CN113201557B - Method for guiding editing system to mediate crops to generate endogenous herbicide resistance - Google Patents
Method for guiding editing system to mediate crops to generate endogenous herbicide resistance Download PDFInfo
- Publication number
- CN113201557B CN113201557B CN202110506582.0A CN202110506582A CN113201557B CN 113201557 B CN113201557 B CN 113201557B CN 202110506582 A CN202110506582 A CN 202110506582A CN 113201557 B CN113201557 B CN 113201557B
- Authority
- CN
- China
- Prior art keywords
- leu
- ala
- ser
- val
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
- C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
- C12Y604/01002—Acetyl-CoA carboxylase (6.4.1.2)
Abstract
The invention discloses a method for guiding an editing system to mediate crops to generate endogenous herbicide resistance, and obtains ACCase mutant genotypes with multiple herbicide resistances, wherein the ACCase mutant genes respectively obtain single amino acid mutation at different sites. Firstly, an ACCase mutant gene is obtained by utilizing a CRISPR-mediated guide editing system, and the ACCase mutant gene is specifically represented by the way that the 1879 th amino acid is respectively mutated into leucine, threonine, valine, serine, methionine and the like from isoleucine, the 1927 th amino acid is mutated into tyrosine or phenylalanine from proline, the 2097 th amino acid is mutated into glycine, serine or leucine from tryptophan, the 2139 th amino acid is mutated into aspartic acid, valine and serine from isoleucine, the 2176 th amino acid is mutated into glycine, and the 2194 th amino acid is mutated into serine and alanine from glycine. These ACCase mutant genes confer to varying degrees resistance to herbicides of the acetyl-coa carboxylase inhibitor class to recipient plants.
Description
Technical Field
The invention belongs to the field of plant genetic engineering and plant herbicide-resistant breeding, and a multi-type ACCase gene mutant herbicide-resistant rice strain is obtained by utilizing a guide editing system.
Background
The shortage of food is one of the most serious global problems in this century, and in recent years, with the rapid development of social economy and the continuous improvement of agricultural technology, the shortage of food is alleviated, but in order to meet the growing demand for food due to the rapid growth of population, there is an urgent need to improve the yield of rice and improve the quality of rice. With the large-area application of the direct seeding cultivation technology of rice in agricultural production, the problem of weeds in the paddy field in the direct seeding production of rice becomes an important factor influencing the crop yield. In order to control weeds in rice fields, a large amount of manpower, material resources and financial resources are invested, and a large amount of herbicide is sprayed. The traditional breeding mode is long in period and deficient in available germplasm resources, so that the cultivation of herbicide-resistant rice is necessary.
Due to the widespread use of chemical herbicides, weed resistance occurs at such a high rate and over such a wide range, not only increasing the cost of weeding, but also increasing environmental stress. Currently, there are two views of the cause of the development of resistant weed populations: a method for controlling the resistance of weeds to herbicides, which comprises contacting the weeds with the herbicides for a long period of time to cause mutation or alteration in gene expression of a gene coding for the site of action of the herbicides, resulting in improvement in the detoxification ability of the weeds to the herbicides or in the appearance of herbicide-resistant or drug-resistant populations. In general, the development of weed resistance is essentially a process by which a resistance gene is selected, and the inheritance of the resistance gene is the basis for the development of resistance by weeds. Previous reports suggest that resistance occurs not only because plants alter the uptake and transport of herbicides or plants accelerate herbicide metabolism, but also primarily because the site of action of herbicides is altered. A significant proportion of weeds acquire resistance by deregulating or reducing their affinity for herbicides through a change in the target enzyme ACCase. With the development of transgenic technology and genome editing technology, an effective way is provided for the herbicide-resistant breeding of rice.
Disclosure of Invention
The technical problem is as follows: the technical problem to be solved by the invention is to provide a method for guiding an editing system to mediate crop to generate endogenous herbicide resistance, and also to provide a rice ACCase mutant protein capable of endowing plants with resistance to (tolerance to) acetyl coenzyme A carboxylase herbicides.
To this end, the invention provides a method for guiding an editing system to mediate the generation of endogenous herbicide resistance of crops, which is characterized in that the method comprises the following steps:
1) Constructing a guide editing expression box containing ACCase specific site random mutation, sgRNA and a guide template RNA expression box;
2) Genetically transforming the target crop by the expression vector in the expression cassette to make the target crop contain ACCase mutant protein, wherein the ACCase mutant protein is mutated at least one of the following sites: 1879 th, 1927 th, 2097 th, 2139 th, 2176 th and 2194 th;
3) And (3) allowing the target crops to express the rice ACCase mutant protein.
In one embodiment, the invention provides a rice ACCase mutant protein, wherein a plurality of amino acid sequences of the ACCase mutant protein are subjected to site-directed substitution to obtain a mutant.
Preferably, the rice ACCase of the present invention has various types of mutations at amino acids 1879, 1927, 2097, 2139, 2176 and 2194.
Preferably, the 1879 th amino acid is mutated from isoleucine to leucine, threonine, valine, serine, methionine, etc., the 1927 th amino acid is mutated from proline to tyrosine or phenylalanine, the 2097 th amino acid is mutated from tryptophan to glycine, serine or leucine, the 2139 th amino acid is mutated from isoleucine to asparagine, valine or serine, the 2176 th amino acid is mutated from aspartic acid to glycine, and the 2194 nd amino acid is mutated from glycine to serine and alanine, respectively.
The invention also provides a rice ACCase mutant protein, which comprises one of the following proteins: (a) 1, and the amino acid sequence in (a) is subjected to site-directed substitution to obtain the protein with acetyl-CoA carboxylase activity and derived from (a).
The invention also provides a nucleic acid or gene encoding the protein.
The nucleic acid or gene of the present invention comprises:
(i) Nucleic acids or genes encoding said proteins; or
(ii) A nucleotide sequence which hybridizes with the nucleotide sequence defined in (a) under stringent conditions and encodes a protein having acetyl-CoA carboxylase activity.
The invention also provides a recombinant vector containing the nucleic acid or the gene.
The invention also provides the method of the invention and the application of the corresponding ACCase mutant protein, nucleic acid or gene and recombinant vector in herbicide resistance of plants.
The present invention also provides a method for obtaining a plant having herbicide resistance, comprising the steps of: 1) Allowing the plant to comprise the nucleic acid or gene; or
2) Allowing the plants to express the rice ACCase mutant protein.
The invention also provides methods of obtaining plants that are herbicide resistant. The method is not only suitable for obtaining the ACCase gene, but also comprises the obtaining of other plant gene mutants and materials.
Further, the present invention provides methods for enhancing the tolerance of plants, plant tissues, plant cells to at least one herbicide that interferes with the activity of the ACCase enzyme. Thus, herbicide resistance in the present invention refers to resistance to (tolerance to) acetyl-coa carboxylase herbicides.
The method of enhancing the resistance of a plant, plant tissue or plant cell to a herbicide according to the present invention can be carried out by transformation or by crossing, selfing and asexual propagation, and can also be obtained by site-directed mutagenesis of a gene so that the target plant includes the mutated sequence of the present invention.
The method for enhancing the herbicide resistance of the plant, the plant tissue or the plant cell can be implemented by transformation or hybridization, selfing and asexual propagation, and can also be obtained by means of gene site-directed mutagenesis, so that the target plant expresses the amino acid sequence of the invention.
The invention also provides a herbicide-tolerant rice plant, which expresses the ACCase gene containing herbicide-resistant mutation sites, wherein the gene sequence is different from the ACCase gene sequence of a wild rice plant, and is a sequence of the ACCase gene containing herbicide-resistant mutation sites. The inventor obtains the rice ACCase mutant sequence carrying the mutant site by a directional mutation method, and transfers the rice ACCase mutant sequence into a wild rice variety, and finds that the transgenic rice carrying the ACCase mutant site can resist the ACCase herbicide, while the wild rice is sensitive to the ACCase herbicide. The invention also provides the application of the nucleic acid or the gene and the protein in plant breeding for cultivating plants with herbicide resistance, especially crops, and also provides the application of the protein and the coding gene thereof in transgenic or non-transgenic plants such as rice and the like.
Drawings
Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:
FIG. 1 shows a guide editing carrier schematic
FIG. 2 shows a guide editing plant containing ACCase mutation sites,
FIG. 3 is a graph showing the sequencing results of the ACCase mutation sites of rice;
FIG. 4 shows the comparison of the herbicide-resistant effect of another mutant of the present invention with that of the wild type.
Detailed Description
The present invention will be described below with reference to examples. It will be understood by those skilled in the art that the following examples are illustrative only and are not intended to limit the scope of the present invention in any way.
The experimental procedures in the following examples are conventional unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.
Example 1 plant ACCase mutation site acquisition and construction of plant expression vectors
Taking rice as an example, the nucleotide sequence TTCCTCGTGCTGGACAAGTG in ACC gene of plants is selectedMultiple positions of TGG, etc Dot(the underlined part is the PAM sequence of the 5'NGG-3' structure) as a targeting site. Synthesizing (general biological Co., ltd.) a forward oligonucleotide chain and a complementary reverse oligonucleotide chain according to the selected target site, wherein the specific sequences are shown in Table 1:
TABLE 1
CRISPR-mediated guided editing system
The invention adopts a SpCas9 protein-mediated guide editing system pHUN411-PE2, which can introduce random mutation of pre-designed NNN on a genome. The pHUN411-PE2 vector was digested with BsaI endonuclease (NEB) at 37 ℃ for 4 hours, and the digestion system was inactivated at 65 ℃ for 10 minutes, to serve as a backbone fragment for constructing a recombinant vector. The backbone fragment and the insert of the recombinant vector and sgRNA Scoffold were ligated end-to-end by the Goldgate method (NEB) and introduced into E.coli. Positive transformants were obtained by selecting plaques with kanamycin resistance and no spectinomycin resistance. After sequencing verification, positive plasmids are extracted to form a recombinant vector plasmid for plant ACC gene CRISPR/Cas9 targeting, which is named as pHUN411-PE2-ACC PegRNA, a plant expression vector is transferred into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (plant group preservation of the center for component supervision and inspection of transgenic biological products of the department of agriculture of the academy of agricultural sciences of Anhui) by a freeze-thaw method, and positive clones are obtained by colony PCR screening, so that the Agrobacterium containing the pHUN411-PE2-ACC PegRNA is obtained. The guide editing vector used to target ACCase is shown in figure 1.
