JP2020078312A - Method of producing l-amino acids - Google Patents

Abstract

To provide methods of producing L-amino acids by inhibiting target gene transcription using acetate-inducible promoter.SOLUTION: Provided is a method of producing L-amino acids, the method comprising a step of culturing a recombinant coryneform microorganism capable of producing L-amino acids, the recombinant coryneform microorganism being transformed by inducing an acetate-inducible promoter to the downstream of a stop codon of a target gene in a chromosome, in a direction opposite to the target gene transcription, and the target gene being a gene located at a branch point of a biosynthetic pathway of L-amino acids.SELECTED DRAWING: None

Description

  The present invention relates to a method for producing L-amino acid using a gene transcription inhibition method.

This application claims the benefit of Patent Document 1 filed on October 11, 2013 and Patent Document 2 filed on July 18, 2014 to the Korean Patent Office (KIPO), the entire contents of which are hereby incorporated by reference. Incorporated into the book as a reference.
One or more embodiments of the present invention relate to methods for producing L-amino acids using gene transcription inhibition methods.

In coryneform microorganisms, pyruvic acid (pyruvate) produced through glycolysis (Glycolysis) from various carbon sources is oxaloacetate.
) And converted to aspartate. The aspartic acid is
Through each biosynthetic pathway, threonine, methionine (Methioni)
ne), isoleucine and lysine (Fig. 1). Therefore, by inhibiting the expression of the gene located at the branch point in the process of amino acid biosynthesis, the production of by-products can be reduced and the production of the target amino acid can be increased.

As described above, in order to develop a microorganism as a strain capable of producing a target substance with high titer by utilizing genetic engineering or metabolic engineering technology, genes related to various metabolic processes in the microorganism are required. Must be able to selectively regulate the expression of. Recently, a technique called "artificial convergent transcription" for reducing gene expression has been reported (Non-Patent Document 1). In the artificial convergent transcription technology, an RNA polymerase complex derived from each promoter is inserted by inserting a promoter that progresses in the reverse direction of the gene transcription direction downstream of the transcription terminator of the target gene. Is a technique that causes mutual collision during the transcription process to reduce the expression of the target gene.

Therefore, the present inventors have developed a technique of inserting an acetic acid-inducible promoter so as to proceed in the direction opposite to the transcription direction of the target gene, and selectively inhibiting the expression of the target gene in the presence of acetic acid, It was confirmed that this can be effectively applied to inhibit the expression of a gene located at a branch point to provide a coryneform microorganism with improved L-amino acid productivity, and the present invention was completed.

Korean Patent Application No. 10-2013-0121090 Korean Patent Application No. 10-2014-0091307 Korean registered patent 0159812 Korean registered patent 0924065 Korean registered patent 1994-0001307 Korean registered patent 2031126, reference 2011-0127955 Korea registration publication number 2013-0061570

Krylov et al., J Mol Microbiol Biotechnol, 18:1-13, 2010 Gerstmeir et al., J Biotechnol, 104, 99-122, 2003 Binder et al. Genome Biology 2012, 13: R40 Blombach B et al., Appl Microbiol Biotechnol. 2007 Sep;76(3):615-23. Appl. Microbiol. Biotechnol. (1999) 52:541-545 Mateos et al., J Bacteriol, 176(23), 7362-7371, 1994 Patek et al., Biotechnology letters, Vol 19, No 11, 1997

An object of the present invention is to provide a method for producing an L-amino acid by inhibiting the gene transcription of interest using an acetic acid-inducible promoter.

In order to achieve the above object, the present invention provides
1) a step of culturing a recombinant coryneform microorganism having an L-amino acid-producing ability, which is transformed by introducing an acetic acid-inducible promoter downstream of a stop codon of a target gene in a chromosome; and 2) the culturing step In the step of adding acetic acid to reduce the expression of the target gene during the culture and enhance the L-amino acid-producing ability of the recombinant coryneform microorganism.
A method for producing an L-amino acid containing is provided.

Hereinafter, embodiments according to the present invention will be described in detail with reference to the accompanying drawings, and in the entire specification,
The same reference numerals provided in the drawings indicate the same members. In this regard, it should be understood that these embodiments may be embodied in other specific forms and are not limiting. Therefore, these examples are merely described with reference to the drawings for explaining the embodiments of the present invention. When an expression such as “at least one” precedes a list of components, it modifies the list of all components, not each component of the list. Hereinafter, the present invention will be described in detail.

In one aspect, the invention comprises
1) culturing a recombinant coryneform bacterium capable of producing L-amino acid, which is transformed by introducing an acetic acid-inducible promoter downstream of the stop codon of a gene of interest in the chromosome; and 2) in the culturing step Adding acetic acid to reduce the expression of the target gene during culture and enhance the L-amino acid-producing ability of the recombinant coryneform microorganism;
A method for producing an L-amino acid containing is provided.

In the present invention, the term “acetate-inducible promoter (acetate-inducible) is used.
“Promoter)” means a promoter having an expression-inducing activity in the presence of acetic acid.

In coryneform microorganisms, acetic acid is an acetate kinase (a kinase).
ckA, NCgl2656) and phosphotransacetylase (phosphotrans)
Acetylase, pta, NCgl2657) or by succinyl-CoA:acetate CoA-transferase (succinyl-CoA:acetate CoA).
-Transferase, actA, NCgl2480) gives acetyl CoA(a
cetyl CoA), followed by isocitrate lyase (i) in the glyoxylate cycle.
It is metabolized through the action of socirate lyase, aceA, NCgl2248). In E. coli, acetyl-CoA synthetase (acetyl-CoA synthet).
ace, acs, b4069) converts acetic acid to acetyl CoA (Non-Patent Document 2).
). Expression of the gene involved in acetic acid metabolism is induced in the presence of acetic acid. Therefore, when these gene promoters are used, gene expression can be specifically induced in the presence of acetic acid.

Here, as an acetic acid-inducible promoter, isocitrate lyase (isocitrate) is used.
lyase)-encoding gene (aceA, NCgl2248) promoter or acetate kinase (acetate kinase)-encoding gene (ackA, NC)
gl2656) and phosphotransacetylase (phosphotransacetyl)
and a promoter of a gene (pta, NCgl2657) operon encoding ase), that is, an upstream promoter of the pta gene. More specifically, in the acetic acid-inducible promoter, the aceA gene promoter has the base sequence set forth in SEQ ID NO: 1, and has 486 base pairs upstream of the aceA gene and an open reading frame (open). The reading frame (ORF) contains 36 base pairs from the N-terminus.

The upstream promoter of the pta gene, which is another acetic acid-inducible promoter, has the base sequence shown in SEQ ID NO: 2 and contains 340 base pairs upstream of the pta gene.

Further, it is obvious that if the expression of the target gene can be induced by acetic acid, it is included in the scope of the present invention. As an example, while containing the nucleotide sequence of SEQ ID NO: 1 or 2, or including the conserved sequence of the nucleotide sequence of SEQ ID NO: 1 or 2, one or a large number (amino acid residue of protein) at one or more positions. 2 to 20, preferably 2 to 10 and more preferably 2 to 5) bases are substituted,
A deletion, insertion, addition, or inverted nucleotide sequence can be included, but as long as it can maintain or enhance the function of the inducible promoter, the nucleotide sequence of SEQ ID NO: 1 or 2 is: 80% or more, preferably 90% or more, more preferably 95% or more, particularly preferably 97% or more homologous base sequences can be included, and the substitution, deletion, insertion, addition, or inversion of the bases can be included. Etc., as long as the function of the inducible promoter is maintained,
Naturally occurring variant sequences or artificial variant sequences can also be included.

