some embodiments, the nucleic acid can be delivered without the use of a virus (ie, by a non-viral vector) and can be measured as the amount of nucleic acid. In general, any suitable amount of nucleic acid can be used with the compositions and methods of the present disclosure. In some cases, the nucleic acids are at least about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 μg, 10 μg, 100 μg, 200 μg, 300 μg, 400 μg, 500 μg, 600 μg, 700 μg, 800 μg, 900 μg, 1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, It can be 900 mg, 1 g, 2 g, 3 g, 4 g, or 5 g. In some cases, nucleic acids can be up to about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 μg, 10 μg, 100 μg, 200 μg, 300 μg, 400 μg, 500 μg. , 600 μg, 700 μg, 800 μg, 900 μg, 1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg. , 900 mg, 1 g, 2 g, 3 g, 4 g, or 5 g.

In some embodiments, a self-complementary vector (sc) can be used. Viral by using a self-complementary AAV vector, as provided by Wu, Hum Gene Ther., 2007, Vol. 18, pp. 171-82, which is incorporated herein by reference. The requirement for the synthesis of double-stranded DNA can be bypassed, resulting in an increase in the expression rate of the transgene protein.

In some embodiments, multiple AAV vectors can be generated to allow selection of optimal serotypes, promoters, and transgenes.

In some cases, the vector can be a targeting vector, in particular a targeting vector that selectively binds to specific cells such as cancer cells or tumor cells or ocular cells. Viral vectors for use in the present disclosure may include viral vectors that exhibit low toxicity to target cells and induce the production of therapeutically useful amounts of anti-VEGF protein in a cell-specific manner.

The compositions and methods of the present disclosure include adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, herpes simplex virus, lentivirus, poxvirus, Sendaivirus (HVJ) -lipocytosis complex, Moloney mouse. Provided is any suitable viral nucleic acid delivery system including, but not limited to, the use of leukemia virus, and at least one of HIV-based viruses. Preferably, the viral vector comprises a strong eukaryotic cell promoter operably linked to the polynucleotide, such as the cytomegalovirus (CMV) promoter.

In general, any suitable viral vector can be engineered to be optimized for use with the compositions and methods of the present disclosure. For example, a viral vector derived from adenovirus (Ad) or adeno-associated virus (AAV) can be used. Both human and non-human viral vectors can be used and the recombinant viral vector can be altered to be replication deficient in humans. If the vector is an adenovirus, the vector can contain a polynucleotide having a promoter operably linked to a gene encoding an anti-VEGF protein and is replication deficient in humans.

To combine the advantageous properties of the two viral vector systems, hybrid viral vectors can be used to deliver nucleic acids encoding the sFLT-1 protein to target cells or tissues. Those skilled in the art will be familiar with standard techniques for constructing hybrid vectors. Such techniques can be found, for example, in Sambrook et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor, NY, or in any number of laboratory manuals discussing recombinant DNA techniques. The double-stranded AAV genome within an adenovirus capsid containing a combination of AAV ITR and adenovirus ITR can be used for transduction into cells. In another variant, the AAV vector can be placed in a "gutless" adenovirus vector, a "helper-dependent" adenovirus vector, or a "high volume" adenovirus vector. Adenovirus / AAV hybrid vectors are discussed in Lieber et al., J. Virol., 73: 9314-9324, 1999. Retrovirus / adenovirus hybrid vectors are discussed in Zheng et al., Nature Biotechnol., Vol. 18, pp. 176-186, 2000.

The retrovirus genome contained in adenovirus can be integrated into the target cell genome to carry out stable gene expression.

Replication-deficient recombinant adenovirus vectors can be produced according to known techniques. Quantin et al., Proc. Natl. Acad. Sci. USA, Vol. 89: pp. 2581-2584 (199)
2); See Stratford-Perricadet et al., J. Clin. Invest., Vol. 90: pp. 626-630 (1992); and Rosenfeld et al., Cell, Vol. 68, pp. 143-155 (1992).

In addition, preferred vectors may include, but are not limited to, viral vectors, fusion proteins, and chemical conjugates. Retroviral vectors include Moloney murine leukemia virus and HIV-based viruses. In some cases, HIV-based viral vectors can be used that include at least two vectors in which the gag and pol genes are derived from the HIV genome and the env gene is derived from another virus. A DNA viral vector can be used. These vectors include pox vectors such as orthopox vectors or avipox vectors, and herpesvirus vectors such as type I simple herpesvirus (HSV) vectors [incorporated herein by reference, Geller, A.I. et al., J. Neurochem, Volume 64: pp. 487 (1995); Lim, F. et al., "DNA Cloning: Mammalian Systems", edited by D. Glover (Oxford Univ. Press, Oxford England) (1995); Geller, A.I. et al., Proc Natl. Acad. Sci .: U.S.A .: 90 volumes, 7603 pages (1993); Geller, A.I. et al., Proc Natl. Acad. Sci USA, 87 volumes: 1149 pages (1990)], adenovirus vector [reference herein. Incorporated in Le Gal LaSalle et al., Science, 259: 988 (1993); Davidson et al., Nat. Genet., 3: 219 (1993); Yang et al., J. Virol., 69: 2004. Page (1995)], and an adeno-associated virus vector [Kaplitt, M.G. et al., Nat. Genet., Vol. 8, p. 148 (1994), incorporated herein by reference].

Other viral vectors that can be used in accordance with the present disclosure include herpes simplex virus (HSV) based vectors. HSV vectors lacking one or more early early genes (IEs) are generally non-cytotoxic, persist in a state similar to latency within target cells, and are efficiently transduced into target cells. It is advantageous to bring about. The recombinant HSV vector can incorporate about 30 kb of heterologous nucleic acid.

Retroviruses such as C-type retroviruses and lentiviruses can also be used in the present disclosure. For example, Hu and Pathak, Pharmacol. Rev., 52: 493511, 2000; and Fong et al., Crit. Rev. Ther. Drug Carrier Syst., 17: 1-60, incorporated herein by reference. As provided by Page 2000, the retroviral vector can be based on the murine leukemia virus (MLV). MLV-based vectors can contain up to 8 kb of heterologous (therapeutic) DNA in place of viral genes. Heterologous DNA can include tissue-specific promoters and anti-VEGF protein nucleic acids. For delivery to neoplastic cells, the heterologous DNA also encodes a ligand for a tissue-specific receptor.

Vigna and Naldini, J. Gene Med., Vol. 5, pp. 308-316, 2000; and Miyoshi et al., J. Virol., Vol. 72: 8150-8, incorporated herein by reference.
Additional retroviral vectors can also be used, including, but not limited to, replication-deficient lentivirus-based vectors, including human immunodeficiency (HIV) -based vectors, as provided by page 157, 1998. Lentiviral vectors can be advantageous in that they can infect both active and non-dividing cells. They can also be highly efficient when transducing into human epithelial cells.

Lentiviral vectors for use in the present disclosure can be derived from hitland virus and non-human (including SIV) lentivirus. Examples of lentiviral vectors include nucleic acid sequences required for vector reproduction, as well as tissue-specific promoters operably linked to anti-VEGF protein genes. Nucleic acid sequences can include viral LTRs, primer binding sites, polyprint lacto, att sites, and capsid forming sites.

The lentiviral vector can be packaged into any suitable lentiviral capsid. Substitution of one particle protein with another particle protein derived from a different virus is referred to as "pseudotyping". Vector capsids can contain viral enveloped proteins derived from other viruses, including murine leukemia virus (MLV) or vesicular stomatitis virus (VSV). The use of VSVG protein results in high vector titers, resulting in increased stability of vector viral particles.

Also in the present disclosure are alpha virus-based vectors, such as alpha virus-based vectors made from Semuliki forest fever virus (SFV) and Sindbis virus (SIN). The use of alphavirus is incorporated herein by reference, Lundstrom, K., Intervirology, 43: 247-257, 2000; and Perri et al., Journal of Virology, 74: 9802-9807, 2000. Listed in the year.

Recombinant replication-deficient alphavirus vectors can be advantageous because they allow high levels of heterologous (therapeutic) gene expression and can infect a wide range of target cells. Alphavirus replicons present specific cells on their virion surface by presenting a functional heterologous ligand or binding domain that allows selective binding to target cells expressing the cognate binding partner. Can be targeted to molds. Alphavirus replicons can establish latency and therefore long-term expression of heterologous nucleic acids in target cells. Replicons can also exhibit transient heterologous nucleic acid expression in target cells.

Pox virus vectors can introduce genes into the cytoplasm of cells. The Avipox viral vector can result in short-term expression of the gene or nucleic acid only. Adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus (HSV) vectors can be used with the compositions and methods of the present disclosure. In some embodiments, the adenovirus vector may result in shorter-term expression (eg, less than about 1 month) than the adeno-associated virus, but may also exhibit much longer-term expression. The particular vector selected may depend on the target cell and the condition being treated.

Adeno-associated virus (AAV) is a small, non-enveloped, single-stranded DNA virus. AAV is a non-pathogenic human parvovirus, a helper virus for replication, which can depend on helper viruses including adenovirus, herpes simplex virus, vaccinia virus, and CMV. Exposure to wild-type (wt) AAV is not known to be associated with or cause any human pathology and is common within the general population, usually in the first decade of life. Occurs in association with adenovirus infection.

As used herein, "AAV" refers to an adeno-associated virus and "rAAV" refers to a recombinant adeno-associated virus.

In some cases, wild-type AAV encodes the rep and cap genes. The rep gene is required for viral replication and the cap gene is required for capsid protein synthesis. By combining an alternative translation initiation site with a splicing site, the small genome may be able to express four rep gene products and three cap gene products. The rep gene product and rep gene sequence within the inverted terminal sequence (145 bp ITR across the genome) can be crucial in this process. At present, 11 serotypes of AAV have been isolated. AAV2 can be used with the compositions and methods of the present disclosure. The compositions and methods of the present disclosure provide the use of any suitable AAV serotype. In some embodiments, the AAV is selected from the group consisting of AAV1, AAV2, AAV2.5, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, rh10, and hybrids thereof. ..

In some embodiments, the present disclosure is a recombinant virus comprising a nucleic acid further comprising the human form of truncated soluble VEGF receptor 1 (sFLT-1), rAAV. A recombinant virus named sFlt-1 is provided. The vector is a serotype 2 recombinant replication-deficient adeno-associated virus (rAAV) vector. In another aspect, the vector is rAAV. A serotype 2 recombinant replication-deficient adeno-associated virus (rAAV) vector named sFlt-1.

AAV2 is best characterized. It has been shown that rAAV2 is capable of mediating long-term transgene expression in the eyes of many animal species. In rats, the rAAV-mediated reporter gene (green fluorescent protein) was still present 18 months after injection. In monkeys, the same reporting gene was present 17 months after injection. Similarly, rAAV. High sFLT-1 protein levels were also present in the vitreous of monkey eyes injected with sFlt-1 15 months after injection.

rAAV. sFlt-1 has been investigated for intraocular angiogenic disorders in animal models. rAAV. sFlt-1 was thought to slow the progression of angiogenesis in animal models of corneal and retinal angiogenesis. Interestingly, rAAV-mediated sFlt-1 pointed to some inhibition of angiogenesis in a monkey model of choroidal angiogenesis (a model for age-related macular degeneration or exudative morphology of AMD). In this study, rAAV. The presence of the sFlt-1 construct showed low levels of expression of sFLT-1 in the monkey eye and did not affect monkey health or retinal function. rAAV. There is no evidence to suggest any safety issues associated with systemic exposure to sFlt-1. In addition to the overall positive findings and lack of toxicity of the rAAV vector in these studies, rAAV in a mammalian model of choroidal angiogenesis / AMD. Findings by sFlt-1 provide extensive data supporting that the vector, when administered intraocularly, exhibits a suitable safety profile.

In a monkey model, rAAV. Which improves certain symptoms of AMD. Despite the ability of sFlt-1, sFLT-1 protein levels in the retina are unexpectedly low. In the art, expression levels of sFLT-1, driven by constitutively active mammalian promoters, have been shown to result in high levels of protein expression in a large number of cell types. Without being bound by theory, there can be multiple possibilities for this lower predicted expression level. As a large multidomain protein, sFLT-1 may be sensitive to early proteolysis, may have a slow rate of expression, and may not be optimally sorted. With respect to the latter, sFLT-1 as a secreted protein enters the secretory pathway when expressed recombinantly intracellularly. In retinal cells, including RPE cells, sFLT-1 may be secreted to the apical side or to the basal side, depending on the protein ER or Golgi apparatus fractionation. In some cases, suboptimal fractionation can be used to secrete the molecule into the undesired basal lateral membrane and thus inhibit VEGF signaling and neovascular angiogenesis on the apical surface of the RPE cell layer. It may reduce the concentration of sFLT-1 molecule.

In addition, there was no known in the art how this unexpectedly low level of sFLT-1 could affect the efficacy of the drug in the actual treatment of AMD disease in humans. Although rarely high levels in monkey models have shown promising signs of ameliorating AMD symptoms, only monkey animal models for AMD provide surrogate for AMD disease. The AMD symptoms described herein are artificially induced (via laser) within the retina. Although this model is suitable for a variety of analyses, it is difficult to extrapolate the effectiveness of the actual drug in the treatment of symptoms in the monkey model to the treatment of disease in humans. Unexpectedly, rAAV. The low protein levels provided by sFlt-1 further increase the difficulty of assessing it without experimentation in humans.

In addition, three clinical trials for Lebers Congenital Amaurosis (LCA) have been conducted in the United Kingdom and the United States using the rAAV2 skeleton. LCA is a rare hereditary eye disease that appears at birth or in the first few months of life and is characterized by eye shake, slow or absent pupillary reflex, and severe visual loss or blindness. To date, no safety issues have been reported after injection of the rAAV2 construct into the subretinal space of 6 participants in these two trials. All teams involved in the clinical trial concluded that their findings support further gene therapy research in LCA patients.

Given the apparent technical difficulty of producing substantial or sustained high levels of sFLT-1 in monkeys, rAAV. A variety of optimization strategies can be taken to address one or more of the technical problems underlying low protein levels of sFlt-1 within the retina after introduction of sFlt-1. In some cases, optimization strategies, including those provided by the compositions and methods of the present disclosure, optimize the sFlt-1 protein sequence or sFlt-1 protein domain, introduce control elements, and introduce retinal cells. It may include directing proper preparative after expression within, or increasing the level of the sFlt-1 protein to compensate for any of these possible factors. In some cases, the compositions and methods of the present disclosure are specific strategies directed towards the latter, raising protein levels in the human retina above the sFlt-1 levels previously observed in monkey studies. It provides a strategy involving the integration of specific nucleic acid sequences directed towards that. Using the various sequences, linkers, UTRs, introns, sFLT-1 variants, or combinations thereof described herein, rAAV. It is possible to increase the protein level of the sFlt-1 protein in the retina after exposure to sFlt-1.

Vectors may contain components or functionality that further modulate gene delivery and / or gene expression or provide other forms of beneficial properties to the targeted cell. Such other components include, for example, components that affect cell binding or targeting (including components that mediate cell-type-specific or tissue-specific binding); affect the uptake of vector nucleic acids by cells. Influencing components; components that affect the localization of polynucleotides in cells after uptake (such as agents that mediate nuclear localization); and components that affect the expression of polynucleotides. Such components could also include markers such as detection and / or selection markers that can be used to detect or select cells that take up and express the nucleic acid delivered by the vector. Such components can also be provided as a natural feature of the vector (such as the use of certain viral vectors with components or functionality that mediate binding and uptake), and the vector provides such functionality. It can also be modified as follows.

The marker for selection may be positive, negative, or bifunctional. A positive selection marker allows selection of cells carrying the marker, whereas a negative selection marker allows the cells carrying the marker to be selectively excluded. Bifunctional (ie, positive / negative) markers (eg, Lupton, S., WO 92/08796, published May 29, 1992; and Lupton, S., WO 94, published December 8, 1994. Various such marker genes have been described, including (see / 28143). Examples of negative selection markers may include the incorporation of resistance genes into antibiotics such as ampicillin or kanamycin. Such marker genes can provide additional regulatory measures that can be advantageous in the context of gene therapy. A wide variety of such vectors are known and generally available in the art.

In some cases, the nucleic acid encoding the antibiotic resistance marker may include, but is not limited to, sequences such as, but not limited to, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, or SEQ ID NO: 114.

Many viral vectors suitable for the methods of the present disclosure can incorporate one or more promoters into the vector to allow the vector to express multiple heterologous genes. In addition, the vector may also include a sequence encoding a signal peptide or other moiety that facilitates expression of the anti-VEGF protein from the target cell.

The nucleic acid encoding the gene product can be placed under transcriptional control by a promoter. As used herein, the term "promoter" refers to the appropriate DNA sequence required to initiate transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the proper position and orientation in relation to nucleic acids that control initiation by RNA polymerase and gene expression. In some cases, promoters can include "strong" promoters or constitutively active promoters. For example, the CMV promoter can be used as a constitutively active promoter known in the art. In some cases, the CMV promoter may include additional regulatory elements to promote expression. In some cases, the CMV promoter may include a pre-early CMV promoter.

In some cases, a promoter may refer to a sequence that results in lower levels of the sFLT-1 protein than a "weak" or strong promoter. In some cases, the promoter can also be used to drive selective expression of sFLT-1. In some cases, promoters or other regulatory elements used in combination with other sequences described herein can also be used to drive selective expression of sFLT-1 in ocular cells or tissues. can.

In addition, the term "promoter" 104 is also used herein interchangeably to refer to any further suitable transcriptional control module that may be near the initiation site of RNA polymerase. You can also do it. In the compositions and methods of the present disclosure, any suitable promoter and transcriptional control module can be used to express the transgene 106. Further transcriptional control modules may include, but are not limited to, elements such as HSV thymidine kinase (tk) and SV40 early transcription units. In general, promoters can consist of discontinuous functional modules, each consisting of about 7-20 bp of DNA, or 20-5000 bp of DNA, one or more for transcriptional activator or transcriptional repressor proteins. Can contain recognition sites of. The compositions and methods of the present disclosure provide any suitable regulatory sequence, or a combination thereof. Optionally, these transcriptional control module sequences can be referred to or identified as enhancer or repressor sequences.

At least one module within each promoter functions to locate the initiation site of RNA synthesis. One example is the TATA box. Other examples can include several promoters lacking the TATA box, such as the promoter of the terminal deoxynucleotidyl transferase gene in mammals and the promoter of the late SV40 gene, with discontinuous elements occupying the starting site itself. , Helps to fix the start position.

Additional promoter elements regulate the frequency of transcription initiation. Some promoters may also contain functional elements downstream of the initiation site, but in general, promoter elements are located in the region 30-110 bp upstream of the initiation site. The spacing between promoter elements can often be flexible so that promoter function is preserved when the elements are inverted or moved relative to each other. With the tk promoter, for example, the spacing between promoter elements can be increased to a gap of 50 bp before activity begins to decay. Depending on the promoter, the individual elements can be positioned to function synergistically or independently to activate transcription.

The compositions and methods of the present disclosure provide any suitable sequence for controlling the expression of a nucleic acid sequence of interest in a targeted cell. Therefore, when targeting human cells, the sequence of the coding region of the nucleic acid can be engineered to be adjacent to and under the control of a promoter capable of being expressed in human cells. In general, such promoters may include human promoters and may also include viral promoters.

In various aspects of the disclosure, the human cytomegalovirus (CMV) pre-early gene promoter (ie-CMV), SV40 early promoter, Laus sarcoma virus long-term repeat, β-actin, rat insulin promoter, and glyceraldehyde-3. -The phosphate dehydrogenase can be used to obtain high levels of expression of the coding sequence of interest (eg, sFLT-1). Also the use of other viral or mammalian cell promoters or bacterial phage promoters known in the art to achieve expression of the coding sequence of interest, provided that the expression level is sufficient for a given purpose. is assumed. In some embodiments, a prokaryotic regulatory sequence, such as the T7 RNA polymerase promoter sequence, can be present within the vector. In another aspect, the vector does not contain such regulatory sequences. By using a promoter with known properties, the level and pattern of expression of the protein of interest after transfection or transformation can be optimized.

