JP2020519310A - Creation of herbicide resistance gene and its use - Google Patents

Abstract

Methods for creating herbicide tolerant plants with the CRISPR/Cas9 system are provided. Also provided are methods for screening endogenous gene mutation sites capable of conferring herbicide resistance in plants and the use of identified endogenous gene mutation sites in crop crosses.

Description

The present invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to methods for creating new herbicide-tolerant plants by base editing techniques, and methods for screening for endogenous gene mutations that can confer herbicide resistance in plants. .. The invention also relates to the use of identified endogenous gene mutations in crop crosses.

Weeds are a major threat to crops, not only affecting crop yield and quality, but also transferring agricultural pests and diseases. Therefore, effective weed control is essential for achieving high yields in agriculture. Traditional manual weeding is inefficient and results in high costs and has therefore been gradually replaced by spraying herbicidal chemicals during crop growth. Currently, in China's agricultural production, the area and amount of herbicides applied has already exceeded that of pesticides and fungi.

The mechanism of action of herbicides can be divided into three categories. The first is to suppress enzymes involved in the plant photosynthesis system, the second is to suppress cell metabolism such as the inhibition of amino acid or fatty acid synthesis, and the third is to inhibit microtubule polymerization or Suppress cell growth/division, including interference with phytohormonal systems. Herbicide-suppressing enzymes are also susceptible in many crops, and therefore many herbicides can cause significant damage to crops while controlling weeds. Therefore, improving crop tolerance to herbicides is of great significance.

There are two main strategies for increasing crop tolerance to herbicides. One is target tolerance, which means that the enzyme suppressed by the herbicide is mutated so that the herbicide cannot effectively suppress the physiological activity of the enzyme. This strategy generally involves resistance to imidazolinones, glyphosate, sulfonylureas, atrazine and the like. The second is detoxification, ie the protection of the physiological function of the target enzyme through rapid degradation of the herbicide. This strategy generally involves tolerance to glufosinate, 2,4-D, dicamba and the like by the plant's endogenous P450 enzyme system and transgenes.

Two different technological approaches to achieving herbicide tolerance in plants are currently two distinct technological approaches: i) traditional crop crosses including chemical mutagenesis, radiation mutagenesis, and ii) transgenes. That is, there is the integration of the herbicide resistance gene into the plant of interest. However, the probability of acquiring herbicide resistance mutations (especially multiple mutations in the same information) by traditional cross produce is very low and it is possible to produce linked unwanted mutations. Transgene technology can only introduce known herbicide resistance genes into plants of interest to confer the expected herbicide resistance.

There is still a need in the art for simpler and more efficient methods for obtaining herbicide tolerant plants and new herbicide tolerant genes.

FIG. 1 shows a screen for resistance mutations in rice ALS. Figure 3 shows a screen for resistance mutations in rice ACCase. Figure 3 shows a screen for resistance mutations in wheat ALS.

I. Definitions In the present invention, scientific and technical terms used herein have the meaning commonly understood by one of ordinary skill in the art, unless otherwise indicated. Also, all terms and experimental procedures used herein in relation to protein and nucleotide chemistry, molecular biology, cell and tissue culture, microbiology, immunology are consistent with terms generally used in the art and conventional methods. Belong to For example, standard DNA recombination and molecular cloning techniques used herein are well known to those of skill in the art and are described in detail in the following references: Sambrook, J. et al. Fritsch, E.; F. and Maniatis, T.; , Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook et al"). Meanwhile, in order to better understand the present invention, definitions and explanations for related terms are provided below.

"Cas9 nuclease" and "Cas9" can be used interchangeably herein and are referred to as RNA-directed nucleases, which are Cas9 proteins or fragments thereof (active DNA cleavage of Cas9). Domain and/or a protein containing the gRNA binding domain of Cas9). Cas9 is a component of the CRISPR/Cas (clustered and regularly spaced short palindromic repeats and related systems) genome editing system that targets and cleaves DNA target sequences under the guidance of guide RNAs. Form a DNA double-strand break (DSB).

“Guide RNA” and “gRNA” can be used interchangeably herein and are typically composed of crRNA and tracrRNA molecules that form a complex through a partial complement, The crRNA is sufficiently complementary to the target sequence for hybridization and includes a sequence that is directed toward the CRISPR complex (Cas9+crRNA+tracrRNA) and specifically binds to the target sequence. However, it is known in the art that single-stranded guide RNAs (sgRNAs) can be designed that include the features of both crRNA and tracrRNA.

"Deaminase" refers to an enzyme that catalyzes a deamination reaction. In some embodiments of the invention, deaminase refers to cytidine deaminase that catalyzes the deamination of cytidine or deoxycytidine to uracil or deoxyuridine, respectively.

When applied to plant cells, the "genome" includes not only chromosomal DNA found in the nucleus but also organelle DNA found within intracellular components of the cell (eg, mitochondria, plastids).

As used herein, the term "plant" includes whole plants and any progeny, cells, tissues, or parts of plants. The term “plant part” includes, for example, seeds (including mature seeds and immature seeds), plant cuttings, plant cells, plant cell cultures, plant organs (eg pollen, embryo, flower, fruit, bud, leaf). , Roots, stems and explants), but include any part(s) of the plant. A plant tissue or plant organ may be a seed, protoplast, callus, or some other group of plant cells organized into structural or functional units. The plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained and has a genotype substantially the same as the plant. Sometimes plants can be regenerated. In contrast, some plant cells are unable to regenerate to produce plants. Regenerable cells in plant cells or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, cobs, cobs, husks, or It may be a handle.

Plant parts include harvestable parts and parts useful for the growth of progeny plants. Plant parts useful for propagation include, but are not limited to, for example, seeds, fruits, cuttings, shoots, tubers, and rhizomes. The harvestable part of the plant may be any useful part of the plant including, but not limited to, flowers, pollens, buds, tubers, leaves, stems, fruits, seeds, and roots.

A plant cell is a structural and physiological unit of a plant and includes a protoplast cell having no cell wall and a plant cell having a cell wall. Plant cells may be in the form of isolated single cells, or aggregates of cells (eg, fragile callus and cultured cells), and more highly organized units (eg, plant tissue). , Plant organs, and plants). Thus, a plant cell may be a protoplast, a gametogenic cell, or a cell or collection of cells capable of regenerating into a whole plant. Thus, a seed that comprises a plurality of plant cells and is capable of regenerating into a whole plant is herein referred to as a "plant cell" in the embodiments.

The term "protoplast," as used herein, refers to a plant cell whose cell wall has been completely or partially removed, exposing its lipid bilayer membrane, and thus completely removed. Including, but not limited to, protoplasts and spheroplasts in which the cell wall is only partially removed. Typically, protoplasts are isolated plant cells without a cell wall that have the capacity for regeneration into cell culture or whole plants.

The "progeny" of a plant includes any subsequent generation of the plant.

A “genetically modified plant” includes a plant that contains an exogenous polynucleotide in its genome. For example, an exogenous polynucleotide has been stably integrated into the genome, thereby transmitting it to successive generations. The exogenous polynucleotide can be integrated into the genome either alone or as part of a recombinant DNA construct. A modified gene or expression control sequence means that the sequence contains one or more nucleotide substitutions, deletions, or additions in the plant genome. For example, the genetically modified plants obtained according to the invention may contain one or more C to T substitutions relative to wild type plants (corresponding plants that are not genetically modified).

The term “exogenous” with respect to a sequence is substantially modified from a sequence that originates from an exogenous species, or, if from the same species, an artificial human-mediated composition and/or its native form at a genetic locus. Means an array.

“Polynucleotide”, “nucleic acid sequence”, “nucleotide sequence”, or “nucleic acid fragment” refers to single- or double-stranded RNA or DNA that optionally contains synthetic unnatural or altered nucleotide bases. Used interchangeably to refer to polymer. Nucleotides (usually found in their 5'-monophosphate form) are designated by the one-letter code as follows: "A" stands for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C". "" is cytidylic acid or deoxycytidylic acid, "G" is guanylic acid or deoxyguanylic acid, "U" is uridylic acid, "T" is deoxythymidylic acid, and "R" is purine (A or G ), “Y” represents pyrimidine (C or T), “K” represents G or T, “H” represents A or C or T, “I” represents inosine, and “N” represents any nucleotide.