The term “homology” in the present invention means the identity between two different nucleotide sequences, but score, identity, similarity.
It can be determined by a method well known to those skilled in the art using BLAST 2.0 for calculating a parameter such as y), but is not particularly limited thereto.

In the present invention, unless stated otherwise, the term “upstream” is 5
'Direction, and the term "downstream" means 3'direction.

In the present invention, the target gene in the chromosome is a threonine (Threon) from various carbon sources.
ine), methionine (Methionine), isoleucine (Isoleucine)
) And lysine and other genes involved in the biosynthesis process of amino acids,
In particular, it can be a gene located at a branch point in the biosynthetic pathway.

For example, in the case of lysine, the pyruvate dehydrogenase subunit E1 (pyruvated d), which is involved in converting pyruvate to acetyl CoA (acetyl CoA).
hydrogenase subunit E1, aceE, NCgl2167) gene, homoserine dehydrogenase (hom, NCgl1) that produces homoserine from aspartic acid.
136) gene and meso-2,6-diaminopimelic acid (m
UD used for synthesizing bacterial cells using eso-2,6-diaminopimelate)
P-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelic acid ligase (UDP-N-acetylmuramoylalanyl-D-glutam)
ate-2,6-diaminopimate ligase, murE, NCgl
2083) A gene or the like is located at the branch point of the biosynthetic pathway.

Further, in the case of threonine, dihydrodipicolinate synthase, which is involved in the formation of lysine from aspartic acid (dihydrodipicolinate synthase, da)
pA, NCgl1896) gene, in the case of methionine, homoserine kinase (homoserine kinase, thrB, which is involved in the production of threonine from homoserine,
The NCgl1137) gene is a branch point. Alanine (an amino acid derived from pyruvic acid
In the case of Alanine and Valine, pyruvic acid was replaced with acetyl CoA (ac
Pyruvate dehydrogenase subunit E involved in conversion to etyl CoA)
1 (pyrivate dehydrogenase subunit E1, aceE
, NCgl2167) gene is located at the equinox.

Here, as a specific example of the target gene, pyruvate dehydrogenase subunit E
Gene encoding 1 (aceE, NCgl2167), gene encoding homoserine dehydrogenase (hom, NCgl1136), gene encoding UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelic acid ligase (m
urE, NCgl2083) or a gene encoding dihydrodipicolinate synthase (
dapA, NCgl1896), but is not limited thereto.

Specifically, the pyruvate dehydrogenase subunit E1 (pyruvate de)
hydrogenase subunit E1, aceE, NCgl2167) uses the final metabolite of glycolysis, pyruvate, in the TCA cycle (tricarboxylic aci).
PDHC (pyruvate dehydr), which is involved in the influx into the d cycle
It is one of the constituent proteins of the genease complex). Therefore, ace
By reducing the expression amount of the E gene, the inflow of the carbon source into the TCA cycle can be weakened, and the inflow of the carbon source toward the lysine biosynthesis can be increased to increase the production of lysine.

Homoserine dehydrogenase,
hom, NCgl1136) is an aspartic acid semialdehyde (aspartate).
It is an enzyme that synthesizes homoserine from semidehyde. Since aspartic acid semialdehyde is one of the intermediate precursors of the lysine biosynthesis pathway, it lowers the activity of the hom gene, thereby weakening the influx of the carbon source into the homoserine synthesis pathway, which leads to lysine biosynthesis. The inflow of carbon source can be increased to increase the production of lysine.

UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelic acid ligase (UDP-N-acetylmuramoylalanyl-D-glu
tamate-2,6-diaminopimelate ligase, murE, N
Cgl2083) is an enzyme involved in the synthesis of bacterial cells, and meso-2,6-diaminopimelic acid (meso-2,6-diaminopimelate) is used for the synthesis of bacterial cells. Meso-2,6-diaminopimelic acid is also used as a precursor of lysine biosynthesis, and by reducing the activity of the murE gene, it weakens the influx of a carbon source into the synthesis of bacterial cells, and the lysine biosynthetic pathway. The influx of carbon source into the can be increased to increase the production of lysine.

Dihydrodipicolinate synthase (dihydrodipicolinate synt)
hase, dapA, NCgl1896) is aspartic acid semialdehyde (aspa).
It is an enzyme that is involved in the production of lysine using rtate semidehyde.
Aspartic acid semialdehyde is one of the intermediate precursors of the threonine biosynthetic pathway. Therefore, by reducing the activity of the dapA gene, the influx of carbon source into the lysine synthetic pathway is weakened and the threonine biosynthesis is promoted. The influx of carbon source can be increased to increase threonine production.

The term “stop codon” in the present invention is a codon on mRNA that acts as a signal notifying the completion of the protein synthesis process without specifying an amino acid, and is generally a UAA. , UAG, and UGA are used as stop codons.

In the present invention, the term “transcription terminator” is used.
"inverted repeat" having many GC bases.
t sequence), which terminates transcription of a gene by forming a hairpin loop.

In the present invention, as described above, an acetic acid-inducible promoter is introduced downstream of the stop codon of the target gene, preferably between the stop codon and the upstream of the transcription terminator for the purpose of reducing the expression of the target gene. be able to. By using an acetic acid-inducible promoter, the target gene is transcribed in the reverse direction by acetic acid at the time when the expression of the target gene can be reduced, and RNA polymerase complex (RNA polymerase complex)
Cause a collision during the transcription process to reduce the expression of the target gene.

The time at which the expression of the target gene can be reduced can be any time during the culture, and more specifically, it may be before or during the culture.

The term “transformation” in the present invention means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. To do. The introduced polynucleotide is
If it can be expressed in the host cell, it can be located inside the chromosome of the host cell, or it can be located extrachromosomally. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed.

The coryneform microorganism having L-amino acid-producing ability used in the present invention is Corynebacterium (
Genus Corynebacterium, Brevibacterium
um genus, Astrobacterium sp. (Arthrobacter sp.), and Microbacterium genus (Microbacterium sp.). Such coryneform microorganisms are produced from Corynebacterium glutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum, and these. Examples thereof include mutants or strains that produce L-amino acids, preferably Corynebacterium glutamicum, but not limited to these examples.

More specifically, in the present invention, as a coryneform microorganism, Corynebacterium glutamicum KCCM11016P strain (former deposit number KFCC10881, refer to Patent Document 3),
Corynebacterium glutamicum KCCM10770P strain (see Patent Document 4), Corynebacterium glutamicum KCCM11347P strain (former deposit number KFCC1075
0, see Patent Document 5).

Further, in the present invention, Corynebacterium glutamicum CJ is used as a coryneform microorganism.
3P strain is used, which is based on reports such as binder (Binder) using Corynebacterium glutamicum wild strain (ATCC13032) as a parent strain, and three types of genes related to lysine production efficiency (pyc(P458S), hom(V59A), lysC(T
311I)) has a lysine-producing ability by introducing a mutation (Non-patent Document 3).

In addition, as another coryneform microorganism, Corynebacterium glutamicum KCCM1122
A 2P strain is used, which is an L-threonine producing strain (Patent Document 6).

