JP2021066663A - Nucleic acid molecule - Google Patents

Abstract

To provide a nucleic acid molecule that promotes the growth of β-pancreatic Langerhans islet cells as a therapeutic for Type 1 and/or 2 diabetes.SOLUTION: The β-pancreatic Langerhans islet cell growth promoter contains nucleic acid molecules having SEQ ID NO: 1: UGUAGUGUUUCCUACUUUAUGGA (SED ID NO: 1).SELECTED DRAWING: None

Description

The present invention relates to nucleic acid molecules that promote the proliferation of pancreatic Langerhans islet β cells.

It has been reported that the decrease or deletion of pancreatic Langerhans islet β cells occurs not only in type 1 diabetes but also in type 2 diabetes. Therefore, as a promising therapeutic method for these diabetes, regeneration and promotion of proliferation of pancreatic Langerhans islet β cells can be considered.

Recently, it has been clarified that transplantation of bone marrow cells promotes the proliferation of pancreatic Langerhans islet β cells (see Non-Patent Documents 1 to 3). However, the mechanism is not clear.

In addition, it has been clarified that in vivo administration of microRNAs miR-106b-5p and miR-222-3p promotes the proliferation of pancreatic Langerhans islet β cells (see Non-Patent Document 4).

Hasegawa, Y. et al. Bone marrow (BM) transplantation promotes beta-cell regeneration after acute injury through BM cell mobilization. Endocrinology 148, 2006-2015, doi: en.2006-1351 [pii] Hess, D. et al. Bone marrow-derived stem cells initiate pancreatic regeneration. Nature biotechnology 21, 763-770, doi: 10.1038 / nbt841 (2003). Nakayama, S. et al. Impact of whole body irradiation and vascular endothelial growth factor-A on increased beta cell mass after bone marrow transplantation in a mouse model of diabetes induced by streptozotocin. Diabetologia 52, 115-124, doi: 10.1007 / s00125 -008-1172-z (2009). Tsukita, S. et al. MicroRNAs 106b and 222 improve hyperglycemia in a mouse model of insulin-deficient diabetes via pancreatic β-cell proliferation. EBioMedicine 15, (2017), 163-172, doi: 10.1016 / j.ebiom. 2016.12. 002.

An object of the present invention is to provide a nucleic acid molecule that promotes the proliferation of pancreatic Langerhans islet β cells.

The present inventors have made diligent efforts to clarify the mechanism of the phenomenon that the proliferation of pancreatic islet β-cells is promoted by transplanting bone marrow cells, and the microRNAmiR-142a-3p is found in the pancreas. It was found that it regulates the proliferation promotion of Langerhans islet β cells, and the present invention was completed.

One embodiment of the present invention is a growth-promoting agent for pancreatic islet β-cells, which contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or an expression construct thereof. The nucleic acid molecule may be an RNA molecule. It may be used to promote the proliferation of pancreatic Langerhans cell β-cells after bone marrow transplantation. It may also be administered intravenously.

Another embodiment of the present invention is a diabetes therapeutic agent containing any of the above growth promoters. It may be a therapeutic agent for type 1 diabetes and / or type 2 diabetes.

A further embodiment of the present invention is a method for examining the growth promotion of pancreatic islet Langerhans β cells, which comprises synthesizing a nucleic acid molecule having a base sequence having 1 to 12 mutations in SEQ ID NO: 1 or an expression construct thereof. , A step of investigating whether the nucleic acid molecule or its expression construct promotes the proliferation of pancreatic Langerhans islet β cells.

A further embodiment of the present invention is a method for obtaining a nucleic acid molecule or an expression construct thereof that promotes the proliferation of pancreatic islet β-cells, and is a method for obtaining a plurality of nucleic acids having a base sequence having 1 to 12 mutations in SEQ ID NO: 1. A step of synthesizing a molecule or its expression construct, a step of examining whether the plurality of nucleic acid molecules or its expression construct promote the proliferation of pancreatic Langerhans islet β cells, and a nucleic acid molecule or a nucleic acid molecule promoting the proliferation of pancreatic Langerhans islet β cells. Includes a step of identifying the expression construct.

A further embodiment of the present invention is a method for examining the promotion of insulin secretion in pancreatic islet Langerhans β cells, which is a step of synthesizing a nucleic acid molecule having a base sequence having 1 to 12 mutations in SEQ ID NO: 1 or an expression construct thereof. And a step of examining whether the nucleic acid molecule or its expression construct promotes insulin secretion in pancreatic Langerhans islet β cells.