Selection of promoters that are regulated in response to specific physiological signals or signals for synthesis may allow inducible expression of the gene product. For example, when using a multicistronic vector, if the expression of one or more transgenes is toxic to the cells in which the vector is produced, then one or more of the transgenes will be expressed. It may be desirable to block or reduce. Examples of transgenes that can be toxic to producing cell lines are pro-apoptotic genes and cytokine genes. Multiple inducible promoter systems are available for producing viral vectors when the transgene product can be toxic. The compositions and methods of the present disclosure provide any suitable combination of promoter sequence, regulatory sequence, and transgene. In some cases, sequence combinations may not result in toxicity to cells. In some cases, sequence combinations can result in high toxicity to cells. In some cases, sequence combinations can result in moderate levels of toxicity within the cell.

The ecdysone system (Invitrogen, Carlsbad, Calif) is one such system for expressing a transgene. This system is designed to allow regulation of the expression of genes of interest in mammalian cells. The ecdysone system consists of a tightly regulated expression mechanism that allows expression at the basal level of the transgene, but with more than 200-fold inducibility. The ecdysone system is based on the ecdysone receptor of a heterodimer of the genus Drosophila, and when an analog such as ecdysone or mristolone A binds to the receptor, the receptor activates the promoter and the transgene is expressed downstream. Is turned on to obtain high levels of mRNA transcripts. In this system, all of the monomers of the heterodimer receptors are constitutively expressed from a single vector, whereas the ecdysone-responsive promoter, which drives the expression of the gene of interest, is separate. On the plasmid of. Manipulation of this type of system into the gene transfer vector of interest can be used in the compositions and methods of the present disclosure. Then, by co-transfecting the production cell line with a plasmid containing the gene of interest and the receptor monomer, it is possible to produce a gene transfer vector without expressing a potentially toxic transgene. Will be. At the appropriate time, ecdysone or mristolone A could activate the expression of the transgene.

In some situations, it may be desirable to regulate the expression of the transgene in the gene therapy vector. For example, different viral promoters can be utilized that vary in intensity of activity depending on the desired expression level. The CMV pre-early gene promoter in mammalian cells can be used to result in strong transcriptional activation. Modified forms of the less potent CMV promoter are also used when low levels of transgene expression are desired. When expression of the transgene in hematopoietic cells is desired, a retroviral promoter such as LTR (long terminal repeat) derived from MLV or MMTV is often used. Other viral promoters that can be used depending on the desired effect are adenoviral promoters such as adenoviral promoters derived from the SV40, RSV LTR, HIV-1 LTR and HIV-2 LTR, E1A region, E2A region, or MLP region. , AAV LTR, Califlower Mosaic Virus, HSV-TK, and chicken sarcoma virus.

In some embodiments, tissue-specific promoters are used to transcribe in specific tissue or cells to reduce potential toxicity or undesired effects on untargeted tissue. For example, promoters such as PSA, provasin, prostate acid phosphatase, or prostate-specific glandular kallikrein (hK2) can be used to target gene expression in the prostate.

In some cases, promoters or regulatory sequence elements can be used to direct selective expression within ocular cells or tissues. For example, promoters, sequence elements, or regulatory sequences found within specific ocular cell types such as retinal pigment epithelial cells can be used in suitable expression constructs (eg, RPE65 promoter or VMD2 promoter).

Choosing the right promoter can be easily achieved. In some cases, high expression or strong promoters can be used. An example of a suitable promoter is the 763 base pair cytomegalovirus (CMV) promoter. Rous sarcoma virus (RSV) (Davis et al., Hum Gene Ther, Vol. 4, p. 151 (1993)) and the MMT promoter can also be used. Certain proteins can be expressed using their natural promoter. Other elements that can enhance expression, such as enhancers, or systems that can result in high levels of expression, such as the tat gene and tar element, can also be incorporated. The cassette was then loaded into a vector such as pUC19, pUC118, pBR322, or, for example, E.I. It can be inserted into a plasmid vector such as another known plasmid vector containing the origin of replication of E. coli. See Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory press (1989). Promoters are discussed above. The plasmid vector may also contain selective markers such as the β-lactamase gene for ampicillin resistance, provided that the marker polypeptide does not adversely affect the metabolism of the organism being treated. The cassette can also be attached to a nucleic acid binding moiety within a synthetic delivery system, such as the system disclosed in WO95 / 22618, which is incorporated herein by reference. In general, the promoter sequence and / or any relevant regulatory sequence may comprise at least about 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 bp, or 10000 bp. .. The promoter sequence and any related regulatory sequence can include up to about 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 bp, or 10000 bp.

In some embodiments, the recombinant virus or plasmid is a cytomegalovirus (CMV) promoter, a Raus sarcoma virus (RSV) promoter, and an MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter. , RPE65 promoter, and promoter selected from opsin promoters. In general, the promoter sequences and promoter / enhancer sequences provided by the present disclosure are SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: No. 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 , SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 340, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, and any sequence selected from SEQ ID NO: 47. Uru, but not limited to these.

In some embodiments, antibiotic markers are used in the process of producing recombinant virus. Antibiotic resistance markers can be used to identify positive transgenic cells when producing recombinant viruses. In some embodiments, the antibiotic marker comprises a sequence encoding an antibiotic resistance gene, such as the sequences provided herein, including, but not limited to, the sequences shown in FIGS. 8A and 8B. For example, markers that confer resistance may include, but are not limited to, kanamycin, gentamicin, ampicillin, chloramphenicol, tetracycline, doxycycline, or hygromycin. In some embodiments, the antibiotic resistance gene is a non-beta-lactam antibiotic resistance gene, such as kanamycin.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus comprises a sequence encoding an origin of replication sequence, such as the origin of replication sequence provided herein. The origin of replication sequence generally provides a useful sequence for propagating the plasmid. In general, the origin of replication sequence provided by the present disclosure may include, but is not limited to, any sequence selected from the sequences provided in FIGS. 7A, 7B, 7C and 7D.

In some embodiments, the origin sequence or replication origin sequence is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, It may include, but is not limited to, sequences such as, but not limited to, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus comprises an enhancer such as the enhancer provided herein.

In some embodiments, the recombinant virus and / or the plasmid used to generate the recombinant virus is disclosed herein in US Pat. No. 7,635,474, which is provided herein and incorporated herein by reference. Includes a chimeric intron or intron 105, such as a chimeric intron or intron. Introns or chimeric introns can be used interchangeably herein. In some cases, an intron may refer to any sequence that may be transcribed but not translated. In some cases, an intron may refer to any sequence that may be transcribed but is removed from the intracellular mature RNA transcript. In some cases, the intron may include at least about 1 bp, 50 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 bp, or 5000 bp. In some cases, the intron may include at least about 1 bp, 50 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 bp, or 5000 bp. In some cases, the intron can be about 300 bp. In some cases, the intron can be about 200-400 bp. In some cases, the chimeric intron can be about 100-500 bp. In some cases, the intron can be about 50-200 bp. In some cases, the intron can be an intact, naturally occurring intron or chimeric intron.

In some embodiments, the intron may include, but is not limited to, sequences such as, but not limited to, SEQ ID NO: 48, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, or SEQ ID NO: 120.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus is such as the polyA (polyadenylation) sequence provided herein (eg, SV40 polyA sequence). Includes poly A (polyadenylation) sequence 107. In general, any suitable poly A sequence can be used for the desired expression of the transgene (ie, sFLT-1). For example, in some cases, the present disclosure provides sequences that include the SV40 poly A sequence or a portion of the SV40 poly A sequence. In some cases, the native poly A sequence (3'UTR) found downstream of the human sFLT-1 gene found in the human genome sequence can be used. In other cases, poly A sequences found downstream of genes other than sFLT-1 can be used. In other cases, the present disclosure provides a poly A sequence containing one or more poly A sequences or a combination of poly A sequence elements. In some cases, the poly A sequence is not used. In some cases, one or more poly A sequences may be referred to as untranslated regions (UTRs), 3'UTRs, or termination sequences.

In certain aspects of the disclosure, multiple gene or polycistronic messages are transmitted using an internal ribosome entry site (IRES) or foot-and-mouth disease virus (FMDV) element. Can be created. The IRES element can bypass the ribosome scanning model of 5'methylation cap-dependent translation and initiate translation at the internal site. IRES elements from two members of the picornavirus family (poliovirus and cardiovirus), as well as IRESs from mammalian messages are described. The IRES element can be connected to a heterogeneous open reading frame. Multiple open reading frames, each separated by an IRES, can be transcribed together to create a polycistronic message. The IRES element allows each open reading frame to access the ribosome for efficient translation. Multiple genes can be efficiently expressed using a single promoter / enhancer to transcribe a single message. An alternative system for co-expressing two proteins in a gene therapy delivery vector is the FMDV 2A system. The FMDV 2A system utilizes a retrovirus plasmid vector capable of linking the two genes to a nucleotide encoding the 2A sequence derived from the picornavirus foot-and-mouth disease virus. Transcription and translation result in bicistronic mRNA and two independent protein products.

Any heterogeneous open reading frame can be connected to the IRES element. It may include genes for intracellular proteins or membrane binding proteins and markers for selection, which are multi-subunit proteins that are secretory proteins encoded by independent genes. In this manner, expression of multiple proteins can be simultaneously engineered into cells with a single construct and a single marker for selection.

The poly A sequence is 1 to 10 bp, 10 to 20 bp, 20 to 50 bp, 50 to 100 bp, 100 to 500 bp, 500 bp to 1 Kb, 1 Kb to 2 Kb, 2 Kb to 3 Kb, 3 Kb to 4 Kb, 4 Kb to 5 Kb, 5 Kb to 6 Kb, 6 Kb. It may include lengths of ~ 7Kb, 7Kb-8Kb, 8Kb-9Kb, and 9Kb-10Kb. The poly A sequence is at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, It can include lengths of 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb. The poly A sequence has a maximum of 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp. , 500bp, 600bp, 700bp, 800bp, 900bp, 1Kb, 2Kb, 3Kb, 4Kb, 5Kb, 6Kb, 7Kb, 8Kb, 9Kb, and 10Kb.

In some cases, the poly A sequence or termination sequence may include, but is not limited to, sequences such as, but not limited to, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55. ..

In general, the poly A sequences provided by the present disclosure may include, but are not limited to, any sequence selected from the poly A regions 1-10 provided in FIGS. 9A and 9B.

In some cases, the poly A sequence contains, but is not limited to, the half-life of the transgene mRNA, the stability of the transgene mRNA, or the regulation of transcription for a variety of parameters that affect protein expression. Can be optimized. For example, the poly A sequence can be altered to increase the mRNA transcript of the transgene, resulting in increased protein expression. In some cases, the poly A sequence can be altered to shorten the half-life of the mRNA transcript of the transgene, resulting in reduced protein expression.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus comprises a polynucleotide encoding a human sFLT-1 protein or a functional fragment thereof. Optionally, the plasmid used to generate the recombinant virus and / or the recombinant virus comprises a nucleic acid encoding another anti-VEGF protein or VEGF inhibitor.

Optionally, the VEGF inhibitor may include, but is limited to, sequences such as SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, or SEQ ID NO: 122. Not done.

In some cases, the nucleic acid of the VEGF inhibitor can encode a polypeptide sequence which may include, but is not limited to, a polypeptide sequence such as SEQ ID NO: 109, or SEQ ID NO: 121.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus provides a regulatory nucleic acid fragment capable of directing the selective expression of the sFLT-1 protein in ocular cells. include. In some cases, ocular cells may include retinal pigment epithelial cells (RPEs).

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus may contain one or more untranslated regions (UTRs) or UTR sequences. In general, any suitable UTR sequence can be used for the desired optimal expression of the transgene (ie, sFLT-1). For example, in some cases, the UTR region or UTR sequence may include a naturally occurring sequence. In some cases, the UTR sequence can be a sequence found upstream (5'UTR) or downstream (3'UTR) of the human sFLT-1 gene found in the human genome sequence or a portion thereof. In other cases, the UTR sequence may include an unnatural sequence, such as an unnatural sequence found upstream or downstream of a gene other than sFLT-1, and may further be described herein by one or more. It may also include an array that further includes a combination of UTR array elements. In some cases, only 5'UTR sequences are used. In some cases, only 3'UTR sequences are used. In some cases, UTR sequences are not used.

The UTR sequences are 1-10bp, 10-20bp, 20-50bp, 50-100bp, 100-500bp, 500bp-1Kb, 1Kb-2Kb, 2Kb-3Kb, 3Kb-4Kb, 4Kb-5Kb, 5Kb-6Kb, 6Kb- It can include lengths of 7Kb, 7Kb-8Kb, 8Kb-9Kb, and 9Kb-10Kb. The UTR sequence is at least 1bp, 2bp, 3bp, 4bp, 5bp, 6bp, 7bp, 8bp, 9bp, 10bp, 20bp, 30bp, 40bp, 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 200bp, 300bp, 400bp, 500bp. , 600bp, 700bp, 800bp, 900bp, 1Kb, 2Kb, 3Kb, 4Kb, 5Kb, 6Kb, 7Kb, 8Kb, 9Kb, and 10Kb. The maximum UTR sequence is 1bp, 2bp, 3bp, 4bp, 5bp, 6bp, 7bp, 8bp, 9bp, 10bp, 20bp, 30bp, 40bp, 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 200bp, 300bp, 400bp, It can include lengths of 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb.

Generally, the UTR sequences provided by the present disclosure are SEQ ID NO: 91, SEQ ID NO: 2, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: Any sequence including, but not limited to, 99, SEQ ID NO: 100, and SEQ ID NO: 101 can be included, but is not limited thereto.

Optionally, variants of the 5'UTR and / or 3'UTR can be optimized for the desired level of protein expression. In some cases, the 3'UTR sequence can be the half-life of the transgene mRNA, the stability or secondary structure of the transgene mRNA, or conditional regulation (eg, binding of various factors that modulate translation). It can be optimized for a variety of parameters that affect protein expression, including but not limited to. For example, the 3'UTR sequence can be altered to prolong the half-life of the mRNA transcript of the transgene, resulting in increased protein expression. In some cases, the 3'UTR sequence can be altered to shorten the half-life of the mRNA transcript of the transgene, resulting in reduced protein expression.

In general, a 3'UTR sequence can contain a variety of sequence elements. The present disclosure discloses one or more polyadenylation signals, linker sequences, spacer sequences, SECIS elements, AU-rich sequences or ARE sequences or miRNA binding sequences or RNAi binding sequences, transcription terminator sequences 3'terminating sequences or variants thereof. Provided are 3'UTR sequences that may include, but are not limited to, sequence elements such as field and / or combinations.

In some cases, the 5'UTR sequence affects protein expression, including, but not limited to, the half-life of the intracellular transgene mRNA, the stability or secondary structure of the transgene mRNA, or the regulation of transcription. It can be optimized for the various parameters it exerts. For example, the 5'UTR sequence can be altered to increase the translation efficiency of the mRNA transcript of the transgene, resulting in increased protein expression. In some cases, the 5'UTR sequence can be altered to reduce the translation efficiency of the mRNA transcript of the transgene, resulting in reduced protein expression.

In general, a 5'UTR sequence can contain a variety of sequence elements. The present disclosure describes one or more ribosome-binding sites (RBSs), linker sequences, spacer sequences, regulatory sequences, regulatory response elements, riboswitches, sequences that promote or inhibit translation initiation, regulatory sequences for mRNA transport or them. Provided are 5'UTR sequences which may include, but are not limited to, sequence elements such as variants and / or combinations of.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus may comprise one or more linker or spacer sequences. The linker or spacer sequences described herein can be used interchangeably. In general, the linker or spacer sequence can be any suitable sequence used to create a non-adjacent sequence between at least two sequence elements. For example, in one aspect of the disclosure, the linker sequence is inserted between the ITR-1 (108) sequence, or ITR-2 (103), and the antibiotic resistance gene sequence 106, as reflected in FIG. 1A. Can be found. In another example, the linker sequence is any sequence of recombinant virus or plasmid encoding recombinant virus, including ITR sequence, promoter or promoter / enhancer sequence, intron sequence, transgene sequence, and polyA region sequence. It can be inserted adjacent to the element. In general, any suitable linker or spacer sequence can be used to create non-adjacent sequences. For example, in some cases, the linker sequence can be a randomly generated sequence. In some cases, the linker sequence can be a non-specific sequence optimized to prevent the formation of secondary structures or intramolecular interactions that can adversely affect protein expression. In some cases, the linker sequence may include any additional functional sequence elements including, but not limited to, introns, regulatory sequences, enhancers, and the like. Functional elements within the linker sequence can be used for the desired optimal production of the virus and / or expression of the transgene. In some cases, the linker sequence is the cloning site, the remnants of the preceding cloning site, or other insignificant sequence, and the insertion of such a linker between any two sequence elements is optional.

In general, the linker sequences provided by the present disclosure may include, but are not limited to, any sequence selected from the sequences provided in FIGS. 9D, 9E, and 9F.

In some cases, the length of the linker sequence can be optimized for the desired optimal production of the virus and / or expression of the transgene. Optionally, the length of one or more linker sequences located at one or more sites within the viral genome or plasmid can be varied to result in the desired optimal protein expression. For example, a linker sequence can be found between the intron described herein and the transgene (ie, sFLT-1). The length of the linker sequence can be varied to alter the effect of the transgene in the cell on transcription and subsequent translation.

The linker sequences are 1 to 10 bp, 10 to 20 bp, 20 to 50 bp, 50 to 100 bp, 100 to 500 bp, 500 bp to 1 Kb, 1 Kb to 2 Kb, 2 Kb to 3 Kb, 3 Kb to 4 Kb, 4 Kb to 5 Kb, 5 Kb to 6 Kb, 6 Kb to It can include lengths of 7Kb, 7Kb-8Kb, 8Kb-9Kb, and 9Kb-10Kb. The linker sequences are at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp. , 600bp, 700bp, 800bp, 900bp, 1Kb, 2Kb, 3Kb, 4Kb, 5Kb, 6Kb, 7Kb, 8Kb, 9Kb, and 10Kb. The maximum linker sequence is 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, It can include lengths of 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb.

In some cases, the linker or spacer sequences may be SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, and SEQ ID NO: 90 can be included, but are not limited thereto.

In some embodiments, the recombinant virus comprises an inverted terminal sequence (ITR) used to package the recombinant gene expression cassette into a virion of a viral vector. In some cases, ITR is derived from adeno-associated virus (AAV). In some cases, ITR is derived from AAV serotype 2. In some cases, the ITR may include, but is not limited to, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus is: a) first ITR sequence; b) promoter sequence; c) intron sequence; d) first. UTR sequence; e) a sequence encoding a VEGF inhibitor; f) a second UTR sequence; g) a poly A sequence; and h) a second ITR sequence containing nucleic acid elements. In some aspects of the plasmid used to generate the recombinant virus and / or the recombinant virus, the promoter sequence comprises a promoter / enhancer sequence. In some embodiments, the sequence encoding the VEGF inhibitor comprises a sequence encoding the human sFLT-1 protein or a functional fragment thereof. In another aspect, the plasmid used to generate the recombinant virus further comprises an origin of replication sequence 102. In some embodiments, the plasmid further comprises the sequence of an antibiotic resistance gene provided herein.

In some embodiments, the plasmid used to generate the recombinant virus and / or the recombinant virus is: a) first ITR sequence; b) first linker sequence; c) promoter sequence; d. ) Second linker sequence; e) Intron sequence; f) Third linker sequence; g) First UTR sequence; h) Sequence encoding VEGF inhibitor; i) Second UTR sequence; j) Fourth Linker sequence; k) Poly A sequence; l) Fifth linker sequence; and m) Nucleic acid elements in the order of the second ITR sequence. In some aspects of the plasmid used to generate the recombinant virus and / or the recombinant virus, the promoter sequence comprises a promoter / enhancer sequence. In some embodiments, the sequence encoding the VEGF inhibitor comprises a sequence encoding the human sFLT-1 protein or a functional fragment thereof. In another aspect, the plasmid used to generate the recombinant virus further comprises an origin of replication sequence. In some embodiments, the plasmid further comprises the sequence of an antibiotic resistance gene provided herein.