“Polypeptide”, “peptide”, “amino acid sequence” and “protein” are used interchangeably herein and refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residue is an artificial chemical analog of the corresponding naturally occurring amino acid, and to naturally occurring amino acid polymers. The terms “polypeptide”, “peptide”, “amino acid sequence” and “protein” refer to glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. Also included are modifications, including but not limited to.

As used herein, "expression construct" refers to a vector suitable for expressing a nucleotide sequence of interest in a plant, such as a recombinant vector. "Expression" refers to the production of a functional product. For example, expression of a nucleotide sequence can refer to transcription of the nucleotide sequence (such as transcribing to produce mRNA or functional RNA) and/or translation of RNA into protein precursors or mature proteins.

The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or in some embodiments, an RNA (such as mRNA) that can be translated.

An "expression construct" of the invention is a regulatory sequence or nucleotide sequence of interest derived from a different source, or a regulatory sequence of interest derived from the same source but arranged in a different manner than normally found in nature. And a nucleotide sequence.

“Regulatory sequences” or “regulators” are used interchangeably and are located upstream within the coding sequence (5′ non-coding sequence) or downstream of the coding sequence (3′ non-coding sequence), and Refers to nucleotide sequences that affect transcription, RNA processing or stability, or translation of related coding sequences. A plant expression regulator refers to a nucleotide sequence capable of controlling transcription, RNA processing or stability, or translation of a nucleotide sequence of interest in a plant.

Regulatory sequences can include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

"Promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the invention, the promoter is a promoter capable of controlling gene transcription in a plant cell, whether it originates from a plant cell or not. The promoter can be a constitutive promoter or a tissue-specific promoter or a developmentally regulated promoter or an inducible promoter.

"Constitutive promoter" refers to a promoter that generally causes gene expression in most cell types in most situations. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and are expressed primarily, but not necessarily exclusively, in one tissue or organ, but in one specific cell or cell. Refers to a promoter that can also be expressed in the mold. "Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. An "inducible promoter" selectively expresses a DNA sequence operably linked to the promoter in response to an endogenous or exogenous stimulus (such as environment, hormone, or chemical signal).

As used herein, the term "operably linked" refers to a regulatory element (eg, but not limited to, a promoter sequence, a transcription termination sequence, etc.) that is a nucleic acid sequence (coding sequence or open reading frame). Associated, which means that transcription of the nucleotide sequence is controlled and regulated by the transcriptional regulator. Techniques for operably linking regulatory region to nucleic acid molecules are known in the art.

“Introduction” of a nucleic acid molecule (plasmid, linear nucleic acid fragment, RNA, etc.) or protein into a plant transforms a plant cell with the nucleic acid or protein so that the nucleic acid or protein can function in the plant cell Means “Transformation” as used herein includes stable transformation and transient transformation.

"Stable transformation" refers to the introduction of an exogenous nucleotide sequence into the plant genome, resulting in a genetically stable inheritance. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the plant and any successive generations of its genome.

"Transient transformation" refers to the introduction of nucleic acid molecules or proteins into plant cells to carry out their function without stable inheritance. In transient transformation, the exogenous nucleic acid sequence does not integrate into the plant genome.

II. A base editing system for producing a herbicide-resistant plant The present invention provides the following (i) to (v), i) a base editing fusion protein, and a guide RNA:
ii) an expression construct comprising a nucleotide sequence encoding a base-editing fusion protein and a guide RNA,
iii) a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA,
iv) an expression construct comprising a nucleotide sequence encoding a base-editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA,
v) A system for base editing of a herbicide resistance-related gene in a plant genome, comprising at least one of expression constructs comprising a nucleotide sequence encoding a base editing fusion protein and a nucleotide sequence encoding a guide RNA. Wherein the base editing fusion protein contains a nuclease inactive CRISPR nuclease domain (such as a nuclease inactive Cas9 domain) and a deaminase domain, wherein the guide RNA is associated with herbicide resistance in a plant genome. The base editing fusion protein can be directed to a target sequence in a gene.

The herbicide tolerance-related gene may be a gene encoding a protein having important physiological activity in plants that can be suppressed by the herbicide. Mutations in such herbicide tolerance-related genes can reverse the repression of the herbicide and retain its physiological activity. Alternatively, the herbicide tolerance-related gene can encode a protein capable of degrading the herbicide. Increasing the expression of such genes associated with herbicides or enhancing their degradative activity can result in increased tolerance to herbicides.

In some embodiments of the present invention, herbicide resistance-related genes include PsbA gene (resistance to atrazine etc.), ALS (acceptor synthase) gene (resistance to sulfonylurea, imidazolidinone etc.) , EPSPS (5-enolpyruvate oxalate-3-phosphate synthase) gene (resistant to glyphosate), ACCase (acetyl-CoA carboxylase) gene (resistant to setoxydim, etc.), PPO (protoporphyrinogen oxidase) ) Gene (resistant to carfentrazone-ethyl etc.) and HPPD (p-hydroxyphenylpyruvate dioxygenase) gene (resistant to mesotrione etc.), PDS (phytoene dehydrogenase) (resistant to difluphenican etc.) , GS (glutamine synthetase) (a herbicide target such as glufosinate), DOXPS (a herbicide target such as clomazone), P450 (involved in herbicide degradation), but not limited thereto.

In some embodiments, the guide RNA targets one or more of SEQ ID NO:19-SEQ ID NO:78.

The nuclease inactive CRISPR nuclease that can be used in the present invention is not particularly limited, provided that it has the ability to target a specific DNA under the induction of gRNA, for example, Nuclease inactive CRISPR nucleases derived from Cas9, Cpf1 and the like can be used. Nuclease inactive Cas9 nuclease is preferred.

The DNA cleavage domain of Cas9 nuclease is known to contain two subdomains, the HNH nuclease subdomain and the RuvC subdomain. The HNH subdomain cleaves the strand that is complementary to the gRNA, while the RuvC subdomain cleaves the non-complementary strand. Mutations in these subdomains can inactivate the Cas9 nuclease, forming "nuclease inactive Cas9." Nuclease inactive Cas9 possesses the DNA binding ability dictated by gRNA. Thus, in principle, when fused with an additional protein, nuclease-inactive Cas9 can simply target the additional protein to almost any DNA sequence through co-expression with a suitable guide RNA. it can.

Cytidine deaminase can catalyze the deamination of cytidine (C) in DNA to form uracil (U). When the nuclease inactive Cas9 is fused to cytidine deaminase, the fusion protein can target a target sequence in the plant genome through the guidance of guide RNAs. The DNA duplex is not cleaved by the loss of Cas9 nuclease activity, whereas the deaminase domain in the fusion protein is derived from cytidine, a single-stranded DNA that forms during the formation of the Cas9-guide RNA-DNA complex. It can be converted to U and then the C to T substitution may be accomplished by base mismatch repair.

Therefore, in some embodiments of the invention, the deaminase is a cytidine deaminase, such as the apolipoprotein B mRNA editing complex (APOBEC) family deaminase. In particular, the deaminase described herein is a deaminase that can accept single-stranded DNA as a substrate.

Examples of cytidine deaminase that can be used in the present invention include, but are not limited to, APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, or CDA1.

In some specific embodiments of the invention, the cytidine deaminase comprises the amino acid sequence set forth in position 9 to position 235 of SEQ ID NO: 10 or SEQ ID NO: 11.

The nuclease inactive Cas9 of the present invention can be derived from Cas9 of different species, for example S. Pyogenes Cas9 (SpCas9, the amino acid sequence of which is shown in SEQ ID NO: 5). Mutations in both the HNH nuclease and RuvC subdomains of SpCas9 (including, for example, the D10A and H840A mutations) result in the nuclease-killing Cas9 (dCas9) S. Inactivate the Pyogenes Cas9 nuclease. Inactivation of one of the subdomains by the mutation allows Cas9 to acquire nickase activity, resulting in Cas9 nickase (nCas9), for example nCas9 with only the D10A mutation.