A further embodiment of the present invention is a method for obtaining a nucleic acid molecule or an expression construct thereof that promotes insulin secretion of pancreatic Langerhans islet β cells, and has a plurality of base sequences having 1 to 12 mutations in SEQ ID NO: 1. A step of synthesizing a nucleic acid molecule or its expression construct, a step of examining whether or not the plurality of nucleic acid molecules or its expression construct promote insulin secretion of pancreatic Langerhans islet β cells, and a step of promoting insulin secretion of pancreatic Langerhans islet β cells. The process of identifying a nucleic acid molecule or its expression construct,
including.

In any of the above methods, the base sequence of the nucleic acid molecule may be a sequence having 1 to 6 mutations in SEQ ID NO: 1 or a sequence having 1 to 3 mutations.

The SEQ ID NO: 1 is as follows.
UGUAGUGUUCCUACUUUAUGGA (SEQ ID NO: 1)

INDUSTRIAL APPLICABILITY According to the present invention, it has become possible to provide a nucleic acid molecule that promotes the proliferation of pancreatic Langerhans islet β cells.

In one example of the present invention, it is a figure showing that the expression level of Ki-67 mRNA expressed in pancreatic Langerhans islet β cells into which miR-142a-3p was introduced was relatively increased.

Hereinafter, embodiments of the present invention completed based on the above findings will be described in detail with reference to examples.

Unless otherwise specified in embodiments and examples, MR Green & J. Sambrook (Ed.), Molecular cloning, a laboratory manual (4th edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2012) ); FM Ausubel, R. Brent, RE Kingston, DD Moore, JG Seidman, JA Smith, K. Struhl (Ed.), Current Protocols in Molecular Biology, John Wiley & Sons Ltd. Or the method of modifying or modifying it. When using a commercially available reagent kit or measuring device, the protocol attached to them is used unless otherwise specified.

It should be noted that the objects, features, advantages, and ideas of the present invention are apparent to those skilled in the art by the description of the present specification, and those skilled in the art can easily reproduce the present invention from the description of the present specification. it can. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention and are shown for illustration or explanation purposes. It is not limited. It will be apparent to those skilled in the art that various modifications and modifications can be made based on the description herein within the intent and scope of the invention disclosed herein.

== Nucleic acid molecule used in the present invention and its expression construct ==
The pancreatic islet β-cell proliferation promoter, insulin secretagogue, and diabetes therapeutic agent according to the present invention contain a nucleic acid molecule having the sequence of SEQ ID NO: 1.

miR-142a-3p: UGUAGUGUUCCUACUUAUGGA (SEQ ID NO: 1)
Nucleic acid molecules have natural nucleotides (RNA-type ribonucleotides having adenin, guanine, uracil, citocin as bases, or DNA-type deoxyribonucleotides having adenin, guanine, timine, citocin) or non-natural nucleotides (eg, inosin It may be composed of nucleotides, α-enantiomer type of natural nucleotides, etc.), or it may be a chimeric molecule composed of both, but RNA composed of ribonucleotides is preferable.

Nucleotides may be modified with sugars and / or bases (purines and / or pyrimidines) for the purpose of facilitating absorption by cells, resistance to degradation by nucleases, and the like. As a sugar modification, for example, one or more hydroxyl groups may be substituted with halogens, alkyls, amines, and azides, and may be etherified or esterified. Also, the entire sugar may be replaced with sterically and electronically equivalent structures such as aza sugars and carbocyclic sugar analogs. As the modification of the base, for example, it may be alkylated and / or acylated, or it may be subjected to heterocyclic substitution.

The pancreatic islet β-cell proliferation promoter, insulin secretagogue, and diabetes therapeutic agent according to the present invention may contain an expression construct expressing a nucleic acid molecule having the sequence of SEQ ID NO: 1. This expression construct comprises an expression vector portion and an insertion portion that, when expressed, constitutes the nucleic acid molecule. As the expression vector, a known one can be used, and it may be a plasmid vector or a viral vector. Examples of the viral vector include an adenovirus vector, an adeno-associated virus vector, and a retroviral vector. The expression promoter contained in the expression vector is not particularly limited, and may be a constitutive promoter such as CMV promoter, RSV promoter, SV40 promoter, actin promoter, or a conditionally expressed promoter such as HSP promoter. However, it is preferable that the promoter functions specifically in pancreatic Langerhans islet β cells such as an insulin promoter.

== Pancreatic islet β-cell proliferation promoter ==
The pancreatic islet β-cell proliferation promoter according to the present invention contains a nucleic acid molecule having the sequence of SEQ ID NO: 1 or an expression construct thereof. The use of this growth promoter is not particularly limited, and it can be used for both reagents and pharmaceuticals.