IV. Pharmaceutical Composition A pharmaceutical composition is one or more active ingredients, as well as one or more excipients or carriers suitable for administration to a human patient, in order to achieve the desired diagnostic or therapeutic or prophylactic effect. , Stabilizers, or fillers. For stability in storage and ease of handling, the pharmaceutical composition was lyophilized (ie, lyophilized and dried), which can be reconstituted with saline or water prior to administration to the patient. ) Or can be formulated as a vacuum dried powder. Alternatively, the pharmaceutical composition can also be formulated as an aqueous solution. The pharmaceutical composition may contain a proteinaceous active ingredient. Unfortunately, proteins are extremely difficult to stabilize, and as a result, when formulated and reconstituted (if required), and when stored prior to use of proteins containing pharmaceutical compositions. May result in loss of protein and / or loss of protein activity. Stability issues can arise due to protein denaturation, degradation, dimerization, and / or polymerization. Various excipients such as albumin and gelatin have been used with varying degrees of success in attempts to stabilize the active ingredients of proteins present in pharmaceutical compositions. In addition, cryoprotectants such as alcohol have also been used to reduce denaturation of proteins in the frozen state of lyophilization.

Pharmaceutical compositions suitable for internal use include sterile aqueous or sterile dispersions and sterile powders for the instant preparation of sterile injectable or sterile injectable dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic saline, or phosphate buffered saline (PBS). In all cases, the composition shall be sterile and fluid to the extent that easy injectability exists. The composition must be stable under manufacturing and storage conditions and must be protected against the contaminating effects of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (eg, glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be achieved, for example, by using a coating such as lecithin, in the case of dispersions by maintaining the required particle size, and by polysolvate (Tween ™), sodium dodecyl sulfate ( Sodium Lauryl Sulfate), Lauryl Dimethylamine Oxide, Cetyltrimethylammonium Bromide (CTAB), Polyethoxylated Alcohol, Polyoxyethylene sorbitan, Octoxinol (Triton X 100 ™), N, N-Dimethyldodecylamine-N- Oxide, hexadecyltrimethylammonium bromide (HTAB), polyoxyl 10 lauryl ether, Brij 721 (trademark), bile salt (sodium deoxycholate, sodium colate), pururonic acid (F-68, F-127), polyoxyl himeshi It can be maintained by using surfactants such as oil (Cremophor ™), noniphenol ethoxylate (Tergitol ™), cyclodextrin, and ethylbenzethonium chloride (Hyamine ™). Prevention of microbial action can be achieved with a variety of antibacterial and antifungal agents such as parabens, chlorobutanol, phenols, ascorbic acid, thimerosal and the like. In many cases, it will be preferable to include an isotonic agent, for example, sugar, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Delayed absorption of the internal composition can be achieved by including in the composition an agent that delays absorption, such as aluminum monostearate and gelatin.

Sterilization solutions are prepared by incorporating the active compound, on demand, in the appropriate solvent, in the required amount, with one component or combination of components listed above, followed by filtration sterilization. Can be done. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing the basic dispersion medium and other required components derived from the components listed above. For sterile powders for preparing sterile injectable solutions, the preparation method is vacuum drying and lyophilization-drying, which brings any additional desired ingredient added to the active ingredient powder from its pre-sterile filtered solution. ..

In one aspect, the active compound is prepared with a carrier that protects the compound from rapid excretion from the body, such as a controlled release formulation containing an implant and a microencapsulated delivery system. Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Those skilled in the art will know how to prepare such formulations. The material can also be purchased. Liposomal suspensions, including liposomes targeted to infected cells with monoclonal antibodies to viral antigens, can also be used as pharmaceutically acceptable carriers. These can be prepared, for example, according to methods known to those of skill in the art, as described in US Pat. No. 4,522,811, which are incorporated herein by reference.

It is particularly advantageous to formulate the oral or parenteral composition in a unit dosage form for ease of administration and dosage homogeneity. As used herein, a unit dosage form is a physically separate unit suitable for a single dose of a human subject to be treated, each unit calculated to provide the desired therapeutic effect. A predetermined amount of the active compound, which refers to a unit containing the active compound associated with the required pharmaceutical carrier. The specifications of the unit dosage forms of the present disclosure are determined by the unique characteristics of the active compound and the particular therapeutic effect achieved, as well as the constraints inherent in the art for the formulation of such active compounds to treat individuals. And depend directly on these.

The pharmaceutical composition can be incorporated into a container, pack, or dispenser with instructions for administration.

The pharmaceutical compositions of the present disclosure can, when administered to animals, including humans, result in (directly or indirectly) a biologically active metabolite or residue thereof. Incorporate pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound. Thus, for example, the disclosure also attracts prodrugs and pharmaceutically acceptable salts of the compounds of the present disclosure, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Be done.

The term "prodrug" is prepared in the body or in its cells in an inactive form that is converted to an active form (ie, a drug) by the action and / or conditions of an endogenous enzyme or other chemical. Indicates a therapeutic agent.

The term "pharmaceutically acceptable salt" refers to the physiologically and pharmaceutically acceptable salt of the compounds of the present disclosure: that is, it retains the desired biological activity of the parent compound and has an undesired toxic effect on it. Refers to salt that is not added.

Pharmaceutically acceptable base-added salts are formed from metals or amines such as alkali metals and alkaline earth metals or organic amines. Metals used as cations include sodium, potassium, magnesium, calcium and the like. Amines include NN'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (eg, Berge et al., "Pharmaceutical Salts", J. Pharma Sci. , 1977, Vol. 66, p. 119). The base-added salt of the acidic compound is prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in a conventional manner. The free acid form can be regenerated by contacting the salt form with the acid and isolating the free acid in a conventional manner. Although the free acid forms differ in some way from their respective salt forms and certain physical properties, such as solubility in polar solvents, the salts of interest in the present disclosure are otherwise of theirs. Equivalent to each free acid.

As used herein, a "pharmaceutical additive salt" includes a pharmaceutically acceptable salt in the acid form of one of the components of the compositions of the present disclosure. These include organic or inorganic acid salts of amines. Preferred acid salts are chloride salts, acetates, salicylates, nitrates, and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and are basic salts with, for example, inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, or phosphoric acid; organic carboxylic acids. , Sulfonic acid, sulphonic acid or phosphonic acid or N-substituted sulfamic acid, such as acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid , Shuic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid, Or a basic salt with isonicotinic acid; and a basic salt with 20 alpha amino acids involved in the synthesis of proteins in nature, such as amino acids such as glutamate or aspartic acid; and also phenylacetic acid, methanesulfonic acid, ethane. Sulphonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfoic acid, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfone Other acids Organic, such as acids, basic salts with 2-phosphoglyceric acid or 3-phosphoglyceric acid, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamic acidate), or ascorbic acid. Includes basic salts of various inorganic and organic acids, such as compounds. A pharmaceutically acceptable salt of the compound can also be prepared with a pharmaceutically acceptable cation. Suitable, pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline cations, alkaline earth cations, ammonium cations, and quaternary ammonium cations. Carbonates or bicarbonates are also possible. For oligonucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to: (I) Salts formed by cations such as sodium, potassium, ammonium, magnesium, calcium, polyamides such as spermin and spermidin; (II) inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitrate and the like. Acid-added salts formed by (III), for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, Salts formed by organic acids such as alginic acid, polyglutamic acid, naphthalene sulfonic acid, methane sulfonic acid, p-toluene sulfonic acid, naphthalenedi sulfonic acid, polygalacturonic acid; and (IV) elemental anions such as chlorine, bromine, and iodine. A salt formed from.

The pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be made from a variety of ingredients, including but not limited to preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids.

Certain compositions of the present disclosure also incorporate carrier compounds into the formulation. As used herein, a "carrier compound" or "carrier" is inactive (ie, has no biological activity by itself), but does, for example, degrade a biologically active nucleic acid. Alternatively, it may refer to a nucleic acid or an analog thereof that is recognized as a nucleic acid by an in vivo process that reduces the bioavailability of a nucleic acid having biological activity by facilitating its removal from the circulation. In general, co-administration of nucleic acids with carrier compounds, in excess of the latter substance, is probably due to competition between the carrier compounds and nucleic acids for a common receptor, liver, kidney or other additional This can result in a substantial reduction in the amount of nucleic acid recovered in the reservoir of the circulation. For example, partial recovery of phosphorothioate oligonucleotides in liver tissue is reduced when co-administered with polyinosic acid, dextran sulfate, polycitidic acid, or 4-acetamido-4'isothiocyano-stilbene-2,2'disulfonic acid. (Miyao et al., Antisense Res. Dev., 1995, Vol. 5, pp. 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, Vol. 6, pp. 177-183).

The vector or recombinant virus (virion) can be incorporated into a pharmaceutical composition for administration to mammalian patients, especially humans. The vector or virion can be formulated in a non-toxic, inert, pharmaceutically acceptable aqueous carrier at a pH of preferably in the range of 3-8, more preferably in the range of 6-8. Such sterile compositions will include vectors or virions containing nucleic acids encoding therapeutic molecules dissolved in aqueous buffers that exhibit acceptable pH when reconstituted.

In some embodiments, the pharmaceutical compositions provided herein are pharmaceutically acceptable carriers and / or excipients such as saline, phosphate buffered saline, phosphates and amino acids. Includes therapeutically effective amounts of vectors or virions mixed with polymers, polyols, sugars, buffers, preservatives, as well as other proteins. Exemplary amino acids, polymers, and sugars include octylphenoxypolyethoxyethanol compounds, polyethylene glycol monostearic acid compounds, polyoxyethylene sorbitan fatty acid esters, sucrose, fructose, dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol. , Galactitol, xylitol, lactose, trehalose, bovine serum albumin or human serum albumin, citric acid, acetic acid, Ringer's solution and Hanks' solution, cysteine, arginine, carnitine, alanine, glycine, lysine, valine, leucine, polyvinylpyrrolidone, polyethylene, and It is glycol. Preferably, the formulation is stable at 4 ° C. for at least 6 months.

In some embodiments, the pharmaceutical compositions provided herein are phosphate buffered saline (PBS) or sodium phosphate / sodium sulfate, Tris buffer, glycine buffer, sterile water, and Good et al. 1966), Biochemistry, Vol. 5, Includes buffers such as other buffers known to those of skill in the art, such as the buffer described on page 467. The pH of the buffer solution in which the pharmaceutical composition containing anti-VEGF contained in the adenovirus vector delivery system is dissolved is in the range of 6.5 to 7.75, 7 to 7.5, or 7.2 to 7.4. Can be within. The pH of the formulation can range from about 3.0 to about 12.0. The pH of the immunogenic composition can be at least about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 pH units. The pH of the immunogenic composition can be up to about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 pH units.

In some embodiments, the pharmaceutical compositions provided herein include substances that increase the viscosity of the suspension, such as carboxymethyl sodium cellulose, sorbitol, or dextran. Included in an amount of about 1-10 percent, such as 6, 7, 8, 9, or 10 percent.

Certain embodiments of the present disclosure provide pharmaceutical compositions containing one or more recombinant viruses and one or more other chemotherapeutic agents.

Examples of such chemotherapeutic agents are daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, merphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, citarabin (CA), 5 -Includes anti-cancer drugs such as fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MIX), corhitin, vincristin, vinblastin, etoposide, teniposide, cisplatin, and diethylstillestrol (DES). Is not limited to these. In general, see "The Merck Manual of Diagnosis and Therapy," 15th edition, edited by Berkow et al., 1987, Rahway, NJ, pp. 1206-1228).

Anti-inflammatory drugs, including but not limited to non-steroidal anti-inflammatory agents and corticosteroids, and antiviral agents including, but not limited to, ribivillin, vidarabine, acyclovir, and ganciclovir are also included in the compositions of the present disclosure. ("The Merck Manual of Diagnosis and Therapy", 15th edition, edited by Berkow et al., 1987, Rahway, N.J., pp. 2499-2506 and pp. 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of this disclosure. Two or more combined compounds can be used together or sequentially.

In another related aspect, the compositions of the present disclosure may contain one or more recombinant viruses, in particular sFLT-1 with different sequences. Two or more combined viruses can be used together or sequentially.

In another aspect, the present disclosure is a unit dose pharmaceutical composition comprising a viral genome of about 1 × 10 ⁶ to about 1 × 10 ¹⁵ wherein the virus comprises a nucleic acid encoding sFLT-1. The composition is provided.

Optionally, the unit dose of the pharmaceutical composition of the present disclosure can be measured as pfu (plaque forming unit). In some cases, the unit dose pfu of the pharmaceutical compositions of the present disclosure can be from about 1 × 10 ⁸ to about 5 × 10 ¹⁰ pfu. In some cases, the unit dose pfu of the pharmaceutical compositions of the present disclosure is at least about 1 × 10 ⁸ , 2 × 10 ⁸ , 3 × 10 ⁸ , 4 × 10 ⁸ , 5 × 10 ⁸ , 6 × 10 ⁸ , 7 ×. 10 ⁸ , 8 × 10 ⁸ , 9 × 10 ⁸ , 1 × 10 ⁹ , 2 × 10 ⁹ , 3 × 10 ⁹ , 4 × 10 ⁹ , 5 × 10 ⁹ , 6 × 10 ⁹ , 7 × 10 ⁹ , 8 × 10 ⁹ , 9 × 10 ⁹ , 1 × 10 ¹⁰ , 2 × 10 ¹⁰ , 3 × 10 ¹⁰ , 4 × 10 ¹⁰ , and 5 × 10 ¹⁰ pfu. In some cases, the unit dose pfu of the pharmaceutical compositions of the present disclosure may be up to about 1 × 10 ⁸ , 2 × 10 ⁸ , 3 × 10 ⁸ , 4 × 10 ⁸ , 5 × 10 ⁸ , 6 × 10 ⁸ , 7. × 10 ⁸ , 8 × 10 ⁸ , 9 × 10 ⁸ , 1 × 10 ⁹ , 2 × 10 ⁹ , 3 × 10 ⁹ , 4 × 10 ⁹ , 5 × 10 ⁹ , 6 × 10 ⁹ , 7 × 10 ⁹ , 8 × 10 ⁹ , 9 × 10 ⁹ , 1 × 10 ¹⁰ , 2 × 10 ¹⁰ , 3 × 10 ¹⁰ , 4 × 10 ¹⁰ , and 5 × 10 ¹⁰ pfu.

In some cases, the viral vectors of the present disclosure can be measured as vector genomes. Optionally, the unit dose of the pharmaceutical composition of the present disclosure is a vector genome of 1 × 10 ¹⁰ to 3 × 10 ¹² . Optionally, the unit dose of the pharmaceutical composition of the present disclosure is a vector genome of 1 × 10 ⁹ to 3 × 10 ¹³ . Optionally, the unit dose of the pharmaceutical composition of the present disclosure is a vector genome of 1 × 10 ¹⁰ to 1 × 10 ¹¹ . Optionally, the unit dose of the pharmaceutical composition of the present disclosure is a vector genome of 1 × 10 ⁸ to 3 × 10 ¹⁴ . In some cases, the unit dose of the pharmaceutical composition of the present disclosure is at least about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ . 1, × 10 ⁸ , 1 × 10 ⁹ , 1 × 10 ¹⁰ , 1 × 10 ¹¹ , 1 × 10 ¹² , 1 × 10 ¹³ , 1 × 10 ¹⁴ , 1 × 10 ¹⁵ , 1 × 10 ¹⁶ , 1 × 10 ¹⁷ , And a 1 × 10 ¹⁸ vector genome. Optionally, the unit dose of the pharmaceutical composition of the present disclosure is a vector genome of 1 × 10 ⁸ to 3 × 10 ¹⁴ . In some cases, the unit doses of the pharmaceutical compositions of the present disclosure may be up to about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10. ⁷ , 1x10 ⁸ , 1x10 ⁹ , 1x10 ¹⁰ , 1x10 ¹¹ , 1x10 ¹² , 1x10 ¹³ , 1x10 ¹⁴ , 1x10 ¹⁵ , 1x10 ¹⁶ , 1x10 ¹⁷ and 1 × 10 ¹⁸ vector genomes.

Optionally, unit doses of the pharmaceutical compositions of the present disclosure can be measured using multiplicity of infection (MOI). In some cases, MOI may refer to the ratio or multiple of a vector or viral genome to cells capable of delivering nucleic acids. In some cases, the MOI can be ^1x106 . In some cases, the MOI can be ^1x105 to ^1x107 . In some cases, the MOI can be 1 × 10 ⁴ to 1 × 10 ⁸ . In some cases, the recombinant viruses of the present disclosure are at least about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ , 1 ×. 10 ⁸ , 1x10 ⁹ , 1x10 ¹⁰ , 1x10 ¹¹ , 1x10 ¹² , 1x10 ¹³ , 1x10 ¹⁴ , 1x10 ¹⁵ , 1x10 ¹⁶ , 1x10 ¹⁷ , and 1 × 10 ¹⁸ MOI. In some cases, the recombinant virus of the present disclosure is a MOI of 1 × 10 ⁸ to 3 × 10 ¹⁴ . In some cases, the recombinant viruses of the present disclosure may be up to about 1 × 10 ¹ , 1 × 10 ² , 1 × 10 ³ , 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ , 1 × 10 ⁸ , 1 × 10 ⁹ , 1 × 10 ¹⁰ , 1 × 10 ¹¹ , 1 × 10 ¹² , 1 × 10 ¹³ , 1 × 10 ¹⁴ , 1 × 10 ¹⁵ , 1 × 10 ¹⁶ , 1 × 10 ¹⁷ , and. It has a MOI of 1 × 10 ¹⁸ .

In some embodiments, the nucleic acid can be delivered without the use of a virus (ie, by a non-viral vector) and can be measured as the amount of nucleic acid. In general, any suitable amount of nucleic acid can be used with the compositions and methods of the present disclosure. In some cases, the amount of nucleic acid is at least about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng, 1 μg, 10 μg, 100 μg, 200 μg, 300 μg, 400 μg, 500 μg, 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, It can be 800 mg, 900 mg, 1 g, 2 g, 3 g, 4 g, or 5 g. In some cases, nucleic acids can be up to about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng. , 600 ng, 700 ng, 800 ng, 900 ng, 1 μg, 10 μg, 100 μg, 200 μg, 300 μg, 400 μg, 500 μg, 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg. , 900 mg, 1 g, 2 g, 3 g, 4 g, or 5 g.

In some embodiments, the pharmaceutical composition comprises from about 1 × 10 ⁶ to about 1 × 10 ¹⁵ recombinant viruses, from about 1 × 10 ⁷ to about 1 × 10 ¹⁴ recombinant viruses, about 1 × 10 ⁸ . Includes ~ about 1 × 10 ¹³ recombinant viruses, about 1 × 10 ⁹ to about 3 × 10 ¹² recombinant viruses, or about 1 × 10 ¹⁰ to about 3 × 10 ¹² recombinant viruses.

Kits Compositions and reagents useful in the present disclosure can be packaged within the kit to facilitate the application of the present disclosure. In some embodiments, the method provides a kit comprising the recombinant nucleic acid of the present disclosure. In some embodiments, the method provides a kit comprising the recombinant virus of the present disclosure. Instructions are provided on electronic storage media, such as instructions printed on the kit's package insert, instructions printed on one or more containers, as well as computer-readable storage media. It could be any desired form, including but not limited to electronically stored instructions. It also incorporates software packages on computer-readable storage media that allow users to incorporate information and calculate control doses, if desired.

In another aspect, the disclosure provides a kit comprising the pharmaceutical compositions provided herein. In yet another aspect, the disclosure provides kits in the treatment of diseases such as, for example, AMD, DME, RVO, angiogenesis-related diseases, cancer, autoimmune diseases, infectious disease organisms and the like.

In one aspect, the kit comprises (a) the recombinant virus provided herein and (b) instructions for administering a therapeutically effective amount of the recombinant virus to a cell or individual. In some embodiments, the kit may include a pharmaceutically acceptable salt or solution for administering the recombinant virus. If desired, the kit may further include instructions for appropriate operating parameters in the form of display or separate package inserts. For example, the kit may have standard instructions that provide the physician or laboratory technician with information for preparing a dose of recombinant virus.

If desired, the kit allows the patient sample to be compared with control information that serves as a basis for determining whether the dose of recombinant virus is, for example, a therapeutic dose consistent with tumor regression. Can further include reference information or control information. If desired, the kit could further include devices for administration, such as syringes, filter needles, extension tubes, cannulas, and subretinal injectors.