Example 2 Positive transgenic plants
After the glumes of the mature rice seeds are removed, the seeds are soaked in 70% alcohol for 1min, and the alcohol is poured off. Seeds were soaked for 40min (150 r/min) with 1 drop of Tween 20 in 50% sodium hypochlorite (stock solution available chlorine concentration greater than 4%). And pouring off sodium hypochlorite, and washing for 5 times by using sterile water until the solution is clear and has no sodium hypochlorite taste. The seeds were soaked in sterile water overnight. The embryos were removed from the seeds along the aleurone layer with a scalpel and inoculated onto callus induction medium. After dark culture for 11 days at 30 ℃, separating the callus from endosperm and embryo, and pre-culturing the primary callus with good bud removing state and vigorous division for 3-5 days for agrobacterium transformation.
Agrobacterium tumefaciens transformed with the recombinant expression vector described above was used for Agrobacterium-mediated genetic transformation, selection of transformants, regeneration of transgenic plants, etc. by the method described in connection with Yongbo Duan (Yongbo Duan, chenguang Zhai, et al. An effective and high-throughput protocol for Agrobacterium mediated transformation based on phosphorus enzyme mutation selection in Japonica rice Plant (Oryza sativa L. [ J ]. Plant Report,2012.DOI 10.10/s 00299-012-1275-3), etc., 2. Mu.M haloxyfop herbicide was added to the medium to obtain resistant calli, and further resistant plants were obtained (FIG. 1).
Example 3: mutation site analysis of plant acetyl coenzyme A carboxylase herbicide-resistant mutant 2139
The obtained herbicide-resistant mutant plants were subjected to leaf selection and genomic DNA extraction, and sent to Invitrogen corporation for amplification and monoclonal cloning. The sequencing result is compared with the wild type Nipponbare ACCase gene, and the base mutation is found at different target positions of the ACCase gene. It is noted that the mutant plants were obtained by screening under the condition of herbicide as screening pressure.
Referring to fig. 2, the inventor transplanted wild type and two kinds of mutant plants into soil, after spraying haloxyfop-p-methyl 0.15g/L for 2 times every 3 days, the mutant plants showed resistance to herbicide, and three groups of plants were wild type, plants with 2139 th site mutated to asparagine and valine, and plants with 2139 th site mutated to serine, respectively.
As shown in the middle part of FIG. 2, since the conversion of the picture into a gray image may not be obvious, but it is obvious from the original picture that the leftmost wild type gene plant is withered and yellow and loses vitality, the plant I2139S with the middle 2139 th site mutated into leucine is still life-sign and is a green plant, but the growth is still inhibited, the plant height is obviously lower than that of the plants I2139V and I2139N,
furthermore, it was demonstrated that the mutants found by the inventors of the present application all have herbicide resistance, with I2139V and I2139N being particularly preferred.
Similarly, using the same method as described above, the inventors of the present application have found several sites that can be used to develop herbicide resistance, namely, 1879 th, 1927 th, 2097 th, 2176 th and 2194 th sites.
Taking 2097 as an example (the sequence of the mutant is shown in a sequence table 1), as shown in figure 4, the mutant gene has 2-site mutation on ACCase gene, the nucleotide at the 6289 th site has mutation, and is respectively changed from T to G, or the nucleotide at the 6289 th site and the nucleotide at the 6291 st site have mutation, and is respectively changed from T to G and G to C/T, (namely, the 6289-6291 site has mutation from TGG to GGG or GGC or GGT), so that the tryptophan to glycine is changed at the 2097 th site of the corresponding coded amino acid sequence, the experimental effect under similar experiments can be obviously seen from figure 4, the wild type and two mutant plants are transplanted into soil, after 0.15G/L haloxyfop is sprayed for 2 times every 3 days, the mutant plants show the resistance to herbicides, and the three groups of plants are respectively wild type plants, plants with leucine at the 2097 th site and plants with glycine at the 2097 th site.
As can be seen from the figure, the leftmost wild type gene plant is withered and yellow and loses vitality, and the W2097L of the plant with the 2097 th site mutated into leucine in the middle still has life signs and is a green plant, but the growth of the plant is inhibited, and the plant height is obviously lower than that of the W2097G.
Furthermore, it was confirmed that the mutants found by the present inventors all have herbicide resistance, and particularly W2097G resistance is excellent.
While the principles of the invention have been described in detail in connection with the preferred embodiments thereof, it will be understood by those skilled in the art that the foregoing embodiments are merely illustrative of exemplary implementations of the invention and are not limiting of the scope of the invention. The details in the examples are not to be construed as limitations on the scope of the invention, and any obvious modifications, equivalent alterations, simple substitutions, etc. based on the technical solution of the present invention are intended to fall within the scope of the present invention without departing from the spirit and scope of the present invention.
Sequence listing
Less than 110 and more than Anhui province academy of agricultural sciences
< 120 > a method for guiding editing system to mediate crops to generate endogenous herbicide resistance
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2414
<212> PRT
< 213 > mutant (ACCase)
<400> 1
Met Pro Met Arg Pro Trp Glu Phe Ile Ile Leu Gly Arg Thr Ala Pro
1 5 10 15
Ile Ser Pro Pro Pro Leu Gly Ile Ser Ala Phe Ser Arg Pro Leu Arg
20 25 30
Leu Arg Leu Arg Leu Arg Leu Ala Ala Val Val Asp Ala Ala Arg Ile
35 40 45
Gln Thr Pro Pro Arg Val Ala Phe Ser Ala Phe Phe Phe Phe Phe Phe
50 55 60
Phe Phe Ser Glu Gly Leu Ser Arg Glu Gly Thr Ala Ala Arg Leu Pro
65 70 75 80
Ala Leu Ile Tyr Arg Val Pro Phe Ile Pro Cys Leu Leu Gln Leu Gln
85 90 95
Ile Arg Ala Pro His Ala Asp Pro Arg Pro Ala Gly Phe Ser Cys Ala
100 105 110
His His Phe Leu Ala Leu Ala Gln Gly Leu Ser Ser Ser Leu Leu Ser
115 120 125
Gly Thr Ile Ser His Ile Trp Gly Phe Ile Phe Ser Leu Tyr Gly Thr
130 135 140
Thr His Leu Arg Asn Arg Ala Ile Leu Leu Phe Gly Leu Ala Gly Ile
145 150 155 160
Ile Asp Leu Pro Asn Asp Ala Ala Ser Glu Val Asp Ile Ser His Gly
165 170 175
Ser Glu Asp Pro Arg Gly Pro Thr Val Pro Gly Ser Tyr Gln Met Asn
180 185 190