In one embodiment of the present invention, all of the coryneform microorganisms into which the promoter having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention has been introduced are L-lysine or L compared to the parent strain.
-Threonine production capacity increased.

In the method of the present invention, for culturing the coryneform microorganism, any culturing condition and culturing method known in the art can be used.

Examples of the medium used for culturing the coryneform strain include, for example, Manual of
Methods for General Biology by the
American Society for Bacteriology (Washin
gton D.D. C. , USA, 1981).

Among the components of the medium, sugar sources used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil and coconut oil. , Fatty acids such as palmitic acid, stearic acid, linoleic acid, alcohols such as glycerol and ethanol, organic acids such as acetic acid. These substances can be used individually or as a mixture.

Nitrogen sources used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybeans, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen sources can also be used individually or as a mixture.

Sources of phosphorus used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. Also, the culture medium must contain metal salts such as magnesium sulfate or iron sulfate required for growth. Finally, in addition to the substances mentioned, essential growth substances such as amino acids and vitamins are used. Also, a suitable precursor is used for the culture medium. The raw material may be added batchwise or continuously by a method suitable for the culture during the culture process.

During the culturing of said microorganism, basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in a suitable manner to adjust the pH of the culture. Further, it is possible to suppress the generation of bubbles by using an antifoaming agent such as fatty acid polyglycol ester. Oxygen or an oxygen-containing gas (eg, air) is injected into the culture to maintain aerobic conditions. Cultivation temperature is usually 20°C to 45°C, preferably 2°C.
It is 5°C to 40°C. The culturing time can be continued until the desired production amount of L-amino acid is maximized, but it is preferably 10 to 160 hours.

In the method of the present invention, the culturing can be carried out continuously or batchwise such as batch process, fed-batch and repeated fed-batch process. Such a culture method is well known in the art, and any method can be used.

The term "culturing stage" in the present invention can include both a medium preparation stage and a culture stage.

The L-amino acid produced in the culturing step of the present invention may further include a step of purifying or recovering, and the purifying or recovering method may be a method for culturing the microorganism of the present invention, such as a batch method, a continuous method or The target L-amino acid can be purified or recovered from the culture broth using an appropriate method known in the art depending on the fed-batch culture method and the like.

In the present invention, the L-amino acid produced in the culturing step may be one selected from the group consisting of threonine, methionine, isoleucine, lysine, valine or alanine, preferably lysine or threonine. ..

It is a figure showing a branching point in an amino acid biosynthesis process in a coryneform microorganism. a) is between the stop codon of the aceE gene and the upstream of the transcription terminator, and b) is that the aceA gene promoter is inserted downstream of the transcription terminator and the aceE gene is transferred in the opposite direction to the aceE gene. It is a figure showing that it inhibits the expression of.

Hereinafter, the present invention will be described in detail with reference to Examples. However, these examples are for exemplifying the present invention, and the scope of the present invention is not limited to such examples.

Example 1: Selection of acetic acid-inducible promoter Isocitrate lyase (aceA, NCgl22)
48) is a major enzyme of the glyoxylate cycle, and its gene is expressed in the presence of acetic acid. In addition, acetate kinase (aceta
te kinase, ackA, NCgl2656) and phosphotransacetylase (p
Hosphotransacetylase, pta, NCgl2657) also form an operon as an enzyme involved in the metabolic process of acetic acid, and its expression is enhanced in the presence of acetic acid. The aceA gene and the promoter site of the pta-ackA operon are
It is already known (Non-patent document 2).

In this example, the aceA gene promoter and the pta-ack operon promoter, that is, the upstream promoter site of the pta gene was selected for use in the purpose of inhibiting transcription of the target gene in the presence of acetic acid. The aceA gene (NCBI registration number NC) registered in the gene bank (NIH GenBank) of the National Institutes of Health
gl2248), based on the base sequence of the aceA gene, 486 base pairs (bas)
e pair) and open reading frame (open reading frame)
e, ORF), a base sequence (SEQ ID NO: 1) containing 36 base pairs was secured from the N-terminal.
Further, a base sequence (SEQ ID NO: 2) containing 340 base pairs upstream of the pta gene was secured based on the base sequence of the pta gene (NCBI accession number NCgl2657) registered in the gene bank of the National Institutes of Health. ..

Example 2: Preparation of vector for inhibiting aceE gene expression Pyruvate dehydrogenase subunit E1 (pyruvate dehydrolog)
The enzyme subunit E1, aceE, NCgl2167) is capable of converting pyruvic acid, which is the final metabolite of glycolysis, into the TCA cycle (tricarboxylic acid cycl).
e) PDHC (pyruvate dehydrogena) involved in influx
se complex) is one of the constituent proteins. Therefore, it is possible to weaken the inflow of the carbon source into the TCA cycle by decreasing the expression amount of the aceE gene and increase the inflow of the carbon source toward lysine biosynthesis to increase the production of lysine (Non-Patent Document 1). 4).

By inserting the aceA gene promoter downstream of the aceE gene and proceeding in the direction opposite to the aceE gene transcription direction, the expression of the aceE gene was selectively inhibited in the presence of acetic acid (Fig. 2).

First, CLC main workbench software (CLC main workbench
h software; CLC bio, Denmark) was used to predict the transcription terminator of the aceE gene. The transcription terminator is an inverted repeat that is rich in GC bases.
t) sequence, which terminates gene transcription by forming a hairpin loop at this site. As a result of predicting the transcription terminator of the aceE gene, a
56 from the 21st base downstream from the stop codon of the ceE gene.
Up to the 36th base, 36 base pairs (hair pair) have a hairpin loop (hairpi).
(n loop) structure and was predicted as a transcription terminator. In this Example based on this, two vectors capable of proceeding in the opposite direction of the aceE gene transcription direction were prepared by inserting the aceA gene promoter upstream or downstream of the aceE gene transcription terminator.

<2-1> Construction of pDZ-aceE1-PaceA vector for inhibiting aceE gene expression
Downstream manufacturing aceE gene termination codon, i.e., between the upstream of the transcription terminator and the stop codon, was produced a vector for inserting the aceA gene promoter.

In order to secure a fragment of the aceE gene derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, and the restriction enzyme XbaI recognition site at the 5′ end and the restriction enzyme SpeI recognition at the 3′ end of the fragment. Primers with inserted sites (SEQ ID NOS: 3 and 4) were synthesized. PCR was carried out using the synthesized primers to obtain a DNA fragment containing 296 bp from the base 2474 to the base 2769, which is the stop codon, from the start codon (start codon). In addition, primers (SEQ ID NOS: 5 and 6) in which a restriction enzyme SpeI recognition site and a restriction enzyme XbaI recognition site were inserted at the 5′ end and the 3′ end of the fragment were synthesized and PCR was performed to obtain 300 bp downstream of the aceE gene stop codon. A DNA fragment containing Polymerase is PfuUtr
a ^™ High-Fidelity DNA Polymerase (Stratagene), PCR conditions: denaturation 95° C., 30 seconds; annealing 55° C., 30 seconds; and polymerization 72.
After repeating 30° C. and 30 seconds 30 times, a polymerization reaction was carried out at 72° C. for 7 minutes.