Recombinant viruses can be produced by any suitable means. The methods and compositions of the present disclosure provide the production of recombinant viruses by a variety of means, including the use of transgenic cells, which may include mammalian cells, insect cells, animal cells, or fungal cells.

For example, in some embodiments, the recombinant virus can be produced by transfection of insect cells via recombinant baculovirus. In some cases, recombinant baculovirus can be produced as an intermediate in which the baculovirus can contain sequences necessary to produce other viruses, such as AAV virus or rAAV2 virus. Optionally, one or more baculoviruses can also be used in the production of recombinant viruses used in the compositions and methods of treatment of the present disclosure. In some cases, insect cells such as Sf9 cell line, High-Five cell line, or Sf21 cell line can also be used. In some cases, cell lines can be generated using transient methods (ie, infection with transgenes that are not stably integrated). In other cases, cell lines can be generated by the generation of stable cell lines (ie, infections with transgenes that are stably integrated into the host cell genome). In another aspect, the pharmaceutical compositions provided herein are made using adherent human fetal-derived kidney 293 (HEK293: human embryonic kidney 293) cells. In an alternative embodiment, the pharmaceutical compositions provided herein are prepared using HEK293 cells adapted to suspension. In another aspect, the pharmaceutical compositions provided herein are prepared using a baculovirus expression system (BVES) in insect cells. In some embodiments, the vector is produced using a herpes helper virus. In some embodiments, the vector is produced using the producer cloning method. In some embodiments, the vector is produced using Ad-AAV.

In general, any suitable method can be used in the biochemical purification of recombinant viruses for use in the pharmaceutical compositions described herein. The recombinant virus can be collected directly from the cells or from the culture medium surrounding the host cells. The virus can be purified using a variety of biochemical means, such as gel filtration, filtration, chromatography, affinity purification, gradient ultracentrifugation, or size exclusion. Recombinant viruses can be examined for content (ie, identification), purity, or potency (ie, activity) using any suitable means prior to formulation into a pharmaceutical composition. Methods may include, but are not limited to, immunoassays, ELISAs, SDS-PAGEs, Western blots, Northern blots, Southern blots, or PCR, HUVEC assays.

V. Treatment Method In another aspect, the present disclosure is a method for treating a pathological angioplasty-related disease, in which a pharmaceutically effective amount of the pharmaceutical composition provided herein is treated in such a manner. Provided is a method comprising the step of administering to a human subject in need. In some embodiments, the disease is age-related retinopathy (AMD), wet AMD, atrophic AMD, retinal angiogenesis, chorioretinopathy, diabetic retinopathy, proliferative diabetic retinopathy, retinal vein occlusion, Selected from the group of ocular angiogenic diseases consisting of central retinal vein occlusion, branched retinal vein occlusion, diabetic luteal edema, diabetic retinopathy, ischemic retinopathy, and diabetic retinopathy ..

In some cases, atrophic AMD can also be treated. In some cases, atrophic AMD may be referred to as central geographic atrophy characterized by atrophy of the retinitis pigmentosa layer below the retina and subsequent loss of photoreceptors in the central part of the eye. The compositions and methods of the present disclosure provide treatment for any and all forms of AMD.

In another aspect, the disclosure is a method for the prophylactic treatment of AMD or ocular angiogenic disorders described herein, in a pharmaceutically effective amount of the pharmaceutical composition provided herein. Provided are methods that include the step of administering a substance to a human subject in need of such treatment. The present disclosure can be used to treat patients who are at risk of developing AMD or presenting with early symptoms of AMD. This may include simultaneous or sequential eye treatments. Simultaneous treatment may mean administering the treatment to each eye at the same time, or treating both eyes at the same visit to the treating physician or other health care provider. Patients are also at high risk of developing AMD in a healthy pair of eyes presenting with AMD symptoms, or are also at high risk of developing AMD in patients with a genetic predisposition to the development of AMD. Is recorded. The present disclosure can be used as a prophylactic measure in the prevention of AMD in the paired eye.

Although the mechanism underlying the increased risk of ocular angiogenic disease progression in the pair of eyes is unknown, studies have been conducted in the art detailing this increased risk. .. For example, in one such large study of 110 paired eyes, 98 eyes developed advanced to late AMD, choroidal neovascularization (CNV), and 15 eyes developed. Foveal geographic atrophy (GA) was observed to develop (Ophthalmologica., 2011, Vol. 226 (No. 3): pp. 110-8, doi: 10.1159 / 000329473; Curr Opin Ophthalmol., June 1998. , Volume 9 (No. 3): pp. 38-46). Advanced to end-stage within this cohort, both by non-ocular features (age, gender, history of hypertension or smoking) and by eye characteristics of the test eye at baseline (lesion composition, lesion size, or visual acuity). AMD was not predicted. However, statistical analysis shows that AMD symptoms in the first eye, including drusen size, localized pigmentation, and nonfoveal geographic atrophy, are significant in assessing the risk of developing AMD in the paired eye. It points out that it had an independent relationship. Recent studies have pointed out that among eye features, genetic factors and certain environmental factors can play a role in increasing the risk of developing AMD in a pair of eyes (JAMA Ophthalmol., 2013). April 1, Volume 131 (No. 4): pp. 448-55, doi: 10.1001 / jamaophthalmol.2013.2578). Given the well-characterized increase in the risk of developing AMD in the untreated pair of eyes, the art prevents onset and subsequent visual loss due to the disease. A way to do it is needed.

As used herein, the terms "subject" or "individual" or "patient" refer to an individual who has or is suspected of having a disease or disorder. In the present disclosure, subjects, individuals, or patients can be used interchangeably and include mammalian and non-mammalian animals. Examples of mammals are mammal classes: humans, chimpanzees, and non-human primates such as other apes and monkey species; farm animals such as cows, horses, sheep, goats, pigs; rabbits, dogs, and cats. Pet animals such as; including, but not limited to, any member of such as, but not limited to, laboratory animals including rodents such as rats, mice, and guinea pigs. Examples of non-mammals include, but are not limited to, birds, fish and the like. In some aspects of the methods and compositions provided herein, the mammal is a human.

The term "subject" or "individual" also includes humans over the age of 20 who suffer from a disorder or disease. Unexpectedly, the disclosure can be used in a range of patient ages. This includes younger patients who are not generally associated with AMD disease, which appears more frequently in patients over 65 years of age. The human subject or patient of the present disclosure may include at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 years. .. Human subjects or patients of the present disclosure include up to about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 years. sell.

In some embodiments, the term "subject" or "individual" includes patients who alter their response to penicillin, such as resistance or susceptibility to its effects, or who exhibit or lack symptoms of an allergic reaction to a drug.

A. Delivery Method In some embodiments, the pharmaceutical composition is administered to the subretinal site using any orientation method. In some cases, the service method may be an injectable service method, such as the service method described in US Pat. No. 20100817, which is incorporated herein by reference in its entirety. In some cases, direct administration to the subretinal site involves injection of the liquid pharmaceutical composition via a syringe. In another example, direct administration may involve injection via a cannula or other suitable device for delivering the vector or recombinant virus. In another example, direct administration may include an implant that further contains a suitable vector for delivering a transgene such as sFLT-1. In some cases, the implant can be placed directly in or near the retina.

The central retinal region, macula region, and foveal region of the retina are endemic between mammals and primates. In addition, there are markedly different differences in anatomy and subsequent pathogenic mechanisms of AMD between primates and humans. The central retina is the band of the retina that surrounds the posterior pole between the vascular arcades of the primate eye, including the fovea, macula, and peripheral band. The macula is near the center of the retina and is about 1.5 mm in diameter. This band contains the highest concentrations of both rod and pyramidal photoreceptors. At the center of the macula is the fovea, which is a pit containing the highest concentration of pyramidal photoreceptors. The macula and foveal regions of the retina also contain underlying RPE cells. These areas of the retina contribute to the perception of fine details (visual acuity) and the perception of color. Since this region contributes to the most important part of human vision (microvision), safe and effective targeting of the vector to the macula and the subretinal space of the fovea is desired. Optionally, the pharmaceutical compositions of the present disclosure are administered to the central retina. Optionally, the pharmaceutical compositions of the present disclosure are administered to the central retina outside the fovea.

Briefly, a general method for delivering the vector to the macula and the subretinal space of the fovea can be illustrated by the following short outline. This example is intended only to illustrate certain features of the method and is not intended to be limiting.

In general, the vector can be delivered in the form of a suspension that is injected intraocularly (subretinal) under direct observation using a surgical microscope. This procedure may involve injection of a vector suspension using a narrow cannula through one or more microretinal incisions into the subretinal space after vitrectomy.

Briefly, normal sphere volume can be maintained by suturing the infusion cannula in place and injecting (eg, saline) throughout surgery. Replace the volume of vitreous gel removed by injecting saline or other isotonic solution from the infusion cannula using a cannula of appropriate inner diameter size (eg, 20-27 gauge). , Perform vitrectomy. (1) Removal of the cortex (posterior hyaline membrane) facilitates penetration of the retina by cannula, (2) removal and replacement with fluid (eg, physiological saline) provides space for intraocular injection of the vector. It is advantageous to perform vitrectomy to reduce the possibility of retinal tears and unexpected retinal detachment by creating and (3) controlling its removal.

In some embodiments, the vector utilizes a cannula of appropriate inner diameter size (eg, 27-45 gauge) and thus to the subretinal space within the central retina by creating a bleb within the subretinal space. Inject directly. In another embodiment, for subretinal injection of the vector suspension, a small volume (eg, about 0.1-about 0.5 ml) of a suitable fluid (such as saline or Ringer's solution) is subretinal in the central retina. Prioritize subretinal injection into the cavity. This initial injection into the subretinal cavity establishes an initial fluid bleb in the subretinal cavity, causing localized retinal detachment at the location of the initial bleb. This initial fluid bleb facilitates targeted delivery of the vector suspension to the subretinal cavity (by defining the injection surface prior to delivery of the vector), possible vector administration to the choroid and the vitreous cavity. It is possible to minimize the possibility of injection or reflux of the vector into. In some embodiments, one or more vector suspensions and / or 1 are administered to the initial fluid bleb by direct administration of these fluids to the initial fluid bleb by a cannula having the same inner diameter or even a smaller inner diameter. Alternatively, a fluid containing a plurality of additional therapeutic agents can be further injected.

Intraocular administration of vector suspensions and / or initial small volume fluids can be performed using a small inner diameter cannula (eg, 27-45 gauge) attached to a syringe. In some embodiments, the plunger of the syringe can be driven by a mechanized device, such as by stepping on a foot pedal. A micro-inner diameter cannula is delivered through a scleral incision across the vitreous cavities to a predetermined site of each subject in the retina, depending on the band of the targeted retina (in the central retina). In one embodiment, administration is performed to a site outside the fovea. Under direct visualization, the vector suspension is mechanically injected under the sensory nerve retinal and self-sealing non-enlarged retinal incision causes localized retinal detachment. As mentioned above, the vector can also be injected directly into the subretinal space to create a bleb within the central retina, which can be injected into the initial bleb within the central retina and magnified (and expanded). It is also possible to expand the retinal detachment band). In some embodiments, the injection of the vector suspension is followed by an injection of another fluid into the bleb.

Unwanted to be bound by theory, the rate and location of subretinal injections may result in localized shear forces that can damage the macula, fovea, and / or underlying RPE cells. be. Subretinal injections can be performed at a rate that minimizes or avoids shear forces. In some embodiments, the vector is injected over about 15-17 minutes. In some embodiments, the vector is injected over about 17-20 minutes. In some embodiments, the vector is injected over about 20-22 minutes. In some embodiments, the vector is injected over about 1 minute, or about 1-3 minutes or less than 1 minute. In some embodiments, the vector is injected at a rate of about 35 to about 65 μl / min or 65 μl / min to about 150 μl / min. In some embodiments, the vector is injected at a rate of about 35 μl / min. In some embodiments, the vector is injected at a rate of about 40 μl / min. In some embodiments, the vector is injected at a rate of about 45 μl / min. In some embodiments, the vector is injected at a rate of about 50 μl / min. In some embodiments, the vector is injected at a rate of about 55 μl / min. In some embodiments, the vector is injected at a rate of about 60 μl / min. In some embodiments, the vector is injected at a rate of about 65 μl / min. In some embodiments, the vector is injected at a rate of about 100 μl / min. For those skilled in the art, the rate and number of injections of bleb, for example, the volume of vector required to create sufficient retinal detachment to access the cells of the central retina or the size of the bleb, deliver the vector. You will recognize that it can be oriented by the size of the cannula used in the retina and the ability to keep the position of the cannulas in the present disclosure safe.

One or more (eg, two, three or more) blebs can be created. In general, the total volume of one or more blebs produced by the methods and systems of the present disclosure cannot exceed the fluid volume of the eye, eg, about 4 ml in a typical human subject. The total volume of each individual bleb is preferably about 0.1-0.2 ml. Those skilled in the art will recognize that in the creation of blebs according to the methods and systems of the present disclosure, proper intraocular pressure must be maintained to avoid damage to the ocular structure. The size of each individual bleb can be, for example, from about 50 μl to about 100 μl, from about 50 μl to about 200 μl, from about 0.1 to about 0.2 ml, from about 0.1 to about 0.3 ml, or> 0.3 ml. ..

In order to safely and efficiently transduce the band of the target retina (eg, the central retina) outside the margin of the original position of the bleb, in some cases, the bleb is manipulated to transduce the bleb. It may be desirable to reposition to the target band. The manipulation of the bleb is the dependence of the bleb created by the volume of the bleb, the repositioning of the eye containing the bleb, the repositioning of the human head with one or more eyes containing one or more blebs, and / Or can be applied by liquid-air exchange. Bleb manipulation is particularly relevant to the central retina, as the central retina is generally resistant to detachment by subretinal injection.

In some embodiments, after subretinal injection, liquid-air exchange is utilized, which temporarily replaces the fluid from the infusion cannula with air, eg, air that is blown onto the surface of the retina. When the volume of air moves the saline fluid from the vitreous cavity, the bleb is kept in place without overflowing into the vitreous cavity. In some cases, with proper eyeball positioning, the subretinal vector bleb can be manipulated to involve adjacent bands (eg, macula and / or fovea). In some cases, the mass of the bleb is sufficient to attract the bleb to gravity without the use of liquid-air exchange. The movement of the bleb can also be facilitated by repositioning the head of the human subject so that the bleb can be pulled to the desired position in the eye. Once the desired configuration of the bleb has been achieved, the fluid is returned to the vitreous cavity. The fluid is a suitable fluid, such as fresh saline. In general, subretinal vectors can be left in situ without retinal repositioning for retinal incision and without intraocular tamponade, and the retina spontaneously reattaches within about 48 hours. ..

Subretinal administration of AAV-2 to treat eye disease is supported in the treatment of the rare hereditary disease Leber congenital ulcer (“LCA”). The pathology of LCA and the patient population of LCA are different from the pathology of exudative AMD and the patient population and are therefore the treatment of exudative AMD by gene therapy, in particular the treatment of exudative AMD with AAV-2 is rAAV. It was not predicted to be safe and effective prior to clinical studies with sFLT. In particular, LCA is a degenerative hereditary disease caused by inadequate expression of the retinal protein RPE-65. LCA causes slow visual loss in infants and young children and generally results in total blindness by young adulthood before the age of 25-30 years. In contrast, wet AMD, already described herein, is generally caused by the growth of new blood vessels in the retina in later years, beginning between the ages of 65 and 75 years. The presence of new blood vessels raises concerns that AAV particles, transgenes, or transgene products will be transported outside the eye in larger quantities than shown in LCA studies. In addition, rAAV. Prior to the findings that treatment of exudative AMD with viral vectors such as sFLT-1 was safe and effective, it was uncertain that the immune system and immune response to foreign substances would change as patients age. It was bringing.

B. Effect of Treatment In some embodiments, a single injection of the pharmaceutical composition of the present disclosure into an affected eye not only demonstrates the benefits of Lucentis® treatment, but also a single injection. May also request.

The pharmaceutical compositions of the present disclosure can stop leakage into existing blood vessels and further inhibit new angiogenesis in the subretinal lumen of patients with CNV secondary to AMD for at least 18 months. Yes, in some embodiments, activity persists for 3-5 years. Leakage and inhibition of new angiogenesis prevent the development of blindness in affected patients.

In some embodiments, the sFLT-1 protein level in the vitreous of the human subject is about 500-5,000 pg / ml, about 600-4,000 pg / ml, about 800-3,000 pg / ml, about 900. ~ 2,000 pg / ml, or about 1,000 ~ 1,800 pg / ml, 500 ~ 700 pg / ml, 700 ~ 1,000 pg / ml, 1,000 ~ 1200 pg / ml, 1200 ~ 1,500 pg / ml, 1 , 800-2000 pg / ml. In some cases, protein levels in the vitreous of human subjects are at least about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, or 2400 pg / ml. In some cases, protein levels in the vitreous of human subjects can be up to about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700. 1800, 1900, 2000, 2100, 2200, 2300, or 2400 pg / ml.

In some cases, protein "level" may refer to any amount or any relative amount of protein. In some cases, the level can be measured as concentration (eg, pM, nM, uM, etc.), molarity (eg, m), mass (eg, pg, ug, ng, etc.), or any suitable measurement. can. In some cases, unitless measurements can indicate a level.

In some cases, the protein level was at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0 to which the pharmaceutical composition was administered. .9, 1.0, 2, 3, 4, 5, 6, 7, 14, 21, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350 , Or can be measured after 365 days. In some cases, protein levels were up to about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, when the pharmaceutical composition was administered. 0.9, 1.0, 2, 3, 4, 5, 6, 7, 14, 21, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, It can be measured after 350, or 365 days. Optionally, protein levels are measured at least 72 hours after administration of the pharmaceutical composition.

Administration of the pharmaceutical compositions of the present disclosure generally does not result in side effects or adverse events.

In some embodiments, no vector is detected in the tear, blood, saliva, or urine sample of a human subject 7, 14, 21, or 30 days after administration of the pharmaceutical composition. In some embodiments, the presence of the viral vector is detected by qPCR or ELISA known in the art.

In some cases, at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 to which the pharmaceutical composition was administered. .0, 2, 3, 4, 5, 6, 7, 14, 21, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, or 365 days later No vector is detected in tear, blood, saliva, or urine samples of human subjects. In some cases, the pharmaceutical composition was administered at a maximum of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2, 3, 4, 5, 6, 7, 14, 21, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, or 365 After days, no vector is detected in tear, blood, saliva, or urine samples in human subjects. In some cases, no vector is detected in tear, blood, saliva, or urine samples of human subjects measured at least 72 hours after administration of the pharmaceutical composition.

In some embodiments, the human subject is clinical as assessed by continuous eye examination for at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. Does not show significant retinal toxicity. In some embodiments, the human subject is clinical as assessed by continuous eye examination for up to about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. Does not show significant retinal toxicity.

In some embodiments, there are no signs of inflammation in the surface, anterior segment, or vitreous in human subjects for at least 2 months. In some cases, there are no signs of inflammation on the surface, anterior segment, or vitreous in human subjects 1 week or 3, 6, 9, or 12 months after administration of the pharmaceutical composition.

In some embodiments, after the dosing step, there are no inflammatory signs, including cytotoxic T cell responses within about 10% of the normal range. In some embodiments, no increase in T cell response as measured by ELISpot is seen. In some embodiments, T cells did not express HLA-DR or Ki67 and were activated, as described in Lai et al., 2011, Gene Therapy, which is incorporated herein by reference in its entirety. Does not generate an effector phenotype. In some embodiments, no vitreous inflammation is observed by biomicroscopy (BE) and indirect ophthalmoscopic examination (IOE) after the dosing step. In some embodiments, minor inflammation of the vitreous that disappears within 10 days after the dosing step is observed by biomicroscopy (BE) and indirect ophthalmoscopic examination (IOE). In some embodiments, the human subject does not require remedies for at least 120 days after administration. In some embodiments, the human subject does not require remedies for at least 30 days, at least 60 days, at least 90 days, at least 120 days, at least 180 days, at least 270 days, or at least 365 days after administration.