Gly Ile Ile Asn Glu Thr His Asn Gly Arg His Ala Ser Val Ser Lys
195 200 205
Val Val Glu Phe Cys Thr Ala Leu Gly Gly Lys Thr Pro Ile His Ser
210 215 220
Val Leu Val Ala Asn Asn Gly Met Ala Ala Ala Lys Phe Met Arg Ser
225 230 235 240
Val Arg Thr Trp Ala Asn Asp Thr Phe Gly Ser Glu Lys Ala Ile Gln
245 250 255
Leu Ile Ala Met Ala Thr Pro Glu Asp Leu Arg Ile Asn Ala Glu His
260 265 270
Ile Arg Ile Ala Asp Gln Phe Val Glu Val Pro Gly Gly Thr Asn Asn
275 280 285
Asn Asn Tyr Ala Asn Val Gln Leu Ile Val Glu Ile Ala Glu Arg Thr
290 295 300
Gly Val Ser Ala Val Trp Pro Gly Trp Gly His Ala Ser Glu Asn Pro
305 310 315 320
Glu Leu Pro Asp Ala Leu Thr Ala Lys Gly Ile Val Phe Leu Gly Pro
325 330 335
Pro Ala Ser Ser Met His Ala Leu Gly Asp Lys Val Gly Ser Ala Leu
340 345 350
Ile Ala Gln Ala Ala Gly Val Pro Thr Leu Ala Trp Ser Gly Ser His
355 360 365
Val Glu Val Pro Leu Glu Cys Cys Leu Asp Ser Ile Pro Asp Glu Met
370 375 380
Tyr Arg Lys Ala Cys Val Thr Thr Thr Glu Glu Ala Val Ala Ser Cys
385 390 395 400
Gln Val Val Gly Tyr Pro Ala Met Ile Lys Ala Ser Trp Gly Gly Gly
405 410 415
Gly Lys Gly Ile Arg Lys Val His Asn Asp Asp Glu Val Arg Thr Leu
420 425 430
Phe Lys Gln Val Gln Gly Glu Val Pro Gly Ser Pro Ile Phe Ile Met
435 440 445
Arg Leu Ala Ala Gln Ser Arg His Leu Glu Val Gln Leu Leu Cys Asp
450 455 460
Gln Tyr Gly Asn Val Ala Ala Leu His Ser Arg Asp Cys Ser Val Gln
465 470 475 480
Arg Arg His Gln Lys Ile Ile Glu Glu Gly Pro Val Thr Val Ala Pro
485 490 495
Arg Glu Thr Val Lys Glu Leu Glu Gln Ala Ala Arg Arg Leu Ala Lys
500 505 510
Ala Val Gly Tyr Val Gly Ala Ala Thr Val Glu Tyr Leu Tyr Ser Met
515 520 525
Glu Thr Gly Glu Tyr Tyr Phe Leu Glu Leu Asn Pro Arg Leu Gln Val
530 535 540
Glu His Pro Val Thr Glu Trp Ile Ala Glu Val Asn Leu Pro Ala Ala
545 550 555 560
Gln Val Ala Val Gly Met Gly Ile Pro Leu Trp Gln Ile Pro Glu Ile
565 570 575
Arg Arg Phe Tyr Gly Met Asn His Gly Gly Gly Tyr Asp Leu Trp Arg
580 585 590
Lys Thr Ala Ala Leu Ala Thr Pro Phe Asn Phe Asp Glu Val Asp Ser
595 600 605
Lys Trp Pro Lys Gly His Cys Val Ala Val Arg Ile Thr Ser Glu Asp
610 615 620
Pro Asp Asp Gly Phe Lys Pro Thr Gly Gly Lys Val Lys Glu Ile Ser
625 630 635 640
Phe Lys Ser Lys Pro Asn Val Trp Ala Tyr Phe Ser Val Lys Ser Gly
645 650 655
Gly Gly Ile His Glu Phe Ala Asp Ser Gln Phe Gly His Val Phe Ala
660 665 670
Tyr Gly Thr Thr Arg Ser Ala Ala Ile Thr Thr Met Ala Leu Ala Leu
675 680 685
Lys Glu Val Gln Ile Arg Gly Glu Ile His Ser Asn Val Asp Tyr Thr
690 695 700
Val Asp Leu Leu Asn Ala Ser Asp Phe Arg Glu Asn Lys Ile His Thr
705 710 715 720
Gly Trp Leu Asp Thr Arg Ile Ala Met Arg Val Gln Ala Glu Arg Pro
725 730 735
Pro Trp Tyr Ile Ser Val Val Gly Gly Ala Leu Tyr Lys Thr Val Thr
740 745 750
Ala Asn Thr Ala Thr Val Ser Asp Tyr Val Gly Tyr Leu Thr Lys Gly
755 760 765
Gln Ile Pro Pro Lys His Ile Ser Leu Val Tyr Thr Thr Val Ala Leu
770 775 780
Asn Ile Asp Gly Lys Lys Tyr Thr Ile Asp Thr Val Arg Ser Gly His
785 790 795 800
Gly Ser Tyr Arg Leu Arg Met Asn Gly Ser Thr Val Asp Ala Asn Val
805 810 815
Gln Ile Leu Cys Asp Gly Gly Leu Leu Met Gln Leu Asp Gly Asn Ser
820 825 830
His Val Ile Tyr Ala Glu Glu Glu Ala Ser Gly Thr Arg Leu Leu Ile
835 840 845
Asp Gly Lys Thr Cys Met Leu Gln Asn Asp His Asp Pro Ser Lys Leu
850 855 860
Leu Ala Glu Thr Pro Cys Lys Leu Leu Arg Phe Leu Val Ala Asp Gly
865 870 875 880
Ala His Val Asp Ala Asp Val Pro Tyr Ala Glu Val Glu Val Met Lys
885 890 895
Met Cys Met Pro Leu Leu Ser Pro Ala Ser Gly Val Ile His Val Val
900 905 910
Met Ser Glu Gly Gln Ala Met Gln Ala Gly Asp Leu Ile Ala Arg Leu
915 920 925
Asp Leu Asp Asp Pro Ser Ala Val Lys Arg Ala Glu Pro Phe Glu Asp
930 935 940
Thr Phe Pro Gln Met Gly Leu Pro Ile Ala Ala Ser Gly Gln Val His
945 950 955 960
Lys Leu Cys Ala Ala Ser Leu Asn Ala Cys Arg Met Ile Leu Ala Gly
965 970 975
Tyr Glu His Asp Ile Asp Lys Val Val Pro Glu Leu Val Tyr Cys Leu
980 985 990
Asp Thr Pro Glu Leu Pro Phe Leu Gln Trp Glu Glu Leu Met Ser Val
995 1000 1005
Leu Ala Thr Arg Leu Pro Arg Asn Leu Lys Ser Glu Leu Glu Gly Lys
1010 1015 1020
Tyr Glu Glu Tyr Lys Val Lys Phe Asp Ser Gly Ile Ile Asn Asp Phe
1025 1030 1035 1040
Pro Ala Asn Met Leu Arg Val Ile Ile Glu Glu Asn Leu Ala Cys Gly
1045 1050 1055
Ser Glu Lys Glu Lys Ala Thr Asn Glu Arg Leu Val Glu Pro Leu Met
1060 1065 1070
Ser Leu Leu Lys Ser Tyr Glu Gly Gly Arg Glu Ser His Ala His Phe
1075 1080 1085
Val Val Lys Ser Leu Phe Glu Glu Tyr Leu Tyr Val Glu Glu Leu Phe
1090 1095 1100
Ser Asp Gly Ile Gln Ser Asp Val Ile Glu Arg Leu Arg Leu Gln His
1105 1110 1115 1120
Ser Lys Asp Leu Gln Lys Val Val Asp Ile Val Leu Ser His Gln Ser
1125 1130 1135
Val Arg Asn Lys Thr Lys Leu Ile Leu Lys Leu Met Glu Ser Leu Val
1140 1145 1150
Tyr Pro Asn Pro Ala Ala Tyr Arg Asp Gln Leu Ile Arg Phe Ser Ser
1155 1160 1165
Leu Asn His Lys Ala Tyr Tyr Lys Leu Ala Leu Lys Ala Ser Glu Leu
1170 1175 1180
Leu Glu Gln Thr Lys Leu Ser Glu Leu Arg Ala Arg Ile Ala Arg Ser
1185 1190 1195 1200
Leu Ser Glu Leu Glu Met Phe Thr Glu Glu Ser Lys Gly Leu Ser Met
1205 1210 1215
His Lys Arg Glu Ile Ala Ile Lys Glu Ser Met Glu Asp Leu Val Thr
1220 1225 1230
Ala Pro Leu Pro Val Glu Asp Ala Leu Ile Ser Leu Phe Asp Cys Ser
1235 1240 1245
Asp Thr Thr Val Gln Gln Arg Val Ile Glu Thr Tyr Ile Ala Arg Leu
1250 1255 1260
Tyr Gln Pro His Leu Val Lys Asp Ser Ile Lys Met Lys Trp Ile Glu
1265 1270 1275 1280
Ser Gly Val Ile Ala Leu Trp Glu Phe Pro Glu Gly His Phe Asp Ala
1285 1290 1295
Arg Asn Gly Gly Ala Val Leu Gly Asp Lys Arg Trp Gly Ala Met Val
1300 1305 1310
Ile Val Lys Ser Leu Glu Ser Leu Ser Met Ala Ile Arg Phe Ala Leu
1315 1320 1325
Lys Glu Thr Ser His Tyr Thr Ser Ser Glu Gly Asn Met Met His Ile
1330 1335 1340
Ala Leu Leu Gly Ala Asp Asn Lys Met His Ile Ile Gln Glu Ser Gly
1345 1350 1355 1360
Asp Asp Ala Asp Arg Ile Ala Lys Leu Pro Leu Ile Leu Lys Asp Asn
1365 1370 1375
Val Thr Asp Leu His Ala Ser Gly Val Lys Thr Ile Ser Phe Ile Val
1380 1385 1390
Gln Arg Asp Glu Ala Arg Met Thr Met Arg Arg Thr Phe Leu Trp Ser
1395 1400 1405
Asp Glu Lys Leu Ser Tyr Glu Glu Glu Pro Ile Leu Arg His Val Glu
1410 1415 1420
Pro Pro Leu Ser Ala Leu Leu Glu Leu Asp Lys Leu Lys Val Lys Gly
1425 1430 1435 1440
Tyr Asn Glu Met Lys Tyr Thr Pro Ser Arg Asp Arg Gln Trp His Ile
1445 1450 1455
Tyr Thr Leu Arg Asn Thr Glu Asn Pro Lys Met Leu His Arg Val Phe
1460 1465 1470
Phe Arg Thr Leu Val Arg Gln Pro Ser Val Ser Asn Lys Phe Ser Ser
1475 1480 1485
Gly Gln Ile Gly Asp Met Glu Val Gly Ser Ala Glu Glu Pro Leu Ser
1490 1495 1500
Phe Thr Ser Thr Ser Ile Leu Arg Ser Leu Met Thr Ala Ile Glu Glu
1505 1510 1515 1520
Leu Glu Leu His Ala Ile Arg Thr Gly His Ser His Met Tyr Leu His
1525 1530 1535
Val Leu Lys Glu Gln Lys Leu Leu Asp Leu Val Pro Val Ser Gly Asn
1540 1545 1550
Thr Val Leu Asp Val Gly Gln Asp Glu Ala Thr Ala Tyr Ser Leu Leu
1555 1560 1565
Lys Glu Met Ala Met Lys Ile His Glu Leu Val Gly Ala Arg Met His
1570 1575 1580