P for introducing a chromosome prepared by cutting with the two PCR amplification products and a restriction enzyme XbaI in advance
The DZ vector (Patent Document 4) was added to the In-fusion Cloning Kit (TAK).
ARA, JP) and cloned to prepare pDZ-aceE1 vector.

SEQ ID NO: 3 aceE-P1F 5'- ccggggatcctctagacctccggcccatacgttgc -3'
SEQ ID NO: 4 aceE-P1R 5'- ttgagactagttattcctcaggagcgtttg -3'
SEQ ID NO: 5: aceE-P2F 5'- gaataactagtctcaagggacagataaatc -3'
SEQ ID NO: 6 aceE-P2R 5'- gcaggtcgactctagagaccgaaaagatcgtggcag -3'

In order to secure the aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOS: 7 and 8) in which Spe I restriction enzyme sites were inserted at the 5'end and 3'end of the fragment were synthesized. Corynebacterium glutamicum KCCM1
PCR was carried out using the synthesized primer with 1016P chromosomal DNA as a template to amplify a promoter site of about 500 bp having the nucleotide sequence of SEQ ID NO:1. The DNA fragment obtained by treating the PCR amplification product and the pDZ-aceE1 vector with the restriction enzyme SpeI was
-Fusion Cloning Kit (TAKARA, JP) was used for cloning to prepare pDZ-aceE1-PaceA vector.

SEQ ID NO: 7: PaceA-P3F 5'- gtcccttgagactagtagcactctgactacctctg -3'
SEQ ID NO: 8: PaceA-P3R 5'-ctgaggaataactagtttcctgtgcggtacgtggc -3'

<2-2> Construction of pDF-aceE2-PaceA vector for inhibiting aceE gene expression
Downstream of manufacturing aceE gene transcription terminator to prepare a vector for inserting the aceA gene promoter.

In order to secure the aceE gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, the restriction enzyme XbaI recognition site at the 5′ end and the restriction enzyme SpeI recognition site at the 3′ end. Primers (SEQ ID NOS: 9 and 10) in which was inserted were synthesized. PCR was performed using the synthesized primers to obtain a DNA fragment containing 294 bp from the 2538th base to the 62nd base downstream of the stop codon from the start codon of the aceE gene. The restriction enzyme S is added to the 5'end of the fragment.
PCR was performed using the peI recognition site and the primers (SEQ ID NOs: 11 and 12) in which a restriction enzyme XbaI recognition site was inserted at the 3'end, and 294 bp from the 69th base to the 362nd base downstream of the aceE gene stop codon. The containing DNA fragment was secured. Polymerase is P
fuUltra ^™ High-Fidelity DNA Polymerase (Stratag
ene), PCR conditions were denaturation 95° C., 30 seconds; annealing 55° C., 30 seconds; and polymerization 72° C., 30 seconds, repeated 30 times, and then a polymerization reaction was performed at 72° C. for 7 minutes.

The two PCR amplification products and the pDZ vector for chromosome introduction prepared by cutting with the restriction enzyme XbaI in advance were treated with In-fusion Cloning Kit (TAKARA, JP
) Was used for cloning to prepare a pDZ-aceE2 vector.

SEQ ID NO: 9: aceE-P4F 5'- ccggggatcctctagaggtcccaggcgactacacc -3'
SEQ ID NO: 10: aceE-P4R 5'- gagctactagtacgacgaatcccgccgccagacta -3'
SEQ ID NO: 11: aceE-P5F 5'- gtcgtactagtagctctttttagccgaggaacgcc -3'
SEQ ID NO: 12: aceE-P5R 5'- gcaggtcgactctagacatgctgttggatgagcac -3'

In order to secure the aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOS: 13 and 14) in which restriction enzyme SpeI recognition sites were inserted at the 5'end and 3'end of the fragment were synthesized. Corynebacterium glutamicum KC
PCR was performed using the chromosomal DNA of CM11016P as a template and the synthesized primer to amplify a promoter site of about 500 bp having the nucleotide sequence of SEQ ID NO:1. The P
A DNA fragment obtained by treating the CR amplification product and the pDZ-aceE2 vector with the restriction enzyme SpeI was prepared using In-fusion Cloning Kit (TAKARA, JP),
It cloned and produced the pDZ-aceE2-PaceA vector.

SEQ ID NO: 13: PaceA-P6F 5'- aaaaagagctactagtagcactctgactacctctg -3'
SEQ ID NO: 14: PaceA-P6R 5'- gattcgtcgtactagtttcctgtgcggtacgtggc -3'

Example 3: Production of aceA gene promoter-inserted strain downstream of aceE gene The vectors pDZ-aceE1-PaceA and pDZ-aceE produced in Example 2 above.
2-PaceA was transformed into L-lysine-producing strain Corynebacterium glutamicum KCCM11016P using the electric pulse method (Non-Patent Document 5), and the aceA gene promoter was provided downstream of the aceE gene stop codon on the chromosome. Insert and aceE
Strains that proceeded in the direction opposite to the gene transcription direction were isolated by performing PCR to obtain L-lysine-producing strains, which were respectively isolated from Corynebacterium glutamicum KCC.
M11016P::aceE1-PaceA and Corynebacterium glutamicum KC
It was named CM11016P::aceE2-PaceA. Corynebacterium glutamicum KCCM11016P :: aceE1-PaceA is Corynebacte
It was deposited internationally under the name of rum glutamicum CA01-2271 on June 12, 2013 under the deposit number KCCM11432P at the Korean Microorganism Conservation Center. The produced strain was obtained by performing PCR using SEQ ID NO: 3 and SEQ ID NO: 6 in the case of KCCM11016P:: aceE1-PaceA, and SEQ ID NO: 9 and SEQ ID NO: 12 in the case of KCCM11016P:: aceE2-PaceA, thereby carrying out PCR. The base sequence was finally confirmed through analysis of the base sequence for the site.

Example 4: Ratio of lysine-producing ability of aceA gene promoter-inserted strain downstream of aceE gene
Produced in Corynebacterium glutamicum KCCM11016P strains and Example 3 using as compare parent strain is L- lysine-producing strain Corynebacterium glutamicum KCCM
11016P::aceE1-PaceA and KCCM11016P::aceE2-
PaceA was cultured in the following manner for L-lysine production.

Corynebacterium glutamicum parent strains KCCM11016P and KCCM11016P::ac in a 250 ml corner-baffle flask containing 25 ml of the following seed medium.
eE1-PaceA, KCCM11016P::aceE2-PaceA was inoculated and 3
The culture was carried out at 0° C. for 20 hours with shaking at 200 rpm. 25 containing 24 ml of the following production medium
A 0 ml corner-baffle flask was inoculated with 1 ml of the seed culture and cultivated with shaking at 200 rpm at 30° C. for 72 hours. The compositions of the seed medium and the production medium are as follows.

<Seed medium (pH 7.0)>
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH ₂ PO ₄ 4
g, K ₂ HPO ₄ 8 g, MgSO ₄ 7H ₂ O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 20
00 μg (based on 1 L of distilled water)

<Production medium (pH 7.0)>
Glucose _{100g, (NH 4) 2 SO} 4 40g, soy protein 2.5g, corn steep solids (Corn Steep Solids) 5g, urea 3g, _KH 2 PO _{4
1g, MgSO 4 7H 2 O 0.5g} , biotin 100 [mu] g, thiamine HCl10
00 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3000 μg, C
aCO ₃ 30 g (based on 1 L of distilled water).