As used herein, remedy refers to the administration of a dose of VEGF inhibitor after the initial administration of the pharmaceutical composition described herein. Relief measures are administered to boost the amount of VEGF inhibition in the patient's eye to stop or reverse the signs and symptoms of disease progression. The decision to administer a salvage procedure may be based on certain diagnostic criteria in the clinical study described in Example 12 or on the physician's clinical judgment that signs of active disease are present in the patient.

In some embodiments, there is no evidence of loss of vision, elevated IOP, retinal detachment, or any intraocular or systemic immune response in the human subject for at least 120 days after administration. In some embodiments, loss of vision, increased IOP in the human subject for at least 30 days, at least 60 days, at least 90 days, at least 120 days, at least 180 days, at least 270 days, or at least 365 days after administration. , Retinal detachment, or no evidence of any intraocular or systemic immune response. In some embodiments, loss of vision, IOP, in the human subject for up to 30 days, at least 60 days, at least 90 days, at least 120 days, at least 180 days, at least 270 days, or at least 365 days after administration. No evidence of elevation, retinal detachment, or any intraocular or systemic immune response.

In some embodiments, the patient's best corrected visual acuity (BCVA) improves by 1, 2, 3, 4, 5 lines or more.

In some embodiments, reduction of angiogenesis as assessed by fluorescein angiography (FA) follows the dosing step.

In some cases, the net film thickness can be measured to examine the effect of the treatment. In some cases, the central retinal thickness of a human subject does not increase by more than 50 microns, 100 microns, or 250 microns within 12 months after treatment with the pharmaceutical compositions of the present disclosure. In some cases, the central retinal thickness of a human subject is at least 50 microns, 100 microns, 200 microns, 250 microns, 300 microns, within 3, 6, 9 or 12 months after treatment with the pharmaceutical compositions of the present disclosure. It decreases by 400 microns, 500 microns, and 600 microns. The reduction of the central retinal thickness in a human subject is performed by reducing the central retinal thickness at a certain point in time by 1, 3, 7, or 10 days after administration of the pharmaceutical composition of the present disclosure, or within 1, 3, 7, or 10 days. It can be measured in comparison with the measurement of the retina.

C. Combination Treatment with VEGF Inhibitor In some embodiments, the method further comprises administering to a human subject a pharmaceutically effective amount of VEGF inhibitor.

In some embodiments, the VEGF inhibitor comprises an antibody against VEGF or a functional fragment thereof. In some embodiments, the VEGF inhibitor comprises ranibizumab. In another aspect, the VEGF inhibitor is a soluble receptor, fusion protein, or fragment thereof, such as aflibercept or sFLT01. In some embodiments, the pharmaceutical composition is administered at least 1, 2, 3, 4, 5, 6, 7, or 8 days after administration of the VEGF inhibitor. In some embodiments, the pharmaceutical composition is administered up to 1, 2, 3, 4, 5, 6, 7, or 8 days after administration of the VEGF inhibitor. In some embodiments, the pharmaceutical composition is administered within 90 days after administration of the VEGF inhibitor.

In some embodiments, the patient is treated under a protocol such as the protocol outlined in FIG. After the protein expressed by the recombinant virus is expressed at the appropriate level (or "when expressed"), the patient undergoes criteria-based retreatment:
a. If the disease recurs, retreatment with ranibizumab is permissible b. Control group is expected to be retreated 5-8 times per year c. In the treatment group, equivalent vision is expected while substantially reducing the number of retreatments.

Patients have signs of active CNV:
a. Symptoms based on objective criteria assessed by blinded workers (engineers and ophthalmologists) b. Retreatment criteria are eligible for retreatment if there are signs based on the substantial course of "as needed" (PRN) treatment in previous studies with anti-VEGF agents.

Retreatment is
a. ETDRS (Diabetic Retinopathy Early Treatment Study) character decline from previous visits to human subjects is> 10 (which can be attributed to retinal causes), or with the patient's perception of loss of function, as well as the previous The decrease in letters due to ETDRS from the visit is>5;
b. At the time of OCT, there is any new increase or prolongation of fluid under the sensory retina, retinal pigment epithelium (RPE), or within the retina;
c. It is justified on the basis of signs of active disease, such as the presence of signs of increased leakage from CNV via FA.

In some embodiments, the VEGF inhibitor is administered at least once prior to administration of the pharmaceutical composition, followed by an additional one or two doses at intervals of approximately 30 days to result in protein expression. Prevent the progression of the disease while growing to the appropriate level. In some embodiments, the VEGF inhibitor is administered at least twice prior to administration of the pharmaceutical composition. In some embodiments, the VEGF inhibitor is administered for 6-7 weeks after administration of the pharmaceutical composition.

In some embodiments, the frequency of administration of the VEGF inhibitor is reduced to less than a year or stopped altogether.

In some embodiments, the present disclosure is used after three or more treatments with a VEGF inhibitor. In some embodiments, the present disclosure is used after observing that AMD patients do not show improvement in BCVA after using other VEGF inhibitors.

D. Other Combination Treatment In another preferred embodiment, the treatment of the patient, along with other therapies such as chemotherapy, radiation, surgery, anti-inflammatory agents, selected vitamins, etc., is the pharmaceutical composition provided herein. Includes administration of one or more of them. Other agents can be administered before the pharmaceutical composition, after the pharmaceutical composition, or co-administered with the pharmaceutical composition.

Aspects of the present disclosure can be implemented without presenting any theoretical aspects. Furthermore, the theoretical aspects are also presented, with the understanding that Applicants do not want to be bound by the theory presented.

Although preferred embodiments of the present disclosure have been described and described herein, it will be apparent to those skilled in the art that such embodiments are provided for purposes of illustration only. Those skilled in the art will now come up with numerous variations, changes, and replacements without departing from this disclosure. It should be understood that various alternatives to the aspects of the present disclosure described herein can be incorporated in the practice of the present disclosure. The following claims are intended to define the scope of the present disclosure, the methods and structures within the scope of these claims, and their equivalents covered therein.

The effective dose of nucleic acid will be a function of the particular protein to be expressed, the particular disease targeted, the patient and the patient's clinical condition, body weight, age, gender, and so on.

Those skilled in the art will appreciate that numerous and diverse modifications can be made to achieve essentially similar results without departing from the spirit of the present disclosure. For the objects discussed, all references referred to herein are incorporated by reference in their entirety. The following examples are incorporated for illustrative purposes only and are not intended to limit the scope of this disclosure.

It must be explained that the percentages according to the following examples are all weight percent (wt%) of the contents, even if not specified.

(Example 1)
rAAV. sFlt-1
One example of a recombinant virus is rAAV. It is sFlt-1. rAAV. sFLT-1 encodes the human form of the vector and truncated soluble VEGF receptor 1 (sFLT-1). The vector is a serotype 2 recombinant replication-deficient adeno-associated virus (rAAV) vector.

rAAV. sFlt-1 was manufactured under "Good Manufacturing Practices and Quality Control Standards" (cGMP). At the manufacturing facility, according to protocol requirements, the final product is aliquoted (ie, 1x10) into sterile, low virus-binding microcentrifugal tubes (individually packaged, low residual, sterile flat cap vials). A ¹⁰ or 1 × 10 ¹¹ viral genome (200 □ l) was stored at -80 □ C and awaited release of the final product. Each vial contained sufficient vector for use in a single patient (administering 100 □ l).

Recombinant virus, rAAV. sFlt-1 is a recombinant adeno-associated virus 2 (rAAV2) vector carrying soluble VEGFR receptor 1 (VEGFR1) or sFLT-1 driven by the human cytomegalovirus (CMV) promoter. rAAV. The intact AAV2 genome used as the sFlt-1 vector and backbone is Lai.
Et al., Gene Therapy, 2002, Vol. 9 (No. 12): Prepared as described on pages 804-813. The rAAV2 vector lacks the viral coding sequence, i.e., rep and cap are replaced with expression cassettes for therapeutic genes. rAAV. The active portion of sFlt-1 is sFlt-1. sFLT-1 is a soluble cleaved form of naturally occurring vascular endothelial growth factor receptor 1 (VEGFR1 or Flt-1). sFLT-1 is the only known endogenous specific inhibitor of VEGF. sFLT-1 is produced by alternative splicing and lacks the membranous proximal immunoglobulin-like domain, the transmembrane region, and the intracellular tyrosine kinase domain. Thus, sFLT-1 contains only the first 6th extracellular immunoglobulin-like loop followed by 31 unique amino acid residues. sFLT-1 was first identified in human umbilical vein endothelial cells (HUVEC), but has since been found to occur spontaneously in the placenta of pregnant women and in systemic circulation. rAAV. The sFLT-1 used in the production of sFlt-1 is an open reading frame encoding only the first 6th extracellular immunoglobulin-like domain of the full-length transmembrane FLT-1 and is alternatively spliced. It contains an open reading frame followed by a unique 31 amino acid length C-terminal extension representing the secretory soluble FLT-1 isoforms already described.

Although ITRs have been shown to possess minor promoter activity, for maximum levels of transgene expression, cassettes are generally promoter / enhancer combinations, short intron sequences, therapeutic gene cDNA, and polyadenylation. Includes a transgene signal. rAAV. In sFlt-1, enhancers / promoters and chimeric introns of human CMV major pre-early genes were placed upstream of the sFLT-1 cDNA. The monkeyvirus 40 polyadenylation (SV40 polyA) signal was placed downstream of the sFLT-1 cDNA.

The in vitro binding of sFLT-1 to VEGF is widely supported. The ability of sFLT-1 to inhibit VEGF-driven angioplasty has attracted considerable interest in its potential clinical application, but is described in Example 12 by rAAV. Prior to clinical studies on sFlt-1, there was no evidence of efficacy or aptitude in humans. The angiogenesis-suppressing activity of sFLT-1 is due to two mechanisms: i) isolation of VEGF to which it binds with high affinity, and ii) transmembrane isoforms of the VEGF receptors Flt-1 and KDR / Flk-1. Can result from inhibition of VEGF by the formation of an inactive heterodimer.

rAAV. Nucleotide sequence and schematic diagram of the plasmid vector used to generate sFlt-1 rAAV. sFlt-1 is a pSSV. CI. It was generated via triple transfection with DNA derived from the hsFlt-1 plasmid vector and helper plasmid. rAAV. sFlt-1 was purified using a series of nuclear isolation, density gradient centrifugation, and heparin sulfate affinity column chromatography. A schematic representation of the sFLT-1 plasmid vector is shown in FIG.

Prescription rAAV. sFlt-1 has two concentrations: 1 x 1010 vector genome per 100 uL (low dose) and 1 x 1011 vector genome per 100 uL (high dose) sterile phosphate buffered saline in two concentrations: sterile low virus-binding microcentrifuge tube. Formulated in water (pH 7). The formulation is a preservative-free formulation for single use by subretinal injection with a single thawing.

rAAV (bv). sFlt-1
A second example of a recombinant virus is rAAV (bv). It is sFlt-1. rAAV (bv). sFlt-1 is produced using the baculovirus expression system (BEVS) in Sf9 insect cells and is a recombinant replication of serotype 2 encoding the human form of truncated soluble VEGF receptor 1 (sFLT-1). It is a defective adeno-associated viral (rAAV) vector. Vectors were produced using infection with two recombinant baculoviruses, Bac-inRep-inCap and Bac-sFlt-1, of Sf9 cells. Bac-sFlt-1 has been described by Maniatis et al., Using standard molecular biology methods, further described below, for Frag001m-BHKan and the plasmid skeleton V109-pFB-AAV-CMV. -Derived from Bakumid DNA generated from transformation of electrocompetent cells with AVA01-pFB-CMV-sFlt, a 8.7 kb plasmid cloned from SV40pA-Kan. Frag001m was chemically synthesized by Blue Heron Biotech, LLC (Bothell, WA) and cloned into the BHKan skeleton, the following contiguous nucleic acid elements: ITR (AAV serotype 2), CMV-IE promoter, chimeric intron, 5'. It was formed from an untranslated region (UTR), an sFlt-1 coding sequence, an SV40 polyA region, and an ITR (AAV serotype 2). The plasmid V109-pFB-AAV-CMV-SV40pA-Kan was described by Virovek, Inc. Obtained from (Hayward, CA). The plasmid contains a kanamycin antibiotic resistance gene, a ColE1 origin, and an SV40 polyA region sandwiched between a CMV-IE promoter, introns, multiple cloning sequences, and an inverted terminal sequence (ITR) derived from AAV serotype 2. Contains a recombinant AAV cassette to be used. This rAAV cassette was sandwiched between a gentamicin resistance gene and a Tn7L junction. AVA0l-pFB-CMV-sFlt did not contain the T7 RNA polymerase promoter or other prokaryotic regulatory sequences. Bac-inRep-inCap is a recombinant baculovirus containing an expression cassette for the rep gene and cap gene derived from AAV serotype 2.

RAAV (bv) in baculovirus. Production of sFlt-1 rAAV (bv). sFlt-1 is described in US Patent Application No. 12 / 297,958, and more specifically, it was produced in baculovirus according to the following method. Sf9 cells are grown at 28 ° C. in SF900 II SFM medium containing 100 units of penicillin per ml and 100 μg / ml streptomycin to about 107 cells per ml and 5 per ml before infection. Diluted into x106 cells. Each of Bac-inRep-inCap and Bac-sFlt-1 was added to m. o. i. Was used to infect cells at 28 ° C. for 3 days to produce AAV-type 2 vectors. After infection for 3 days, cell pellet was collected by centrifugation at 2,000 rpm for 15 minutes in a tabletop centrifuge. Cell pellets are lysed in lysis buffer as described by Urabe et al., Hum Gene Ther., Vol. 1, Volume 13 (No. 16), pp. 1935-43 (2002) and intracellular nucleic acids (DNA). And RNA) were digested with benzonase (Sigma, St. Louis, Mo). Cytolysis is cleaned by centrifugation in an Avanti J-25 centrifuge (Beckman, Fullerton, Calif) at 8,000 rpm for 30 minutes, then 5 ml of 1.55 g of CsCl solution per cc, and 1 per cc. It was loaded into a SW28 centrifuge tube containing 10 ml of .32 g of CsCl solution. After centrifugation at 15 ° C. and 28,000 rpm for about 16 hours, the rAAV-containing fraction was recovered by puncturing the centrifuge tube using a syringe needle and subjected to a second round of CsCl ultracentrifugation. The rAAV-containing fraction was recovered again by puncturing the centrifuge tube using a syringe needle and dialyzed in PBS buffer to remove salts and cleaning agents. Vector titers were determined by a quantitative real-time PCR assay according to the protocol of the manufacturer (Applied Biosystems, Foster City, California).

(Example 2)
In vitro inhibition of VEGF-induced endothelial cell proliferation VEGF-induced induction of human umbilical vascular endothelial cell (HUVEC) proliferation was assessed and VEGF-induced HUVEC proliferation was inhibited by rAAV-mediated sFLT-1. A study was conducted to determine if. The presence of sFLT-1 in transduced cells was first confirmed by Western blot analysis on the conditioned medium (FIG. 2, panel a). rAAV. 293 cells transduced with sFlt-1 and rAAV. A conditioned medium derived from gfp transduced 293 cells was added to VEGF-treated HUVEC with increasing dilution. Only control starvation medium (normal HUVEC growth medium without bovine endothelial growth factor) was also included. Heparin was added to each well at 100 μg / mL. VEGF-induced relative growth of VEGF and HUVECS treated with different conditioned media was 25 μL of 3- (4,5-dimethylthiazole-2-yl) -2,5-diphenyltetrazolium bromide (3- (4). , 5-dimethythiazol-2-yl) -2,5-diphenyltetrozolium bromide) (MTT, 5 mg / mL, Sigma) was assayed by addition to each well at 37 ° C. for 4 hours. rAAV. It was confirmed that sFLT-1, encoded and secreted by the rAAV vector in 40 μL of conditioned medium derived from 293 cells transduced with sFlt-1, inhibits VEGF-induced HUVECS proliferation by 32%. .. By doubling the volume of conditioned medium, cell growth equivalents resulted in complete inhibition to basal levels similar to cultures in starvation medium (Fig. 2, panel b).

rAAV. In vitro evaluation of the efficacy of the sFt-1 vector Recombinant human sFlt- by quantifying the expression of human sFlt-1 protein in transduced human fetal kidney 293 (HEK293) cells via ELISA. A study was conducted to evaluate the efficacy of the AAV vector encoding one gene. Human fetal-derived kidney 293 cells are obtained from American Type Culture Collection (Rockville, MD, USA) and are accompanied by 10% fetal bovine serum (FBS: fetal bovine serum, GIBCO) and 1-fold concentration of penicillin-streptomycin-glutamine. The cells were cultured in a modified eagle medium (DMEM: Dulbecco's Modified Eagle Medium; Gibco, Grand Island, NY, USA). All cultures were maintained at 37 ° C. and 5% CO2 in a humidified atmosphere.

HEK293 cells were seeded with 8x10 ⁴ or 1.5x10 ⁵ cells per 24 wells and at 60-90% confluency 1x10 in DMEM medium supplemented with 2% FBS. Recombinant AAV vectors with multiplicity of infection (MOI) in the range of ³ to 1 × ¹⁰⁶ were transduced. After 72 hours, the conditioned medium after transduction was collected. An aliquot of conditioned medium was prepared for ELISA using reagents according to standard instructions by the R & D Systems SVR100B Quantikine ELISA Human sVEGF R1 / sFlt-1 kit (R & D Systems, Minneapolis, MN). Samples, reference materials, and controls are prepared with R & D SYSTEMS ELISA reagents according to the ELISA kit instructions, then transferred to an ELISA plate pre-coated with antibody against sVEGF R1 / sFlt-1 and transferred to a horizontal orbital microplate. Incubated on a shaker at room temperature for 2 hours. After incubation, anti-sVEGF R1 conjugate (2 hours), substrate solution (30 minutes) and stop solution are sequentially added to each well according to standard ELISA assay procedures, with suction and wash steps between them. Applied to. The optical density (OD) of the sample, reference material, and control was measured by an ELISA plate reader within 30 minutes of stopping the substrate reaction. Concentrations of sFlt-1 in pg / mL units were calculated using SoftmaxPro software using OD measurements with an ELISA plate reader.

rAAV. sFlt-1 and rAAV (bv). The results of the study on sFlt-1 are shown in FIGS. 25A and 25B. rAAV. sFlt-1 and rAAV (bv). 72 hours after transduction of sFlt-1, the concentration of sFlt-1 protein expressed by HEK293 cells was in the range of 100-1,000 pg / mL with a MOI of ^1x104 and 100 with a MOI of ^1x105 . The range was from 10,000 pg / mL, and the MOI of 1 × ¹⁰⁶ was from 1,000 to 10,000 pg / mL.

(Example 3)
RAAV in mice. sFlt-1 study A transgenic mouse (trVEGF029) with slow but stable retinal angiogenesis induced by transgenic expression of human VEGF from photoreceptor cells was used as a model for retinal angiogenesis. did. Two separate studies were performed on these mice.

In the first mouse study, 13 transgenic mice were subjected to rAAV in one eye. Changes in ocular angiogenesis were evaluated before and after administration of the sFlt-1 vector (1 × 10 ¹¹ vector particles) and contralateral intraocular control vector. At 1, 3, and 8 months after injection, the eye was evaluated for neovascular changes using fluorescein angiography. The degree, intensity, and stage of angiogenesis were graded through three observers who were blinded to the procedure performed in the subject eye (0-4). A statistically significant overall reduction in neovascular grading from a median grade of "3" (before injection) to a median grade of "1" one month after injection (P = 0. 012) was seen. This reduction is due to rAAV. It was also maintained 3 months (median = 1; P = 0.001) and 8 months (median = 1; P = 0.001) after injection with sFlt-1. rAAV. Injection of the sFlt-1 vector was neovascularized in 85% of the treated eyes (11 of 13) compared to 8% (1 of 13) of the eyes treated with the control vector. It resulted in long-term (at least 8 months) regression of vascular vessels.

Histological examination of the eye in this preclinical study revealed that the disruption or loss of photoreceptors was found in rAAV. It was revealed that sFlt-1 was significantly more prominent than (P <0.01) compared with the injected eye. Expression of sFLT-1 was also confirmed by reverse transcriptase polymerase chain reaction analysis on tissue samples; sFLT-1 mRNA was detected in all four test eyes. When the control (rAAV.gfp) vector was compared with the injected eye, rAAV. In eyes injected with sFlt-1, rAAV. No sFlt-1 vector-specific adverse effects were observed.