Therefore, in some embodiments of the invention, the nuclease inactive Cas9 of the invention comprises amino acid substitutions D10A and/or H840A as compared to wild-type Cas9.

In some preferred embodiments of the invention, the nuclease inactive Cas9 of the invention has nickase activity. Without being bound by any theory, eukaryotic mismatch repair uses nicks on the DNA strand for the removal and repair of mismatched bases in the DNA strand. The U:G mismatch formed by cytidine deaminase can be repaired to C:G. Through the introduction of a nick on the strand containing the unedited G, it would be possible to preferentially repair the U;G mismatch to the desired U:A or T:A. Therefore, preferably, the nuclease inactive Cas9 is a Cas9 nickase in which the cleavage activity of the HNH subdomain of Cas9 is retained, whereas the cleavage activity of the RuvC subdomain is inactivated. For example, nuclease inactive Cas9 contains the amino acid substitution D10A as compared to wild-type Cas9.

In some embodiments of the invention, nuclease inactive Cas9 comprises the amino acid sequence of SEQ ID NO:6. In some preferred embodiments, the nuclease inactive Cas9 comprises the amino acid sequence of SEQ ID NO:7.

In some embodiments of the invention, the deaminase domain is fused to the N-terminus of the nuclease inactive Cas9 domain. In some embodiments, the deaminase domain is fused to the C-terminus of the nuclease inactive Cas9 domain.
In some embodiments of the invention, the deaminase domain and the nuclease inactive Cas9 domain are fused through a linker. The linker has a length of 1 to 50 (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20). , Or 20 to 25, 25 to 50) or more amino acids, or a non-functional amino acid sequence having no secondary or higher structure. For example, the linker may be a flexible linker such as GGGGS, GS, GAP, (GGGGS)×3, GGS, (GGS)×7, and the like. In some preferred embodiments, the linker is the XTEN linker shown in SEQ ID NO:8.

In the cell, uracil DNA glycosylase catalyzes the removal of U from DNA and initiates base excision repair (BER), which results in U:G to C:G repair. Therefore, without any theoretical limitation, the inclusion of a uracil DNA glycosylase inhibitor in the base-editing fusion protein of the present invention or the system of the present invention can increase the efficiency of base-editing.

Thus, in some embodiments of the invention, the base editing fusion protein further comprises a uracil DNA glycosylase inhibitor (UGI). In some embodiments, the uracil DNA glycosylase inhibitor comprises the amino acid sequence set forth in SEQ ID NO:9.

In some embodiments of the invention, the base edit fusion protein of the invention further comprises a nuclear localization sequence (NLS). In general, the one or more NLSs in the base-editing fusion protein should be of sufficient strength to drive the accumulation of the base-editing fusion protein in the nucleus of the plant cell in a sufficient amount for the base-editing function. In general, the strength of nuclear localization activity is determined by the number and position of NLS and one or more specific NLS used in the base-editing fusion protein, or a combination thereof.

In some embodiments of the invention, the NLS of the base edit fusion protein of the invention may be localized at the N-terminus and/or the C-terminus. In some embodiments, the base edit fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS. In some embodiments, the base-editing fusion protein has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs at or near the N-terminus. Including. In some embodiments, the base-editing fusion protein has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs at or near the C-terminus. Including. In some embodiments, the base edit fusion protein comprises a combination thereof, such as one or more NLSs at the N-terminus and one or more NLSs at the C-terminus. If there are more than one NLS, each NLS may be selected as independent of the other NLS. In some preferred embodiments of the invention, the base editing fusion protein comprises two NLSs, eg, the two NLSs are located at the N-terminus and the C-terminus, respectively.

Generally, NLS consists of one or more short sequences of positively charged lysines or arginines exposed on the surface of proteins, although other types of NLS are also known in the art. Non-limiting examples of NLS include KKRKV (nucleotide sequence 5′-AAGAAGAGAAAAGGTC-3′), PKKKRKV (nucleotide sequence 5′-CCCAAGAAGAAGAGGAAGGTG-3′ or CCAAGAAGAGAGAGAGAGGTGT), or SGGSPGKKAGGAGGAGGAGAGCTGAGGGAGGAGGAGAGGTG (nucleotide sequence 5′-CCCAAGAAGAGAGAGAGGGTT). Can be mentioned.

In some embodiments of the invention, the N-terminus of the base edit fusion protein comprises NLS having the amino acid sequence represented by PKKKRKV. In some embodiments of the invention, the C-terminus of the base edit fusion protein comprises NLS having the amino acid sequence represented by SGGSPKKKKRKV.

In addition, the base-editing fusion protein of the present invention includes a cytoplasmic localization sequence, a chloroplast localization sequence, a mitochondrial localization sequence, and the like, depending on the position of the DNA to be edited. Other localized sequences can also be included, such as.

In some embodiments of the invention, the base edit fusion protein comprises the amino acid sequence set forth in SEQ ID NO:10 or SEQ ID NO:11.

In order to obtain efficient expression in plants, in some embodiments of the invention, the nucleotide sequence encoding the base editing fusion protein is codon optimized for the plant to be base edited. ing.

Codon optimization is performed by maintaining at least one codon of the native sequence (eg, about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or about 1 while maintaining the native amino acid sequence). More than 2, more than 3, more than 4, more than 5, more than 10, more than 15, more than 20, more than 25, more than 50 or more codons) more frequently or most often in the gene of the host cell. Refers to a method of modifying a nucleic acid sequence for enhanced expression in a host cell of interest by replacing the codons used. Various species exhibit particular biases for certain codons for particular amino acids. Codon bias (difference in codon usage between organisms) is often correlated with the efficiency of translation of messenger RNA (mRNA), which in turn, among other things, is the nature of the translated codon and the particular transfer RNA ( tRNA) molecule. The preference of selected tRNAs in cells is generally a reflection of the most frequently used codons in peptide synthesis. Thus, genes can be tailored for optimal gene expression in a given organism based on codon optimization. A table of codon usage can be found, for example, at www. kazusa. It is readily available in the "Codon Usage Database" available at orjp/codon/, and these tables can be applied in many ways. Nakamura, Y.; , Et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res. 28:292 (2000).

In some embodiments of the invention, the optimized nucleotide sequence of the codon encoding the base editing fusion protein is set forth in SEQ ID NO:12 or SEQ ID NO:13.

In some embodiments of the invention, the guide RNA is single-stranded guide RNA (sgRNA). Methods of constructing a suitable sgRNA with a given target sequence are known in the art. For example, Wang, Y. et al. Simultaneous editing of three homoalleles in hexaploid bread wheat conference heritable residence to powdery mildew. Nat. Biotechnol. 32, 947-951 (2014), Shan, Q.; et al. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. Biotechnol. 31, 686-688 (2013), Liang, Z.; et al. Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas system. J Genet Genomics. 41, 63-68 (2014).

In some embodiments of the invention, a nucleotide sequence encoding a base editing fusion protein and/or a nucleotide sequence encoding a guide RNA is operably linked to a plant expression regulator such as a promoter.

Examples of promoters that can be used in the present invention include cauliflower mosaic virus 35S promoter (Odell et al. (1985) Nature 313: 810-812), maize Ubi-1 promoter, wheat U6 promoter, rice U3 promoter, Maize U3 promoter, rice actin promoter, TrpPro5 promoter (US Patent Application Publication No. 10/377,318 filed on Mar. 16, 2005), pEMU promoter (Last et al. Theor. Appl. Genet. 81:581). -588), MAS promoter (Velten et al. (1984) EMBO J. 3:2723-2730), maize H3 histone promoter (Lepetit et al. Mol. Gen. Genet. 231:276-285 and Atanasova et al. 1992) Plant J. 2(3):291-300), and Brassica napus ALS3 (PCT application WO 97/41228) promoters, but are not limited thereto. Promoters that can be used in the present invention include Moore et al. (2006) Plant J. Also included are commonly used tissue-specific promoters as reviewed in 45(4):651-683.