After the culture was completed, the amount of L-lysine produced was measured by a method using HPLC. Acetic acid (ac
Etate) is not added, Corynebacterium glutamicum KCCM110
16P and KCCM11016P::aceE1-PaceA, KCCM11016P:
The L-lysine concentration in the culture solution for aceE2-PaceA is shown in Table 1 below.

In addition, strains were cultured in the same manner except that 5 g/L of acetic acid was added to the production medium, and L-lysine producing ability was compared. The L-lysine concentration in the culture solution is as shown in Table 2 below.

As shown in Table 1, KCCM11016P::a in the absence of acetic acid.
ceE1-PaceA, KCCM11016P :: aceE2-PaceA strain is
It was confirmed that the parent strain KCCM11016P and lysine-producing ability did not change.

However, as shown in Table 2 above, in the presence of acetic acid, KCCM11016P
:: The aceE1-PaceA strain has a lysine productivity of 3.6% or more as compared to the parent strain KCCM11016P, and the KCCM11016P :: aceE2-PaceA strain has a lysine productivity of 2.5% as compared to the parent strain KCCM11016P. It was confirmed that the above improvements were made.

Then, KCCM11016P :: aceE1-PaceA and KCCM11016
Comparing P :: aceE2-PaceA, in the case of KCCM11016P in which the aceA promoter was inserted upstream of the transcription terminator of the aceE gene, that is, between the stop codon and the upstream of the transcription terminator, lysine was detected. Since it is more effective in production, it can be seen that using the downstream of the gene stop codon as an insertion site, that is, between the stop codon and the upstream of the transcription terminator, inhibits gene expression more effectively.

Example 5: Preparation of pDZ-ace E-Ppta vector for inhibiting aceE gene expression Acetate kinase (acetate kinase, ackA, NCgl2656) and phosphotransacetylase (phosphotransacetylase, pta, NC)
gl2657) forms an operon as an enzyme involved in the acetic acid metabolism process, and its expression is enhanced in the presence of acetic acid like isocitrate lyase. Therefore, when these gene promoters are used, gene expression can be specifically induced in the presence of acetic acid.

In this Example, p was used to inhibit the expression of the aceE gene under the condition of acetic acid.
A vector was constructed to utilize the promoter of the ta-ack operon, that is, the upstream promoter site of the pta gene.

In order to inhibit the expression of the aceE gene, a pta gene promoter is inserted downstream of the aceE gene stop codon, that is, between the stop codon and the upstream of the transcription terminator, and the ac
A vector capable of proceeding in the direction opposite to the eE gene transcription direction was prepared.

Example 2 using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template to secure the aceE gene fragment derived from Corynebacterium glutamicum.
A pDZ-aceE1 vector was prepared in the same manner as in.

In order to secure the pta gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 15 and 16) designed to have restriction enzyme SpeI recognition sites at the 5'end and 3'end of the fragment were synthesized. .. Using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primers, P
CR was performed to amplify a promoter site of about 340 bp having the nucleotide sequence of SEQ ID NO:2. A DNA section obtained by treating the PCR amplification product and the pDZ-aceE1 vector with a restriction enzyme SpeI was cloned by using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-aceE1-Ppta vector.

SEQ ID NO: 15: Ppta-P7F 5'- gtcccttgagactagtctttgctggggtcagatttg-3'
SEQ ID NO: 16: Ppta-P7R 5'-ctgaggaataactagtacatcgcctttctaatttc-3'

Example 6: Preparation of pta gene promoter insertion strain downstream of aceE gene and lysine production
Comparing the functions The vector pDZ-aceE1-Ppta prepared in Example 5 was treated in the same manner as in Example 3 with the L-lysine-producing strain Corynebacterium glutamicum KCCM11016.
L-lysine is produced by transforming P, inserting the pta gene promoter downstream of the aceE gene stop codon on the chromosome, and performing PCR to isolate the strain that has proceeded in the reverse direction of the aceE gene transcription direction. To obtain a strain that does KCCM11016P :: a
It was named ceE1-Ppta. Production strain KCCM11016P :: aceE1-P
pta is obtained by performing PCR using SEQ ID NO: 3 and SEQ ID NO: 6 as primers,
The base sequence was finally confirmed through analysis of the base sequence for the target site.

The produced strain was cultured in the same manner as in Example 4, and the concentration of L-lysine recovered therefrom was measured. When acetic acid is not added, the L-lysine concentration in the culture solution is shown in Table 3 below.

In addition, strains were cultured in the same manner except that 5 g/L of acetic acid was added to the production medium, and L-lysine producing ability was compared. The L-lysine concentration in the culture solution is shown in Table 4 below.

As shown in Table 3, KCCM11016P::ac in the absence of acetic acid.
It was confirmed that the eE1-Ppta strain had the same lysine-producing ability as the parent strain KCCM11016P.

However, as shown in Table 4 above, in the presence of acetic acid, KCCM11016P
It was confirmed that the aceE1-Ppta strain had an improved lysine productivity of 2.4% or more as compared with the parent strain KCCM11016P.

In addition, KCCM11016P::aceE1-PaceA strain is KCCM11016.
Since P:: aceE1-Ppta strain has a better lysine-producing ability, using the aceA gene promoter in the presence of acetic acid more effectively inhibits the expression of the target gene than using the pta gene promoter. I understand.

Example 7: Preparation of downstream aceA gene promoter insertion strain of aceE gene The vector pDZ-aceE1-PaceA prepared in the above Example 2 was used in the same manner as in Example 3 to produce L-lysine-producing strain Corynebacterium glutamicum. KFCC1075
0, KCCM10770P and CJ3P3 strains, and aceE on the chromosome
KFCC10750 that produces L-lysine by inserting the aceA gene promoter downstream of the gene stop codon and separating the strain that has proceeded in the opposite direction of the aceE gene transcription direction by PCR, and isolates it. :
Three strains of aceE1-PaceA and CJ3P :: aceE1-PaceA were obtained. The prepared strain was subjected to PCR using SEQ ID NO: 3 and SEQ ID NO: 6 as primers to finally confirm the base sequence through analysis of the base sequence for the target site.

The produced strain was cultured in the same manner as in Example 4, and the concentration of L-lysine recovered therefrom was measured. When acetic acid is not added, the L-lysine concentration in the culture solution is shown in Table 5 below.

In addition, strains were cultured in the same manner except that 5 g/L of acetic acid was added to the production medium, and L-lysine producing ability was compared. The L-lysine concentration in the culture solution is shown in Table 6 below.

As shown in Table 5, KFCC10750::ac in the absence of acetic acid.
eE1-PaceA, KCCM10770P :: aceE1-PaceA and CJ3
It was confirmed that the three strains of P :: aceE1-PaceA had the same lysine-producing ability as the parent strain.

However, as shown in Table 6 above, in the presence of acetic acid, the lysine-producing ability was lower than that of KF.
CC10750 :: aceE1-PaceA strain is 5% of parent strain, KCCM1077
0P ::: aceE1-PaceA strain has a parent strain ratio of 2.8%, CJ3P :: ac
It could be confirmed that the eE1-PaceA strain was improved in the parent strain ratio by 15%, respectively.