In a second study conducted on trVEGF02 transgenic mice, the purpose of the study was rAAV. Subretinal injections of sFlt-1 are arbitrary cell-mediated immune responses that can have a negative effect on long-term expression of sFLT-1 or cause immune response-related damage to the retina. It was to determine if there was an immune response that resulted. In this study, rAAV. Subretinal injection of sFlt-1 (8 x 109 viral particles) or phosphate buffered saline (PBS) was given. Then rAAV. Retinas of 30 mice from the sFlt-1 or control treatment group were subjected to the presence of immune cells (white blood cells, macrophages, and B and T lymphocytes) 1 week and 1 month after injection. evaluated. A flow cytometric study of the posterior optic cup showed that 1 week after injection, CD45 + leukocytes (6.6-fold increase compared to the control; P <0.05) and CD11b + macrophages (5 compared to the control). A 0.7-fold increase; a statistically significant increase in P <0.036) was shown. However, at this point, no differences were found in CD19 +, CD8 +, and CD4 + (B lymphocytes and T lymphocytes). One month after injection, rAAV. No difference in cell number between leukocyte subsets (ie, CD45 + cells, CD19 + cells, CD11b + cells, CD8 + cells, or CD4 + cells) was observed in the eyes of mice treated with sFlt-1 or PBS controls. It is suggested that the infiltration of leukocytes and macrophages was transient. Flow cytometric assessments of spleen lymphocyte subsets from these mice at 1 week and 1 month showed no significant difference in lymphocyte count. This finding suggests that a transient, localized immune response was shown within the retina, but no systemic immune response was observed.

In this second study, rAAV. Histological studies of eyes derived from 5 of sFlt-1 or PBS-injected mice showed observable immune response-related disruption or sequelae in the retina in any of the test mice. It was never revealed.

RAAV. In this transgenic mouse model (trVEGF02) for retinal neovascularization. To assess the effect of sFlt-1 on the level of angiogenesis, rAAV. The retinas of mice injected with sFlt-1 or PBS were also independently graded 2 months after treatment via two different evaluators. Generally, rAAV. Eyes injected with sFlt-1 showed a significant reduction in mean angiogenesis grade (before injection: 1.46 ± 0.58; after injection: 0.81 ± 0.57; P <0.00015). In contrast, eyes injected with PBS controls showed a significant increase in mean angiogenesis grade (before injection: 1.08 ± 0.56; after injection: 1.63 ± 0.96; P. <0.018).

Findings from this second mouse study are from rAAV. It clearly points to that treatment with sFlt-1 was thought to reverse the progressive increase in angiogenesis observed in this mouse model for retinal angiogenesis and AMD. In addition, rAAV. Only a limited localized inflammatory response was observed one week after subretinal injection with sFlt-1, which disappeared one month later. This immune response is based on rAAV in the retina. It was considered not to impair the long-term therapeutic efficacy of sFlt-1.

In the transgenic mouse model described in Example 3, the pharmaceutical compositions disclosed herein can be used for the treatment and / or prevention of other retinal vascular diseases associated with VEGF inhibition. To support. These include diabetic luteal edema, diabetic retinal ischemia, diabetic retinal edema, proliferative diabetic retinopathy, retinal vein occlusion, central retinal vein occlusion, and retinal vein branch occlusion. Clinical studies have shown that some VEGF inhibitors, such as Lucentis, effectively treat certain of these diseases, including diabetic macular edema and retinal vein occlusion. The rAAV. Supported in these mouse models. The effectiveness of sFlt-1 is described in rAAV. sFlt-1 also indicates that it is also effective in treating these VEGF-mediated diseases.

(Example 4)
RAAV in rats. sFlt-1 Study Rat rAAV. In the sFlt-1 study, two models for ocular neovascularization were used: a cautery-induced corneal neovascularization model and a laser photocoagulation-induced choroidal neovascularization (CNV) model. In the corneal neovascularization model, rAAV. The sFlt-1 vector (8 × 10 ⁸ virus particles) was injected, the control vector (rAAV.gfp) was injected into the contralateral eye, and then the cornea was cauterized. The eyes were then examined for angiogenesis 4 days after cauterization using slit lamp photography. rAAV. Significantly lower rates of corneal angioplasty were found in sFlt-1 treated eyes compared to control treated eyes (27% and 63%, respectively; P = 0.009). .. Histological examination of the eye was cauterized and rAAV. It was shown that corneal blood vessels were not observed in most of the eyes treated with sFlt-1. Histological examination also showed that in eyes injected with the control vector, cell infiltration into the corneal stromal layer was rAAV. It was also revealed that it was more prominent compared to the eyes treated with sFlt-1. In addition, in eyes treated with the control vector, overt edema and swelling of the corneal stroma were also seen, whereas rAAV. There was no evidence of significant tissue swelling in eyes treated with sFlt-1.

In the laser photocoagulation-induced CNV model, rAAV. The sFlt-1 vector (8 x 108 virus particles) was subretinal injection and the control vector (rAAV.gfp) was subretinal injection into the contralateral eye. Laser photocoagulation was used to induce CNV one month after injection. Five weeks after laser photocoagulation, the eye was examined for CNV using fluorescein fundus angiography. rAAV. In sFlt-1 treated eyes, only 41% of the laser-treated band showed leakage compared to 60% in control vector-treated eyes (P = 0. 002). 16 weeks after laser-guided CNV, rAAV. The angiogenesis exhibited by sFlt-1 treated eyes was still significantly lower than that of control eyes. Histological examination of the eye in the zone directly adjacent to the injection site revealed normality of the retinal pigment epithelium as well as normality of the outer nuclear layer and outer nuclear layer. These findings suggested that there was no apparent toxicity associated with sFLT-1 expression. The electroretinogram is also available in rAAV. It also pointed to the normal functioning of the eye treated with sFlt-1. rAAV. The majority of laser lesions treated with the sFlt-1 vector and control vector developed subretinal cell membranes. However, rAAV. Proliferative endothelial cells in lesions in the eye treated with sFlt-1 were generally few, reflecting the findings of fluorescein angiography and rAAV. It is indicated that in eyes treated with sFlt-1, the rate of angiogenesis (ie, angiogenesis) is reduced.

In a rat model for diabetes, rAAV. sFlt-1 and rAAV (bv). Study with sFlt-1 rAAV. For the treatment of diabetic retinopathy (DR) and diabetic macular edema (DME). sFlt-1 and rAAV (bv). To further evaluate the safety and efficacy of sFlt-1, experiments in a rat model for diabetes will be performed.

Visual loss in diabetic patients is mediated by inflammation, resulting in macular edema as a result of the final fracture of the blood-retinal barrier and subsequent vascular leakage. The streptozotocin (STZ) diabetic rat model presents a well-characterized pattern of vascular leakage in which VEGF is strongly upregulated as early as 2 weeks (Miyamoto, K. et al.). , Proc Natl Acad Sci USA, Volume 96, 10836 ~
Page 10841 (1999)). Current approaches to the treatment of animal models for DR support only a partial elucidation of vascular leakage.

Diabetes is induced by intraperitoneal injection of streptozotocin in Brown Norwegian rats (50 mg / kg). Diabetes is confirmed and monitored by blood glucose readings. Rats with blood glucose> 350 mg / dl are considered diabetic. Eight days after the onset of diabetes, Chalberg, TW et al., Invest Ophthalmol Vis Sci
, 46, pp. 2140-2146 (2005), using established techniques, 1x10 ¹⁰ or 5x10 ¹⁰ vg rAAV. sFlt-1 or rAAV (bv). Rats are treated with 5 μL subretinal injections containing sFlt-1 (n = 12 eyes per group). AAV2. GFP (5 x 10 ¹⁰ vg) and vehicle are injected as controls. Non-diabetic and non-diabetic non-treated groups are also used as controls.

rAAV (bv) expressing sFLT-1. The effect of sFlt-1 on vascular leakage is measured after 60 days. Retinal vascular leakage is measured by the FITC-albumin leakage method after injection using FITC-conjugated albumin as a tracer. The FITC-albumin leakage method is a method commonly used to directly measure the leakage of FITC-albumin leaking from the circulation to the retina and measure the vascular permeability of the retina. Retinal vascular leakage in the injected eye is compared to non-diabetic controls, untreated diabetic eyes, and vehicle-treated diabetic eyes, as well as wild-type AAV serotypes 2 and 8.

Results: rAAV (bv) expressing sFLT-1. sFlt-1 reduces vascular leakage in STZ-diabetic rats, whereas AAV2. Injections of GFP and other controls do not reduce vascular leakage.

(Example 5)
RAAV in monkeys. sFlt-1 study rAAV. The efficacy and safety of sFlt-1 was also investigated by inducing CNV using laser photocoagulation in a non-human primate (macaque monkey) model of AMD. One challenge in developing treatments for AMD in humans is that non-human primates do not develop AMD. The CNV induced by laser photocoagulation simulates the symptoms of some AMD, but the underlying biological process is not the progression of chronic disease, but the healing of acute injury, and therefore AMD or others. It may not be possible to predict the efficacy of any particular treatment for CNV in humans with CNV-based disease. Nevertheless, the human eye is anatomically more similar to the non-human primate eye than the non-primate eye, thus assessing the toxicity of potential treatments or other interventions and the histological response to them. In order to do so, non-human primates are frequently studied.

In the first study of non-human primates, rAAV. sFlt-1 (4 × 10 ¹² viral particles) was subretinal injection and a control vector (rAAV.gfp) was subretinal injection into the contralateral eye. The eye health of monkeys was assessed regularly after subretinal injection. There were no apparent complications directly associated with subretinal injection of the control vector or rAAVsFlt-1 vector. Transient conjunctival irritation and vitreous haze were detected the week after injection, but disappeared by the second week. In the right eye of one of the monkeys, subretinal injection did not respond and therefore the animal was not subject to further assessment.

Subretinal injection of 40-100 uL of rAAV suspension lifted the retina and created a bleb containing the vector between the pigment epithelium and the photoreceptor layer in a localized manner. This bleb was self-corrected within 24-48 hours. No other retinal abnormalities were observed during the follow-up period (3-17 months post-injection), except for minor disturbances to the retinal pigment epithelium at the needle penetration point. No other abnormalities or adverse events were observed, and no surgery-related retinal detachment was observed at any time.

To assess the long-term therapeutic efficacy of rAAVsFlt-1, four injected monkeys were then subjected to intense laser photocoagulation 16 months after treatment with the vector. In each eye, a laser was used to induce eight lesions, and then the eyes were monitored for CNV 2 and 4 weeks after laser treatment. After laser photocoagulation, only 3 out of 4 monkeys could be analyzed and therefore efficacy data were collected for 3 animals. Leakage / angiogenesis was minimal, as none of the three monkey eyes treated with rAAVsFlt-1 developed CNV-related lesions and only weak fluorescein staining was observed. Shown. All contralateral eyes treated with the control vector developed CNV-related lesions.

RAAV injected into the subretinal space. Eight monkeys were used in a follow-up study aimed at assessing the safety and toxicity of sFlt-1. Five of them had rAAV. sFlt-1 was injected and two animals had rAAV. Gfp was injected, one was injected with recombinant Flt-1 protein in both eyes, and one was kept as an uninjected control. Monkeys were examined by color fundus photography, fluorescein fundus angiography, and electroretinography before and after injection. Blood was routinely collected for assaying sFLT-1 levels and peripheral blood lymphocytes were isolated for flow cytometry and evaluated for immune cell subset response. At sacrifice (3, 9, and 12 months after injection), i) use a real-time polymerase chain reaction on the extracted genomic DNA, rAAV. In vivo distribution study on sFlt-1 vector; iii) Quantification of hsFlt-1 protein and AAV2 capsid protein levels by ELISA; and iii) Tissues were harvested for histology of the eye.

Color fundus photography, fluorescein fundus angiography, and electroretinography did not detect any adverse effects on the eye after injection. Plasma sFLT-1 levels in either male or female monkeys tested were also determined by rAAV. It did not show an increase in levels associated with sFlt-1 injection. Except for the optic nerve sample, rAAV.A. No sFlt-1 sequence was detected. Paraffin-embedded sections of the eye stained with hematoxylin and eosin exhibited normal appearance.

While the anatomy of non-human primates is more similar to human anatomy than the anatomy of small mammals such as mice, it makes studies in non-human primates interesting but does not predict clinical outcomes in humans. Also exists. As mentioned above, the study in this example uses a laser injury model in which the animal has healthy retinal tissue in the absence of laser injury. The retinal tissue did not degenerate within the diseased retinal tissue over time, nor was there a disease-specific virulence factor present. Non-human primates are more likely to differ from humans in unpredictable ways in terms of biodistribution, pharmacokinetics, and dose dependence, antibody titers, immune and inflammatory responses. Further differences include ILM (inner limiting membrane) and the volume of the vitreous cavity, which is about four times that of the non-human primates used in this study in humans. The human internal limiting membrane, a barrier that acts to limit transport between the retina and the vitreous, is a more fundamental and effective barrier than monkey ILM.

(Example 6)
Safety Studies In these studies, the sFLT-1 protein was measured in animal vitreous and plasma using an enzyme immunoassay assay kit for detecting the sFLT-1 protein. The sFLT-1 protein level is rAAV. sFlt-1 was upregulated intravitreal and intraocularly in injected animals. FIG. 3A shows rAAV. Monkey eye (left eye) injected with sFlt-1 and rAAV. The levels of sFLT-1 protein in the vitreous of the control monkey eye injected with gfp as well as the non-injected monkey eye (right eye) are shown. The sFLT-1 protein level was found in 5 cases of rAAV. It was significantly higher in 4 of the eyes injected with sFlt-1. Table 5.3.1 shows intraocular and rAAV. Of non-injected mice. The sFLT-1 protein levels in the eyes of mice injected with sFlt-1 and in the eyes of enucleated mice 1 month after injection are shown. Overexpression of sFLT-1 in the mouse eye and monkey vitreous had no adverse effect on their overall health. In monkeys, overexpression of sFLT-1 in the vitreous had no effect on their retinal function and had no apparent clinical or histologically toxic effects on the eye. rAAV. Significantly higher sFLT-1 protein levels in sFlt-1 injected eyes suggest long-term rAAV-mediated expression of hsFLT-1 and detection of viral mRNA sequences in monkey retina 17 months after injection. And support previous data on the presence of rAAV-mediated gfp expression.

Plasma hsFLT-1 levels in monkeys showed no tendency at different sampling times (Fig. 3B). This is rAAV. It is suggested that injection of sFlt-1 had no apparent effect on plasma hsFLT-1 levels. Fluctuations in levels had no effect on the health of any monkey.

表２：免疫原性研究において使用される動物株、注射経路、持続期間、およびｒＡＡＶ．ｓＦｌｔ－１の用量の概要

Table 2: Animal strains, injection routes, durations, and rAAV. Used in immunogenicity studies. Summary of sFlt-1 dose

(Example 7)
Immunogenicity studies on mice Using flow cytometry, rAAV. Intraocular mice at 1, 2, and 4 weeks after injection. The cell-mediated immune response to sFlt-1 treatment was evaluated. Integrin leukocytes were identified based on the expression of CD45 and classified as monocytes / granulocytes, B cells, CD4 ⁺ T cells, and CD8 ⁺ T cells based on their respective expression of CD11b, CD19, CD4, and CD8. The posterior optic cup was collected from 5 mice in each group (mice injected with rAAV.sFLT-1, control mice injected with PBS, control mice not injected) and pooled for analysis. As shown in FIG. 4A, there is no difference in the number of cells recovered from each group of mice over the course of this experiment. However, a significant increase in the number of CD45 ⁺ cells was seen 1 and 2 weeks after injection, which disappeared by 4 weeks (Fig. 4B). Almost all of the increase seen after 1 week can be attributed to the increase in CD11b ⁺ cells, as there is no difference in the number of CD4 ⁺ cells, CD8 ⁺ cells, and CD19 ⁺ cells (FIGS. 4D-F). Would be (Fig. 4C). Two weeks later, AAV. There was no longer a significant difference in the number of CD11b ⁺ present in the eyes of mice injected with sFlt-1, but instead a significant increase in the number of CD4 ⁺ T cells and CD8 ⁺ T cells, as well as B cells. There was a possible trend towards an increase in. The number of CD4 ⁺ cells and CD8 ⁺ cells decreased sharply after 4 weeks, but maintained a marked increase compared to mice injected with PBS and mice not injected. In contrast, no changes were observed in the numbers of CD11b ⁺ cells, CD4 ⁺ cells, CD8 ⁺ cells, and CD19 ⁺ cells in the spleen during the course of this experiment (FIGS. 5A-E).

The function of T cells infiltrating the retina was closely investigated by stimulating them with PMA / ionomycin or anti-CD3 and measuring intracellular IFN-gamma production via flow cytometry. FIG. 6 shows rAAV. It shows that after injection of sFlt-1, a small portion of both CD4 ⁺ T cells and CD8 ⁺ T cells were primed to produce IFN-gamma as compared to the non-injected control. The frequency of IFN-gamma-producing cells did not change significantly over the course of the experiment, despite the apparent increase in CD8 ⁺ T cells on day 3 (Fig. 6B). Restimulation of T cells with a class I MHC-restricted epitope of the rAAV capsid protein measured low levels of IFN-gamma and, in the absence of any stimulus (data not shown), some IFN-gamma. was detected. In summary, these results are from rAAV. A small portion of T cells infiltrating the eye of mice injected with sFlt-1 was newly activated to produce IFN-gamma, which occurred during the course of this experiment during the T cell subset. Indicates that it did not change.

The data presented for these experiments on the infiltration of immune cells into the eyes of mice injected with AAV-sFLT-1 clearly show two waves of cell infiltration. Waves by CD4 ⁺ T cells and CD8 ⁺ T cells were observed 2 weeks after the initial wave by CD11b ⁺ cells after 1 week. Importantly, none of the waves of infiltration were anymore after 4 weeks, suggesting that the infiltration had disappeared on its own. Importantly, production of the sFLT-1 protein was not attenuated at this point, but continued to be expressed at extremely high levels.

Data on IFN-gamma production indicate that approximately 5% of CD4 ⁺ T cells and CD8 ⁺ T cells were newly primed, and this frequency did not change over the course of the experiment. rice field. Hu et al. First described the disruption of the blood-retinal barrier by activated T cells, and the data presented herein are consistent with infiltration of activated CD4 ⁺ cells and activated CD8 ⁺ cells. However, there is evidence of an increase in the number of capsid-specific T cells within this population, as only restimulation with specific peptides revealed low levels of IFN-gamma production that did not change over the course of the experiment. I couldn't. In summary, these observations are based on rAAV. The initial irritation caused by the injection of sFlt-1 produced a short-lived wave of immune cell infiltration, which disappeared by itself within 4 weeks and could be harmful to eye tissue, of sFLT-1. It suggests that it did not elicit an ongoing immune response that could affect expression.

(Example 8)
Immunogenicity studies on monkeys Using a panel of antibodies to identify changes in the immune cell subset population, rAAV. sFlt-1 or rAAV. The immune response after subretinal injection of gfp was analyzed. The results are summarized in FIG. Very small changes in the immune cell subset population were observed in some monkeys, but they were not statistically significant. Despite this result, a more thorough study of circulating cells was subsequently performed. Specifically, we evaluated the possibility that the vector (rAAV) or the inserted gene product (sFLT-1) could trigger immune activation. We searched for B cell and T cell activation (FIGS. 5 and 6). Other lymphocyte populations were also analyzed to determine if treatment would cause observable differences that could be an indicator of direct activation or response to activation. The analysis was performed using classical marker combinations (Pitcher, 2002, p. 129) as well as the novel phenotypic analysis described in a recently published report (Miller, 2008, p. 126). rice field. Using a small subset of phenotypic markers (HLA-DR, Ki-67, and Bcl-2), we used CD4 + T cells or CD8 + T cells and / or B after administration of rAAV-sFLT-1. We investigated whether the cells showed signs of activation. In a study published by Miller et al., Activated T cells were characterized by the expression of the differentiation marker HLA-DR and the cell cycle-related nuclear antigen Ki-67, which is used as a marker for proliferation. Presents the phenotype of the activated effector. Dormant T cells do not express Ki-67, whereas circulating T cells or newly divided T cells upregulate Ki-67 expression. Levels of Ki-67 expression are usually detected as part of the circulation of homeostatic cells.