III. Method for Making a Herbicide Tolerant Plant by Base Editing In another aspect, the invention provides a system of the invention for base editing a herbicide resistance-related gene into a herbicide resistant plant, within the genome of the plant. Introducing a base RNA that targets a base-editing fusion protein within the plant to a target sequence of a herbicide resistance-related gene, resulting in one or more nucleotide substitutions in the target sequence. Provide a method for producing plants.

In some embodiments, the method further comprises screening the plants for herbicide resistance.

In some embodiments, the herbicide tolerance associated gene encodes a herbicide tolerance associated protein. In some embodiments of the present invention, the herbicide tolerance-related proteins include PsbA (tolerant to atrazine, etc.), ALS (tolerant to sulfonylurea, imidazolidinone, etc.), EPSPS (tolerant to glyphosate). ), ACCase (resistant to cetoxidim, etc.), PPO (resistant to carfentrazone-ethyl, etc.) and HPPD (resistant to mesotrione, etc.), PDS (resistant to difluphenican, etc.), GS ( Herbicide targets such as glufosinate), DOXPS (herbicide targets such as clomazone), P450 (involved in herbicide degradation), but are not limited thereto.

In some embodiments, the nucleotide substitution is a C to T substitution. In some embodiments, the nucleotide substitution is a C to A substitution or a C to G substitution. In some embodiments, a nucleotide substitution located within a non-coding region in a herbicide resistance gene, such as an expression control region. In some embodiments, the nucleotide substitution results in an amino acid substitution in the herbicide tolerance protein encoded by the gene. In some embodiments, the nucleotide and/or amino acid substitutions confer herbicide tolerance to the plant.

In some embodiments of the invention, the nucleotide and/or amino acid substitutions that confer herbicide tolerance to the plant may be any known substitution in the herbicide tolerance related gene that confer herbicide tolerance to the plant. .. By the method of the invention, single mutations, double mutations or multiple mutations capable of conferring herbicide tolerance can be created in plants in situ without the need for a transgene. it can. Mutations may be known in the art or may be newly identified by the methods of the invention.

The present invention relates to herbicide resistance, which comprises modifying the ALS gene in a plant by the base editing method of the present invention, resulting in a mutation of one or more amino acids in ALS that confers herbicide resistance to the plant. Provide a method for producing plants. In some embodiments, the amino acid mutations are A122T, P197S, P197L, P197F, R198C, D204N, A205T, D204N+A205T, G654K, G655D, G655S, G655N, G654K+G655D, G654K+G655S65,N195P5G19G, P654N, G654K, P195N, G654K, P195N. , D204N, A205T, D204N + A205T, G654D, G654S, G654N, G655D, G655S, G655N, G654D + G655D, G654D + G655S, G654D + G655N, G654S + G655D, G654S + G655S, G654S + G655N, G654N + G655D, G654N + G655S, G654N + G655N, selected from A122T or some combination thereof, wherein For the amino acid position, refer to SEQ ID NO: 2 (the amino acid sequence of ALS in Arabidopsis thaliana (Genbank accession number NP — 190425)). In some specific embodiments, the amino acid mutations are selected from P197A, P197F, P197S, P197Y, P197F+R198C, G654E+G655S, G654K+G655S, G654E+G659N, P197F+G654E+G655S, or any combination thereof at these positions. , SEQ ID NO: 2 (amino acid sequence of ALS in Arabidopsis thaliana (Genbank accession number NP — 190425)).

Thus, in some embodiments, the guide RNA is a sequence encoding an amino acid(s) selected from the group consisting of A122, P197, R198, D204, A205, G654, G655, G659, or any combination thereof. Is targeted to the amino acid position where SEQ ID NO: 2 (amino acid sequence of ALS in Arabidopsis thaliana (Genbank accession number NP — 190425)) is referenced.

In some embodiments, the ALS is rice ALS and its wild type sequence is set forth in SEQ ID NO:16. In some embodiments, the ALS is wheat ALS and its wild-type sequence is set forth in SEQ ID NO:17 (partial sequence) (genbank ID: AAO53548.1).

The present invention includes a herbicide-tolerant plant comprising modifying the PsbA gene in a plant by the base editing method of the present invention, resulting in a mutation of one or more amino acids in PsbA conferring herbicide resistance to the plant. Provide a way to create.

The present invention comprises a herbicide-tolerant plant comprising modifying the EPSPS gene in a plant by the base editing method of the present invention, resulting in a mutation of one or more amino acids in EPSPS that confers herbicide resistance to the plant. Provide a way to create. In some embodiments, the amino acid mutation is selected from the group consisting of T102I, A103V, T102I+A103V, wherein the amino acid position refers to SEQ ID NO:4 (Wheat A Genome EPSPS Amino Acid Sequence (GenBank Accession No. ALK27163)).

Therefore, in some embodiments, the guide RNA targets a target sequence comprising a sequence encoding amino acid(s) selected from the group consisting of T102 and/or A103, wherein the amino acid position is , SEQ ID NO:4.

The present invention comprises the modification of the ACCase gene in plants by the base editing method of the present invention, resulting in a mutation of one or more amino acids in the ACCase that confers herbicide resistance to the plant. Provide a method for producing resistant plants. In some embodiments, the amino acid mutations are S1768F, R1793K, A1794T, R1793K+A1794T, R1825H, D1827N, R1825H+D1827N, L1815F, A1816V, R1817stop, L1815F37R17+17+18,18+18,18A18,18A18,18A16,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18A18 , G1854D, G1855D, G1855S, G1854N, G1854D + G1855D, G1854D + G1855S, G1854D + G1855N, D1971N, D1972N, D1971N + D1972N, G1983D, P1993S, P1993L, P1993F, R1994C, P1993S + R1994C, P1993L + R1994C, P1993F + R1994C, S2003F, A2004V, T2005I, S2003F + A2004V, S2003F + T2005I, A2004V + T2005I, T2007I , A2008V, T2007I + A2008V, R2028K, W2027C, G2029D, G2029S, G2029N, R2028K + G2029D, R2028K + G2029S, R2028K + G2029N, T2047I, R2070Q, G2071R, R2070Q + G2071R, A2090T, E2091K, A2090T + E2091K, A2090V, E2106K, S2119N, R2220Q, S2119N + R2220Q, A1813V, R1793K, A1794T , R1793K + A1794T, E1796K, E1797K, E1796K + E1797K, T1800M, L1801F, T1800M + L1801F, A1813V, G1854D, G1854S, G1854N, G1855D, G1855S, G1855N, G1854D + G1855D, G1854D + G1855S, G1854D + G1855N, G1854S + G1855D, G1854S + G1855S, G1854S + G1855N, G1854N + G1855D, G1854N + G1855S, G1854N + G1855N, S1849F, H1850Y , S1849F+H1850Y, D1874N, D1875N, D1874N+D1875N, R2028K, G2029D, G2029S, G2029N, R2028K+G2029D, R202 8K + G2029S, R2028K + G2029N, L2024F, T2047I, R2070C, A2090V, G1983D, E1989K, R1990Q, E1989K + R1990Q, P1993S, P1993L, P1993F, R1994C, P1993S + R1994C, P1993L + R1994C, P1993F + R1994C, T2007I, A2008V, T2007I + A2008V, S2003L, A2004V, T2005I, S2003L + A2004V, S2003L + T2005I, A2004V+T2005I, S2003L, A2004V+T2005I, L2099F, E2106K, R2220K, G2119D, R2220K+G2119D, or any combination thereof, wherein the amino acid position refers to SEQ ID NO: 1 (Nosmenotepoucus amino acid sequence) (GenBank accession number CAC84161.1)). In some embodiments, the amino acid mutation is selected from W2027C, W2027C+R2028K, wherein the amino acid position refers to SEQ ID NO: 1 (Alopecurus myosuroides ACCase amino acid sequence (GenBank Accession No. CAC84161). .1)).

Therefore, in some embodiments, the guide RNA is S1768, R1793, A1794, R1825, D1827, L1815, A1816, R1817, A1837, G1854, G1855, D1971, D1972, G1983, P1993, R1994, S2003, A2004,. T2005, T2007, A2008, R2028, G2029, T2047, R2070, G2071, A2020, E2091, E2106, S2119, R2220, A1813, E1796, E1797, T1800, L1801, S1849, H1850, D1874, D1875, L2020, R1989, E1989. Targets a target sequence comprising a sequence encoding an amino acid(s) selected from the group consisting of L2099, or any combination thereof, where the amino acid position refers to SEQ ID NO:1.

In some embodiments, the ACCase is a rice ACCase and its wild-type sequence is set forth in SEQ ID NO:14 (genbank ID:B9FK36). In some embodiments, the ACCase is a wheat ACCase, the wild type sequence of which is shown in SEQ ID NO: 15 (genbank ID: ACD46684.1).

The present invention relates to a herbicide-tolerant plant, which comprises modifying the PPO gene in a plant by the base editing method of the present invention, resulting in a mutation of one or more amino acids in PPO, which confers herbicide resistance to the plant. Provide a way to create.

The present invention comprises a herbicide-tolerant plant comprising modifying the HPPD gene in a plant by the base editing method of the present invention, resulting in a mutation of one or more amino acids in the HPPD, which confers herbicide resistance to the plant. Provide a way to create. In some embodiments, the mutation of amino acids, P277S, P277L, V364M, C413Y, G414D, G414S, G414N, G415E, G415R, G415K, G414D + G415E, G414D + G415R, G414D + G415K, G414S + G415E, G414S + G415R, G414S + G415K, G414N + G415E, G414N + G415R, G414N + G415K , C413Y + G415E, C413Y + G415R, C413Y + G415K, C413Y + G414D, C413Y + G414S, C413Y + G414N, C413Y + G414D + G415E, C413Y + G414D + G415R, C413Y + G414D + G415K, C413Y + G414S + G415E, C413Y + G414S + G415R, C413Y + G414S + G415K, C413Y + G414N + G415E, C413Y + G414N + G415R, C413Y + G414N + G415K, P277S, P277L, V366I, C413Y, G414D, G414S, G414N, G415E, G415R, G415K , G414D + G415E, G414D + G415R, G414D + G415K, G414S + G415E, G414S + G415R, G414S + G415K, G414N + G415E, G414N + G415R, G414N + G415K, C413Y + G415E, C413Y + G415R, C413Y + G415K, C413Y + G414D, C413Y + G414S, C413Y + G414N, C413Y + G414D + G415E, C413Y + G414D + G415R, C413Y + G414D + G415K, C413Y + G414S + G415E, C413Y + G414S + G415R, C413Y + G414S + G415K, C413Y + G414N + G415E, C413Y + G414N + G415R, C413Y + G414N + G415K or, Selected from any combination of these, where the amino acid position refers to SEQ ID NO: 3 (Rice HPPD amino acid sequence (Genbank Accession No. XP — 015626163)).

Thus, in some embodiments, the guide RNA is a target sequence comprising a sequence encoding amino acid(s) selected from the group consisting of P277, V364, C413, G414, G415, V366, or any combination thereof. Where the amino acid position is referenced to SEQ ID NO:3.

The design of target sequences that can be recognized and targeted by the Cas9-guide RNA complex is within the industrial skill of those skilled in the art. In general, the target sequence is the sequence that is complementary to the approximately 20 nucleotide leader sequence contained in the guide RNA, the 3'end of which is immediately adjacent to the protospacer flanking motif (PAM) NGG. ..

For example, in some embodiments of the present invention, the target sequence has the structure 5′-N _X -NGG-3′, where N is independently selected from A, G, C, and T. X is an integer 14≦X≦30, N _X represents X consecutive nucleotides, and NGG is a PAM sequence. In some specific embodiments of the invention X is 20.

In some embodiments, the guide RNA targets one or more of SEQ ID NO:19-SEQ ID NO:78.

The base editing system of the present invention has a broad deamination window in plants, for example, a 7 nucleotide long deamination window. In some embodiments of the methods of the invention, one or more C bases at positions 3-9 of the target sequence are replaced with T. For example, any one, two, three, four, five, six, or seven Cs in positions 3-9 in the target sequence, if present, can be replaced with T. .. For example, if there are 4 Cs in positions 3-9 of the target sequence, any 1, 2, 3, 4 Cs can be replaced by T. The C bases may be contiguous or separated by other nucleotides. Therefore, when there is more than one C in the target sequence, different mutation combinations can be obtained by the method of the invention.

In some embodiments of the methods of the present invention, further comprising screening plants with the desired nucleotide substitutions. Nucleotide substitutions in plants can be detected by T7EI, PCR/RE or sequencing methods, see, for example, Shan, Q. et al. Wang, Y.; Li, J.; & Gao, C.C. Genome editing in rice and where using the CRISPR/Cas system. Nat. Protoc. 9, 2395-2410 (2014).

In the method of the present invention, the base editing system can be introduced into a plant by various methods well known to those skilled in the art. Methods that can be used to introduce the base editing system of the present invention into plants include particle bombardment, PEG-mediated protoplast transformation, Agrobacterium-mediated transformation, plant virus-mediated Includes, but is not limited to, transformation, pollen tube approach, and ovary injection approach. In some embodiments, the base editing system is introduced into plants by transient transformation.

In the method of the present invention, modification of the target sequence can be achieved by simply introducing or producing the base-editing fusion protein and the guide RNA in plant cells, and the modification can be achieved by stabilizing the plant using the base-editing system. Stable inheritance is possible without the need for transformation. This avoids the potential off-target effects of the stable base editing system and also the integration of exogenous nucleotide sequences within the plant genome, resulting in higher biosafety.

In some preferred embodiments, this introduction is performed in the absence of selective pressure, thereby avoiding the integration of the exogenous nucleotide sequence within the plant genome.

In some embodiments, this introducing transforms the base editing system of the present invention into an isolated plant cell or tissue, which is then transformed into the transformed plant cell or tissue. Including regenerating into treated plants. Preferably, this regeneration is carried out in the absence of selective pressure, ie no selective agent for the selective gene carried on the expression vector is used during tissue culture. Without the use of selective agents, the efficiency of plant regeneration can be increased to obtain modified plants that do not contain exogenous nucleotide sequences.

In other embodiments, the base editing system of the present invention can be transformed into specific sites of untreated plants such as leaves, shoot tips, pollen tubes, young ears, or hypocotyls. This is particularly suitable for the transformation of plants which are difficult to regenerate by tissue culture.

In some embodiments of the invention, the protein expressed in vitro and/or the RNA molecule transcribed in vitro is directly transformed into a plant. The protein and/or RNA molecule can achieve base editing within the plant cell and can be subsequently degraded by the cell to avoid integration of the exogenous nucleotide sequence into the plant genome.

Thus, in some embodiments, the herbicide-tolerant plant is transgene-free.

Plants that can be used in the methods of the invention include monocots and dicots. For example, the plant may be a crop plant such as wheat, rice, corn, soybean, sunflower, sorghum, canola, alfalfa, cotton, barley, millet, sugar cane, tomato, tobacco, tapioca, or potato. The plant may also be a vegetable crop, including but not limited to cabbage, kale, cucumber, tomato. The plant may also be a flower crop, including but not limited to carnations, peonia, roses, and the like. The plant may also be a fruit crop, including but not limited to watermelon, melon, strawberry, blueberry, grape, apple, citrus, peach. The plant may also be a Chinese herb that includes, but is not limited to, Radix isatidis, licorice, ginseng, and Saposhnikovia divaricata. The plant can also be Arabidopsis thaliana.

In some embodiments of the invention, the method further comprises obtaining a progeny of the herbicide tolerant plant.

In another aspect, the invention also provides a herbicide tolerant plant or progeny or part thereof, wherein said plant is obtained by the above-described method of the invention. In some embodiments, the herbicide tolerant plant is transgene-free.

In another aspect, the present invention provides for crossing a first herbicide-tolerant plant obtained by the above-described method of the present invention with a second plant that has no herbicide tolerance, thereby providing a herbicide. There is also provided a plant crossing method comprising introducing resistance into a second plant.

The invention also includes herbicide-tolerant plants or progeny obtained by the method of the invention.

IV. Identifying Variants of Herbicide Resistance-Associated Proteins By the method of the present invention, a large number of mutants of herbicide tolerance-related genes are easily obtained by targeted base modification of herbicide tolerance-related genes. , And new herbicide resistance mutations can then be identified through resistance screening.

Accordingly, the present invention provides the following: i) to produce a herbicide tolerant plant by the method of Section III above;
ii) determining the herbicide resistance-related gene and/or the encoded herbicide resistance-related protein in the resulting herbicide-tolerant plant, thereby identifying the sequence of the mutant, and Also provided is a method of identifying a mutant of a herbicide tolerance-related protein that can be imparted to a plant.

V. Herbicide Tolerance Associated Protein Variants, Nucleic Acids, Expression Constructs and Uses thereof The present invention also provides variants of the herbicide tolerance related proteins identified by the methods according to the previous Section IV of the present invention.

The present invention also provides a plant ACCase variant as compared to wild-type ACCase, wherein the ACCase variant is 1768, 1793, 1796, 1797, 1794, 1800, 1801, 1813, 1813, 1815, 1825. , 1827, 1815, 1816, 1817, 1837, 1838, 1849, 1850, 1854, 1855, 1874, 1875, 1971, 1872, 1983, 1989, 1990, 1993, 1994, 2003, 2004, 2005, 2007, 2008, 2024. , 2027, 2028, 2029, 2047, 2070, 2071, 2090, 2091, 2090, 2106, 2099, 2106, 2119, 2220, comprising a mutation of an amino acid at one or more positions, wherein See SEQ ID NO: 1 for amino acid position and the mutant confers herbicide tolerance to plants. In some embodiments, the amino acid mutations are S1768F, R1793K, A1794T, R1793K+A1794T, R1825H, D1827N, R1825H+D1827N, L1815F, A1816V, R1817stop, L1815F37R17+17+18,18+18,18A18,18A18,18A16,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18,18A18A18 , G1854D, G1855D, G1855S, G1854N, G1854D + G1855D, G1854D + G1855S, G1854D + G1855N, D1971N, D1972N, D1971N + D1972N, G1983D, P1993S, P1993L, P1993F, R1994C, P1993S + R1994C, P1993L + R1994C, P1993F + R1994C, S2003F, A2004V, T2005I, S2003F + A2004V, S2003F + T2005I, A2004V + T2005I, T2007I , A2008V, T2007I + A2008V, R2028K, G2029D, G2029S, G2029N, R2028K + G2029D, R2028K + G2029S, R2028K + G2029N, T2047I, R2070Q, G2071R, R2070Q + G2071R, A2090T, E2091K, A2090T + E2091K, A2090V, E2106K, S2119N, R2220Q, S2119N + R2220Q, A1813V, R1793K, A1794T, R1793K + A1794T , E1796K, E1797K, E1796K + E1797K, T1800M, L1801F, T1800M + L1801F, A1813V, G1854D, G1854S, G1854N, G1855D, G1855S, G1855N, G1854D + G1855D, G1854D + G1855S, G1854D + G1855N, G1854S + G1855D, G1854S + G1855S, G1854S + G1855N, G1854N + G1855D, G1854N + G1855S, G1854N + G1855N, S1849F, H1850Y, S1849F + H1850Y , D1874N, D1875N, D1874N+D1875N, W2027C, R2028K, W2027C+R2028K, G2029D, G2029S, G2029N, R202 8K + G2029D, R2028K + G2029S, R2028K + G2029N, L2024F, T2047I, R2070C, A2090V, G1983D, E1989K, R1990Q, E1989K + R1990Q, P1993S, P1993L, P1993F, R1994C, P1993S + R1994C, P1993L + R1994C, P1993F + R1994C, T2007I, A2008V, T2007I + A2008V, S2003L, A2004V, T2005I, S2003L + A2004V, S2003L+T2005I, A2004V+T2005I, S2003L, A2004V+T2005I, L2099F, E2106K, R2220K, G2119D, R2220K+G2119D, or any combination thereof, wherein the amino acid position refers to SEQ ID NO:1. In some specific embodiments, the amino acid mutations are selected from W2027C, W2027C+R2028K, where the amino acid position refers to SEQ ID NO:1.

In some embodiments, the ACCase is rice ACCase, the wild type sequence of which is shown in SEQ ID NO:14 (genbank ID: B9FK36). In some embodiments, the ACCase is a wheat ACCase, the wild type sequence of which is shown in SEQ ID NO: 15 (genbank ID: ACD46684.1).

Due to the expression of such mutants, plants (rice, corn, wheat and other monocotyledonous plants) will have cyclohexenone herbicides (such as crethodim), aryloxyphenoxypropionic acid herbicides (such as haloxyfop-P-methyl). , Phenylpyrazoline herbicides (such as oxazoline) and other ACCase inhibitors Herbicide single resistance (tolerant to one herbicide) or cross-tolerance (tolerant to more than one herbicide) Can be obtained. ACCase is a key enzyme in the fatty acid synthesis pathway of plants, and inhibition of its activity ultimately leads to plant death due to fatty acid deficiency.

The present invention also provides a plant ALS variant as compared to wild type ALS, wherein the ALS variant is one or more selected from 122, 197, 204, 205, 653, 654, 655, 659. Of the amino acid position, where the amino acid position refers to SEQ ID NO:2, which confers herbicide tolerance to the plant. In some specific embodiments, the mutation of amino acids, A122T, P197A, P197Y, P197S, P197L, P197F, D204N, A205T, D204N + A205T, E654K, G655D, G655S, G655N, E654K + G655D, E654K + G655S, E654K + G655N, G659N, P197S, P197L, P197F, D204N, A205T, D204N + A205T, G654D, G654S, G654N, G655D, G655S, G655N, G654D + G655D, G654D + G655S, G654D + G655N, G654S + G655D, G654S + G655S, G654S + G655N, G654N + G655D, G654N + G655S, G654N + G655N, A122T, or some combination thereof, Selected, where amino acid positions refer to SEQ ID NO:2. In some specific embodiments, the amino acid mutations are selected from P197A, P197F, P197S, P197Y, P197F+R198C, G654E+G655S, G654K+G655S, G654E+G659N, P197F+G654E+G655S, or any combination thereof at these positions. See SEQ ID NO:2.

In some embodiments, the ALS is rice ALS, the wild type sequence of which is set forth in SEQ ID NO:16. In some embodiments, the ALS is wheat ALS, the wild type sequence of which is shown in SEQ ID NO: 17 (partial sequence) (genbank ID: AAO535488.1).

Due to the expression of such mutants, plants (eg, monocots such as rice, corn, wheat, and dicots such as soybean, cotton, canola, and sunflower) are treated with the following herbicides: imidazolinone herbicides. Agents (such as imazames), sulfonylurea herbicides (such as nicosulfuron), triazolinone herbicides (such as flucarbazone sodium), triazolopyrimidine herbicides (such as penoxlam), pyrimidine salicylate herbicides (such as bispyribac-sodium) It may be possible to have a higher level of herbicide tolerance to one or more of ALS is a key enzyme in the synthesis of branched chain amino acids in plants, and inhibition of its activity ultimately results in plant death due to the lack of branched chain amino acids.

The present invention also provides a plant HPPD variant, which compared to wild-type HPPD, the HPPD comprises amino acid at one or more positions selected from 277, 364, 366, 413, 414, 415. A mutation is included where the amino acid position refers to SEQ ID NO:3, which confers herbicide resistance to the plant. In some specific embodiments, the mutation of amino acids, P277S, P277L, V364M, C413Y, G414D, G414S, G414N, G415E, G415R, G415K, G414D + G415E, G414D + G415R, G414D + G415K, G414S + G415E, G414S + G415R, G414S + G415K, G414N + G415E, G414N + G415R, G414N + G415K, C413Y + G415E, C413Y + G415R, C413Y + G415K, C413Y + G414D, C413Y + G414S, C413Y + G414N, C413Y + G414D + G415E, C413Y + G414D + G415R, C413Y + G414D + G415K, C413Y + G414S + G415E, C413Y + G414S + G415R, C413Y + G414S + G415K, C413Y + G414N + G415E, C413Y + G414N + G415R, C413Y + G414N + G415K, P277S, P277L, V366I, C413Y, G414D, G414S, G414N, G415E, G415R, G415K, G414D + G415E, G414D + G415R, G414D + G415K, G414S + G415E, G414S + G415R, G414S + G415K, G414N + G415E, G414N + G415R, G414N + G415K, C413Y + G415E, C413Y + G415R, C413Y + G415K, C413Y + G414D, C413Y + G414S, C413Y + G414N, C413Y + G414D + G415E, C413Y + G414D + G415R, C413Y + G414D + G415K, C413Y + G414S + G415E, C413Y + G414S + G415R, C413Y + G414S + G415K, C413Y + G414N + G415E, C413Y + G414N + G415R, C413Y+G414N+G415K, or some combination thereof.

In some embodiments, the HPPD is rice HPPD, the wild type sequence of which is shown in SEQ ID NO:3. In some embodiments, the HPPD is wheat HPPD, the wild type sequence of which is set forth in SEQ ID NO:18.

Due to the expression of such mutants, plants (eg, monocots such as rice, corn, wheat, and dicots such as soybean, cotton, rapeseed, and sunflower) may have one or more HPPD inhibitor herbicides ( For example, it may be possible to obtain higher levels of resistance to mesotrione, topramezone). HPPD is a key enzyme in the chlorophyll synthesis pathway in plants. Inhibition of the activity of HPPD ultimately results in plant bleaching and killing.

The invention also provides a plant EPSPS variant as compared to wild type EPSPS, wherein the EPSPS comprises a mutation of an amino acid at one or more positions selected from 102 and 103, wherein the amino acid Position refers to SEQ ID NO:4, which confers herbicide tolerance to plants. In some embodiments, the amino acid mutation is selected from the group consisting of T102I, A103V, T102I+A103V. The EPSPS enzyme is a key enzyme in the synthesis of aromatic amino acids in plants, and inhibition of its activity ultimately leads to plant death due to the lack of aromatic amino acids.

In some embodiments, the EPSPS is wheat EPSPS, the wild type sequence of which is shown in SEQ ID NO:4.

Expression of such variants can significantly increase resistance to glyphosate in plants (eg, monocots such as rice, corn, wheat, and dicots such as soybean, cotton, rapeseed, and sunflower). it can.

In some embodiments, the variants of the invention also include mutations of other amino acids known in the art that are capable of conferring herbicide tolerance to plants.

The invention also provides an isolated nucleic acid comprising a nucleotide sequence encoding a variant of the invention.

The invention also provides an expression cassette comprising a nucleotide sequence encoding a variant of the invention operably linked to regulatory sequences.

The invention also provides an expression construct comprising a nucleotide sequence encoding a variant of the invention, said nucleotide sequence being operably linked to a regulatory sequence.

The invention also provides the use of the mutants, isolated nucleic acids, expression cassettes and expression constructs of the invention in the production of herbicide tolerant plants.

The present invention also provides a method for producing a herbicide-resistant plant, which comprises introducing the isolated nucleic acid of the present invention, the expression cassette of the present invention, and/or the expression construct of the present invention into a plant.

The invention also provides herbicide-tolerant plants containing or transformed with the expression cassettes of the invention. The invention also covers the progeny of herbicide tolerant plants.

The plants include monocots and dicots. For example, the plant may be a crop plant such as wheat, rice, corn, soybean, sunflower, sorghum, canola, alfalfa, cotton, barley, millet, sugar cane, tomato, tobacco, tapioca, or potato. The plant may also be a vegetable crop, including but not limited to cabbage, kale, cucumber, tomato. The plant may also be a flower crop, including but not limited to carnations, peonia, roses, and the like. The plant may also be a fruit crop, including but not limited to watermelon, melon, strawberry, blueberry, grape, apple, citrus, peach. The plant may also be a Chinese herb that includes, but is not limited to, Radix isatidis, licorice, ginseng, and Saposhnikovia divaricata. The plant can also be Arabidopsis thaliana.

Example 1. Construction of Base Editing Vectors In this example, base editing vectors for herbicide resistance related genes such as ALS, ACCase, EPSPS, and HPPD for different crops were constructed.

rice:
Yuan Zong (Zong, Y. et al. Precise base editing in rice, where and maize with a Cas9- cytidine deaminase gene, Na. Biotechnol. A gene and a base editing vector targeting the OsHPPD gene was constructed using the pH-nCas9-PBE construct. In particular, 4 target single sites in OsALS (R1-R4), 3 target dual sites in OsALS gene (R25-R27), and 20 target single sites in OsACCase gene (R5-R24). , And four target single sites of OsHPPD (R28 to R30). The sgRNA target sequences in this experiment are shown in Table 1. Potential resistance mutations are shown in Table 3.

Wheat:
Yuan Zong (Zong, Y. et al. Precise base editing in rice, where and maize with a Cas9- cytidine deaminase fusion, Nat. Biotechnol. A base editing vector targeting the TaEPSPS and TaHPPD genes was constructed using pTaU6. In particular, four target single sites in the TaALS gene (W1 to W3, W16), three target double sites in the TaALS gene (W31 to W33), 20 target single sites in the TaACCase gene (W4 to W16). W15, W17-W24), three target single sites of the TaEPSPS gene (W25-W27) and three target single sites of the TaHPPD gene (W28-W30), and one simultaneous TaALS gene and TaACCase. Of the target double site (W34). The sgRNA target sequences in this experiment are shown in Table 2. Potential resistance mutations are shown in Table 4.

Example 2. Transformation of Rice and Wheat Rice (Agrobacterium-based transformation):
The pH-nCas9-PBE vector was transformed into Agrobacterium strain AGL1 by electroporation. Agrobacterium-mediated transformation, tissue culture and regeneration of Zhonghua 11 was performed by Shan et al. (Shang, Q. et al. Targeted genome modification of crop plants using a CRISPR-Cassystem. )). Hygromycin selection (50 μg/ml) was used during all subsequent tissue culture.

Wheat (particle bombardment transformation):
As already described (Zhang, K., Liu, J., Zhang, Y., Yang, Z. & Gao, C. Biolistic genetic transformation of China elite livewe. J. Genet Genomics. 42, 39-42 (2015)), plasmid DNA (equally mixed pnCas9-PBE vector and pTaU6 vector respectively) were used to apply particles to Kenong 199 embryos. After bombardment, embryos were processed according to Zhang, K et al., but no selection agent was used during tissue culture.

Example 3. Establishing Tolerance Screening Conditions for Transformed Plants The herbicides listed in Table 5 were selected and 1/2 MS medium containing different concentrations of herbicides was added to wild-type rice and wild-type wheat tissue culture. Was prepared for screening seedlings of. After 7 days, the minimum herbicide concentration that suppressed plant growth was selected for subsequent screening of transformed plants.

Example 4. Screening and Identification of Resistant Plants The transformed plants obtained in Example 3 were grown on the corresponding herbicide screening medium (Table 5), the phenotype was observed and resistant plants were selected (Fig. 1-Fig. 3).

After extracting the DNA of resistant plants, T7EI and PCR/RE were performed. Finally, target gene mutations were confirmed by Sanger sequencing.

As a result, the following mutations in the plant endogenous proteins ALS and ACCase were identified as herbicide resistance mutations. In addition to the C to T mutation, the base editing system of the present invention can also result in a C to G/A mutation, so we screened for unexpected resistance mutations.

Claims (24)

A method for producing a herbicide-tolerant plant, preferably a transgene-free herbicide-tolerant plant, which comprises introducing a system for base-editing a herbicide-resistance-related gene into said plant, whereby a guide RNA Targeting a base-editing fusion protein with a target sequence of a herbicide tolerance-related gene in the plant, resulting in one or more nucleotide substitutions in the target sequence, the system comprising: )-(V);
i) a base editing fusion protein and a guide RNA,
ii) an expression construct comprising a nucleotide sequence encoding a base-editing fusion protein and a guide RNA,
iii) a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA,
iv) an expression construct comprising a nucleotide sequence encoding a base-editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA,
v) At least one of the expression constructs containing a nucleotide sequence encoding a base-editing fusion protein and a nucleotide sequence encoding a guide RNA, wherein the base-editing fusion protein is a nuclease inactive CRISPR (nuclease inactive) (Eg Cas9) domain and a deaminase domain, wherein the guide RNA can target the base-editing fusion protein with a target sequence in the herbicide resistance-related gene within the plant genome,
Said one or more nucleotide substitutions confer herbicide tolerance to said plant,
Optionally, the method further comprises screening the plant for herbicide tolerance. The method according to claim 1, wherein the herbicide resistance-related gene encodes a herbicide resistance-related protein selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, P450. The method according to claim 1, wherein the base-editing fusion protein comprises the amino acid sequence of SEQ ID NO: 10 or SEQ ID NO: 11. 2. The method of claim 1, wherein the guide RNA targets one or more of SEQ ID NO:19-SEQ ID NO:78. The herbicide tolerance related gene encodes for ACCase and the one or more nucleotide substitutions result in an amino acid substitution within the ACCase selected from W2027 and W2027+R2028, wherein the amino acid position is SEQ ID NO: 1 The method according to claim 1, which is shown in FIG. The herbicide resistance-related gene encodes for ALS, and the one or more nucleotide substitutions are P197A, P197F, P197S, P197Y, P197F+R198C, G654E+G655S, G654K+G655S, G654E+G659N, any combination of P197F+G654E+G655S, or any of these selected from P197F+G654E+G655S. The method of claim 1, wherein an internal amino acid substitution results, wherein the amino acid position is set forth in SEQ ID NO:2. The herbicide tolerance-related gene encodes for ALS and the guide RNA is an amino acid selected from the group consisting of A122, P197, R198, D204, A205, G654, G655, G659, or any combination thereof. 2.) The method of claim 1, wherein the targeting sequence comprises a targeting sequence comprising a sequence encoding a), wherein the amino acid position is set forth in SEQ ID NO:2. The herbicide tolerance-related gene encodes for ACCase, and the guide RNA is S1768, R1793, A1794, R1825, D1827, L1815, A1816, R1817, A1837, G1854, G1855, D1971, D1972, G1983, P1993, R1994, S2003. , A2004, T2005, T2007, A2008, R2028, G2029, T2047, R2070, G2071, A2090, E2091, E2106, S2119, R2220, A1813, E1796, E1797, T1800, L1801, S1849, H1850, D1874, D1875, L2075, L2098. , R1990, L2099, or any combination thereof, targeting a target sequence comprising a sequence encoding one or more amino acids, wherein the amino acid position is SEQ ID NO: 1 The method according to claim 1, which is shown in FIG. Wherein the herbicide tolerance-related gene codes for EPSPS and the guide RNA targets a target sequence comprising a sequence coding for one or more amino acids selected from the group consisting of T102 and/or A103, wherein The method of claim 1, wherein the amino acid position is shown in SEQ ID NO:4. One or more amino acids selected from the group consisting of the herbicide tolerance-related gene encoding for HPPD and the guide RNAs consisting of P277, V364, C413, G414, G415, V366, or any combination thereof. 2. The method of claim 1, wherein the targeting sequence comprises a targeting sequence comprising a sequence encoding the amino acid sequence, wherein the amino acid position is set forth in SEQ ID NO:3. A method for identifying a mutant of a herbicide tolerance-related protein, wherein the mutant is capable of imparting herbicide resistance to a plant,
i) creating a herbicide tolerant plant by the method of claim 1.
ii) determining the sequence of said herbicide tolerance related gene and/or the sequence of the encoded herbicide tolerance related protein in the resulting herbicide tolerant plant, thereby identifying the sequence of said variant. ,Method. 12. The method of claim 11, wherein the herbicide tolerance related herbicide tolerance related protein is selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, P450. A mutant of the herbicide tolerance-related protein identified by the method according to claim 11 or 12, which is capable of conferring herbicide resistance to a plant. Compared to the wild-type ACCase, the ACCase mutant has 1768, 1793, 1796, 1797, 1794, 1800, 1801, 1813, 1813, 1815, 1825, 1827, 1815, 1816, 1817, 1837, 1838, 1849. , 1850, 1854, 1855, 1874, 1875, 1971, 1872, 1983, 1989, 1990, 1993, 1994, 2003, 2004, 2005, 2007, 2008, 2024, 2027, 2028, 2029, 2047, 2070, 2071, 2090. , 2091, 2090, 2106, 2099, 2106, 2119, 2220, comprising an amino acid mutation at one or more positions, wherein the amino acid position is SEQ ID NO: 1. An ACCase variant as shown in 1, wherein the variant confers herbicide tolerance to plants. ALS variants, wherein the ALS variant comprises a mutation of an amino acid at one or more positions selected from 122, 197, 204, 205, 653, 654, 655, 659 as compared to wild type ALS. An ALS mutant, which is a mutant, wherein the amino acid position is shown in SEQ ID NO: 2, and the mutant confers herbicide resistance to plants. A variant of HPPD, wherein said HPPD comprises a mutation of an amino acid at one or more positions selected from 277, 364, 366, 413, 414, 415 compared to wild type HPPD, The position of the amino acid is shown in SEQ ID NO: 3 and the mutant HPPD, wherein the mutant confers herbicide tolerance to plants. A EPSPS variant, wherein said EPSPS comprises a mutation of an amino acid at one or more positions selected from 102 and 103 compared to wild-type EPSPS, wherein said amino acid position is SEQ ID NO: 4 And the EPSPS mutant, wherein said mutant confers herbicide tolerance to plants. An isolated nucleic acid comprising a nucleotide sequence encoding a variant according to any one of claims 13 to 17. An expression cassette comprising a nucleotide sequence encoding a variant according to any one of claims 13 to 17 operably linked to a regulatory sequence. An expression construct comprising a nucleotide sequence encoding a variant according to any one of claims 13 to 17, wherein said nucleotide sequence is operably linked to a regulatory sequence. A variant according to any one of claims 13 to 17 in the production of a herbicide tolerant plant, an isolated nucleic acid according to claim 18, an expression cassette according to claim 19 and a claim 20. Use of expression constructs. A method for producing a herbicide-resistant plant, which comprises introducing the isolated nucleic acid according to claim 18, the expression cassette according to claim 19, and/or the expression construct according to claim 20 into a plant. 20. Obtained by the method of claim 1 or claim 22, comprising the expression cassette of claim 19, or transforming with the isolated nucleic acid of claim 18 or the expression construct of claim 20. Herbicide tolerant plants. The plant is selected from monocotyledonous plants and dicotyledonous plants, for example, the plant is wheat, rice, corn, soybean, sunflower, sorghum, canola, alfalfa, cotton, barley, millet, sugar cane, tomato, tobacco, tapioca. , Potato, cabbage, kale, cucumber, tomato, carnation, peony, rose, watermelon, melon, strawberry, blueberry, grape, apple, citrus, peach, radix isatidis, licorice, ginseng, saposhinikavia var. ), and Arabidopsis thaliana, the method according to any one of claims 1 to 10, the mutant according to any one of claims 13 to 17, The use according to claim 21, the method according to claim 22, and the herbicide-tolerant plant according to claim 23.

Images