Example 8: Preparation of hom gene expression inhibition vector By weakening the L-threonine biosynthetic pathway using a substrate similar to the L-lysine biosynthetic pathway,
The L-lysine production capacity can be increased. In order to weaken the L-threonine biosynthetic pathway, homoserine dehydrogenase (hom, NC, which produces homoserine) from aspartic acid is used.
11136) and a method of decreasing the enzyme activity.

In Corynebacterium glutamicum, the hom gene is the same as the thrB gene.
Forms the thrB operon, and the transcription terminator is located downstream of the thrB gene. It has been reported that a promoter is present upstream of the hom-thrB operon, that is, upstream of the hom gene, and a second promoter is also present upstream of the thrB gene ORF (Non-Patent Document 6). Therefore, a is placed downstream of the hom gene stop codon.
In order to maintain the expression of the thrB gene by inserting the ceA gene promoter and proceeding in the direction opposite to the transcription direction of the hom gene to selectively inhibit the expression of the hom gene in the presence of acetic acid. A second promoter sequence was added upstream of the ORF.

In this example, ac between the downstream of the hom gene stop codon and the upstream of the thrB gene, ac
A recombinant vector for inserting the eA gene promoter was prepared.

In order to secure the hom gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template to
Primers (SEQ ID NOS: 17 and 18) designed so as to have a restriction enzyme XbaI recognition site at the 3′ end and a restriction enzyme SpeI recognition site at the 3′ end were synthesized. PCR was performed using the synthesized primers to obtain a DNA fragment containing 300 bp from the 1039th base to the 1338th stop codon of the hom gene. Even if the aceA promoter is inserted between the hom-thrB operons due to the inhibition of hom gene expression, t
Expression of the hrB gene must be maintained. Therefore, when a DNA fragment containing 300 bp downstream of the hom gene stop codon was prepared, a 32 bp thrB promoter sequence was added to the D
Primers (SEQ ID NOS: 19 and 20) inserted on the 5'side of the NA fragment were synthesized. PCR was performed using this primer (SEQ ID NOS: 19 and 20), and the restriction enzyme Sp was added to the 5'end of the fragment.
A 344 bp DNA fragment having an eI recognition site and a restriction enzyme XbaI recognition site at the 3'end was secured. PCR was performed under the same conditions as in Example 2.

The two PCR amplification products and the pDZ vector for chromosome introduction prepared by cutting with the restriction enzyme XbaI in advance were treated with In-fusion Cloning Kit (TAKARA, JP
) Was used for cloning to prepare a pDZ-hom vector.

SEQ ID NO: 17: hom-h1F 5'- ccggggatcctctagaccaggtgagtccacctacg -3'
SEQ ID NO: 18: hom-h1R 5'- gaggcggatcactagtttagtccctttcgaggcgg -3'
SEQ ID NO: 19: hom-h2F 5'- actagtgatccgcctcgaaagggac -3'
SEQ ID NO: 20: hom-h2R 5'- gcaggtcgactctagagactgcggaatgttgttgtg -3'

In order to secure the aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOS: 21 and 22) were synthesized in which restriction enzyme SpeI recognition sites were inserted at the 5'end and 3'end of the fragment, respectively. Corynebacterium glutamicum KC
PCR was performed using the synthesized primer with CM11016P chromosomal DNA as a template to amplify a promoter region of about 500 bp having the nucleotide sequence of SEQ ID NO: 1. The P
The DNA fragment obtained by treating the CR amplification product and the pDZ-hom vector with the restriction enzyme SpeI was cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-hom-PaceA vector.

SEQ ID NO: 21: PaceA-h3F 5'- gaggcggatcactagtagcactctgactacctctg -3'
SEQ ID NO: 22: PaceA-h3R 5'- aagggactaaactagtttcctgtgcggtacgtggc -3'

Example 9: Preparation of aceA gene promoter insertion strain downstream of hom gene and lysine production
Comparison of Performances The vector pDZ-hom-PaceA prepared in Example 8 was treated in the same manner as in Example 3 to produce L-lysine-producing strain Corynebacterium glutamicum KCCM11016P.
To produce L-lysine by isolating the aceA gene promoter downstream of the hom gene stop codon on the chromosome and proceeding in the direction opposite to the hom gene transcription direction by PCR. KCCM11016P :: hom-PaceA was acquired. The prepared strain KCCM11016P ::: hom-PaceA was subjected to PCR using SEQ ID NO: 17 and SEQ ID NO: 20 as primers to finally confirm its base sequence through analysis of the base sequence for the target site.

The Corynebacterium glutamicum KCCM11016P strain used as the parent strain and the produced KCCM11016P :: hom-PaceA strain were cultured in the same manner as in Example 4 for the production of L-lysine, and the L-lysine recovered therefrom was recovered. The concentration was measured. Corynebacterium glutamicum KCCM11016P and KC without acetic acid
The L-lysine concentration in the culture solution for CM11016P :: hom-PaceA is as shown in Table 7 below.

In addition, strains were cultured in the same manner except that 5 g/L of acetic acid was added to the production medium, and L-lysine producing ability was compared. The L-lysine concentration in the culture solution is as shown in Table 8 below.

As shown in Table 7, KCCM11016P::h in the absence of acetic acid.
It was confirmed that the om-PaceA strain had no change in the lysine production ability as compared with the parent strain KCCM11016P.

However, as shown in Table 8 above, KCCM11016P:
: The hom-PaceA strain has a lysine production capacity of 2 as compared with the parent strain KCCM11016P.
． It was confirmed that the improvement was 6% or more.

Example 10: Preparation of vector for inhibiting murE gene expression UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelic acid ligase (UDP-N-acetylmuramoylanayl-D-glu)
tamate-2,6-diaminopimelate ligase, murE, N
Cgl2083) utilizes meso-2,6-diaminopimelic acid (meso-2,6-diaminopimelate), which is used as a precursor for lysine biosynthesis, but is used for synthesizing cells, but reduces the activity of the murE gene. This can weaken the inflow of the carbon source into the synthesis of the bacterial cells and increase the inflow of the carbon source into the lysine biosynthesis pathway to increase the production of lysine.

The murE gene (NCgl2083) in Corynebacterium glutamicum
It forms an operon together with 7 genes from NCgl2076 to NCgl2082. Transcription of the operon begins at the NCgl2083 murE gene and proceeds in the direction of the NCgl2076 gene. Therefore, the transcription terminator is located downstream of the NCgl2076 gene. The aceA gene promoter is inserted downstream of the murE gene stop codon to advance in the reverse direction of the murE gene transcription direction and selectively mu in the presence of acetic acid.
An additional murE operon promoter was inserted upstream of the NCgl2082 gene ORF in order to maintain the expression of the remaining seven genes other than the murE gene located at the beginning of the operon so as to inhibit the expression of the rE gene. .

In this example, a recombinant vector for inserting the aceA gene promoter downstream of the murE gene stop codon was prepared.

In order to secure the murE gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, the restriction enzyme XbaI recognition site at the 5′ end and the restriction enzyme XhoI recognition site at the 3′ end. Primers (SEQ ID NOS: 23 and 24) designed to have PCR was carried out using the synthesized primers to obtain a DNA fragment containing 300 bp from the start codon of the murE gene to the 1267th base to the 1566th stop codon. Also, 5'of the fragment
A primer designed to have a restriction enzyme XhoI recognition site at the end and a restriction enzyme XbaI recognition site at the 3'end (SEQ ID NOS: 25 and 26) was synthesized, PCR was performed, and the 10th base downstream from the murE gene stop codon was synthesized. A DNA fragment containing 292 bp was secured. PCR
Was performed under the same conditions as in Example 2. The two PCR amplification products and the restriction enzyme XbaI in advance.
The pDZ vector for chromosome transfer prepared by cutting with In-fusion Clonin
Using pKit (TAKARA, JP), cloning was performed to prepare a pDZ-murE vector.

SEQ ID NO: 23: mur-m1F 5'- ccggggatcctctagaaaccctcgttcagaggtgc -3'
SEQ ID NO: 24: mur-m1R 5'- ttgtgatcatctcgagctatccttcttccgtagtaag -3'
SEQ ID NO: 25: mur-m2F 5'- agctcgagatgatcacaatgacccttgg -3'
SEQ ID NO: 26: mur-m2R 5'- gcaggtcgactctagacatgagcataaatgtcagc -3'

In order to secure the aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOS: 27 and 28) designed to have a restriction enzyme XhoI recognition site at the 5′ end of the fragment were synthesized. Corynebacterium glutamicum KCCM11
PCR was performed using the 016P chromosomal DNA as a template and the synthesized primer to amplify a promoter site of about 500 bp having the nucleotide sequence of SEQ ID NO: 1. In order to secure the promoter site of the murE operon derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template,
Primers (SEQ ID NOs: 29 and 30) designed to have a restriction enzyme XhoI recognition site at the 3'end of the fragment were synthesized. PCR was performed using the synthesized primers to obtain a DNA fragment containing 300 bp upstream of the murE gene ORF. DNA fragments obtained by treating the two PCR amplification products and the pDZ-murE vector with the restriction enzyme XhoI were treated with In-fu.
pDZ-using cloning clone kit (TAKARA, JP)
The murE-PaceA-PmurE vector was created.

SEQ ID NO: 27: mur-m3F 5'- tcatcagcagcactctgactacctctg -3'
SEQ ID NO: 28: mur-m3R 5'-agaaggatagctcgagttcctgtgcggtacgtggc -3'
SEQ ID NO: 29: mur-m4F 5'-agagtgctgctgatgatcctcgatttg -3'
SEQ ID NO: 30: mur-m4R 5'- ttgtgatcatctcgagggttttctctcctccacagg -3'

Example 11: Preparation of aceA gene promoter insertion strain downstream of murE gene and lysine
Comparison of Productivity In the same manner as in Example 3, the vector pDZ-murE-PaceA-PmurE produced in the above Example 10 was used as an L-lysine producing strain Corynebacterium glutamicum KCC.
It was transformed into M11016P and aceA was introduced downstream of the murE gene stop codon on the chromosome.
The gene promoter was inserted, and the strain that proceeded in the direction opposite to the murE gene transcription direction was transformed into P.
KCCM11016P:: which produces L-lysine by performing CR and separating
Obtained murE-PaceA-PmurE. The produced strain KCCM11016P:
For murE-PaceA-PmurE, PCR was carried out using SEQ ID NO:23 and SEQ ID NO:26 as primers, and the base sequence was finally confirmed through analysis of the base sequence for the target site.

The Corynebacterium glutamicum KCCM11016P strain used as the parent strain and the produced KCCM11016P :: murE-PaceA-PmurE were cultured for L-lysine production in the same manner as in Example 4, and L-lysine recovered therefrom. Was measured. Corynebacterium glutamicum KCCM1101 when acetic acid is not added
The concentrations of L-lysine in the culture solution for 6P and KCCM11016P :: murE-PaceA-PmurE are shown in Table 9 below.

In addition, strains were cultured in the same manner except that 5 g/L of acetic acid was added to the production medium, and L-lysine producing ability was compared. The L-lysine concentration in the culture solution is shown in Table 10 below.

As shown in Table 9, KCCM11016P::m in the absence of acetic acid.
It was confirmed that the urE-PaceA-PmurE strain had no change in the lysine-producing ability as compared with the parent strain KCCM11016P.

However, as shown in Table 10 above, in the presence of acetic acid, KCCM11016P
It was confirmed that the murE-PaceA-PmurE strain had an improved lysine productivity of 2.8% or more as compared with the parent strain KCCM11016P.

Example 12: Preparation of vector for inhibiting dapA gene expression By weakening the L-lysine biosynthesis pathway using a substrate similar to the L-threonine biosynthesis pathway, L-threonine production capacity can be increased. In order to weaken the L-lysine biosynthesis pathway, a method of decreasing the activity of the dihydrodipicolinate synthase (dapA, NCgl1896) gene involved in the production of lysine from aspartic acid can be mentioned.

In Corynebacterium glutamicum, the dapA gene is ORF4 (NCgl1
895) gene to form the dapA-ORF4 operon, and thus the transcription terminator is located downstream of the ORF4 gene. It has been reported that a promoter exists upstream of the dapA-ORF4 operon, that is, upstream of the dapA gene, and a promoter sequence also exists upstream of the ORF4 gene (Non-Patent Document 7). Therefore,
The aceA gene promoter is inserted downstream of the stop codon of the dapA gene to proceed in the direction opposite to the dapA gene transcription direction so as to selectively inhibit the expression of the dapA gene in the presence of acetic acid, and to express the ORF4 gene. A promoter site 100 bp sequence upstream of the ORF4 gene was added upstream of the ORF4 gene for maintenance.

In this example, a recombinant vector for inserting the aceA gene promoter downstream of the dapA gene stop codon was prepared.

In order to secure the dapA gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, the restriction enzyme XbaI recognition site at the 5′ end and the restriction enzyme SpeI recognition site at the 3′ end. Primers (SEQ ID NOS: 31 and 32) designed to have PCR was carried out using the synthesized primers to obtain a DNA fragment containing 301 bp from the 606th base to the 906th base which is the stop codon of the dapA gene. In addition, a primer (SEQ ID NOs: 33 and 34) having a restriction enzyme SpeI recognition site at the 5′ end and a restriction enzyme XbaI recognition site at the 3′ end is synthesized and PCR is performed to maintain the expression of the ORF4 gene. Thus, a DNA fragment containing a promoter sequence of 100 bp from the start codon of the dapA gene to the second base downstream of the stop codon and 213 bp downstream of the stop codon of the dapA gene was secured. PCR proceeded under the same conditions as in Example 2. The two PCR amplification products and the pDZ vector for chromosome introduction prepared by cutting with the restriction enzyme XbaI in advance were treated with the In-fusion Cloning Kit (TA
KARA, JP) was used for cloning to prepare a pDZ-dapA vector.

SEQ ID NO: 31: dapA-d1F 5'- ccggggatcctctagatgtttggcttgctttgggc -3'
SEQ ID NO: 32: dapA-d1R 5'- gttgatgcactagtttatagaactccagcttt-3'
SEQ ID NO: 33: dapA-d2F 5'- ttctataaactagtgcatcaacgtaggagatcc -3'
SEQ ID NO: 34: dapA-d2R 5'- gcaggtcgactctagacgttctgggaaccctgag -3'

In order to secure a promoter fragment of the aceA gene derived from Corynebacterium glutamicum, primers (SEQ ID NOS: 35 and 36) were synthesized in which restriction enzyme SpeI recognition sites were inserted at the 5'end and 3'end of the fragment, respectively. Corynebacterium glutamicum K
PCR was performed using the synthesized primer with the chromosomal DNA of CCM11016P as a template to amplify a promoter site of about 500 bp having the nucleotide sequence of SEQ ID NO:1. DNA obtained by treating the PCR amplification product and the pDZ-dapA vector with the restriction enzyme SpeI
The sections were cloned into pDZ-da using the In-fusion Cloning Kit (TAKARA, JP).
The pA-PaceA vector was created.

SEQ ID NO: 35: PaceA-d3F 5'- acgttgatgcactagtagcactctgactacctctg -3'
SEQ ID NO: 36: PaceA-d3R 5'- agttctataaactagtttcctgtgcggtacgtggc -3'

Example 13: Preparation of thre aceA promoter inserted downstream of dapA gene and threo
Comparison of nin-producing ability In order to confirm the dapA gene expression inhibitory effect in L-threonine-producing strains, L-
The threonine producing strain KCCM11222P (Patent Document 7) was transformed with the vector pDZ-dapA-PaceA prepared in Example 12 in the same manner as in Example 3, and the aceA gene promoter was provided downstream of the dapA gene on the chromosome. KCCM11222P::dapA-PaceA that produces L-threonine was obtained by performing PCR to isolate the strain that had been inserted and advanced in the direction opposite to the dapA gene transcription direction. The produced strain KCCM11222P :: dapA-PaceA has SEQ ID NO: 31 and SEQ ID NO: 34.
PCR was carried out using as a primer to finally confirm the base sequence through analysis of the base sequence for the target site.

The Corynebacterium glutamicum KCCM11222P strain used as a parent strain and the produced KCCM11222P ::dapA-PaceA strain were cultured by the following method for producing L-threonine.

A 250 ml corner-baffle flask containing 25 ml of seed medium was inoculated with each strain and cultured at 30° C. for 20 hours with shaking at 200 rpm. Then 24 ml of production medium
Inoculate a 250 ml corner-baffle flask containing 1 ml with 3 ml of seed culture.
The culture was carried out at 0° C. for 48 hours with shaking at 200 rpm. The compositions of the seed medium and the production medium are as follows.

<Seed medium (pH 7.0)>
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH ₂ PO ₄ 4
_{g, K 2 HPO 4 8g,} MgSO 4 · 7H 2 O 0.5g, biotin 100 [mu] g, Thiamine HCl 1000 [mu] g, calcium - pantothenate 2000 [mu] g, (referenced to distilled water 1L) nicotinamide 2000 [mu] g

<Production medium (pH 7.0)>
Glucose 100 g, (NH ₄ ) ₂ SO ₄ 20 g, soy protein 2.5 g, corn steep solids (Corn Step Solids) 5 g, urea 3 g, KH ₂ P
_{O 4 1g, MgSO 4 · 7H} 2 O 0.5g, biotin 100 [mu] g, thiamine HCl10
00 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3000 μg, C
aCO ₃ 30 g (based on 1 L of distilled water).

After the culture was completed, the concentration of L-threonine in the culture solution was analyzed using HPLC. Corynebacterium glutamicum KCCM11222P and K without acetic acid
The L-threonine concentration in the culture solution for CCM11222P::dapA-PaceA is shown in Table 11 below.

In addition, strains were cultured in the same manner except that 5 g/L of acetic acid was added to the production medium, and L-threonine producing ability was compared. The L-threonine concentration in the culture solution is shown in Table 12 below.

As shown in Table 11, KCCM11222P::d in the absence of acetic acid.
It was confirmed that the apA-PaceA strain had no change in threonine-producing ability as compared with the parent strain KCCM11222P.

However, as shown in Table 12 above, in the presence of acetic acid, KCCM11222
In the case of P::dapA-PaceA strain, it could be confirmed that the threonine-producing ability was improved by 50% or more as compared with the parent strain KCCM11222P.

Outsourcing organization: Korean Culture Center of Microorganisms (
International Depositary Organization)
Contract number: KCCM11432P
Accepted date: 2013.06.12

As described above, the present invention reduces the expression of a target gene by using acetic acid-inducible promoter and adding acetic acid within an appropriate time, thereby producing the target L-amino acid in high yield. Since it can be produced, it can be effectively used for the production of L-amino acids.

It should be understood that the above examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto. It should be generally understood that the features and characteristics described in each embodiment may utilize other similar features and characteristics in other embodiments.

One or more embodiments of the present invention will be described with reference to the drawings, and various changes in form and specific aspects to those skilled in the art are defined in the claims below. And should be understood to be possible without departing from the scope.

The present invention provides the following.
[1] 1) Introducing an acetic acid-inducible promoter in the chromosome downstream of the stop codon of the target gene
For culturing a recombinant coryneform bacterium capable of producing L-amino acid, which has been transformed by
Floor; and
2) Addition of acetic acid at the above-mentioned culture stage reduces the expression of the above-mentioned target gene during the culture.
And enhancing the L-amino acid-producing ability of the recombinant coryneform bacterium;
A method for producing an L-amino acid containing:
[2] Downstream of the stop codon is upstream of the stop codon of the target gene and the transcription terminator.
The method for producing an L-amino acid according to the above [1], characterized in that
[3] The acetic acid-inducible promoter has the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
The method for producing an L-amino acid according to [1] above, which is characterized in that
[4] The above gene of interest encodes pyruvate dehydrogenase subunit E1
Gene (NCgl12167), gene encoding homoserine dehydrogenase (NCg
11136), UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-
Gene encoding diaminopimelate ligase (NCgl2083) and dihydrodipi
One or more genes from the group consisting of the gene encoding choline synthase (NCgl1896)
The method for producing an L-amino acid according to the above [1], wherein a gene is selected.
[5] The L-amino acid is L-lysine or L-threonine,
The method for producing an L-amino acid according to the above [4].
Hereinafter, embodiments according to the present invention will be described in detail with reference to the accompanying drawings, and in the entire specification,
The same reference numerals provided in the drawings indicate the same members. In this regard, it should be understood that these embodiments may be embodied in other specific forms and are not limiting. Therefore, these examples are merely described with reference to the drawings for explaining the embodiments of the present invention. When an expression such as “at least one” precedes a list of components, it modifies the list of all components, not each component of the list. Hereinafter, the present invention will be described in detail.

Claims (5)

1) a step of culturing a recombinant coryneform microorganism having an L-amino acid-producing ability, which is transformed by introducing an acetic acid-inducible promoter into the chromosome at the downstream of the stop codon of the target gene;
And 2) adding acetic acid in the culturing step to reduce the expression of the target gene during culturing and enhance the L-amino acid-producing ability of the recombinant coryneform microorganism.
A method for producing an L-amino acid containing: The method for producing an L-amino acid according to claim 1, wherein the downstream of the stop codon is between the stop codon of the target gene and the upstream of the transcription terminator. The method for producing an L-amino acid according to claim 1, wherein the acetic acid-inducible promoter has the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The target gene includes a gene encoding a pyruvate dehydrogenase subunit E1 (NCgl12167) and a gene encoding a homoserine dehydrogenase (NCgl1).
136), a gene encoding a UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelic acid ligase (NCgl2083) and a gene encoding a dihydrodipicolinic acid synthase (NCgl1896). The method for producing an L-amino acid according to claim 1, wherein the above genes are selected. The method for producing an L-amino acid according to claim 4, wherein the L-amino acid is L-lysine or L-threonine.

Images