His Leu Ser Val Cys Gln Trp Glu Val Lys Leu Lys Leu Asp Cys Asp
1585 1590 1595 1600
Gly Pro Ala Ser Gly Thr Trp Arg Ile Val Thr Thr Asn Val Thr Ser
1605 1610 1615
His Thr Cys Thr Val Asp Ile Tyr Arg Glu Met Glu Asp Lys Glu Ser
1620 1625 1630
Arg Lys Leu Val Tyr His Pro Ala Thr Pro Ala Ala Gly Pro Leu His
1635 1640 1645
Gly Val Ala Leu Asn Asn Pro Tyr Gln Pro Leu Ser Val Ile Asp Leu
1650 1655 1660
Lys Arg Cys Ser Ala Arg Asn Asn Arg Thr Thr Tyr Cys Tyr Asp Phe
1665 1670 1675 1680
Pro Leu Ala Phe Glu Thr Ala Val Arg Lys Ser Trp Ser Ser Ser Thr
1685 1690 1695
Ser Gly Ala Ser Lys Gly Val Glu Asn Ala Gln Cys Tyr Val Lys Ala
1700 1705 1710
Thr Glu Leu Val Phe Ala Asp Lys His Gly Ser Trp Gly Thr Pro Leu
1715 1720 1725
Val Gln Met Asp Arg Pro Ala Gly Leu Asn Asp Ile Gly Met Val Ala
1730 1735 1740
Trp Thr Leu Lys Met Ser Thr Pro Glu Phe Pro Ser Gly Arg Glu Ile
1745 1750 1755 1760
Ile Val Val Ala Asn Asp Ile Thr Phe Arg Ala Gly Ser Phe Gly Pro
1765 1770 1775
Arg Glu Asp Ala Phe Phe Glu Ala Val Thr Asn Leu Ala Cys Glu Lys
1780 1785 1790
Lys Leu Pro Leu Ile Tyr Leu Ala Ala Asn Ser Gly Ala Arg Ile Gly
1795 1800 1805
Ile Ala Asp Glu Val Lys Ser Cys Phe Arg Val Gly Trp Ser Asp Asp
1810 1815 1820
Gly Ser Pro Glu Arg Gly Phe Gln Tyr Ile Tyr Leu Ser Glu Glu Asp
1825 1830 1835 1840
Tyr Ala Arg Ile Gly Thr Ser Val Ile Ala His Lys Met Gln Leu Asp
1845 1850 1855
Ser Gly Glu Ile Arg Trp Val Ile Asp Ser Val Val Gly Lys Glu Asp
1860 1865 1870
Gly Leu Gly Val Glu Asn Ser His Gly Ser Ala Ala Ile Ala Ser Ala
1875 1880 1885
Tyr Ser Arg Ala Tyr Lys Glu Thr Phe Thr Leu Thr Phe Val Thr Gly
1890 1895 1900
Arg Thr Val Gly Ile Gly Ala Tyr Leu Ala Arg Leu Gly Ile Arg Cys
1905 1910 1915 1920
Ile Gln Arg Leu Asp Gln Pro Ile Ile Leu Thr Gly Tyr Ser Ala Leu
1925 1930 1935
Asn Lys Leu Leu Gly Arg Glu Val Tyr Ser Ser His Met Gln Leu Gly
1940 1945 1950
Gly Pro Lys Ile Met Ala Thr Asn Gly Val Val His Leu Thr Val Ser
1955 1960 1965
Asp Asp Leu Glu Gly Val Ser Asn Ile Leu Arg Trp Leu Ser Tyr Val
1970 1975 1980
Pro Ala Tyr Ile Gly Gly Pro Leu Pro Val Thr Thr Pro Leu Asp Pro
1985 1990 1995 2000
Pro Asp Arg Pro Val Ala Tyr Ile Pro Glu Asn Ser Cys Asp Pro Arg
2005 2010 2015
Ala Ala Ile Arg Gly Val Asp Asp Ser Gln Gly Lys Trp Leu Gly Gly
2020 2025 2030
Met Phe Asp Lys Asp Ser Phe Val Glu Thr Phe Glu Gly Trp Ala Lys
2035 2040 2045
Thr Val Val Thr Gly Arg Ala Lys Leu Gly Gly Ile Pro Val Gly Val
2050 2055 2060
Ile Ala Val Glu Thr Gln Thr Met Met Gln Thr Ile Pro Ala Asp Pro
2065 2070 2075 2080
Gly Gln Leu Asp Ser Arg Glu Gln Ser Val Pro Arg Ala Gly Gln Val
2085 2090 2095
Gly Phe Pro Asp Ser Ala Thr Lys Thr Ala Gln Ala Leu Leu Asp Phe
2100 2105 2110
Asn Arg Glu Gly Leu Pro Leu Phe Ile Leu Ala Asn Trp Arg Gly Phe
2115 2120 2125
Ser Gly Gly Gln Arg Asp Leu Phe Glu Gly Ile Leu Gln Ala Gly Ser
2130 2135 2140
Thr Ile Val Glu Asn Leu Arg Thr Tyr Asn Gln Pro Ala Phe Val Tyr
2145 2150 2155 2160
Ile Pro Met Ala Ala Glu Leu Arg Gly Gly Ala Trp Val Val Val Asp
2165 2170 2175
Ser Lys Ile Asn Pro Asp Arg Ile Glu Cys Tyr Ala Glu Arg Thr Ala
2180 2185 2190
Lys Gly Asn Val Leu Glu Pro Gln Gly Leu Ile Glu Ile Lys Phe Arg
2195 2200 2205
Ser Glu Glu Leu Gln Asp Cys Met Ser Arg Leu Asp Pro Thr Leu Ile
2210 2215 2220
Asp Leu Lys Ala Lys Leu Glu Val Ala Asn Lys Asn Gly Ser Ala Asp
2225 2230 2235 2240
Thr Lys Ser Leu Gln Glu Asn Ile Glu Ala Arg Thr Lys Gln Leu Met
2245 2250 2255
Pro Leu Tyr Thr Gln Ile Ala Ile Arg Phe Ala Glu Leu His Asp Thr
2260 2265 2270
Ser Leu Arg Met Ala Ala Lys Gly Val Ile Lys Lys Val Val Asp Trp
2275 2280 2285
Glu Glu Ser Arg Ser Phe Phe Tyr Lys Arg Leu Arg Arg Arg Ile Ser
2290 2295 2300
Glu Asp Val Leu Ala Lys Glu Ile Arg Ala Val Ala Gly Glu Gln Phe
2305 2310 2315 2320
Ser His Gln Pro Ala Ile Glu Leu Ile Lys Lys Trp Tyr Ser Ala Ser
2325 2330 2335
His Ala Ala Glu Trp Asp Asp Asp Asp Ala Phe Val Ala Trp Met Asp
2340 2345 2350
Asn Pro Glu Asn Tyr Lys Asp Tyr Ile Gln Tyr Leu Lys Ala Gln Arg
2355 2360 2365
Val Ser Gln Ser Leu Ser Ser Leu Ser Asp Ser Ser Ser Asp Leu Gln
2370 2375 2380
Ala Leu Pro Gln Gly Leu Ser Met Leu Leu Asp Lys Met Asp Pro Ser
2385 2390 2395 2400
Arg Arg Ala Gln Leu Val Glu Glu Ile Arg Lys Val Leu Gly
2405 2410
<210> 2
<211> 2414
<212> PRT
< 213 > mutant (ACCase)
<400> 2
Met Pro Met Arg Pro Trp Glu Phe Ile Ile Leu Gly Arg Thr Ala Pro
1 5 10 15
Ile Ser Pro Pro Pro Leu Gly Ile Ser Ala Phe Ser Arg Pro Leu Arg
20 25 30
Leu Arg Leu Arg Leu Arg Leu Ala Ala Val Val Asp Ala Ala Arg Ile
35 40 45
Gln Thr Pro Pro Arg Val Ala Phe Ser Ala Phe Phe Phe Phe Phe Phe
50 55 60
Phe Phe Ser Glu Gly Leu Ser Arg Glu Gly Thr Ala Ala Arg Leu Pro
65 70 75 80
Ala Leu Ile Tyr Arg Val Pro Phe Ile Pro Cys Leu Leu Gln Leu Gln
85 90 95
Ile Arg Ala Pro His Ala Asp Pro Arg Pro Ala Gly Phe Ser Cys Ala
100 105 110
His His Phe Leu Ala Leu Ala Gln Gly Leu Ser Ser Ser Leu Leu Ser
115 120 125
Gly Thr Ile Ser His Ile Trp Gly Phe Ile Phe Ser Leu Tyr Gly Thr
130 135 140
Thr His Leu Arg Asn Arg Ala Ile Leu Leu Phe Gly Leu Ala Gly Ile
145 150 155 160
Ile Asp Leu Pro Asn Asp Ala Ala Ser Glu Val Asp Ile Ser His Gly
165 170 175
Ser Glu Asp Pro Arg Gly Pro Thr Val Pro Gly Ser Tyr Gln Met Asn
180 185 190
Gly Ile Ile Asn Glu Thr His Asn Gly Arg His Ala Ser Val Ser Lys
195 200 205
Val Val Glu Phe Cys Thr Ala Leu Gly Gly Lys Thr Pro Ile His Ser
210 215 220
Val Leu Val Ala Asn Asn Gly Met Ala Ala Ala Lys Phe Met Arg Ser
225 230 235 240
Val Arg Thr Trp Ala Asn Asp Thr Phe Gly Ser Glu Lys Ala Ile Gln
245 250 255
Leu Ile Ala Met Ala Thr Pro Glu Asp Leu Arg Ile Asn Ala Glu His
260 265 270
Ile Arg Ile Ala Asp Gln Phe Val Glu Val Pro Gly Gly Thr Asn Asn
275 280 285
Asn Asn Tyr Ala Asn Val Gln Leu Ile Val Glu Ile Ala Glu Arg Thr
290 295 300
Gly Val Ser Ala Val Trp Pro Gly Trp Gly His Ala Ser Glu Asn Pro
305 310 315 320
Glu Leu Pro Asp Ala Leu Thr Ala Lys Gly Ile Val Phe Leu Gly Pro
325 330 335
Pro Ala Ser Ser Met His Ala Leu Gly Asp Lys Val Gly Ser Ala Leu
340 345 350
Ile Ala Gln Ala Ala Gly Val Pro Thr Leu Ala Trp Ser Gly Ser His
355 360 365
Val Glu Val Pro Leu Glu Cys Cys Leu Asp Ser Ile Pro Asp Glu Met
370 375 380
Tyr Arg Lys Ala Cys Val Thr Thr Thr Glu Glu Ala Val Ala Ser Cys
385 390 395 400
Gln Val Val Gly Tyr Pro Ala Met Ile Lys Ala Ser Trp Gly Gly Gly
405 410 415
Gly Lys Gly Ile Arg Lys Val His Asn Asp Asp Glu Val Arg Thr Leu
420 425 430
Phe Lys Gln Val Gln Gly Glu Val Pro Gly Ser Pro Ile Phe Ile Met
435 440 445
Arg Leu Ala Ala Gln Ser Arg His Leu Glu Val Gln Leu Leu Cys Asp
450 455 460
Gln Tyr Gly Asn Val Ala Ala Leu His Ser Arg Asp Cys Ser Val Gln
465 470 475 480
Arg Arg His Gln Lys Ile Ile Glu Glu Gly Pro Val Thr Val Ala Pro
485 490 495
Arg Glu Thr Val Lys Glu Leu Glu Gln Ala Ala Arg Arg Leu Ala Lys
500 505 510
Ala Val Gly Tyr Val Gly Ala Ala Thr Val Glu Tyr Leu Tyr Ser Met
515 520 525
Glu Thr Gly Glu Tyr Tyr Phe Leu Glu Leu Asn Pro Arg Leu Gln Val