As a reagent, cells can be proliferated by introducing the above nucleic acid molecule or its expression construct into pancreatic Langerhans islet β cells cultured in vitro. The introduction method is not particularly limited, and a known transfection method, lipofection method, electroporation method, or the like can be used.

As a pharmaceutical, it can be used in vivo as an insulin secretagogue, a therapeutic agent for diabetes, a therapeutic agent for complications of diabetes, and the like. The administration target of the nucleic acid molecule or the expression construct thereof is not particularly limited, and is not particularly limited as long as it is an animal including a human or a mouse suffering from the disease. The usage and the like of the diabetes therapeutic agent will be described in detail below as an example.

== Diabetes drug ==
The diabetes therapeutic agent according to the present invention contains a nucleic acid molecule having the sequence of SEQ ID NO: 1.

The dosage form of the therapeutic agent for diabetes is not particularly limited, and various dosage forms, for example, tablets, capsules, powders, granules, pills, liquids, emulsions, suspensions and solutions for oral administration. , Alcohol, syrup, extract, elixir. Parenteral preparations include, for example, injections such as subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections; transdermal or patches, ointments or lotions; sublingual preparations for oral administration. , Oral patches; and aerosols for nasal administration; suppositories, but not limited to. These formulations can be produced by known methods commonly used in the formulation process. Further, the agent according to the present invention may be in a long-acting or sustained-release dosage form.

When preparing an oral solid preparation, add excipients, binders, disintegrants, lubricants, colorants, flavoring agents, odorants, etc. to the active ingredient as necessary, and then tablets by conventional methods. It is possible to produce coated tablets, granules, powders, capsules and the like. Such additives may be those commonly used in the art, for example, excipients include lactose, sucrose, sodium chloride, glucose, starch, calcium carbonate, kaolin, microcrystalline cellulose, silicic acid. As the binder, water, ethanol, propanol, simple syrup, glucose solution, starch solution, gelatin solution, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl starch, methyl cellulose, ethyl cellulose, shelac, calcium phosphate, polyvinylpyrrolidone, etc. Disintegrants include dried starch, sodium alginate, canten powder, sodium hydrogencarbonate, calcium carbonate, sodium lauryl sulfate, monoglyceride stearate, lactose, etc., and lubricants include purified talc, stearate, borosand, polyethylene glycol, etc. As the flavoring agent, sucrose, orange peel, starch, starch acid and the like can be exemplified.

When preparing an oral liquid preparation, an oral liquid preparation, a syrup agent, an elixir agent and the like can be produced by adding a flavoring agent, a buffering agent, a stabilizer, a odorant and the like to the active ingredient. In this case, the flavoring agent may be those listed above, the buffering agent may be sodium citrate or the like, and the stabilizer may be tragant, gum arabic, gelatin or the like.

When preparing an injection, a pH regulator, buffer, stabilizer, isotonic agent, local anesthetic, etc. are added to the active ingredient to produce subcutaneous, intramuscular and intravenous injections by a conventional method. can do. Examples of the pH adjuster and buffer in this case include sodium citrate, sodium acetate, sodium phosphate and the like. Examples of the stabilizer include sodium pyrosulfite, ethylenediaminetetraacetic acid (EDTA), thioglycolic acid, thiolactic acid and the like. Examples of the local anesthetic include procaine hydrochloride, lidocaine hydrochloride and the like. Examples of the tonicity agent include sodium chloride and glucose.

When preparing suppositories, the active ingredient may be a carrier known in the art, such as polyethylene glycol, lanolin, cocoa butter, fatty acid triglyceride, and optionally surface activity such as Tween®. After adding an agent or the like, it can be produced by a conventional method.

When preparing an ointment, a base, a stabilizer, a wetting agent, a preservative, etc., which are usually used as an active ingredient, are blended as necessary, and mixed and formulated by a conventional method. Examples of the base include liquid paraffin, white petrolatum, beeswax, octyldodecyl alcohol, paraffin and the like. Examples of the preservative include methyl paraoxybenzoate, ethyl paraoxybenzoate, and propyl paraoxybenzoate.

When producing a patch, the ointment, cream, gel, paste or the like may be applied to a normal support by a conventional method. As the support, a woven fabric made of cotton, rayon, or chemical fiber, a non-woven fabric, a film such as soft vinyl chloride, polyethylene, or polyurethane, or a foam sheet is suitable.

The amount of the active ingredient contained in the drug can be appropriately determined depending on the dose range of the active ingredient, the number of doses, and the like. The dose is not particularly limited, and the efficacy of the contained ingredients, the form of administration, the route of administration, the type of disease, the nature of the subject (body weight, age, medical condition and the use of other drugs, etc.), and the doctor in charge. It is appropriately selected according to the judgment of. In general, the appropriate dose is preferably in the range of, for example, about 0.01 μg to 100 mg, preferably about 0.1 μg to 1 mg per kg of body weight of the subject. However, these dose changes can be made using common routine experiments for optimization well known in the art. The above dose can be divided into 1 to several times a day.

== Method for investigating the promotion of pancreatic Langerhans cell β-cell proliferation or insulin secretion ==
The method for investigating the promotion of proliferation or insulin secretion of pancreatic islet β-cells according to the present invention is a step of preparing a nucleic acid molecule having a base sequence in which a mutation is introduced into SEQ ID NO: 1 or an expression construct thereof, and a prepared nucleic acid molecule. Alternatively, it comprises the step of examining whether the expression construct promotes the proliferation of pancreatic islet β-cells or the promotion of insulin secretion. The specific method will be described in detail below.

First, a base sequence having a mutation in SEQ ID NO: 1 is designed. The number of bases having a mutation is not particularly limited, but is preferably 6 or less, more preferably 4 or less, further preferably 3 or less, and further preferably 2 or less. It is more preferably one. Nucleic acid molecules having the base sequence designed in this way are synthesized. The synthesis method is not particularly limited, and it may be produced using cells or chemically synthesized. When the expression construct is used, the expression construct is prepared by inserting a DNA having the base sequence into an expression vector or the like.

The method for investigating whether a nucleic acid molecule or an expression construct thereof promotes the proliferation of pancreatic Langerhans islet β cells or the promotion of insulin secretion is not particularly limited. Introduce into cultured pancreatic islet β-cells to examine their proliferative or insulin secretory capacity, or administer to diabetic animals in vivo to examine their proliferative or insulin secretagogue. You may do it. The method for examining the proliferative capacity of cells is not particularly limited, and examples thereof include a method showing a relative increase in the expression level of ki-67 mRNA and a method for counting the number of Ki-67-positive cells. Further, the method for examining the insulin secretagogue ability is not particularly limited, and for example, an anti-insulin antibody can be used to measure the insulin concentration in the supernatant of cultured cells or in the blood of an individual animal.

In addition, a plurality of nucleic acid molecules having different mutations or their expression constructs were designed, and for them, the proliferative ability or insulin secretory ability of pancreatic Langerhans islet β cells was examined, and the nucleic acid molecules having each ability or their expression constructs were identified. By selection, new nucleic acid molecules or expression constructs thereof that promote the proliferation or insulin secretion of pancreatic Langerhans islet β cells can be obtained.

The proliferation of pancreatic Langerhans islet β cells when miR-142a-3p was introduced into pancreatic Langerhans islet β cells was examined by the RT-PCR method using Ki-67 mRNA.

(1) Isolation of pancreatic islet β-cells and introduction of miRNA Coragenase (Sigma) was injected into the pancreatic duct of C57BL / 6J mice (10 to 11 weeks old) to obtain pancreatic islet β-cells from the pancreas. The obtained pancreatic Langerhans islet β cells were dissociated by trypsin treatment, and the collected cells were suspended in RPMI1640 medium (containing 10% FBS, a specified amount of penicillin-streptomycin mixed solution, and a specified amount of gentamicin solution). .. Forty suspended pancreatic Langerhans islet β cells were seeded on a 96-well flat-bottomed plate, and _{cultured at 37 ° C. and 5% CO 2} for 2 days. Then, using Lipofectamine ^TM RNAiMAX (Invitrogen), microRNA having SEQ ID NO: 1 in pancreatic Langerhans islet β cells (referred to as miR-142a-3p) (Cosmobio) or control mirVana ^TM microRNA (miR). -NC (referred to as NC) (Ambion) were introduced and cultured for 3 days. Then, the supernatant was removed by centrifugation, and pancreatic Langerhans islet β cells were collected.

(2) RT-PCR method
Total mRNA was extracted from the recovered pancreatic Langerhans islet β cells using the RNeasy Micro Kit (QIAGEN). DNA was removed from the extracted total mRNA using the Turbo DNA-free kit (Ambion). Then, a reverse transcription reaction was carried out using the High Capacity RNA-to-cDNA Kit (Applied Biosystems), and Ki-67 mRNA was amplified using the 7900HT Fast Real Time PCR system (Applied Biosystems). After calculating the amount of amplification product of Ki-67 mRNA extracted from pancreatic Langerhans islet β cells introduced with miR-142a-3p or miR-NC having a random sequence by the ΔΔCt method using β-actin as an internal standard, respectively. It is shown as a relative value with the amount of amplification product of Ki-67 mRNA extracted from pancreatic islet β cells into which miR-NC was introduced as 1 (Fig. 1).

The details of the amplification reaction of Ki-67 mRNA are as follows.
Forward primer: AGTCTTGGAGAGTCTGATGTTA (SEQ ID NO: 2)
Reverse primer: ACTTCTTGGTGCATACAATGTC (SEQ ID NO: 3)

As a result, as shown in FIG. 1, the expression of Ki-67 mRNA in the pancreatic Langerhans islet β cells into which miR-142a-3p was introduced was about 3 times higher than that in the pancreatic Langerhans islet β cells into which the control miR-NC was introduced. The amount was rising. From this, miR-142a-3p has the effect of promoting the proliferation of pancreatic Langerhans islet β cells.

Claims (13)

Pancreatic islet β-cell proliferation promoter
A growth promoter containing a nucleic acid molecule having SEQ ID NO: 1.
UGUAGUGUUCCUACUUUAUGGA (SEQ ID NO: 1) The growth promoter according to claim 1, wherein a part or all of the nucleotides of the nucleic acid molecule are replaced with DNA-type nucleotides or non-natural type nucleotides. Pancreatic islet β-cell proliferation promoter
A growth promoter containing the expression construct of the nucleic acid molecule according to claim 1 or 2. The growth promoter according to any one of claims 1 to 3, which is used to promote the growth of pancreatic Langerhans cell β cells after bone marrow transplantation. The growth promoter according to any one of claims 1 to 4, which is administered intravenously. A diabetes therapeutic agent containing the growth promoter according to any one of claims 1 to 5. The diabetes therapeutic agent according to claim 6, which is a therapeutic agent for type 1 diabetes and / or type 2 diabetes. A method for investigating the promotion of pancreatic Langerhans cell β-cells.
A step of synthesizing a nucleic acid molecule having a base sequence having 1 to 12 mutations in SEQ ID NO: 1 or an expression construct thereof, and
A step of investigating whether the nucleic acid molecule or its expression construct promotes the proliferation of pancreatic Langerhans islet β cells, and
Including methods.
UGUAGUGUUCCUACUUUAUGGA (SEQ ID NO: 1) A method for obtaining a nucleic acid molecule or an expression construct thereof that promotes the proliferation of pancreatic Langerhans islet β cells.
A step of synthesizing a plurality of nucleic acid molecules having a base sequence having 1 to 12 mutations in SEQ ID NO: 1 or an expression construct thereof, and
A step of investigating whether the plurality of nucleic acid molecules or their expression constructs promote the proliferation of pancreatic Langerhans islet β cells, and
The step of identifying a nucleic acid molecule or an expression construct thereof that promotes the proliferation of pancreatic Langerhans islet β cells, and
Including methods.
UGUAGUGUUCCUACUUUAUGGA (SEQ ID NO: 1) A method for investigating the promotion of insulin secretion in pancreatic Langerhans cell β-cells.
A step of synthesizing a nucleic acid molecule having a base sequence having 1 to 12 mutations in SEQ ID NO: 1 or an expression construct thereof, and
A step of investigating whether the nucleic acid molecule or its expression construct promotes insulin secretion in pancreatic Langerhans islet β cells, and
Including methods.
UGUAGUGUUCCUACUUUAUGGA (SEQ ID NO: 1) A method for obtaining a nucleic acid molecule or an expression construct thereof that promotes insulin secretion in pancreatic Langerhans islet β cells.
A step of synthesizing a plurality of nucleic acid molecules having a base sequence having 1 to 12 mutations in SEQ ID NO: 1 or an expression construct thereof, and
A step of investigating whether the plurality of nucleic acid molecules or their expression constructs promote insulin secretion in pancreatic Langerhans islet β cells, and
Steps to identify nucleic acid molecules or their expression constructs that promote insulin secretion in pancreatic islet β-cells,
Including methods.
UGUAGUGUUCCUACUUUAUGGA (SEQ ID NO: 1) The method according to any one of claims 8 to 11, wherein the base sequence of the nucleic acid molecule is a sequence having 1 to 6 mutations in SEQ ID NO: 1. The method according to any one of claims 8 to 11, wherein the base sequence of the nucleic acid molecule is a sequence having 1 to 3 mutations in SEQ ID NO: 1.

Images