(Example 9)
rAAV. In vivo distribution of sFlt-1 Genomic DNA was extracted from tissues (optic nerve, lymph node, brain, heart, lung, spleen, liver, cornea) recovered immediately after euthanasia of monkeys. A real-time polymerase chain reaction was performed on genomic DNA and injected into the subretinal space. It was determined whether the sFlt-1 vector construct was present at another site. A known amount of control plasmid, pssv. C1. Based on the comparison of Ct values in sflt-1 DNA, rAAV. The sFlt-1 construct was found in the optic nerve of one of the injected eyes with a low gene copy count, but not in any of the other tissue samples. This is rAAV. Injected into the subretinal space. It suggests that sFlt-1 is mainly retained in the eye. Table 4 shows monkeys that were not injected, or rAAV. Monkeys injected with sFlt-1, and rAAV. It is an outline of the Ct value by the genomic DNA extracted from the monkey injected with gfp.

(Example 10)
Efficacy Study on Mouse Model of Retinal Neovascularization Transgenic mice generated via upregulation of VEGF in photoreceptor cells were used in the study. In one eye, rAAV. sFlt-1 was injected and the contralateral eye was injected with rAAV. gfp was injected. The degree, intensity, and stage of angiogenesis were graded based on an agreed scale through a blinded observer. The results were a statistically significant overall reduction in angiogenesis grade from a median of 3 (severe) to a median of 1 (mild) 1 month after injection (1 month after injection). It was shown that P = 0.012) was observed. This low level of fluorescein leakage is associated with rAAV. Since it was maintained 3 months (median = 1; P = 0.001) and 8 months (median = 1; P = 0.001) after injection of sFlt-1, rAAV. A long-lasting therapeutic effect of sFlt-1 is suggested.

(Example 11)
Efficacy study on a monkey model of laser-guided choroidal neovascularization rAAV. sFlt-1 was injected and rAAV. gfp was injected. In the right eye of one of the monkeys, subretinal injection did not respond and therefore the animal was not subject to further assessment. Subretinal injection of 40-100 μl of rAAV suspension lifted the retina and created a bleb containing the vector between the pigment epithelium and the photoreceptor layer in a localized manner. This bleb was self-corrected within 24-48 hours. No other retinal abnormalities were observed during the follow-up period (3-17 months post-injection), except for minor disturbances to the retinal pigment epithelium at the needle penetration point. No other abnormalities or adverse events were observed, and no surgery-related retinal detachment was observed at any time.

サルの網膜機能は、網膜電図写真により評価した。注射された眼および注射されなかった反対側の眼の応答に由来する振幅および陰的時間を計算し、注射前と、注射後の異なる時点とで比較した。結果は、ｒＡＡＶ．ｓＦｌｔ－１、組換えｓＦＬＴ－１タンパク質、またはｒＡＡＶ．ｇｆｐの注射が、サルの網膜機能に対していかなる有害作用も及ぼさないことを示した。 To assess the long-term therapeutic efficacy of rAAVsFlt-1, four injected monkeys were then subjected to intense laser photocoagulation 16 months after treatment with the vector. In each eye, a laser was used to induce eight lesions, and then the eyes were monitored for choroidal angiogenesis 2 and 4 weeks after laser treatment. After laser photocoagulation, only 3 out of 4 monkeys could be analyzed and therefore efficacy data were collected for 3 animals. Leakage / angiogenesis was minimal, as none of the three monkey eyes treated with rAAVsFlt-1 developed choroidal angiogenesis-related lesions and only weak fluorescein staining was observed. Is pointed to. All contralateral eyes treated with the control vector developed choroidal angiogenesis-related lesions. Efficacy data for 3 animals are shown in Table 5.

Retinal function in monkeys was evaluated by electroretinography. Amplitude and implicit time derived from the response of the injected and non-injected contralateral eyes were calculated and compared before and at different time points after injection. The result is rAAV. sFlt-1, recombinant sFLT-1 protein, or rAAV. Injection of gfp has been shown to have no adverse effects on monkey retinal function.

(Example 12)
Standard care in the treatment of wet AMD involves frequent intraocular injections of recombinant anti-VEGF protein every 4-8 weeks. The rAAV construct was developed for soluble Fms-related tyrosine kinase 1 (sFlt-1), a potent (Kd≈10 pM), naturally occurring anti-VEGF protein for treating wet AMD. rAAV. sFlt-1 was produced in the UNC Vector Core Human Application Laboratory according to FDA and ICH guidelines. rAAV. A controlled study of 8 patients was conducted on the safety and efficacy of sFlt-1. The eligibility criteria, inclusion criteria, and exclusion criteria for the study were as follows:

Eligibility Criteria Research Eligible Age: 65+ Gender Eligible for Research: Male and Female Acceptance of Healthy Volunteers: None

Incorporation criteria:
・ Age is 65 years or older;
• Has subfoveal CNV secondary to AMD and has the highest corrected visual acuity of 20/80 to 20/400 or higher in the other eye;
Fluorescein angiography of the subject eye must show evidence of leaking subfoveal choroidal neovascular lesions;
Must be a candidate for intravitreal injection of anti-VEGF;
The overall size of the lesion should not exceed 12 in disk area according to the Macular Photocoagulation Study;
• No previous photomechanical or laser treatment of the retina;
・ Being able to provide informed consent;
• Participants should present clinically acceptable laboratory parameters and ECG at the time of enrollment; and • Be able to comply with protocol requirements, including follow-up visits.

Exclusion criteria:
・ Liver enzyme> Twice the upper limit of normal;
• There is clinical evidence of any type of active infection, including adenovirus, hepatitis A virus, hepatitis B virus, or hepatitis C virus, or HIV virus;
-Any prior treatment for AMD, except anti-VEGF injection, has been applied to the test / control eye;
-There is a laceration in the retinal pigment epithelium;
Extensive submacular scar tissue is seen;
-Having significant retinal disease other than subfoveal CNV, AMD, such as diabetic retinopathy or retinal vein occlusion;
• Having significant non-retinal disease, such as eye atrophy or cataracts;
・ Known allergies to fluorescein;
-Current use of prednisolone, other anti-inflammatory steroids, or immunosuppressive drugs. Non-steroidal drugs such as aspirin are allowed;
• Any other prominent disorder that, in the findings of the investigator, may endanger participants for participation in the study or affect the outcome of the study or the ability of participants to participate in the study. Or have a disability;
• Participants who have participated in another study with the test product within the last 12 weeks; and • Penicillin sensitivity.

Administration procedure: rAAV. A pharmaceutical composition containing sFlt-1 is administered to a subject under conditions suitable for subretinal injection according to the following procedure:
1. 1. Prior to draping, the skin and eyelid margins and eyelashes around the subject's eyes were cleaned with 5% povidone iodine;
2. After applying a sterile whole body drape, further apply an ocular drape;
3. 3. Insert the eyelid, keep the eyelashes away from the field of view, and make sure the eyelid is well placed under the eyelid so that the field of view is protected by the eye drape;
Insert 3 ports for 4.23G or 25G vitrectomy;
5. Connect the saline injection section to the first port;
6. Insert the optical fiber into the second port;
7. 36G-41G subretinal cannula is connected to the drug syringe via a microconnector in the third port;
8. Under the microscope, 100 microliters are injected subretinal;
9. After injection, pull out the instrument and port;
10. Apply chloramphenicol ointment;
11. Drop 1% atropine dropping from a sterile single-use container;
12. It was administered as the eye pad and eye shield were applied.

Here, rAAV. The results of the sFlt-1 study are summarized. All eight enrolled subjects (mean age: 77 years) had active subfoveal choroidal angiogenesis, visual acuity of 20/40 to 20/400, and intravitreal of ranibizumab between 1 and 25 times. The injection had been given in advance. Patients were randomly divided into three groups, a control group and two test groups. All patients received intravitreal injections of ranibizumab on days 1 and 30 of the study. On day 7, 1 × 10 ¹⁰ rAAV. The sFlt-1 vector genome was administered to the first test group via subretinal injection and 1 × 10 ¹¹ rAAV. The sFlt-1 vector genome was administered to a second test group via subretinal injection. In all 6 patients in the test group, the subretinal fluid bleb disappeared within 4 hours. After 24 hours, most of the air in the vitreous was absorbed and only the injection site of the retina was still visible. One patient developed mild bleeding associated with the procedure, which did not affect vision. As expected, there was a transient increase in neutrophil count after vitrectomy, which returned to normal by 14 days after injection. The vector sequence was found in the tears of one subject one day after injection, which was cleared by day 30. To date, other than this single outbreak, AAV2 has not been detected by qPCR or ELISA in any of the subject's blood, saliva, or urine samples. Background levels of the naturally occurring sFLT-1 protein showed large baseline variability in urine, serum, and saliva, but did not increase after treatment. The sFLT-1 level in the vitreous also varied between subjects (975-2085 pg / ml). Blood biochemistry, complete blood count, and T cell response were maintained without any significant changes compared to baseline. rAAV. Subretinal injections of sFlt-1 did not show clinically significant retinal toxicity as assessed by continuous ophthalmic examinations over a two-month period. No inflammatory signs on the surface, anterior, or vitreous were present in any of the subjects. There was no evidence of loss of vision, elevated IOP, retinal detachment, or any intraocular or systemic immune response in any of the patients. An overview of anti-VEGF treatment, both initial and salvage treatment, is summarized in Table 6 for each patient.

None of the patients in the test group required salvage treatment at day 60, and most of the patients in the low-dose test group also did day 90, 120, 150, 180, or 210. It is noteworthy that on day, day 270, or day 365 (one year later), no remedies were requested. Control patients requested multiple salvage procedures. These results are unexpected and extend the promise of gene therapy to a large cohort of older patients with wet AMD. In general, patients treated with current anti-VEGF therapy, such as intravitreal injections of VEGF inhibitor protein or other anti-VEGF agents, will require additional injections within 30, 60, or 90 days.

The highest expression levels of sFLT-1 in the test subject or patient include rAAV. It arrives 6-8 weeks after subretinal administration of sFLT-1. During this so-called "ramp-up" period, at least one, two, or three intravitreal injections of the anti-VEGF agent are injected at intervals of 15-45 days, preferably at intervals of about 30 days, to progress the disease. To prevent. The first intravitreal injection of anti-VEGF agent was performed by rAAV. Administered 1 to 30 days prior to administration of sFlt-1, preferably rAAV. It is preferably administered 5-10 days prior to administration of sFlt-1 to allow absorption of intravitreal injections of anti-VEGF agents (Lucentis or Avastin or Eilea or other non-sFLT agents). This first intravitreal injection was given by rAAV. If administered less than 24 hours prior to subretinal administration of sFLT, this first intravitreal injection can be washed out of the vitreous during the subretinal injection procedure, but the concentration of anti-VEGF agent is less than the therapeutic concentration. And may lead to disease progression.

After the ramp period is complete, patients who treat their AMDs or express sFLT-1 sufficient to prevent the progression of those AMDs may not require additional intravitreal anti-VEGF injections. However, it is expected that those injections will still be made under the care of a physician. Patients are monitored and treated on a necessary basis based on objective criteria, such as increased measurements of central point retina thickness by optical coherence tomography.

In this study, patients in both the control and test groups were assessed for signs of active choroidal angiogenesis on an approximately monthly basis, with the following criteria:
The ETDRS (Diabetic Retinopathy Early Treatment Study) letter decline from the subject's previous visit (which can be attributed to retinal causes) is> 10, or with the patient's perception of loss of function. The decrease in letters due to ETDRS from the visit to the hospital is> 5.
• At the time of OCT, any new increase or prolongation of fluid is seen under the sensory retina, under the retinal pigment epithelium (RPE), or within the retina;
• If any of the signs of increased leakage from CNV via FA were met, retreatment was performed with intravitreal ranibizumab.

(Example 13)
Optical Coherence Tomography (OCT)
Spectral domain optical coherence tomography (SD-OCT) is an approved device (Heiderberg Spectralis® SD-OCT), as well as monitoring the patient's central point network thickness and fluid leakage within the retina. Performed using standard techniques.

Optical coherence tomography (OCT) is a non-contact medical imaging technique similar to ultrasound and MRI. OCT uses reflected light to provide detailed cross-sectional and three-dimensional images of the eye. SPECTRALIS® SD-OCT has the name of a spectral domain because it simultaneously measures reflected light of multiple wavelengths over a spectrum. Increasing the speed and number of scans translates into higher resolution and increased likelihood of observing the disease. In patients with wet AMD, detection of new intraretinal fluid or clinically significant increase in retinal thickness can be detected by SD-OCT (Adhi et al., Curr Opin Ophthalmol., May 2013,
Volume 24 (No. 3), pp. 213-21; Malamos et al., Invest Ophthalmol Vis Sci., 20
October 2009, Volume 50 (No. 10), pp. 4926-33). Detection of these symptoms in patients with AMD points to disease progression that justifies treatment with anti-VEGF therapy such as Lucentis or Eylea.

Symptoms of retinal health and AMD progression in each subject under study were monitored via SD-OCT. At least 6 radial scans within the macula were performed each time about 6 mm in length, and OCT images / scans were collected at each designated visit. SD-OCT images were assessed for the presence of intraretinal fluid through a blinded decoder, and retinal center thickness was measured using Heidelberg Heyex SD-OCT software. The results of central retinal thickness for 8 patients at each visit are shown in Table 7 below.

As shown in Table 7, the mean central retinal thickness of subjects in all dosing cohorts decreased after intravitreal injection of anti-VEGF protein (Lucentis) at the start of the study, as required by the protocol. As expected, the patient's central retinal thickness in the control group begins to increase and fluid can be seen on SD-OCT images within 30-90 days of administration of the anti-VEGF protein. Unexpectedly, the central retinal thickness of subjects in the low and high dose groups is generally rAAV. It is well controlled by sFlt-1 and does not increase over time. New intraretinal fluid does not occur in the retina of low-dose or high-dose subjects. This is shown, for example, by OCT in FIG. After 12 months, rAAV. The central retinal thickness of subjects treated with sFlt-1 is rAAV. Within 12 months of administration of the pharmaceutical composition containing sFlt-1, there was no increase above 50 microns, above 100 microns, or above 250 microns. When compared against the baseline, rAAV. The central retinal thickness of human subjects treated with sFlt-1 was reduced by 50 microns, or in some cases 100 microns, or in some cases 200 microns. This decrease was observed within 8 weeks of administration of sFlt-1 and was maintained for 3 months, 6 months, 9 months, and 12 months. This result is surprising and unknown in the clinical treatment of AMD and ocular angiogenesis in human subjects. More generally, intraretinal fluid and retinal center, even with initial anti-VEGF treatment for 30, 60, 90, or 180 days, without further administration of anti-VEGF protein or other VEGF inhibitor inhibitor. An increase in thickness will be observed.

Fluorescent fundus angiography (FA)
FA was performed using standard techniques. Take a transition image of the subject eye. Mid- and late-stage images of the test and non-test eyes are taken, but FA is obtained at each designated visit.

Biodistribution studies Vector seeding was searched for by amplifying vector genomes isolated from samples from tears, plasma, urine, and saliva by a polymerase chain reaction (PCR). In vivo distribution of vectors and sFLT-1 was investigated by ELISA for sFLT-1 and AAV2 capsids in plasma, tears, and saliva.

DNA Extraction Samples (100-300 ul) were pipeted to Sample Collection Cards (Qiagen, Valencia, CA) or sterile foam chip applicators. DNA was extracted from each sample according to the manufacturer's protocol. The purified DNA was dissolved in 50 ul of elution buffer. The amount of DNA present was determined by a spectrophotometer.

RAAV by real-time PCR. Detection of sFlt-1 Using TaqMan® Gene Expression Assays (Applied Biosystems, USA), genomic DNA samples (0.5-1 μg) were prepared from AAV. The presence of the sFlt-1 vector was screened. The assay includes a pair of unlabeled PCR primers that amplify the fragment between the AAV2 sequence and the sFLT-1 sequence, as well as a TaqMan® probe with a FAM® dye or VIC® dye label, and a TaqMan® probe. It consists of a primer moiety at the 5'end and a non-fluorescent quencher dye at the 3'end. Cycling conditions were one hold at 50 ° C. for 2 minutes and another hold at 95 ° C. for 20 seconds, followed by 45 cycles of 95 ° C. for 3 seconds and 60 ° C. for 30 seconds.

rAAV. Further studies of positive samples for the sFlt-1 fragment were performed to determine the presence of rAAV. The number of gene copies of sFlt-1 was quantified by real-time polymerase chain reaction (PCR). Using the IQ5 Bio-Rad real-time PCR system (Bio-Rad, Hercules, California, CA), the extracted DNA between 0.5 and 1.0 ug was subjected to Platinum SYBR Green qPCR Supermix-UDG (Invitrogen, Cars). , California, USA) and 20 ul of reaction mix containing 0.5 uM primers. A similar set of samples spiked with plasmid DNA containing the target sequence was prepared in parallel with the spiked samples. The primer pair used (forward: CACTAGTCCAGTGTGGTGGA; reverse: AGCCAGGAGACAACCACTTC) used Primer3 Output (Whitehead Institute, MA, USA) to assist in the region derived from the vector cDNA, using Rotorgene (Corbet). Designed to amplify into genes. The cycling conditions used were as follows. There were 60 3-step cycles of 50.0 ° C. for 2 minutes, 95.0 ° C. for 2 minutes, and 95.0 ° C. for 20 seconds, 60.0 ° C. for 20 seconds and 72.0 ° C. for 20 seconds. A calibration curve was prepared in each trial with a 10-fold dilution of plasmid DNA (pSSV.sFlt-1) having the same target vector sequence. Each sample was analyzed in triplicate.

Quantification of sFlt-1 protein concentration by ELISA Concentrations of sFLT-1 present in plasma, tears, and saliva are determined using the Quantikine ELISA kit (R & D Systems, Minneapolis, MN) based on sandwich immunoassay. , Quantitatively measured by ELISA. A sample (100 ul) was added to a 96-well plate coated with a monoclonal antibody specific for VEGF R1 / sFLT-1 and incubated for 2 hours. Unbound sFLT-1 was removed by washing with buffer. After incubation with an enzyme-linked VEGF R1 / sFLT-1 specific polyclonal antibody, excess antibody-enzyme conjugate was washed off and then the sample was incubated with substrate solution. The formation of enzyme-catalyzed chromogens was quantified by measuring the absorbance of visible light at 450 nm. The concentration of sFLT-1 in the sample (in pg / mL units) was calculated from the absorbance values using the calibration curve plotted on recombinant human sFLT-1.

Detection of AAV2 by ELISA AAV2 Titration ELISA Kit (American Research Products, Inc., Belmont, Massachusetts, USA) was used to analyze the presence of AAV2 capsids in plasma, tears, urine, and saliva. The kit uses mouse monoclonal antibodies specific for conformational epitopes on assembled AAV particles based on the sandwich ELISA method. This monoclonal antibody is coated onto a microplate strip and used to capture AAV particles from a specimen. The captured AAV particles were detected in two steps. First, a biotin-conjugated monoclonal antibody against AAV was bound to an immune complex. In the second step, the streptavidin peroxidase conjugate is reacted with the biotin molecule. The addition of the substrate solution results in a color reaction depending on the specifically bound virus particles. Absorbance was measured by the photometric method at 450 nm. The controls in the kit provided contained an AAV particle preparation of empty capsids, making it possible to quantitatively determine samples with unknown particle titers. A sample (100 ul) was added to the plate and the assay was performed according to the manufacturer's protocol.

Detection of AAV-2 Neutralizing Antibodies Plasma to HEK293 cells, AAV2. The ability to block the transduction of gfp was assayed. Patient plasma was serially diluted in normal mouse serum in multiwell plates. AAV2. Plates were incubated at 37 ° C. for 1 hour before gfp was added to each well and added in triplicate to HEK293 cells. Neutralizing antibody titers were expressed as plasma dilution resulting in 50% inhibition of transduction by AAV2-gfp. Maximum gfp activity was represented by a vector diluted in normal mouse serum and maximal inhibition was represented only in medium in normal mouse serum. Baseline plasma from each subject was assayed with each postoperative sample. AAV2. To 293T cells in the test well after 48 hours. Green cells by transduction of gfp were counted and compared to the number of green cells in the baseline serum sample.