530 535 540
Glu His Pro Val Thr Glu Trp Ile Ala Glu Val Asn Leu Pro Ala Ala
545 550 555 560
Gln Val Ala Val Gly Met Gly Ile Pro Leu Trp Gln Ile Pro Glu Ile
565 570 575
Arg Arg Phe Tyr Gly Met Asn His Gly Gly Gly Tyr Asp Leu Trp Arg
580 585 590
Lys Thr Ala Ala Leu Ala Thr Pro Phe Asn Phe Asp Glu Val Asp Ser
595 600 605
Lys Trp Pro Lys Gly His Cys Val Ala Val Arg Ile Thr Ser Glu Asp
610 615 620
Pro Asp Asp Gly Phe Lys Pro Thr Gly Gly Lys Val Lys Glu Ile Ser
625 630 635 640
Phe Lys Ser Lys Pro Asn Val Trp Ala Tyr Phe Ser Val Lys Ser Gly
645 650 655
Gly Gly Ile His Glu Phe Ala Asp Ser Gln Phe Gly His Val Phe Ala
660 665 670
Tyr Gly Thr Thr Arg Ser Ala Ala Ile Thr Thr Met Ala Leu Ala Leu
675 680 685
Lys Glu Val Gln Ile Arg Gly Glu Ile His Ser Asn Val Asp Tyr Thr
690 695 700
Val Asp Leu Leu Asn Ala Ser Asp Phe Arg Glu Asn Lys Ile His Thr
705 710 715 720
Gly Trp Leu Asp Thr Arg Ile Ala Met Arg Val Gln Ala Glu Arg Pro
725 730 735
Pro Trp Tyr Ile Ser Val Val Gly Gly Ala Leu Tyr Lys Thr Val Thr
740 745 750
Ala Asn Thr Ala Thr Val Ser Asp Tyr Val Gly Tyr Leu Thr Lys Gly
755 760 765
Gln Ile Pro Pro Lys His Ile Ser Leu Val Tyr Thr Thr Val Ala Leu
770 775 780
Asn Ile Asp Gly Lys Lys Tyr Thr Ile Asp Thr Val Arg Ser Gly His
785 790 795 800
Gly Ser Tyr Arg Leu Arg Met Asn Gly Ser Thr Val Asp Ala Asn Val
805 810 815
Gln Ile Leu Cys Asp Gly Gly Leu Leu Met Gln Leu Asp Gly Asn Ser
820 825 830
His Val Ile Tyr Ala Glu Glu Glu Ala Ser Gly Thr Arg Leu Leu Ile
835 840 845
Asp Gly Lys Thr Cys Met Leu Gln Asn Asp His Asp Pro Ser Lys Leu
850 855 860
Leu Ala Glu Thr Pro Cys Lys Leu Leu Arg Phe Leu Val Ala Asp Gly
865 870 875 880
Ala His Val Asp Ala Asp Val Pro Tyr Ala Glu Val Glu Val Met Lys
885 890 895
Met Cys Met Pro Leu Leu Ser Pro Ala Ser Gly Val Ile His Val Val
900 905 910
Met Ser Glu Gly Gln Ala Met Gln Ala Gly Asp Leu Ile Ala Arg Leu
915 920 925
Asp Leu Asp Asp Pro Ser Ala Val Lys Arg Ala Glu Pro Phe Glu Asp
930 935 940
Thr Phe Pro Gln Met Gly Leu Pro Ile Ala Ala Ser Gly Gln Val His
945 950 955 960
Lys Leu Cys Ala Ala Ser Leu Asn Ala Cys Arg Met Ile Leu Ala Gly
965 970 975
Tyr Glu His Asp Ile Asp Lys Val Val Pro Glu Leu Val Tyr Cys Leu
980 985 990
Asp Thr Pro Glu Leu Pro Phe Leu Gln Trp Glu Glu Leu Met Ser Val
995 1000 1005
Leu Ala Thr Arg Leu Pro Arg Asn Leu Lys Ser Glu Leu Glu Gly Lys
1010 1015 1020
Tyr Glu Glu Tyr Lys Val Lys Phe Asp Ser Gly Ile Ile Asn Asp Phe
1025 1030 1035 1040
Pro Ala Asn Met Leu Arg Val Ile Ile Glu Glu Asn Leu Ala Cys Gly
1045 1050 1055
Ser Glu Lys Glu Lys Ala Thr Asn Glu Arg Leu Val Glu Pro Leu Met
1060 1065 1070
Ser Leu Leu Lys Ser Tyr Glu Gly Gly Arg Glu Ser His Ala His Phe
1075 1080 1085
Val Val Lys Ser Leu Phe Glu Glu Tyr Leu Tyr Val Glu Glu Leu Phe
1090 1095 1100
Ser Asp Gly Ile Gln Ser Asp Val Ile Glu Arg Leu Arg Leu Gln His
1105 1110 1115 1120
Ser Lys Asp Leu Gln Lys Val Val Asp Ile Val Leu Ser His Gln Ser
1125 1130 1135
Val Arg Asn Lys Thr Lys Leu Ile Leu Lys Leu Met Glu Ser Leu Val
1140 1145 1150
Tyr Pro Asn Pro Ala Ala Tyr Arg Asp Gln Leu Ile Arg Phe Ser Ser
1155 1160 1165
Leu Asn His Lys Ala Tyr Tyr Lys Leu Ala Leu Lys Ala Ser Glu Leu
1170 1175 1180
Leu Glu Gln Thr Lys Leu Ser Glu Leu Arg Ala Arg Ile Ala Arg Ser
1185 1190 1195 1200
Leu Ser Glu Leu Glu Met Phe Thr Glu Glu Ser Lys Gly Leu Ser Met
1205 1210 1215
His Lys Arg Glu Ile Ala Ile Lys Glu Ser Met Glu Asp Leu Val Thr
1220 1225 1230
Ala Pro Leu Pro Val Glu Asp Ala Leu Ile Ser Leu Phe Asp Cys Ser
1235 1240 1245
Asp Thr Thr Val Gln Gln Arg Val Ile Glu Thr Tyr Ile Ala Arg Leu
1250 1255 1260
Tyr Gln Pro His Leu Val Lys Asp Ser Ile Lys Met Lys Trp Ile Glu
1265 1270 1275 1280
Ser Gly Val Ile Ala Leu Trp Glu Phe Pro Glu Gly His Phe Asp Ala
1285 1290 1295
Arg Asn Gly Gly Ala Val Leu Gly Asp Lys Arg Trp Gly Ala Met Val
1300 1305 1310
Ile Val Lys Ser Leu Glu Ser Leu Ser Met Ala Ile Arg Phe Ala Leu
1315 1320 1325
Lys Glu Thr Ser His Tyr Thr Ser Ser Glu Gly Asn Met Met His Ile
1330 1335 1340
Ala Leu Leu Gly Ala Asp Asn Lys Met His Ile Ile Gln Glu Ser Gly
1345 1350 1355 1360
Asp Asp Ala Asp Arg Ile Ala Lys Leu Pro Leu Ile Leu Lys Asp Asn
1365 1370 1375
Val Thr Asp Leu His Ala Ser Gly Val Lys Thr Ile Ser Phe Ile Val
1380 1385 1390
Gln Arg Asp Glu Ala Arg Met Thr Met Arg Arg Thr Phe Leu Trp Ser
1395 1400 1405
Asp Glu Lys Leu Ser Tyr Glu Glu Glu Pro Ile Leu Arg His Val Glu
1410 1415 1420
Pro Pro Leu Ser Ala Leu Leu Glu Leu Asp Lys Leu Lys Val Lys Gly
1425 1430 1435 1440
Tyr Asn Glu Met Lys Tyr Thr Pro Ser Arg Asp Arg Gln Trp His Ile
1445 1450 1455
Tyr Thr Leu Arg Asn Thr Glu Asn Pro Lys Met Leu His Arg Val Phe
1460 1465 1470
Phe Arg Thr Leu Val Arg Gln Pro Ser Val Ser Asn Lys Phe Ser Ser
1475 1480 1485
Gly Gln Ile Gly Asp Met Glu Val Gly Ser Ala Glu Glu Pro Leu Ser
1490 1495 1500
Phe Thr Ser Thr Ser Ile Leu Arg Ser Leu Met Thr Ala Ile Glu Glu
1505 1510 1515 1520
Leu Glu Leu His Ala Ile Arg Thr Gly His Ser His Met Tyr Leu His
1525 1530 1535
Val Leu Lys Glu Gln Lys Leu Leu Asp Leu Val Pro Val Ser Gly Asn
1540 1545 1550
Thr Val Leu Asp Val Gly Gln Asp Glu Ala Thr Ala Tyr Ser Leu Leu
1555 1560 1565
Lys Glu Met Ala Met Lys Ile His Glu Leu Val Gly Ala Arg Met His
1570 1575 1580
His Leu Ser Val Cys Gln Trp Glu Val Lys Leu Lys Leu Asp Cys Asp
1585 1590 1595 1600
Gly Pro Ala Ser Gly Thr Trp Arg Ile Val Thr Thr Asn Val Thr Ser
1605 1610 1615
His Thr Cys Thr Val Asp Ile Tyr Arg Glu Met Glu Asp Lys Glu Ser
1620 1625 1630
Arg Lys Leu Val Tyr His Pro Ala Thr Pro Ala Ala Gly Pro Leu His
1635 1640 1645
Gly Val Ala Leu Asn Asn Pro Tyr Gln Pro Leu Ser Val Ile Asp Leu
1650 1655 1660
Lys Arg Cys Ser Ala Arg Asn Asn Arg Thr Thr Tyr Cys Tyr Asp Phe
1665 1670 1675 1680
Pro Leu Ala Phe Glu Thr Ala Val Arg Lys Ser Trp Ser Ser Ser Thr
1685 1690 1695
Ser Gly Ala Ser Lys Gly Val Glu Asn Ala Gln Cys Tyr Val Lys Ala
1700 1705 1710
Thr Glu Leu Val Phe Ala Asp Lys His Gly Ser Trp Gly Thr Pro Leu
1715 1720 1725
Val Gln Met Asp Arg Pro Ala Gly Leu Asn Asp Ile Gly Met Val Ala
1730 1735 1740
Trp Thr Leu Lys Met Ser Thr Pro Glu Phe Pro Ser Gly Arg Glu Ile
1745 1750 1755 1760
Ile Val Val Ala Asn Asp Ile Thr Phe Arg Ala Gly Ser Phe Gly Pro
1765 1770 1775
Arg Glu Asp Ala Phe Phe Glu Ala Val Thr Asn Leu Ala Cys Glu Lys
1780 1785 1790
Lys Leu Pro Leu Ile Tyr Leu Ala Ala Asn Ser Gly Ala Arg Ile Gly
1795 1800 1805
Ile Ala Asp Glu Val Lys Ser Cys Phe Arg Val Gly Trp Ser Asp Asp
1810 1815 1820
Gly Ser Pro Glu Arg Gly Phe Gln Tyr Ile Tyr Leu Ser Glu Glu Asp
1825 1830 1835 1840
Tyr Ala Arg Ile Gly Thr Ser Val Ile Ala His Lys Met Gln Leu Asp
1845 1850 1855
Ser Gly Glu Ile Arg Trp Val Ile Asp Ser Val Val Gly Lys Glu Asp
1860 1865 1870
Gly Leu Gly Val Glu Asn Ile His Gly Ser Ala Ala Ile Ala Ser Ala
1875 1880 1885
Tyr Ser Arg Ala Tyr Lys Glu Thr Phe Thr Leu Thr Phe Val Thr Gly
1890 1895 1900
Arg Thr Val Gly Ile Gly Ala Tyr Leu Ala Arg Leu Gly Ile Arg Cys
1905 1910 1915 1920
Ile Gln Arg Leu Asp Gln Tyr Ile Ile Leu Thr Gly Tyr Ser Ala Leu
1925 1930 1935
Asn Lys Leu Leu Gly Arg Glu Val Tyr Ser Ser His Met Gln Leu Gly
1940 1945 1950
Gly Pro Lys Ile Met Ala Thr Asn Gly Val Val His Leu Thr Val Ser
1955 1960 1965
Asp Asp Leu Glu Gly Val Ser Asn Ile Leu Arg Trp Leu Ser Tyr Val
1970 1975 1980
Pro Ala Tyr Ile Gly Gly Pro Leu Pro Val Thr Thr Pro Leu Asp Pro
1985 1990 1995 2000
Pro Asp Arg Pro Val Ala Tyr Ile Pro Glu Asn Ser Cys Asp Pro Arg
2005 2010 2015
Ala Ala Ile Arg Gly Val Asp Asp Ser Gln Gly Lys Trp Leu Gly Gly
2020 2025 2030
Met Phe Asp Lys Asp Ser Phe Val Glu Thr Phe Glu Gly Trp Ala Lys
2035 2040 2045
Thr Val Val Thr Gly Arg Ala Lys Leu Gly Gly Ile Pro Val Gly Val
2050 2055 2060
Ile Ala Val Glu Thr Gln Thr Met Met Gln Thr Ile Pro Ala Asp Pro
2065 2070 2075 2080
Gly Gln Leu Asp Ser Arg Glu Gln Ser Val Pro Arg Ala Gly Gln Val
2085 2090 2095
Trp Phe Pro Asp Ser Ala Thr Lys Thr Ala Gln Ala Leu Leu Asp Phe
2100 2105 2110
Asn Arg Glu Gly Leu Pro Leu Phe Ile Leu Ala Asn Trp Arg Gly Phe
2115 2120 2125
Ser Gly Gly Gln Arg Asp Leu Phe Glu Gly Ile Leu Gln Ala Gly Ser
2130 2135 2140
Thr Ile Val Glu Asn Leu Arg Thr Tyr Asn Gln Pro Ala Phe Val Tyr
2145 2150 2155 2160
Ile Pro Met Ala Ala Glu Leu Arg Gly Gly Ala Trp Val Val Val Asp
2165 2170 2175
Ser Lys Ile Asn Pro Asp Arg Ile Glu Cys Tyr Ala Glu Arg Thr Ala
2180 2185 2190
Lys Gly Asn Val Leu Glu Pro Gln Gly Leu Ile Glu Ile Lys Phe Arg
2195 2200 2205
Ser Glu Glu Leu Gln Asp Cys Met Ser Arg Leu Asp Pro Thr Leu Ile
2210 2215 2220
Asp Leu Lys Ala Lys Leu Glu Val Ala Asn Lys Asn Gly Ser Ala Asp
2225 2230 2235 2240
Thr Lys Ser Leu Gln Glu Asn Ile Glu Ala Arg Thr Lys Gln Leu Met
2245 2250 2255
Pro Leu Tyr Thr Gln Ile Ala Ile Arg Phe Ala Glu Leu His Asp Thr
2260 2265 2270
Ser Leu Arg Met Ala Ala Lys Gly Val Ile Lys Lys Val Val Asp Trp
2275 2280 2285
Glu Glu Ser Arg Ser Phe Phe Tyr Lys Arg Leu Arg Arg Arg Ile Ser
2290 2295 2300
Glu Asp Val Leu Ala Lys Glu Ile Arg Ala Val Ala Gly Glu Gln Phe
2305 2310 2315 2320
Ser His Gln Pro Ala Ile Glu Leu Ile Lys Lys Trp Tyr Ser Ala Ser
2325 2330 2335
His Ala Ala Glu Trp Asp Asp Asp Asp Ala Phe Val Ala Trp Met Asp
2340 2345 2350
Asn Pro Glu Asn Tyr Lys Asp Tyr Ile Gln Tyr Leu Lys Ala Gln Arg
2355 2360 2365
Val Ser Gln Ser Leu Ser Ser Leu Ser Asp Ser Ser Ser Asp Leu Gln
2370 2375 2380
Ala Leu Pro Gln Gly Leu Ser Met Leu Leu Asp Lys Met Asp Pro Ser
2385 2390 2395 2400
Arg Arg Ala Gln Leu Val Glu Glu Ile Arg Lys Val Leu Gly
2405 2410
<210> 3
<211> 2414
<212> PRT
< 213 > mutant (ACCase)
<400> 3
Met Pro Met Arg Pro Trp Glu Phe Ile Ile Leu Gly Arg Thr Ala Pro
1 5 10 15
Ile Ser Pro Pro Pro Leu Gly Ile Ser Ala Phe Ser Arg Pro Leu Arg
20 25 30
Leu Arg Leu Arg Leu Arg Leu Ala Ala Val Val Asp Ala Ala Arg Ile
35 40 45
Gln Thr Pro Pro Arg Val Ala Phe Ser Ala Phe Phe Phe Phe Phe Phe
50 55 60
Phe Phe Ser Glu Gly Leu Ser Arg Glu Gly Thr Ala Ala Arg Leu Pro
65 70 75 80
Ala Leu Ile Tyr Arg Val Pro Phe Ile Pro Cys Leu Leu Gln Leu Gln
85 90 95
Ile Arg Ala Pro His Ala Asp Pro Arg Pro Ala Gly Phe Ser Cys Ala
100 105 110
His His Phe Leu Ala Leu Ala Gln Gly Leu Ser Ser Ser Leu Leu Ser
115 120 125
Gly Thr Ile Ser His Ile Trp Gly Phe Ile Phe Ser Leu Tyr Gly Thr
130 135 140
Thr His Leu Arg Asn Arg Ala Ile Leu Leu Phe Gly Leu Ala Gly Ile
145 150 155 160
Ile Asp Leu Pro Asn Asp Ala Ala Ser Glu Val Asp Ile Ser His Gly
165 170 175
Ser Glu Asp Pro Arg Gly Pro Thr Val Pro Gly Ser Tyr Gln Met Asn
180 185 190
Gly Ile Ile Asn Glu Thr His Asn Gly Arg His Ala Ser Val Ser Lys
195 200 205
Val Val Glu Phe Cys Thr Ala Leu Gly Gly Lys Thr Pro Ile His Ser
210 215 220
Val Leu Val Ala Asn Asn Gly Met Ala Ala Ala Lys Phe Met Arg Ser
225 230 235 240
Val Arg Thr Trp Ala Asn Asp Thr Phe Gly Ser Glu Lys Ala Ile Gln
245 250 255
Leu Ile Ala Met Ala Thr Pro Glu Asp Leu Arg Ile Asn Ala Glu His
260 265 270
Ile Arg Ile Ala Asp Gln Phe Val Glu Val Pro Gly Gly Thr Asn Asn
275 280 285
Asn Asn Tyr Ala Asn Val Gln Leu Ile Val Glu Ile Ala Glu Arg Thr
290 295 300
Gly Val Ser Ala Val Trp Pro Gly Trp Gly His Ala Ser Glu Asn Pro
305 310 315 320
Glu Leu Pro Asp Ala Leu Thr Ala Lys Gly Ile Val Phe Leu Gly Pro
325 330 335
Pro Ala Ser Ser Met His Ala Leu Gly Asp Lys Val Gly Ser Ala Leu
340 345 350
Ile Ala Gln Ala Ala Gly Val Pro Thr Leu Ala Trp Ser Gly Ser His
355 360 365
Val Glu Val Pro Leu Glu Cys Cys Leu Asp Ser Ile Pro Asp Glu Met
370 375 380
Tyr Arg Lys Ala Cys Val Thr Thr Thr Glu Glu Ala Val Ala Ser Cys
385 390 395 400
Gln Val Val Gly Tyr Pro Ala Met Ile Lys Ala Ser Trp Gly Gly Gly
405 410 415
Gly Lys Gly Ile Arg Lys Val His Asn Asp Asp Glu Val Arg Thr Leu
420 425 430
Phe Lys Gln Val Gln Gly Glu Val Pro Gly Ser Pro Ile Phe Ile Met
435 440 445
Arg Leu Ala Ala Gln Ser Arg His Leu Glu Val Gln Leu Leu Cys Asp
450 455 460
Gln Tyr Gly Asn Val Ala Ala Leu His Ser Arg Asp Cys Ser Val Gln
465 470 475 480
Arg Arg His Gln Lys Ile Ile Glu Glu Gly Pro Val Thr Val Ala Pro
485 490 495
Arg Glu Thr Val Lys Glu Leu Glu Gln Ala Ala Arg Arg Leu Ala Lys
500 505 510
Ala Val Gly Tyr Val Gly Ala Ala Thr Val Glu Tyr Leu Tyr Ser Met
515 520 525
Glu Thr Gly Glu Tyr Tyr Phe Leu Glu Leu Asn Pro Arg Leu Gln Val
530 535 540
Glu His Pro Val Thr Glu Trp Ile Ala Glu Val Asn Leu Pro Ala Ala
545 550 555 560
Gln Val Ala Val Gly Met Gly Ile Pro Leu Trp Gln Ile Pro Glu Ile
565 570 575
Arg Arg Phe Tyr Gly Met Asn His Gly Gly Gly Tyr Asp Leu Trp Arg
580 585 590
Lys Thr Ala Ala Leu Ala Thr Pro Phe Asn Phe Asp Glu Val Asp Ser
595 600 605
Lys Trp Pro Lys Gly His Cys Val Ala Val Arg Ile Thr Ser Glu Asp
610 615 620
Pro Asp Asp Gly Phe Lys Pro Thr Gly Gly Lys Val Lys Glu Ile Ser
625 630 635 640
Phe Lys Ser Lys Pro Asn Val Trp Ala Tyr Phe Ser Val Lys Ser Gly
645 650 655
Gly Gly Ile His Glu Phe Ala Asp Ser Gln Phe Gly His Val Phe Ala
660 665 670
Tyr Gly Thr Thr Arg Ser Ala Ala Ile Thr Thr Met Ala Leu Ala Leu
675 680 685
Lys Glu Val Gln Ile Arg Gly Glu Ile His Ser Asn Val Asp Tyr Thr
690 695 700
Val Asp Leu Leu Asn Ala Ser Asp Phe Arg Glu Asn Lys Ile His Thr
705 710 715 720
Gly Trp Leu Asp Thr Arg Ile Ala Met Arg Val Gln Ala Glu Arg Pro
725 730 735
Pro Trp Tyr Ile Ser Val Val Gly Gly Ala Leu Tyr Lys Thr Val Thr
740 745 750
Ala Asn Thr Ala Thr Val Ser Asp Tyr Val Gly Tyr Leu Thr Lys Gly
755 760 765
Gln Ile Pro Pro Lys His Ile Ser Leu Val Tyr Thr Thr Val Ala Leu
770 775 780
Asn Ile Asp Gly Lys Lys Tyr Thr Ile Asp Thr Val Arg Ser Gly His
785 790 795 800
Gly Ser Tyr Arg Leu Arg Met Asn Gly Ser Thr Val Asp Ala Asn Val
805 810 815
Gln Ile Leu Cys Asp Gly Gly Leu Leu Met Gln Leu Asp Gly Asn Ser
820 825 830
His Val Ile Tyr Ala Glu Glu Glu Ala Ser Gly Thr Arg Leu Leu Ile
835 840 845
Asp Gly Lys Thr Cys Met Leu Gln Asn Asp His Asp Pro Ser Lys Leu
850 855 860
Leu Ala Glu Thr Pro Cys Lys Leu Leu Arg Phe Leu Val Ala Asp Gly
865 870 875 880