Detection of Anti-AAV2 Antibodies To detect plasma antibodies to AAV2 capsids, protein-bound ELISA plates were coated with 109 vg / ml AAV2 (Vector Core Facility, North Carolina) overnight at ⁴ ° C. .. The plate was blocked at 37 ° C. for 2 hours and then serially diluted anti-AAV2 monoclonal antibody (Industries International, Concord, MA) or patient plasma 1:50, 1: 100, 1: 200. Incubated overnight at 4 ° C. with diluent or 1: 400 diluent. Plates were incubated with horseradish peroxidase (HRP) -conjugated anti-human Ig at 37 ° C. for 2 hours, then with tetramethylbenzidine (TMP) substrate and hydrogen peroxide (H2O2). The reaction was stopped with phosphoric acid (H3PO4) and read at 450 nm on a plate reader. The titer of the anti-AAV2 antibody was calculated based on the calibration curve of the commercially available antibody determined in parallel. Each value was determined in triplets.

Geographic atrophy Human subjects were examined for signs of geographic atrophy in their treated and untreated eyes according to standard techniques. rAAV. No increase in geographic atrophy was observed in patients treated with sFlt-1 after 3, 6, 9, or 12 months. It is hypothesized that treatment can stop the progression of geographic atrophy in the treated eye for up to 15 months, 18 months, 24 months, 36 months, 5 years and 10 years.

(Example 14)
Test rAAV. For treating exudative AMD and choroidal angiogenesis. To further investigate the safety and efficacy of sFlt-1, 40 additional subjects were enrolled in a controlled clinical study. As in the case of Example 12, rAAV. sFlt-1 was produced in the UNC Vector Core Human Application Laboratory according to FDA and ICH guidelines. The eligibility criteria, inclusion criteria, and exclusion criteria for the study were as follows:

Eligibility:
Eligible age for research: 55 years or older Gender eligible for research: Male and female Acceptance of healthy volunteers: None

Incorporation criteria:
・ Age is 55 years or older;
• Having subfoveal CNV secondary to AMD, with a maximum corrected visual acuity of 20/30 to 20/400 in the test eye and a maximum corrected visual acuity of 20/200 or higher in the other eye;
The fluorescein angiography of the subject eye must show evidence of leaking subfoveal choroidal neovascularization; or choroidal neovascularization is currently under active control with anti-VEGF therapy;
Must be a candidate for intravitreal injection of anti-VEGF;
• The overall size of the lesion should not exceed 12 in the disc area according to the macular photocoagulation study;
• No previous photomechanical or laser treatment of the retina;
・ Being able to provide informed consent;
• Participants should present clinically acceptable laboratory parameters and ECG at the time of enrollment; and • Be able to comply with protocol requirements, including follow-up visits.

Exclusion criteria:
・ Liver enzyme> Twice the upper limit of normal;
There is clinical evidence of any type of active infection, including adenovirus, hepatitis A virus, hepatitis B virus, or hepatitis C virus, or HIV virus; or a history of hepatitis B or C. Be recorded;
-Any prior treatment for AMD, except anti-VEGF injection, has been applied to the test / control eye;
-There is a laceration in the retinal pigment epithelium;
Extensive subfoveal scarring, extensive geographic atrophy, or thickening of subretinal blood as determined by the investigator;
-Having significant retinal disease other than foveal CNV, AMD, such as diabetic retinopathy or retinal vein occlusion, which can impair vision in the subject's eye;
Significant non-retinal, including ocular atrophy or marked cataract in the test eye, including central corneal scarring affecting visual acuity, glaucoma with visual field defects, or any measurable uveitis. Having a disease;
・ Known allergies to fluorescein;
-Current use of prednisolone, other anti-inflammatory steroids, or immunosuppressive drugs. Inhaled steroids and non-steroidal drugs such as aspirin are allowed;
• Any other prominent disorder that, in the findings of the investigator, may endanger participants for participation in the study or affect the outcome of the study or the ability of participants to participate in the study. Or have a disability;
• Participants who have participated in another study with the test product within the last 12 weeks; and • Penicillin sensitivity as confirmed by the participant's medical records.

Initially enrolled subjects had active subfoveal choroidal neovascularization, had visual acuity of 20/30 to 20/400 in the test eye, and had been previously given intravitreal injections of ranibizumab between 0 and 25 times. .. Patients were randomly divided into control or test groups until all 14 control patients and 26 test patients were enrolled. All patients received intravitreal injections of ranibizumab on days 1 and 30 of the study. On day 7, 1 × 10 ¹¹ rAAV. The sFlt-1 vector genome is administered to the test group via subretinal injection.

As in the case of the study in Example 12, the highest expression levels of sFLT-1 in the test subject or patient were determined by rAAV. It was reached 6-8 weeks after subretinal administration of sFLT-1. During this so-called "ramp-up" period, at least one, two, or three intravitreal injections of the anti-VEGF agent are injected at intervals of 15-45 days, preferably at intervals of about 30 days, to progress the disease. Was prevented. The first intravitreal injection of anti-VEGF agent was performed by rAAV. Administered 1 to 30 days prior to administration of sFLT-1, preferably rAAV. It is preferably administered 5-10 days prior to administration of sFLT-1 to allow absorption of intravitreal injections of anti-VEGF agents (Lucentis or Avastin or Eilea or other non-sFLT agents). This first intravitreal injection was given by rAAV. If administered less than 24 hours prior to subretinal administration of sFLT, this first intravitreal injection can be washed out of the vitreous during the subretinal injection procedure, but the concentration of anti-VEGF agent is less than the therapeutic concentration. And may lead to disease progression.

After the ramp period is complete, either treat those AMD or other symptoms of choroidal neovascularization, or express sFLT-1 sufficient to prevent the progression of those AMD or other symptoms of choroidal neovascularization. The patient did not require additional intravitreal anti-VEGF injections, but those injections are still expected to be made under the care of a physician.

In this study, reprinted in this example, patients in the control and test groups were assessed for signs of active choroidal angiogenesis on an approximately monthly basis, and the following criteria:
The ETDRS (Diabetic Retinopathy Early Treatment Study) letter decline from the subject's previous visit (which can be attributed to retinal causes) is> 10, or with the patient's perception of loss of function. The decrease in letters due to ETDRS from the visit to the hospital is> 5.
• At the time of OCT, any new increase or prolongation of fluid is seen under the sensory retina, under the retinal pigment epithelium (RPE), or within the retina;
• If any of the signs of increased leakage from CNV via FA were met, retreatment was performed with intravitreal ranibizumab.

(Example 15)
RAAV. To prevent or prevent neovascular disease of the eye or age-related macular degeneration (AMD). To investigate the safety and efficacy of sFlt-1, a further controlled clinical study with 40 (150) patients will be conducted. rAAV (bv). sFlt-1 is described by Lonza Houseton, Inc. Made in (Houston, Texas) according to FDA and ICH guidelines. The eligibility criteria, inclusion criteria, and exclusion criteria for the study were as follows:

Eligibility:
・ Research-eligible age: 50 years or older ・ Research-eligible gender: male and female ・ Acceptance of healthy volunteers: Yes

Incorporation criteria:
Patients with non-exudative AMD (types 2, 3, or 4 according to AREDS criteria; group 4 includes eyes with non-terminal AMD); classified as "exudative" or "atrophic" Incorporate patients with AMD;
・ Age is between 50 and 90 years;
• Being able to understand and comply with exam requirements;
-Visual acuity> 0.4.

Exclusion criteria:
・ Currently registered in clinical trials of ophthalmology;
-The eye is associated with macular or choroidal disorders other than AMD, with signs of unknown properties of AMD;
The eye is associated with the diagnosis of exudative AMD with active subretinal angiogenesis (SRNV) or CNV lesions requiring laser photocoagulation in the subject eye;
-Subject is accompanied by marked crystalline lens opacity that causes visual impairment;
・ The subject has amblyopia;
-Subjects are optic nerve disease (neuropathy, atrophy, papillary edema), intraocular pressure above 25 mmHg, 3 or more glaucoma drugs, 0.8 or more C / D consistent with glaucoma, and unstable glaucoma defined by the visual field. History of retinal vitreous surgery, degenerative myopia, active posterior intraocular inflammatory disease, chronic use of external ocular steroids, vasoproliferative glaucoma (other than AMD), rhegmatogenous retinal detachment, and hereditary With glaucoma dystrophy;
-The subject is accompanied by a demand-type pacemaker or epilepsy;
-Subject with uncontrolled hypertension (defined as 90 or more diastolic blood pressure and 150 or more systolic blood pressure);
-Subject has a recent history of cerebrovascular disease (within the previous year);
-Presenting a transient ischemic attack (TIA) or cerebrovascular attack (CVA);
-The subject is accompanied by a history of AIDS;
-Subjects have undergone intraocular surgery in the test eye within 3 months prior to enrollment in the study;
-Patients do not want to follow the visit examination schedule.

Primary outcome scale:
MPOD and multilocal electroretinogram [Time frame: 1 year later] [Designation as a safety issue: Yes]

Secondary outcome scale:
RAAV (bv) in reducing the risk of developing end-stage AMD. Safety and efficacy of sFlt-1 [Time frame: 1 year later] [Designation as a safety issue: Yes]

(Example 16)
RAAV. For the treatment of neovascular disease of the eye or diabetic macular edema (DME). A further controlled clinical study with 40 patients will be conducted to investigate the safety and efficacy of sFlt-1. rAAV (bv). sFlt-1 is described by Lonza Houseton, Inc. (Houston, Texas) produced according to FDA and ICH guidelines. The eligibility criteria, inclusion criteria, and exclusion criteria for the study were as follows:

Eligibility:
・ Research-eligible age: 18 years or older ・ Research-eligible gender: male and female ・ Acceptance of healthy volunteers: None

General inclusion criteria:
-The subject is eligible if the following criteria are met.
-Written informed consent, as well as certification under the Health Insurance Portability and Accountability Act (HIPAA) at facilities in the United States, and applicable by national law in other countries. Willingness to provide certification, which is a possible certification;
-Having diabetes (type 1 or type 2);
-Retinal thickening secondary to diabetes (diabetes mellitus) (DME), as assessed by optical coherence tomography (OCT), has a central macula thickness of ≥275 μm in the central subfield and is central to the fovea. Extensive thickening is seen;
The highest corrected visual acuity (BCVA) score in the subject eye using the ETDRS (Diabetic Retinopathy Early Treatment Study) protocol at an initial examination distance of 4 meters is an approximate Snellen equivalent visual acuity of 20 / 40-20 / 320;
-It has been determined that visual loss is primarily the result of DME, not the result of other causes;
• Ability and willingness to return to all scheduled visits and assessments (according to investigator's findings).

Exclusion criteria:
-A history of vitreous retinal surgery in the test eye;
• Panretinal photocoagulation (PRP) or macular laser photocoagulation in the test eye within 3 months of screening;
-Having proliferative diabetic retinopathy (PDR) in the test eye, excluding the inactive and disappeared PDR;
• Have preretinal fibrosis in the test eye that extends to iris neovascularization, vitreous hemorrhage, tractional retinal detachment, or macula;
-Have a vitreous macular traction or epiretinal membrane in the subject eye;
• Having eye inflammation (including evidence of inflammation or greater inflammation) in the test eye;
• A history of idiopathic uveitis or autoimmune uveitis in either eye;
• In the test eye, structural damage to the center of the macula that is likely to prevent improvement of VA after the disappearance of macular edema, retinal pigment epithelial (RPE) atrophy, subretinal fibrosis, or tissue formation. There is structural damage, including exudate plaques that have hardened and hardened;
Retinal detachment due to any cause (eg, age-related macular degeneration (AMD), ocular histoplasmosis, or pathological myopia) that is an ocular disorder in the subject eye and can confuse the interpretation of the study results. Having eye disorders including venous occlusion, retinal detachment, macular hole, or choroidal angiogenesis (CNV);
Cataract surgery on the subject's eye within 3 months dating to day 0, yttrium-aluminum-garnet (YAG) laser cyst incision within the last 2 months, or within 90 days Have undergone any other intraocular surgery;
• The subject has uncontrolled glaucoma or has previously undergone filtration surgery;
・ Uncontrolled blood pressure;
-History of cerebrovascular attack or myocardial infarction within 3 months before day 0;
・ Having uncontrolled diabetes;
Having renal failure requiring dialysis or kidney transplantation;
A history of other disorders, metabolic dysfunction, physical examination findings, or clinical laboratory findings that may contraindicate the use of the study drug, affect the interpretation of study results, or treat the subject as a complication. Have a history that raises reasonable suspicion of a disease or condition that is at great risk from the disease.

Primary outcome scale:
• Percentage of patients whose highest corrected visual acuity (BCVA) score increased by ≥15 characters from baseline after 12 months [Timeframe: Baseline-12 months later] [Designated as a safety issue: None]

Secondary outcome scale:
-Average change from baseline in the highest corrected visual acuity (BCVA) score after 12, 24, and 36 months-At 12, 24, and 36 months, snellen-equivalent visual acuity (VA) of 20/40 or higher Percentage of a patient • Mean change from baseline in foveal thickness measured by SD-OCT after 12, 24, and 36 months • Combined anti-VEGF treatment (eg, Lucentis, Avastin, Macugen, or Reduction of the frequency of Eyelea) [Designation as a safety issue: None]

Initial enrollment subjects will have DME, visual acuity in the test eye 20/40 to 20/320, and will have been pre-intravitreal injections of ranibizumab or aflibercept between 0 and 25 times. .. Patients are randomly divided into control or 2 test groups until all 14 control patients and 13 low dose test patients and 13 high dose test patients are enrolled. All patients received intravitreal injections of ranibizumab on days 1 and 30 of the study. On day 7, 1 × 10 ¹⁰ or 1 × 10 ¹¹ rAAV (bv) in a volume of 100 ul. The sFlt-1 vector genome is administered to the test group via subretinal injection.

As in the case of the study in Example 12, the highest expression level of sFLT-1 in the subject or patient was rAAV (bv). It arrives 6-8 weeks after subretinal administration of sFLT-1. During this so-called "ramp-up" period, at least one, two, or three intravitreal injections of the anti-VEGF agent are injected at intervals of 15-45 days, preferably at intervals of about 30 days, to progress the disease. To prevent. The first intravitreal injection of anti-VEGF agent was rAAV (bv). Administered 1 to 30 days prior to administration of sFLT-1, preferably rAAV (bv). It is preferably administered 5-10 days prior to administration of sFLT-1 to allow absorption of intravitreal injections of anti-VEGF agents (Lucentis or Avastin or Eilea or other non-sFLT agents). This first intravitreal injection was given by rAAV (bv). If administered less than 24 hours prior to subretinal administration of sFLT, this first intravitreal injection can be washed out of the vitreous during the subretinal injection procedure, but the concentration of anti-VEGF agent is less than the therapeutic concentration. And may lead to disease progression.

After the ramp period is complete, patients who treat those DMEs or express sFLT-1 sufficient to prevent the progression of those DMEs may not require additional intravitreal anti-VEGF injections. However, it is expected that those injections will still be made under the care of a physician.

In this study, reprinted in this example, patients in the control and test groups were assessed for signs of active DME or new DME and angiogenesis on an approximately monthly basis, and the following criteria:
The ETDRS (Diabetic Retinopathy Early Treatment Study) letter decline from the subject's previous visit (which can be attributed to retinal causes) is> 10, or with the patient's perception of loss of function. The decrease in letters due to ETDRS from the visit to the hospital is> 5.
• At the time of OCT, any new increase or prolongation of fluid is seen under the sensory retina, under the retinal pigment epithelium (RPE), or within the retina;
• If any of the signs of increased leakage from CNV via FA are met, re-treat with intravitreal ranibizumab.

(Example 17)
RAAV. For the treatment of neovascular disease of the eye or retinal vein occlusion (RVO). A further controlled clinical study with 40 patients will be conducted to investigate the safety and efficacy of sFlt-1. The clinical study is one cohort that includes patients with Central Retinal Vein Occlusion (CRVO) and one cohort that includes patients with Branch Retinal Vein Occlusion (BRVO). Performed by patients in two cohorts. As in the case of Example 15, rAAV (bv). sFlt-1 is described by Lonza Houseton, Inc. (Houston, Texas) produced according to FDA and ICH guidelines. The eligibility criteria, inclusion criteria, and exclusion criteria for the study were as follows:

Incorporation criteria:
• Central retinal vein occlusion (CRVO) secondary to central macular edema, or BRVO secondary to branched macular edema, on optical coherent tomography (OCT) for up to 9 months. Evaluated macular edema with an average central subfield thickness of ≥250 μm;
・ ≧ 18-year-old adult;
-The highest corrected visual acuity (BCVA) in the subject eye according to ETDRS (Diabetic Retinopathy Early Treatment Research) is 20/40 to 20/320 (73 to 24 characters).

Exclusion criteria:
• The subject eye has been given any prior treatment with anti-VEGF agents (such as pegaptanib sodium, anecortave acetate, bevacizumab, ranibizumab) or previous systemic anti-angiogenic agents;
-Preceding panretinal laser photocoagulation or macular laser photocoagulation in the test eye;
-The duration of CRVO disease from the date of diagnosis is> 9 months; the duration of BRVO disease from the date of diagnosis is> 9 months;
• Intraocular corticosteroids were once used in the test eye, or periocular corticosteroids were used in the test eye within 3 months of the first day;
• Having macular neovascularization, vitreous hemorrhage, tractional retinal detachment, or preretinal fibrosis in the subject or pair of eyes.

Primary outcome scale:
Average change from baseline in maximum corrected visual acuity (BCVA) score after 6 months [Time frame: baseline and after 6 months] [Designated as a safety issue: None]
-The highest corrected visual acuity (BCVA) character score of 73 to 24 (= 20/40 to 20/320 visual acuity) according to the study baseline range defined by ETDRS (Early Treatment Study for Diabetic Retinopathy) in the test eye. Being (high score represents better function; molecule = (number of participants who maintained vision x 100); denominator = number of participants analyzed)

Secondary outcome scale:
-Percentage of patients whose BCVA score increased by ≥15 characters compared to baseline at 6 months-Average change in central retinal thickness (CRT) from baseline at 6 months [Time frame: baseline and 6 months later] ] [Designation as a safety issue: None]
-Reducing the frequency of concomitant anti-VEGF treatments (eg, Lucentis, Avastin, Macugen, or Eyelea) [designated as a safety issue: none]

The initial enrollment subject would have CRVO or BRVO, visual acuity in the subject eye of 20/40 to 20/320, and pre-intravitreal injection of ranibizumab between 0 and 25 times. Patients are randomly divided into control or 2 test groups until all 14 control patients and 13 low dose test patients and 13 high dose test patients are enrolled. All patients received intravitreal injections of ranibizumab on days 1 and 30 of the study. On day 7, 1 × 10 ¹⁰ or 1 × 10 ¹¹ rAAV (bv) in a volume of 100 ul. The sFlt-1 vector genome is administered to the test group via subretinal injection.

As in the case of the study in Example 14, the highest expression level of sFLT-1 in the subject or patient was rAAV (bv). It arrives 6-8 weeks after subretinal administration of sFLT-1. As described in Example 14, after the ramp period is complete, patients who treat their CRVO or BRVO or express sFLT-1 sufficient to prevent the progression of their CRVO or BRVO are further added. Intravitreal anti-VEGF injections may not be required, but those injections are expected to still be made under the care of a physician.

In this study, reprinted in this example, patients in the control and test groups were assessed on an approximately monthly basis for signs of active retinal vein occlusion or new retinal vein occlusion and angiogenesis. Standards of:
The ETDRS (Diabetic Retinopathy Early Treatment Study) letter decline from the subject's previous visit (which can be attributed to retinal causes) is> 10, or with the patient's perception of loss of function. The decrease in letters due to ETDRS from the visit to the hospital is> 5.
• At the time of OCT, any new increase or prolongation of fluid is seen under the sensory retina, under the retinal pigment epithelium (RPE), or within the retina;
• If any of the signs of increased leakage from CNV via FA are met, re-treat with intravitreal ranibizumab.

Claims (1)

Compositions and the like for use as described herein.

Images