Ala His Val Asp Ala Asp Val Pro Tyr Ala Glu Val Glu Val Met Lys
885 890 895
Met Cys Met Pro Leu Leu Ser Pro Ala Ser Gly Val Ile His Val Val
900 905 910
Met Ser Glu Gly Gln Ala Met Gln Ala Gly Asp Leu Ile Ala Arg Leu
915 920 925
Asp Leu Asp Asp Pro Ser Ala Val Lys Arg Ala Glu Pro Phe Glu Asp
930 935 940
Thr Phe Pro Gln Met Gly Leu Pro Ile Ala Ala Ser Gly Gln Val His
945 950 955 960
Lys Leu Cys Ala Ala Ser Leu Asn Ala Cys Arg Met Ile Leu Ala Gly
965 970 975
Tyr Glu His Asp Ile Asp Lys Val Val Pro Glu Leu Val Tyr Cys Leu
980 985 990
Asp Thr Pro Glu Leu Pro Phe Leu Gln Trp Glu Glu Leu Met Ser Val
995 1000 1005
Leu Ala Thr Arg Leu Pro Arg Asn Leu Lys Ser Glu Leu Glu Gly Lys
1010 1015 1020
Tyr Glu Glu Tyr Lys Val Lys Phe Asp Ser Gly Ile Ile Asn Asp Phe
1025 1030 1035 1040
Pro Ala Asn Met Leu Arg Val Ile Ile Glu Glu Asn Leu Ala Cys Gly
1045 1050 1055
Ser Glu Lys Glu Lys Ala Thr Asn Glu Arg Leu Val Glu Pro Leu Met
1060 1065 1070
Ser Leu Leu Lys Ser Tyr Glu Gly Gly Arg Glu Ser His Ala His Phe
1075 1080 1085
Val Val Lys Ser Leu Phe Glu Glu Tyr Leu Tyr Val Glu Glu Leu Phe
1090 1095 1100
Ser Asp Gly Ile Gln Ser Asp Val Ile Glu Arg Leu Arg Leu Gln His
1105 1110 1115 1120
Ser Lys Asp Leu Gln Lys Val Val Asp Ile Val Leu Ser His Gln Ser
1125 1130 1135
Val Arg Asn Lys Thr Lys Leu Ile Leu Lys Leu Met Glu Ser Leu Val
1140 1145 1150
Tyr Pro Asn Pro Ala Ala Tyr Arg Asp Gln Leu Ile Arg Phe Ser Ser
1155 1160 1165
Leu Asn His Lys Ala Tyr Tyr Lys Leu Ala Leu Lys Ala Ser Glu Leu
1170 1175 1180
Leu Glu Gln Thr Lys Leu Ser Glu Leu Arg Ala Arg Ile Ala Arg Ser
1185 1190 1195 1200
Leu Ser Glu Leu Glu Met Phe Thr Glu Glu Ser Lys Gly Leu Ser Met
1205 1210 1215
His Lys Arg Glu Ile Ala Ile Lys Glu Ser Met Glu Asp Leu Val Thr
1220 1225 1230
Ala Pro Leu Pro Val Glu Asp Ala Leu Ile Ser Leu Phe Asp Cys Ser
1235 1240 1245
Asp Thr Thr Val Gln Gln Arg Val Ile Glu Thr Tyr Ile Ala Arg Leu
1250 1255 1260
Tyr Gln Pro His Leu Val Lys Asp Ser Ile Lys Met Lys Trp Ile Glu
1265 1270 1275 1280
Ser Gly Val Ile Ala Leu Trp Glu Phe Pro Glu Gly His Phe Asp Ala
1285 1290 1295
Arg Asn Gly Gly Ala Val Leu Gly Asp Lys Arg Trp Gly Ala Met Val
1300 1305 1310
Ile Val Lys Ser Leu Glu Ser Leu Ser Met Ala Ile Arg Phe Ala Leu
1315 1320 1325
Lys Glu Thr Ser His Tyr Thr Ser Ser Glu Gly Asn Met Met His Ile
1330 1335 1340
Ala Leu Leu Gly Ala Asp Asn Lys Met His Ile Ile Gln Glu Ser Gly
1345 1350 1355 1360
Asp Asp Ala Asp Arg Ile Ala Lys Leu Pro Leu Ile Leu Lys Asp Asn
1365 1370 1375
Val Thr Asp Leu His Ala Ser Gly Val Lys Thr Ile Ser Phe Ile Val
1380 1385 1390
Gln Arg Asp Glu Ala Arg Met Thr Met Arg Arg Thr Phe Leu Trp Ser
1395 1400 1405
Asp Glu Lys Leu Ser Tyr Glu Glu Glu Pro Ile Leu Arg His Val Glu
1410 1415 1420
Pro Pro Leu Ser Ala Leu Leu Glu Leu Asp Lys Leu Lys Val Lys Gly
1425 1430 1435 1440
Tyr Asn Glu Met Lys Tyr Thr Pro Ser Arg Asp Arg Gln Trp His Ile
1445 1450 1455
Tyr Thr Leu Arg Asn Thr Glu Asn Pro Lys Met Leu His Arg Val Phe
1460 1465 1470
Phe Arg Thr Leu Val Arg Gln Pro Ser Val Ser Asn Lys Phe Ser Ser
1475 1480 1485
Gly Gln Ile Gly Asp Met Glu Val Gly Ser Ala Glu Glu Pro Leu Ser
1490 1495 1500
Phe Thr Ser Thr Ser Ile Leu Arg Ser Leu Met Thr Ala Ile Glu Glu
1505 1510 1515 1520
Leu Glu Leu His Ala Ile Arg Thr Gly His Ser His Met Tyr Leu His
1525 1530 1535
Val Leu Lys Glu Gln Lys Leu Leu Asp Leu Val Pro Val Ser Gly Asn
1540 1545 1550
Thr Val Leu Asp Val Gly Gln Asp Glu Ala Thr Ala Tyr Ser Leu Leu
1555 1560 1565
Lys Glu Met Ala Met Lys Ile His Glu Leu Val Gly Ala Arg Met His
1570 1575 1580
His Leu Ser Val Cys Gln Trp Glu Val Lys Leu Lys Leu Asp Cys Asp
1585 1590 1595 1600
Gly Pro Ala Ser Gly Thr Trp Arg Ile Val Thr Thr Asn Val Thr Ser
1605 1610 1615
His Thr Cys Thr Val Asp Ile Tyr Arg Glu Met Glu Asp Lys Glu Ser
1620 1625 1630
Arg Lys Leu Val Tyr His Pro Ala Thr Pro Ala Ala Gly Pro Leu His
1635 1640 1645
Gly Val Ala Leu Asn Asn Pro Tyr Gln Pro Leu Ser Val Ile Asp Leu
1650 1655 1660
Lys Arg Cys Ser Ala Arg Asn Asn Arg Thr Thr Tyr Cys Tyr Asp Phe
1665 1670 1675 1680
Pro Leu Ala Phe Glu Thr Ala Val Arg Lys Ser Trp Ser Ser Ser Thr
1685 1690 1695
Ser Gly Ala Ser Lys Gly Val Glu Asn Ala Gln Cys Tyr Val Lys Ala
1700 1705 1710
Thr Glu Leu Val Phe Ala Asp Lys His Gly Ser Trp Gly Thr Pro Leu
1715 1720 1725
Val Gln Met Asp Arg Pro Ala Gly Leu Asn Asp Ile Gly Met Val Ala
1730 1735 1740
Trp Thr Leu Lys Met Ser Thr Pro Glu Phe Pro Ser Gly Arg Glu Ile
1745 1750 1755 1760
Ile Val Val Ala Asn Asp Ile Thr Phe Arg Ala Gly Ser Phe Gly Pro
1765 1770 1775
Arg Glu Asp Ala Phe Phe Glu Ala Val Thr Asn Leu Ala Cys Glu Lys
1780 1785 1790
Lys Leu Pro Leu Ile Tyr Leu Ala Ala Asn Ser Gly Ala Arg Ile Gly
1795 1800 1805
Ile Ala Asp Glu Val Lys Ser Cys Phe Arg Val Gly Trp Ser Asp Asp
1810 1815 1820
Gly Ser Pro Glu Arg Gly Phe Gln Tyr Ile Tyr Leu Ser Glu Glu Asp
1825 1830 1835 1840
Tyr Ala Arg Ile Gly Thr Ser Val Ile Ala His Lys Met Gln Leu Asp
1845 1850 1855
Ser Gly Glu Ile Arg Trp Val Ile Asp Ser Val Val Gly Lys Glu Asp
1860 1865 1870
Gly Leu Gly Val Glu Asn Ile His Gly Ser Ala Ala Ile Ala Ser Ala
1875 1880 1885
Tyr Ser Arg Ala Tyr Lys Glu Thr Phe Thr Leu Thr Phe Val Thr Gly
1890 1895 1900
Arg Thr Val Gly Ile Gly Ala Tyr Leu Ala Arg Leu Gly Ile Arg Cys
1905 1910 1915 1920
Ile Gln Arg Leu Asp Gln Phe Ile Ile Leu Thr Gly Tyr Ser Ala Leu
1925 1930 1935
Asn Lys Leu Leu Gly Arg Glu Val Tyr Ser Ser His Met Gln Leu Gly
1940 1945 1950
Gly Pro Lys Ile Met Ala Thr Asn Gly Val Val His Leu Thr Val Ser
1955 1960 1965
Asp Asp Leu Glu Gly Val Ser Asn Ile Leu Arg Trp Leu Ser Tyr Val
1970 1975 1980
Pro Ala Tyr Ile Gly Gly Pro Leu Pro Val Thr Thr Pro Leu Asp Pro
1985 1990 1995 2000
Pro Asp Arg Pro Val Ala Tyr Ile Pro Glu Asn Ser Cys Asp Pro Arg
2005 2010 2015
Ala Ala Ile Arg Gly Val Asp Asp Ser Gln Gly Lys Trp Leu Gly Gly
2020 2025 2030
Met Phe Asp Lys Asp Ser Phe Val Glu Thr Phe Glu Gly Trp Ala Lys
2035 2040 2045
Thr Val Val Thr Gly Arg Ala Lys Leu Gly Gly Ile Pro Val Gly Val
2050 2055 2060
Ile Ala Val Glu Thr Gln Thr Met Met Gln Thr Ile Pro Ala Asp Pro
2065 2070 2075 2080
Gly Gln Leu Asp Ser Arg Glu Gln Ser Val Pro Arg Ala Gly Gln Val
2085 2090 2095
Trp Phe Pro Asp Ser Ala Thr Lys Thr Ala Gln Ala Leu Leu Asp Phe
2100 2105 2110
Asn Arg Glu Gly Leu Pro Leu Phe Ile Leu Ala Asn Trp Arg Gly Phe
2115 2120 2125
Ser Gly Gly Gln Arg Asp Leu Phe Glu Gly Ile Leu Gln Ala Gly Ser
2130 2135 2140
Thr Ile Val Glu Asn Leu Arg Thr Tyr Asn Gln Pro Ala Phe Val Tyr
2145 2150 2155 2160
Ile Pro Met Ala Ala Glu Leu Arg Gly Gly Ala Trp Val Val Val Asp
2165 2170 2175
Ser Lys Ile Asn Pro Asp Arg Ile Glu Cys Tyr Ala Glu Arg Thr Ala
2180 2185 2190
Lys Gly Asn Val Leu Glu Pro Gln Gly Leu Ile Glu Ile Lys Phe Arg
2195 2200 2205
Ser Glu Glu Leu Gln Asp Cys Met Ser Arg Leu Asp Pro Thr Leu Ile
2210 2215 2220
Asp Leu Lys Ala Lys Leu Glu Val Ala Asn Lys Asn Gly Ser Ala Asp
2225 2230 2235 2240
Thr Lys Ser Leu Gln Glu Asn Ile Glu Ala Arg Thr Lys Gln Leu Met
2245 2250 2255
Pro Leu Tyr Thr Gln Ile Ala Ile Arg Phe Ala Glu Leu His Asp Thr
2260 2265 2270
Ser Leu Arg Met Ala Ala Lys Gly Val Ile Lys Lys Val Val Asp Trp
2275 2280 2285
Glu Glu Ser Arg Ser Phe Phe Tyr Lys Arg Leu Arg Arg Arg Ile Ser
2290 2295 2300
Glu Asp Val Leu Ala Lys Glu Ile Arg Ala Val Ala Gly Glu Gln Phe
2305 2310 2315 2320
Ser His Gln Pro Ala Ile Glu Leu Ile Lys Lys Trp Tyr Ser Ala Ser
2325 2330 2335
His Ala Ala Glu Trp Asp Asp Asp Asp Ala Phe Val Ala Trp Met Asp
2340 2345 2350
Asn Pro Glu Asn Tyr Lys Asp Tyr Ile Gln Tyr Leu Lys Ala Gln Arg
2355 2360 2365
Val Ser Gln Ser Leu Ser Ser Leu Ser Asp Ser Ser Ser Asp Leu Gln
2370 2375 2380
Ala Leu Pro Gln Gly Leu Ser Met Leu Leu Asp Lys Met Asp Pro Ser
2385 2390 2395 2400
Arg Arg Ala Gln Leu Val Glu Glu Ile Arg Lys Val Leu Gly
2405 2410
Claims (3)
1. An ACCase mutant protein, which is characterized in that the 1927 position of the ACCase protein in the mutant protein is mutated, and the amino acid sequence of the mutant protein is shown as SEQ ID No.2 or SEQ ID No.3 in a sequence table.
2. An ACCase mutant gene encoding the protein of claim 1.
3. Use of the ACCase mutant protein of claim 1 or the ACCase mutant gene of claim 2 to enhance tolerance of rice, rice tissue, or rice cells to at least one herbicide.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110506582.0A CN113201557B (en) | 2021-05-10 | 2021-05-10 | Method for guiding editing system to mediate crops to generate endogenous herbicide resistance |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110506582.0A CN113201557B (en) | 2021-05-10 | 2021-05-10 | Method for guiding editing system to mediate crops to generate endogenous herbicide resistance |
Publications (2)
Publication Number | Publication Date |
---|---|
CN113201557A CN113201557A (en) | 2021-08-03 |
CN113201557B true CN113201557B (en) | 2023-04-07 |
Family
ID=77030639
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110506582.0A Active CN113201557B (en) | 2021-05-10 | 2021-05-10 | Method for guiding editing system to mediate crops to generate endogenous herbicide resistance |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113201557B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113755457B (en) * | 2020-09-23 | 2022-11-22 | 山东舜丰生物科技有限公司 | Herbicide-resistant acetyl coenzyme A carboxylase mutant and application thereof |
CN113151200A (en) * | 2021-05-10 | 2021-07-23 | 安徽省农业科学院水稻研究所 | Plant ACCase mutant protein and gene sequence and application thereof |
CN115029374B (en) * | 2022-06-24 | 2023-12-26 | 安徽省农业科学院水稻研究所 | PegRNA expression frame for backbone vector, corresponding backbone vector and application |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
BR112013019510B1 (en) * | 2011-02-01 | 2021-09-21 | Colorado Wheat Research Foundation, Inc | METHOD FOR OBTAINING A WHEAT PLANT, METHOD FOR GROWING A WHEAT PLANT, METHOD FOR PRODUCING A WHEAT PLANT, METHOD FOR IDENTIFYING A WHEAT PLANT THAT IS RESISTANT TO THE HERBICIDAL ACETYL-COA CARBOXYLASE, METHOD FOR GIVING RESISTANCE TO ACCASE HERBICIDES A A PLANT, ISOLATED POLYNUCLEOTIDE, NUCLEIC ACID CONSTRUCT, EXPRESSION CASSETTE, METHOD FOR OBTAINING A TRANSGENIC PLANT AND ISOLATED POLYPEPTIDE WITH ACCASE ACTIVITY |
CN108866092B (en) * | 2017-05-11 | 2022-12-27 | 中国科学院遗传与发育生物学研究所 | Production of herbicide-resistant genes and uses thereof |
CN108359646A (en) * | 2018-01-12 | 2018-08-03 | 江苏省农业科学院 | Make plant that there is ACCase muteins and its application of Herbicid resistant |
CN109082416B (en) * | 2018-08-22 | 2021-10-26 | 江苏省农业科学院 | ACCase mutant gene and protein with herbicide resistance and application thereof |
CN109355264B (en) * | 2018-11-28 | 2021-10-26 | 江苏省农业科学院 | Wheat ACCase mutant type gene and application thereof in herbicide resistance of plants |
CN112410308B (en) * | 2020-11-20 | 2023-11-10 | 江苏省农业科学院 | Rice ACCase mutant gene and application of rice ACCase mutant gene protein in herbicide resistance of plants |
-
2021
- 2021-05-10 CN CN202110506582.0A patent/CN113201557B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN113201557A (en) | 2021-08-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113201557B (en) | Method for guiding editing system to mediate crops to generate endogenous herbicide resistance | |
CN107129993B (en) | Modified glyphosate-resistant gene and cultivation method of glyphosate-resistant rice | |
CN110904071B (en) | Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance | |
CN113151200A (en) | Plant ACCase mutant protein and gene sequence and application thereof | |
CN108503700B (en) | Rice grain type protein and coding gene and application thereof | |
CN112250741B (en) | Use of protein derived from rice | |
CN113265401B (en) | Method for improving resistance of rice to HPPD inhibitor herbicide through gene editing and special sgRNA thereof | |
CN112410308B (en) | Rice ACCase mutant gene and application of rice ACCase mutant gene protein in herbicide resistance of plants | |
CN112824526A (en) | Rice ACCase mutant protein and corresponding gene | |
CN102477091B (en) | Rice male sterile protein and coding gene and application thereof | |
CN112301051A (en) | Method for improving soybean yield by GmUVR8 gene mutation and application thereof | |
CN110117318B (en) | Method for improving drought tolerance of plants by down-regulating eISFiso 4G1 gene and eISFiso 4G2 gene | |
CN110184252B (en) | Application of male sterility gene OsDAF1 and method for restoring rice male sterility | |
CN115894646B (en) | OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight | |
CN112813064A (en) | Method for creating endogenous herbicide-resistant rice with high and stable resistance | |
CN113151314B (en) | Plant ACCase mutant gene and application thereof | |
CN108660150A (en) | A method of improving Rice Salt ability | |
CN114478731A (en) | Herbicide-resistant rice mutant protein and application thereof | |
CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
WO2021047377A1 (en) | Application of tpst gene in regulation of traits of plant | |
CN115466747A (en) | Glycosyltransferase ZmKOB1 gene and application thereof in regulating and controlling maize ear fructification character or development | |
CN112522259A (en) | Method for cultivating plant type improved rice material with Oslg1 mutant phenotype through haploid mediation | |
CN106544356A (en) | A kind of method of utilization NPU gene mutations initiative photo-thermo-sensitive genetic male sterile line and its application | |
CN114644692B (en) | Method for creating drought-sensitive corn germplasm by site-directed mutagenesis and application thereof | |
CN112080481B (en) | Spike-type related gene OsFRS5 and application and phenotype recovery method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |