JP2016532439A - Method for producing L-amino acid - Google Patents

Abstract

The present invention includes 1) culturing a recombinant coryneform microorganism having L-amino acid-producing ability, transformed by introducing an acetic acid-inducible promoter downstream of a stop codon of a target gene in a chromosome; and 2 A method for producing an L-amino acid comprising: adding acetic acid in the culturing step to reduce the expression of the target gene during culturing and enhancing the L-amino acid producing ability of the recombinant coryneform microorganism; provide.

Description

  The present invention relates to a method for producing an L-amino acid using a gene transcription inhibition method.

This application claims the benefit of Patent Document 1 filed on October 11, 2013 and Patent Document 2 filed on July 18, 2014 at the Korean Patent Office (KIPO), the entire contents of which are described in this specification. Incorporated by reference into the book.
One or more embodiments of the present invention relate to methods for producing L-amino acids using gene transcription inhibition methods.

  In coryneform microorganisms, pyruvate produced from various carbon sources via glycolysis is converted to aspartate via oxaloacetate. The aspartic acid is converted into amino acids such as threonine, methionine, isoleucine and lysine through each biosynthetic pathway (FIG. 1). Therefore, by inhibiting the expression of the gene located at the branch point in the process of amino acid biosynthesis, the production of by-products can be reduced and the production of the target amino acid can be increased.

  In order to develop a microorganism as a strain capable of producing a target substance at a high titer by using genetic engineering or metabolic engineering techniques as described above, genes related to various metabolic processes in the microorganism are used. It must be possible to selectively regulate the expression of. Recently, a technique called “artificial convergent transcription” for reducing gene expression has been reported (Non-patent Document 1). The artificial convergent transcription technique involves inserting a promoter that proceeds in the direction opposite to the transcription direction of the gene downstream of the transcription terminator of the gene of interest to thereby derive an RNA polymerase complex derived from each promoter. Is a technology that causes collisions with each other during the transcription process to reduce the expression of the target gene.

  Therefore, the present inventors have developed a technique for selectively inhibiting the expression of the target gene in the presence of acetic acid by inserting an acetic acid inducible promoter so as to proceed in the reverse direction of the transcription direction of the target gene, This was effectively applied to inhibit the expression of a gene located at a branch point, and it was confirmed that a coryneform microorganism with improved L-amino acid productivity could be provided, thereby completing the present invention.

Korean Patent Application No. 10-2013-0121090 Korean Patent Application No. 10-2014-0091307 Korean registered patent 0159812 Korea registered patent 0924065 Korean registered patent 1994-0001307 Korean registered patent 2031126, reference 2011-0127955 Korea registration number 2013-0061570

Krylov et al., J Mol Microbiol Biotechnol, 18: 1-13, 2010 Gerstmeir et al., J Biotechnol, 104, 99-122, 2003 Binder et al. Genome Biology 2012, 13: R40 Blombach B et al., Appl Microbiol Biotechnol. 2007 Sep; 76 (3): 615-23 Appl. Microbiol. Biotechnol. (1999) 52: 541-545 Mateos et al., J Bacteriol, 176 (23), 7362-7371, 1994 Patek et al., Biotechnology letters, Vol 19, No 11, 1997

  An object of the present invention is to provide a method for producing an L-amino acid by inhibiting an intended gene transcription using an acetic acid-inducible promoter.

In order to achieve the above object, the present invention provides:
1) a step of culturing a recombinant coryneform microorganism having L-amino acid-producing ability transformed by introducing an acetic acid-inducible promoter downstream of a stop codon of a target gene in a chromosome; and 2) the culturing step Adding an acetic acid to reduce the expression of the target gene during culture and enhance the L-amino acid-producing ability of the recombinant coryneform microorganism;
A method for producing an L-amino acid comprising

  Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings. Throughout the specification, the same reference numerals shown in the drawings indicate the same members. In this context, it should be understood that these embodiments can be implemented in other specific forms and are not limited thereto. Accordingly, these examples are merely described with reference to the drawings to illustrate aspects of the present invention. When an expression such as “at least one” is described prior to the list of components, the list of all components is changed, and each component of the list is not changed. The present invention will be described in detail below.

As one aspect, the present invention provides:
1) culturing a recombinant coryneform microorganism having L-amino acid-producing ability transformed by introducing an acetic acid-inducible promoter downstream of the stop codon of the target gene in the chromosome; and 2) Adding acetic acid to reduce the expression of the target gene during culture and to enhance the L-amino acid-producing ability of the recombinant coryneform microorganism;
A method for producing an L-amino acid comprising

  The term “acetate-inducible promoter” in the present invention means a promoter having an expression-inducing activity in the presence of acetic acid.

  In coryneform microorganisms, acetic acid is produced by acetate kinase (acetate kinase, ackA, NCgl2656) and phosphotransacetylase (phosphotransacetylase, pta, NCgl2657), or succinyl CoA: acetate CoA-transferase (succinyl-CoA: acetate After being converted to acetyl CoA by actA, NCgl2480), it is metabolized through the action of isocitrate lyase (acecitrate lyase, aceA, NCgl2248) in the glyoxylate cycle. In Escherichia coli, acetic acid is converted to acetyl CoA by acetyl CoA synthetase (acetyl-CoA synthetase, acs, b4069) (Non-patent Document 2). Expression of the gene involved in acetic acid metabolism is induced in the presence of acetic acid. Therefore, when these gene promoters are used, gene expression can be specifically induced under conditions where acetic acid is present.

  Here, as an acetic acid-inducible promoter, a gene encoding an isocitrate lyase (aceA, NCgl2248) or a gene encoding an acetic acid kinase (ackA, NCgl2656) and a phosphotransacetylase (phosphotransacetylase) (Pta, NCgl2657) operon promoter, that is, the upstream promoter of the pta gene. More specifically, among the acetic acid-inducible promoters, the aceA gene promoter has the base sequence described in SEQ ID NO: 1, and has 486 base pairs upstream of the aceA gene and an open reading frame (open). reading frame (ORF), including 36 base pairs from the N-terminus.

  Further, an upstream promoter of the pta gene, which is another acetic acid-inducible promoter, has the base sequence described in SEQ ID NO: 2 and includes 340 base pairs upstream of the pta gene.

  In addition, it is obvious that it is included in the scope of the present invention as long as the expression of the target gene can be induced with acetic acid. Examples thereof include one or a plurality (amino acid residues of protein) at one or more positions, including the nucleotide sequence of SEQ ID NO: 1 or 2, or a conserved sequence of the nucleotide sequence of SEQ ID NO: 1 or 2. 2 to 20, preferably 2 to 10, more preferably 2 to 5) bases are substituted, deleted, inserted, added, or reversed. 80% or more, preferably 90% or more with respect to the nucleotide sequence of SEQ ID NO: 1 or 2, as long as the function of the inducible promoter can be maintained or enhanced. More preferably 95% or more, particularly preferably 97% or more of a base sequence having homology, and the substitution, deletion, insertion, addition, or inversion of the base may include the inducibility. As long as to maintain the function of the promoter, it may also contain variant sequences or artificial variant sequence naturally occurring.

  In the present invention, the term “homology” means identity between two different base sequences, but parameters such as score, identity, similarity, and the like are set as parameters. Although it can be determined by a method well known to those skilled in the art using BLAST 2.0 to be calculated, it is not particularly limited thereto.

  In the present invention, unless otherwise stated, the term “upstream” refers to the 5 ′ direction, and the term “downstream” refers to the 3 ′ direction.

  In the present invention, the target gene in the chromosome is a gene involved in the biosynthesis process of amino acids such as threonine, methionine, isoleucine and lysine from various carbon sources, It can be a gene located at a branch point in the biosynthetic pathway.

  For example, in the case of lysine, a pyruvate dehydrogenase subunit E1 (pyruvate dehydrogenase subunit E1, aceE, NCgl2167) gene, which produces homoserine from aspartic acid, is related to the conversion of pyruvate to acetyl CoA. UDP-N used for cell synthesis using homoserine dehydrogenase (hom, NCgl1136) gene and lysine precursor meso-2,6-diaminopimelate (meso-2,6-Diaminopimelate) -Acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelate ligase (UDP-N-acety lmuramolylanyl-D-glutamate-2,6-diamine primate ligase, murE, NCgl2083) gene and the like are located at the branch point of the biosynthetic pathway.

  In the case of threonine, a dihydrodipicolinate synthase (dapA, NCgl1896) gene involved in the production of lysine from aspartic acid, and in the case of methionine, a homoserine kinase (homoserine kinase, involved in the production of threonine from homoserine, thrB, NCgl1137) gene is the branch point. In the case of the amino acids derived from pyruvate, alanine and valine, pyruvate dehydrogenase subunit E1 (pyruvate dehydrogenase subunit E1, ace67, NCg21), which is related to the conversion of pyruvate into acetyl CoA (acetyl CoA). ) The gene is located at the minute point.

  Here, specific examples of the target gene include a gene encoding pyruvate dehydrogenase subunit E1 (aceE, NCgl2167), a gene encoding homoserine dehydrogenase (hom, NCgl1136), UDP-N-acetylmuramoylalanyl- One selected from the group consisting of a gene encoding D-glutamic acid-2,6-diaminopimelate ligase (murE, NCgl2083) or a gene encoding dihydrodipicolinate synthase (dapA, NCgl1896), but not limited thereto is not.

  Specifically, pyruvate dehydrogenase subunit E1 (pyruvate dehydrogenase subunit E1, aceE, NCgl2167) causes pyruvate, which is the final metabolite of glycolysis, to flow into the HC involved in PD in the TCA cycle (tricarboxylic acid cycle). (Pyruvate dehydrogenase complex) is one of the constituent proteins. Therefore, by reducing the expression level of the aceE gene, the inflow of the carbon source to the TCA cycle can be weakened, and the inflow of the carbon source can be increased toward lysine biosynthesis to increase the production of lysine.

  Homoserine dehydrogenase (homose, NCgl1136) is an enzyme that synthesizes homoserine from aspartate semialdehyde. Aspartate semialdehyde is one of the intermediate precursors of the lysine biosynthetic pathway, so reducing the activity of the hom gene attenuates the inflow of the carbon source into the homoserine synthesis pathway, leading to lysine biosynthesis. Increasing carbon source inflow can increase lysine production.

  UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelate ligase (UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminoprimate ligase, murE, NCgl2083) An enzyme involved, meso-2,6-diaminopimelic acid (meso-2,6-Diaminopimelate) is used for cell synthesis. Meso-2,6-diaminopimelic acid is also used as a precursor of lysine biosynthesis, and by reducing the activity of the murE gene, it weakens the inflow of the carbon source to the synthesis of the microbial cells, and the lysine biosynthesis pathway Increasing carbon source inflow to increase lysine production.

  Dihydrodipicolinate synthase (dapA, NCgl1896) is an enzyme involved in the production of lysine using aspartate semialdehyde. Aspartate semialdehyde is one of the intermediate precursors of the threonine biosynthetic pathway, so reducing the activity of the dapA gene attenuates the influx of carbon sources into the lysine synthesis pathway, leading to threonine biosynthesis. Increasing carbon source inflow can increase threonine production.

  The term “stop codon” in the present invention is a codon that acts as a signal notifying the completion of the protein synthesis process without specifying an amino acid among codons on mRNA, and generally UAA. , UAG and UGA are used as stop codons.

  The term “transcription terminator” in the present invention means an inverted repeat sequence in which many GC bases exist, and terminates the transcription of a gene by forming a hairpin loop. Let

  In the present invention, as described above, an acetic acid inducible promoter is introduced downstream of the stop codon of the target gene, preferably between the stop codon and the upstream of the transcription terminator, for the purpose of reducing the expression of the target gene. be able to. By using an acetic acid-inducible promoter, the target gene is transcribed in the reverse direction with acetic acid when the expression of the target gene can be reduced, so that the RNA polymerase complex causes a collision during the transcription process. To reduce target gene expression.

  The time point at which the expression of the target gene can be reduced can be any time during the culture period, and more specifically, may be before or during the culture.

  The term “transformation” in the present invention means that a vector containing a polynucleotide encoding a target protein is introduced into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. To do. The introduced polynucleotide can be located either inserted into the host cell chromosome or located extrachromosomally as long as it can be expressed in the host cell. The polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed.

  Coryneform microorganisms having the ability to produce L-amino acids used in the present invention include the genus Corynebacterium, the genus Brevibacterium, the genus Astrobacter sp., And the genus Microbacterium sp. ) Concept including microorganisms. Such coryneform microorganisms are produced from Corynebacterium glutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum and the like. In addition, mutants or strains that produce L-amino acids can be mentioned, and preferably Corynebacterium glutamicum, but is not limited to these examples.

  More specifically, in the present invention, corynebacterium glutamicum KCCM11016P strain (former deposit number KFCC10881, see Patent Document 3), Corynebacterium glutamicum KCCM10770P strain (see Patent Document 4), corynebacterium as coryneform microorganisms. Glutamicum KCCM11347P strain (old deposit number KFCC10750, see Patent Document 5) was used.

  Further, in the present invention, Corynebacterium glutamicum CJ3P strain is used as a coryneform microorganism. This is based on the report of Binder, etc., and the wild strain Corynebacterium glutamicum (ATCC13032) is used as a parent strain. It is a strain that has the ability to produce lysine by introducing mutations into three genes (pyc (P458S), hom (V59A), lysC (T311I)) related to production efficiency (non-patented) Reference 3).

  Moreover, although Corynebacterium glutamicum KCCM11222P strain is used as another coryneform microorganism, this is an L-threonine-producing strain (Patent Document 6).

  In one embodiment of the present invention, all of the coryneform microorganisms into which the promoter having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention has been introduced have an increased ability to produce L-lysine or L-threonine compared to the parent strain. .

  In the method of the present invention, for culturing coryneform microorganisms, any culture condition and culture method known in the art can be used.

  Examples of the medium used for culturing a coryneform strain include, for example, Manual of Methods for General Bacteriology by the American Society for Bacteriology (Washington DC, USA, 1981).

  Among the components of the medium, the sugar sources used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc. , Fatty acids such as palmitic acid, stearic acid, linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These substances can be used individually or as a mixture.

  Nitrogen sources used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soy, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture.

  The phosphorus source used includes potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a salt containing sodium corresponding thereto. The culture medium must also contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins are used. Also suitable precursors for the culture medium are used. The raw material can be added batchwise or continuously to the culture during the culturing process.

  During the cultivation of the microorganism, the pH of the culture can be adjusted using basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid in a suitable manner. Moreover, the production | generation of a bubble can be suppressed using an antifoamer like fatty acid polyglycol ester. In order to maintain aerobic conditions, oxygen or an oxygen-containing gas (eg, air) is injected into the culture. The culture temperature is usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. The culture time can be continued until the maximum production amount of the desired L-amino acid is obtained, and is preferably 10 to 160 hours.

  In the method of the present invention, the culturing can be performed continuously or batchwise, such as a batch process, a fed batch, and a repeated fed batch process. Such a culture method is well known in the art, and any method can be used.

  The term “culture stage” in the present invention can include both the medium preparation time and the time during culture.

  The L-amino acid produced in the culturing step of the present invention may further include a step of purification or recovery, and the purification or recovery method may be a method of culturing a microorganism of the present invention, for example, batchwise, continuous or Depending on the fed-batch culture method or the like, the target L-amino acid can be purified or recovered from the culture solution using an appropriate method known in the art.

  In the present invention, the L-amino acid produced in the culture step may be one selected from the group consisting of threonine, methionine, isoleucine, lysine, valine or alanine, preferably lysine or threonine. .

It is the figure which showed the branch point of the amino acid biosynthesis process in a coryneform microorganism. a) is inserted between the stop codon of the aceE gene and the upstream of the transcription terminator, b) is inserted into the downstream of the transcription terminator, and the aceA gene promoter is inserted to proceed in the reverse direction of the aceE gene transcription direction. It is the figure which showed inhibiting the expression of.

  Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to such examples.

Example 1: Selection of acetic acid inducible promoter Isocitrate lyase (aceA, NCgl2248) is a major enzyme of the glyoxylate cycle, and its gene is expressed in the presence of acetic acid. . In addition, acetate kinase (acetate kinase, ackA, NCgl2656) and phosphotransacetylase (phosphotransacetylase, pta, NCgl2657) also form operons as enzymes involved in the metabolic process of acetic acid, and their expression is enhanced in the presence of acetic acid. Is done. The promoter sites of the aceA gene and the pta-ackA operon as described above are already known (Non-patent Document 2).

  In this example, the aceA gene promoter and the pta-ack operon promoter, that is, the upstream promoter site of the pta gene were selected for the purpose of inhibiting the transcription of the target gene under conditions where acetic acid was present. Based on the base sequence of the aceA gene (NCBI registration number NCgl2248) registered in the National Institutes of Health gene bank (NIH GenBank), 486 base pairs upstream of the aceA gene and an open reading frame ( A base sequence (SEQ ID NO: 1) containing 36 base pairs from the N-terminus of the open reading frame (ORF) was secured. In addition, a base sequence (SEQ ID NO: 2) containing 340 base pairs upstream of the pta gene was secured based on the base sequence of the pta gene (NCBI registration number NCgl2657) registered in the National Institutes of Health gene bank. .

Example 2: Production of aceE gene expression inhibition vector Pyruvate dehydrogenase subunit E1, aceE, NCgl2167) converts pyruvate, which is the final metabolite of glycolysis, into a TCA cycle. It is one of the constituent proteins of PDHC (pyruvate dehydrogenase complex) involved in influx. Therefore, by reducing the expression level of the aceE gene, the inflow of the carbon source to the TCA cycle can be weakened, and the inflow of the carbon source can be increased toward lysine biosynthesis to increase the production of lysine (Non-Patent Document). 4).

  By inserting the aceA gene promoter downstream of the aceE gene and proceeding in the reverse direction of the aceE gene transcription direction, the expression of the aceE gene was selectively inhibited under conditions where acetic acid was present (see FIG. 2).

  First, the transcription terminator of the aceE gene was predicted using CLC main workbench software (CLC main workware; CLC bio, Denmark). The transcription terminator is an inverted repeat sequence in which many GC bases exist, and forms a hairpin loop at this site to terminate gene transcription. As a result of predicting the transcription terminator of the aceE gene, 36 base pairs from the 21st base to the 56th base downstream from the stop codon of the aceE gene have a hairpin loop structure. It was predicted as a transcription terminator. In this example based on this, the aceA gene promoter was inserted upstream or downstream of the aceE gene transcription terminator, and two types of vectors capable of proceeding in the reverse direction of the aceE gene transcription direction were prepared.

<2-1> Preparation of pDZ-aceE1-PaceA vector for aceE gene expression inhibition Preparation of a vector for inserting the aceA gene promoter downstream of the aceE gene stop codon, that is, between the stop codon and the upstream of the transcription terminator did.

In order to secure a fragment of the aceE gene derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, a restriction enzyme XbaI recognition site at the 5 ′ end and a restriction enzyme SpeI recognition at the 3 ′ end. Primers (SEQ ID NOs: 3 and 4) into which the sites were inserted were synthesized. PCR was performed using the synthesized primer to obtain a DNA fragment containing 296 bp from the aceE gene start codon (start codon) to the 2474th base to the stop codon 2769th base. Also, a primer (SEQ ID NO: 5 and 6) having a restriction enzyme SpeI recognition site inserted at the 5 ′ end and a restriction enzyme XbaI recognition site inserted at the 3 ′ end was synthesized, PCR was performed, and 300 bp downstream of the aceE gene stop codon. A DNA fragment containing The polymerase was PfuUltra ^™ High-Fidelity DNA polymerase (Stratagene), and PCR conditions were: denaturation 95 ° C., 30 seconds; annealing 55 ° C., 30 seconds; and polymerization 72 ° C., 30 seconds repeated 30 times, then at 72 ° C. The polymerization reaction was performed for 7 minutes.

  The pDZ vector for chromosomal introduction (Patent Document 4) prepared by cutting with the two PCR amplification products and the restriction enzyme XbaI in advance was cloned using In-fusion Cloning Kit (TAKARA, JP) and cloned into the pDZ-aceE1 vector. Was made.

SEQ ID NO: 3 aceE-P1F 5'- ccggggatcctctagacctccggcccatacgttgc -3 '
SEQ ID NO: 4: aceE-P1R 5'- ttgagactagttattcctcaggagcgtttg -3 '
SEQ ID NO: 5: aceE-P2F 5'- gaataactagtctcaagggacagataaatc -3 '
SEQ ID NO: 6: aceE-P2R 5'- gcaggtcgactctagagaccgaaaagatcgtggcag -3 '

  In order to secure an aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 7 and 8) were synthesized in which Spe I restriction enzyme sites were inserted into the 5 'end and 3' end of the fragment, respectively. PCR was carried out using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primer to amplify an approximately 500 bp promoter site having the base sequence of SEQ ID NO: 1. A DNA section obtained by treating the PCR amplification product and the pDZ-aceE1 vector with the restriction enzyme SpeI was cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-aceE1-PaceA vector.

SEQ ID NO: 7: PaceA-P3F 5'-gtcccttgagactagtagcactctgactacctctg-3 '
SEQ ID NO: 8: PaceA-P3R 5'-ctgaggaataactagtttcctgtgcggtacgtggc-3 '

<2-2> Preparation of pDF-aceE2-PaceA vector for aceE gene expression inhibition A vector for inserting the aceA gene promoter was prepared downstream of the aceE gene transcription terminator.

In order to secure an aceE gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, a restriction enzyme XbaI recognition site at the 5 ′ end and a restriction enzyme SpeI recognition site at the 3 ′ end. Primers (SEQ ID NOs: 9 and 10) into which was inserted were synthesized. PCR was performed using the synthesized primer to obtain a DNA fragment containing 294 bp from the 2538th base from the start codon of the aceE gene to the 62nd base downstream of the stop codon. Further, PCR was performed using a primer (SEQ ID NO: 11 and 12) in which a restriction enzyme SpeI recognition site was inserted at the 5 ′ end and a restriction enzyme XbaI recognition site was inserted at the 3 ′ end, and the 69th downstream of the aceE gene stop codon. A DNA fragment containing 294 bp from the base to the 362nd base was secured. As the polymerase, PfuUltra ^™ High-Fidelity DNA polymerase (Stratagene) was used, and PCR conditions were as follows: denaturation 95 ° C., 30 seconds; annealing 55 ° C., 30 seconds; and polymerization 72 ° C., 30 seconds 30 times, followed by 7 at 72 ° C. Polymerization reaction was performed for a minute.

  The two PCR amplification products and the pDZ vector for chromosome introduction prepared by cutting with the restriction enzyme XbaI in advance were cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-aceE2 vector.

SEQ ID NO: 9: aceE-P4F 5'- ccggggatcctctagaggtcccaggcgactacacc -3 '
SEQ ID NO: 10: aceE-P4R 5'-gagctactagtacgacgaatcccgccgccagacta-3 '
SEQ ID NO: 11: aceE-P5F 5'-gtcgtactagtagctctttttagccgaggaacgcc-3 '
SEQ ID NO: 12: aceE-P5R 5'- gcaggtcgactctagacatgctgttggatgagcac -3 '

  In order to secure the aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 13 and 14) were synthesized in which a restriction enzyme SpeI recognition site was inserted into the 5 'end and 3' end of the fragment, respectively. PCR was performed using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primer to amplify an approximately 500 bp promoter site having the base sequence of SEQ ID NO: 1. A DNA section obtained by treating the PCR amplification product and the pDZ-aceE2 vector with the restriction enzyme SpeI was cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-aceE2-PaceA vector.

SEQ ID NO: 13: PaceA-P6F 5'- aaaaagagctactagtagcactctgactacctctg-3 '
SEQ ID NO: 14: PaceA-P6R 5'- gattcgtcgtactagtttcctgtgcggtacgtggc -3 '

Example 3: Production of aceA gene promoter insertion strain downstream of aceE gene The vectors pDZ-aceE1-PaceA and pDZ-aceE2-PaceA produced in Example 2 above are L-lysine producing strains using the electric pulse method, respectively. A strain obtained by transforming to Corynebacterium glutamicum KCCM11016P (Non-patent Document 5), inserting an aceA gene promoter downstream of the aceE gene stop codon on the chromosome and proceeding in the reverse direction of the aceE gene transcription direction, was subjected to PCR. By performing isolation, strains producing L-lysine are obtained, which are obtained as Corynebacterium glutamicum KCCM11016P :: aceE1-PaceA and Corynebacterium glutamicum KCCM11016P :: aceE2-Pace, respectively. It was named. Corynebacterium glutamicum KCCM11016P :: aceE1-PaceA was deposited internationally under the name Corynebacterium glutamicum CA01-2271 on June 12, 2013 as deposit number KCCM11432P. In the case of KCCM11016P :: aceE1-PaceA, the prepared strain was obtained by performing PCR using SEQ ID NO: 9 and SEQ ID NO: 12 as primers in the case of KCCM11016P :: aceE2-PaceA. The base sequence was finally confirmed through analysis of the base sequence for the site.

Example 4: Comparison of lysine production ability of aceA gene promoter insertion strain downstream of aceE gene Corynebacterium glutamicum KCCM11016P strain used as a parent strain and Corynebacterium glutamicum KCCM11016P which is an L-lysine production strain prepared in Example 3 ::: aceE1-PaceA and KCCM11016P :: aceE2-PaceA was cultured in the following manner for L-lysine production.

  A 250 ml corner-baffle flask containing 25 ml of the following seed medium is inoculated with Corynebacterium glutamicum parent strains KCCM11016P and KCCM11016P :: aceE1-PaceA, KCCM11016P :: aceE2-PaceA and shaken at 30 ° C. for 20 hours at 200 rpm. Cultured. A 250 ml corner baffle flask containing 24 ml of the following production medium was inoculated with 1 ml of the seed culture and cultured at 30 ° C. for 72 hours with shaking at 200 rpm. The composition of the seed medium and the production medium is as follows.

<Seed medium (pH 7.0)>
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH ₂ PO ₄ 4 g, K ₂ HPO ₄ 8 g, MgSO ₄ 7H ₂ O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotine Acid amide 2000μg (based on 1L of distilled water)

<Production medium (pH 7.0)>
Glucose 100 g, (NH ₄ ) ₂ SO ₄ 40 g, soy protein 2.5 g, corn steep solids 5 g, urea 3 g, KH ₂ PO ₄ 1 g, MgSO ₄ 7H ₂ O 0.5 g, biotin 100 μg, Thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3,000 μg, CaCO ₃ 30 g (based on 1 L of distilled water).

  After completion of the culture, the production amount of L-lysine was measured by a method using HPLC. When acetic acid is not added, L-lysine concentrations in the culture solution for Corynebacterium glutamicum KCCM11016P and KCCM11016P :: aceE1-PaceA, KCCM11016P :: aceE2-PaceA are as shown in Table 1 below. .

  In addition, except that 5 g / L of acetic acid was added to the production medium, the strains were cultured in the same manner, and the L-lysine production ability was compared. The L-lysine concentration in the culture solution is as shown in Table 2 below.

  As shown in Table 1, it was confirmed that the KCCM11016P :: aceE1-PaceA and KCCM11016P :: aceE2-PaceA strains did not change from the parent strain KCCM11016P and lysine-producing ability in the absence of acetic acid.

  However, as shown in Table 2, in the presence of acetic acid, in the case of the KCCM11016P :: aceE1-PaceA strain, the production capacity of lysine is 3.6% or higher compared to the parent strain KCCM11016P, and KCCM11016P :: aceE2-PaceA In the case of the strain, it was confirmed that the lysine production ability was improved by 2.5% or more compared to the parent strain KCCM11016P.

  When KCCM11016P :: aceE1-PaceA and KCCM11016P :: aceE2-PaceA are compared, KCCM11016P with the aceA promoter inserted upstream of the transcription terminator of the aceE gene, that is, between the stop codon and the upstream of the transcription terminator. In the case of aceE1-PaceA, since it is more effective in lysine production, it is more effective to use gene downstream of the gene stop codon, that is, between the stop codon and the transcription terminator upstream as the insertion site. It turns out that it inhibits.

Example 5: Preparation of pDZ-ace E-Ppta vector for aceE gene expression inhibition Acetate kinase (acetate kinase, ackA, NCgl2656) and phosphotransacetylase (phosphotransacetylase, pta, NCgl2657) are enzymes involved in the process of acetic acid metabolism. It forms an operon and, like isocitrate lyase, expression is enhanced in the presence of acetic acid. Therefore, when these gene promoters are used, gene expression can be specifically induced under conditions where acetic acid is present.

  In this example, a vector for using the promoter of the pta-ack operon, that is, the upstream promoter site of the pta gene was prepared for the purpose of inhibiting the expression of the aceE gene under the condition where acetic acid was present.

  In order to inhibit the expression of the aceE gene, a pta gene promoter is inserted downstream of the aceE gene stop codon, that is, between the stop codon and the upstream of the transcription terminator, so as to proceed in the reverse direction of the transcription direction of the aceE gene. A possible vector was prepared.

  In order to secure an aceE gene fragment derived from Corynebacterium glutamicum, a chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template to prepare a pDZ-aceE1 vector in the same manner as in Example 2.

  In order to secure a pta gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 15 and 16) were devised to have restriction enzyme SpeI recognition sites at the 5 ′ end and 3 ′ end of the fragment, respectively. . PCR was carried out using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primer to amplify an approximately 340 bp promoter site having the base sequence of SEQ ID NO: 2. A DNA section obtained by treating the PCR amplification product and the pDZ-aceE1 vector with the restriction enzyme SpeI was cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-aceE1-Ppta vector.

SEQ ID NO: 15: Ppta-P7F 5'-gtcccttgagactagtctttgctggggtcagatttg-3 '
SEQ ID NO: 16: Ppta-P7R 5'-ctgaggaataactagtacatcgcctttctaatttc-3 '

Example 6: Preparation of pta gene promoter insertion strain downstream of aceE gene and comparison of lysine production ability The vector pDZ-aceE1-Ppta prepared in Example 5 was used in the same manner as in Example 3 with the L-lysine producing strain. By transforming to a certain Corynebacterium glutamicum KCCM11016P, inserting a pta gene promoter downstream of the aceE gene stop codon on the chromosome, and performing PCR to isolate the strain that has progressed in the reverse direction of the aceE gene transcription direction , A strain producing L-lysine was obtained and named KCCM11016P :: aceE1-Ppta. The produced strain KCCM11016P :: aceE1-Ppta was finally confirmed by performing PCR using SEQ ID NO: 3 and SEQ ID NO: 6 as primers, and analyzing the base sequence for the target site.

  The prepared strain was cultured in the same manner as in Example 4, and the concentration of L-lysine recovered therefrom was measured. When acetic acid is not added, the L-lysine concentration in the culture solution is as shown in Table 3 below.

  In addition, except that 5 g / L of acetic acid was added to the production medium, the strains were cultured in the same manner, and the L-lysine production ability was compared. The L-lysine concentration in the culture solution is as shown in Table 4 below.

  As shown in Table 3, it was confirmed that the KCCM11016P :: aceE1-Ppta strain had no change in lysine production ability from the parent strain KCCM11016P in the absence of acetic acid.

  However, as shown in Table 4, it can be confirmed that in the presence of acetic acid, the KCCM11016P :: aceE1-Ppta strain improved lysine production ability by 2.4% or more compared to the parent strain KCCM11016P. did it.

  In addition, since the KCCM11016P :: aceE1-PaceA strain has better lysine production ability than the KCCM11016P :: aceE1-Ppta strain, the use of the aceA gene promoter in the presence of acetic acid makes it possible to use the target gene. It turns out that the expression of is inhibited more effectively.

Example 7: Preparation of aceA gene promoter insertion strain downstream of aceE gene The vector pDZ-aceE1-PaceA prepared in Example 2 above was prepared in the same manner as in Example 3 by L. lysine-producing strain Corynebacterium glutamicum. Transform strains of KFCC10750, KCCM10770P and CJ3P3, insert the aceA gene promoter downstream of the aceE gene stop codon on the chromosome, and isolate the strain by proceeding in the reverse direction of the aceE gene transcription direction by PCR As a result, KFCC10750 :: aceE1-PaceA, KCCM10770P :: aceE1-PaceA and CJ3P :: aceE1-PaceA3 strains producing L-lysine were obtained. The prepared strain was finally confirmed by performing PCR using SEQ ID NO: 3 and SEQ ID NO: 6 as primers, and analyzing the base sequence for the target site.

  The prepared strain was cultured in the same manner as in Example 4, and the concentration of L-lysine recovered therefrom was measured. When acetic acid is not added, the L-lysine concentration in the culture solution is as shown in Table 5 below.

  In addition, except that 5 g / L of acetic acid was added to the production medium, the strains were cultured in the same manner, and the L-lysine production ability was compared. The L-lysine concentration in the culture solution is as shown in Table 6 below.

  As shown in Table 5, the three strains of KFCC10750 :: aceE1-PaceA, KCCM10770P :: aceE1-PaceA and CJ3P :: aceE1-PaceA changed in the parent strain and lysine production ability in the absence of acetic acid. Confirmed that there is no.

  However, as shown in Table 6 above, under conditions where acetic acid is present, the lysine production ability is 5% for the KFCC10750 :: aceE1-PaceA strain, and the KCCM10770P :: aceE1-PaceA strain is 2. 8%, CJ3P :: aceE1-PaceA strain was able to confirm that the parent strain ratio was improved by 15%.

Example 8: Preparation of hom gene expression inhibition vector The L-lysine biosynthesis pathway using the same substrate as the L-lysine biosynthesis pathway can be weakened to increase the L-lysine production ability. In order to weaken the L-threonine biosynthetic pathway, there is a method of reducing the enzyme activity of homoserine dehydrogenase (homoserine dehomogenase, hom, NCgl1136) that produces homoserine from aspartic acid.

  In Corynebacterium glutamicum, the hom gene forms a thrB gene and a hom-thrB operon, and a transcription terminator exists downstream of the thrB gene. It has been reported that there is a promoter upstream of the hom-thrB operon, that is, upstream of the hom gene, and there is also a second promoter upstream of the thrB gene ORF (Non-patent Document 6). Therefore, by inserting the aceA gene promoter downstream of the hom gene stop codon and proceeding in the reverse direction of the hom gene transcription direction, the thrB gene is selectively inhibited in the presence of acetic acid. In order to maintain the expression, a second promoter sequence was added upstream of the thrB gene ORF.

  In this example, a recombinant vector for inserting the aceA gene promoter was produced between the downstream of the hom gene stop codon and the upstream of the thrB gene.

  In order to secure a hom gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, a restriction enzyme XbaI recognition site at the 5 ′ end and a restriction enzyme SpeI recognition site at the 3 ′ end. Primers designed to have (SEQ ID NOs: 17 and 18) were synthesized. PCR was performed using the synthesized primer to obtain a DNA fragment containing 300 bp from the 1039th base to the 1338th base of the stop codon from the start codon of the hom gene. In order to inhibit hom gene expression, even if the aceA promoter is inserted between the hom-thrB operons, the thrB gene must maintain its expression. Therefore, when preparing a DNA fragment containing 300 bp downstream of the hom gene stop codon, primers (SEQ ID NOs: 19 and 20) were synthesized in which a 32 bp thrB promoter sequence was inserted on the 5 'side of the DNA fragment. PCR was performed using these primers (SEQ ID NOs: 19 and 20) to obtain a 344 bp DNA fragment having a restriction enzyme SpeI recognition site at the 5 'end and a restriction enzyme XbaI recognition site at the 3' end. PCR was performed under the same conditions as in Example 2.

  Using the In-fusion Cloning Kit (TAKARA, JP), the two PCR amplification products and the pDZ vector for chromosome introduction prepared by cutting with the restriction enzyme XbaI in advance were cloned to prepare a pDZ-hom vector.

SEQ ID NO: 17: hom-h1F 5'- ccggggatcctctagaccaggtgagtccacctacg -3 '
SEQ ID NO: 18: hom-h1R 5'-gaggcggatcactagtttagtccctttcgaggcgg -3 '
SEQ ID NO: 19: hom-h2F 5'-actagtgatccgcctcgaaagggac -3 '
SEQ ID NO: 20: hom-h2R 5'- gcaggtcgactctagagactgcggaatgttgttgtg -3 '

  In order to secure the aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 21 and 22) were synthesized in which restriction enzyme SpeI recognition sites were inserted at the 5 'end and 3' end of the fragment, respectively. PCR was performed using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primer to amplify an approximately 500 bp promoter site having the base sequence of SEQ ID NO: 1. A DNA section obtained by treating the PCR amplification product and the pDZ-hom vector with the restriction enzyme SpeI was cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-hom-PaceA vector.

SEQ ID NO: 21: PaceA-h3F 5'-gaggcggatcactagtagcactctgactacctctg-3 '
SEQ ID NO: 22: PaceA-h3R 5'- aagggactaaactagtttcctgtgcggtacgtggc -3 '

Example 9: Preparation of aceA gene promoter insertion strain downstream of hom gene and comparison of lysine production ability The vector pDZ-hom-PaceA prepared in Example 8 was treated in the same manner as in Example 3 with the L-lysine producing strain. By transforming to a certain Corynebacterium glutamicum KCCM11016P, inserting the aceA gene promoter downstream of the hom gene stop codon on the chromosome and isolating it by performing PCR in the reverse direction of the hom gene transcription direction KCCM11016P :: hom-PaceA, which produces L-lysine, was obtained. The prepared strain KCCM11016P :: hom-PaceA was finally confirmed by performing PCR using SEQ ID NO: 17 and SEQ ID NO: 20 as primers, and analyzing the base sequence for the target site.

  Corynebacterium glutamicum KCCM11016P strain used as the parent strain and the produced KCCM11016P :: hom-PaceA strain were cultured in the same manner as in Example 4 for L-lysine production, and L-lysine recovered from the same was cultured. Concentration was measured. When acetic acid is not added, L-lysine concentrations in the culture solution for Corynebacterium glutamicum KCCM11016P and KCCM11016P :: hom-PaceA are as shown in Table 7 below.

  In addition, except that 5 g / L of acetic acid was added to the production medium, the strains were cultured in the same manner, and the L-lysine production ability was compared. The L-lysine concentration in the culture solution is as shown in Table 8 below.

  As shown in Table 7, it was confirmed that the KCCM11016P :: hom-PaceA strain had no change in the lysine production ability from the parent strain KCCM11016P in the absence of acetic acid.

  However, as shown in Table 8, it can be confirmed that KCCM11016P :: hom-PaceA strain improves lysine production ability by 2.6% or more compared to the parent strain KCCM11016P in the presence of acetic acid. It was.

Example 10: Production of murE gene expression inhibition vector UDP-N-acetylmuramoylalanyl-D-glutamic acid-2,6-diaminopimelate ligase , MurE, NCgl2083) is used for the synthesis of bacterial cells using meso-2,6-diaminopimelate, which is used as a precursor of lysine biosynthesis, and the activity of the murE gene. By reducing the flow rate, it is possible to weaken the inflow of the carbon source into cell synthesis and increase the inflow of the carbon source into the lysine biosynthetic pathway to increase lysine production.

  In Corynebacterium glutamicum, the murE gene (NCgl2083) forms an operon together with seven genes from NCgl2076 to NCgl2082. Transcription of the operon begins with the NCgl2083 murE gene and proceeds in the direction of the NCgl2076 gene. Thus, a transcription terminator is present downstream of the NCgl2076 gene. Insert the aceA gene promoter downstream of the murE gene stop codon and proceed in the reverse direction of the murE gene transcription direction to selectively inhibit the expression of the murE gene in the presence of acetic acid. In order to maintain the expression of the remaining 7 genes other than the located murE gene, an additional promoter for the murE operon was inserted upstream of the NCgl2082 gene ORF.

  In this example, a recombinant vector for inserting the aceA gene promoter downstream of the murE gene stop codon was prepared.

  In order to secure a murE gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, a restriction enzyme XbaI recognition site at the 5 ′ end and a restriction enzyme XhoI recognition site at the 3 ′ end. Primers designed to have (SEQ ID NOs: 23 and 24) were synthesized. PCR was performed using the synthesized primer to obtain a DNA fragment containing 300 bp from the 1267th base from the start codon of the murE gene to the 1566th base of the stop codon. In addition, a primer (SEQ ID NO: 25 and 26) designed to have a restriction enzyme XhoI recognition site at the 5 ′ end and a restriction enzyme XbaI recognition site at the 3 ′ end was synthesized, PCR was performed, and the murE gene termination codon was A DNA fragment containing 292 bp from the 10th base downstream was secured. PCR was performed under the same conditions as in Example 2. Using the In-fusion Cloning Kit (TAKARA, JP), the pDZ vector for chromosomal transfer prepared by cutting with the two PCR amplification products and the restriction enzyme XbaI in advance was cloned to prepare a pDZ-murE vector.

SEQ ID NO: 23: mur-m1F 5'- ccggggatcctctagaaaccctcgttcagaggtgc -3 '
SEQ ID NO: 24: mur-m1R 5'-ttgtgatcatctcgagctatccttcttccgtagtaag -3 '
SEQ ID NO: 25: mur-m2F 5'- agctcgagatgatcacaatgacccttgg -3 '
SEQ ID NO: 26: mur-m2R 5'- gcaggtcgactctagacatgagcataaatgtcagc -3 '

  In order to secure an aceA gene promoter fragment derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 27 and 28) designed to have a restriction enzyme XhoI recognition site at the 5 'end of the fragment were synthesized. PCR was performed using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primer to amplify an approximately 500 bp promoter site having the base sequence of SEQ ID NO: 1. In addition, in order to secure the promoter site of the murE operon derived from Corynebacterium glutamicum, a chromosomal DNA of Corynebacterium glutamicum KCCM11016P was used as a template, and a restriction enzyme XhoI recognition site was devised at the 3 ′ end of the fragment. Primers (SEQ ID NOs: 29 and 30) were synthesized. PCR was performed using the synthesized primer to obtain a DNA fragment containing 300 bp upstream of the murE gene ORF. The DNA sections obtained by treating the two PCR amplification products and the pDZ-murE vector with the restriction enzyme XhoI were cloned using In-fusion Cloning Kit (TAKARA, JP) and cloned into the pDZ-murE-PaceA-PmurE vector. Was made.

SEQ ID NO: 27: mur-m3F 5'- tcatcagcagcactctgactacctctg -3 '
SEQ ID NO: 28: mur-m3R 5'-agagagatagctcgagttcctgtgcggtacgtggc -3 '
SEQ ID NO: 29: mur-m4F 5'- agagtgctgctgatgatcctcgatttg -3 '
SEQ ID NO: 30: mur-m4R 5'-ttgtgatcatctcgagggttttctctcctccacagg -3 '

Example 11: Production of aceE gene promoter insertion strain downstream of murE gene and comparison of lysine production ability The vector pDZ-murE-PaceA-PmurE produced in Example 10 was used in the same manner as in Example 3 to produce an L-lysine producing strain. Is transformed into Corynebacterium glutamicum KCCM11016P, the aceA gene promoter is inserted downstream of the murE gene stop codon on the chromosome, and the strain which has been advanced in the reverse direction of the murE gene transcription direction is isolated by PCR. As a result, KCCM11016P :: murE-PaceA-PmurE producing L-lysine was obtained. The produced strain KCCM11016P :: murE-PaceA-PmurE was finally confirmed by performing PCR using SEQ ID NO: 23 and SEQ ID NO: 26 as primers, and analyzing the base sequence for the target site.

  Corynebacterium glutamicum KCCM11016P strain used as a parent strain and KCCM11016P prepared: murE-PaceA-PmurE were cultured in the same manner as in Example 4 for L-lysine production, and L-lysine recovered therefrom was recovered. The concentration of was measured. When acetic acid is not added, the L-lysine concentration in the culture solution for Corynebacterium glutamicum KCCM11016P and KCCM11016P :: murE-PaceA-PmurE is as shown in Table 9 below.

  In addition, except that 5 g / L of acetic acid was added to the production medium, the strains were cultured in the same manner, and the L-lysine production ability was compared. The L-lysine concentration in the culture solution is as shown in Table 10 below.

  As shown in Table 9, it was confirmed that the KCCM11016P :: murE-PaceA-PmurE strain had no change in the lysine production ability from the parent strain KCCM11016P in the absence of acetic acid.

  However, as shown in Table 10, it is confirmed that the lysine production ability of the KCCM11016P :: murE-PaceA-PmurE strain is improved by 2.8% or more compared to the parent strain KCCM11016P in the presence of acetic acid. I was able to.

Example 12: Preparation of dapA gene expression inhibition vector L-threonine production ability can be increased by weakening the L-lysine biosynthesis pathway using the same substrate as the L-threonine biosynthesis pathway. In order to weaken the L-lysine biosynthetic pathway, a method of decreasing the activity of a dihydrodipicolinate synthase (dapA, NCgl1896) gene involved in the production of lysine from aspartate can be mentioned.

  In Corynebacterium glutamicum, the dapA gene forms the ORF4 (NCgl1895) gene and the dapA-ORF4 operon, and therefore the transcription terminator exists downstream of the ORF4 gene. It has been reported that a promoter is present upstream of the dapA-ORF4 operon, that is, upstream of the dapA gene, and further a promoter sequence is present upstream of the ORF4 gene (Non-patent Document 7). Therefore, the aceA gene promoter is inserted downstream of the dapA gene stop codon and allowed to proceed in the reverse direction of the dapA gene transcription direction so as to selectively inhibit dapA gene expression in the presence of acetic acid. To maintain expression, a promoter site 100 bp sequence upstream of the ORF4 gene was added upstream of the ORF4 gene ORF.

  In this example, a recombinant vector for inserting the aceA gene promoter downstream of the dapA gene stop codon was prepared.

  In order to secure a dapA gene fragment derived from Corynebacterium glutamicum, the chromosomal DNA of Corynebacterium glutamicum KCCM11016P is used as a template, the restriction enzyme XbaI recognition site at the 5 ′ end and the restriction enzyme SpeI recognition site at the 3 ′ end. Primers designed to have (SEQ ID NOs: 31 and 32) were synthesized. PCR was performed using the synthesized primer to obtain a DNA fragment containing 301 bp from the 606th base from the start codon of the dapA gene to the 906th base of the stop codon. In addition, a primer (SEQ ID NO: 33 and 34) having a restriction enzyme SpeI recognition site inserted at the 5 ′ end and a restriction enzyme XbaI recognition site inserted at the 3 ′ end is synthesized and subjected to PCR to maintain the expression of the ORF4 gene. Thus, a DNA fragment further comprising a 100 bp promoter sequence from the base 809 to the second base downstream of the stop codon from the start codon of the dapA gene and a downstream 213 bp of the dapA gene stop codon was secured. PCR proceeded under the same conditions as in Example 2. The two PCR amplification products and the pDZ vector for chromosome introduction prepared by cutting with the restriction enzyme XbaI in advance were cloned using In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-dapA vector.

SEQ ID NO: 31: dapA-d1F 5'- ccggggatcctctagatgtttggcttgctttgggc -3 '
SEQ ID NO: 32: dapA-d1R 5'- gttgatgcactagtttatagaactccagcttt-3 '
SEQ ID NO: 33: dapA-d2F 5'-ttctataaactagtgcatcaacgtaggagatcc -3 '
SEQ ID NO: 34: dapA-d2R 5'- gcaggtcgactctagacgttctgggaaccctgag -3 '

  In order to secure a promoter fragment of the aceA gene derived from Corynebacterium glutamicum, primers (SEQ ID NOs: 35 and 36) were synthesized in which restriction enzyme SpeI recognition sites were inserted at the 5 'end and 3' end of the fragment, respectively. PCR was performed using the chromosomal DNA of Corynebacterium glutamicum KCCM11016P as a template and using the synthesized primer to amplify an approximately 500 bp promoter site having the base sequence of SEQ ID NO: 1. The PCR amplification product and a DNA section obtained by treating the pDZ-dapA vector with the restriction enzyme SpeI were cloned using an In-fusion Cloning Kit (TAKARA, JP) to prepare a pDZ-dapA-PaceA vector. .

SEQ ID NO: 35: PaceA-d3F 5'-acgttgatgcactagtagcactctgactacctctg-3 '
SEQ ID NO: 36: PaceA-d3R 5'- agttctataaactagtttcctgtgcggtacgtggc -3 '

Example 13: Preparation of aceA gene promoter insertion strain downstream of dapA gene and comparison of threonine production ability In order to confirm the dapA gene expression inhibitory effect in L-threonine production strain, KCCM11222P (patent document) In 7), the vector pDZ-dapA-PaceA prepared in Example 12 is transformed in the same manner as in Example 3, and the aceA gene promoter is inserted downstream of the dapA gene on the chromosome to reverse the transcription direction of the dapA gene. KCCM11222P :: dapA-PaceA which produces | generates L-threonine was acquired by PCR isolate | separating the strain advanced to the direction. The produced strain KCCM11222P :: dapA-PaceA was finally confirmed by performing PCR using SEQ ID NO: 31 and SEQ ID NO: 34 as primers, and analyzing the base sequence for the target site.

  The Corynebacterium glutamicum KCCM11222P strain used as the parent strain and the prepared KCCM11222P :: dapA-PaceA strain were cultured in the following manner for L-threonine production.

  Each strain was inoculated into a 250 ml corner baffle flask containing 25 ml of seed medium and cultured with shaking at 200 rpm at 30 ° C. for 20 hours. Thereafter, 1 ml of seed culture was inoculated into a 250 ml corner-baffled flask containing 24 ml of production medium, and cultured with shaking at 200 rpm at 30 ° C. for 48 hours. The composition of the seed medium and the production medium is as follows.

<Seed medium (pH 7.0)>
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH ₂ PO ₄ 4 g, K ₂ HPO ₄ 8 g, MgSO ₄ .7H ₂ O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg Nicotinamide 2000μg (based on 1L of distilled water)

<Production medium (pH 7.0)>
Glucose 100 g, (NH ₄ ) ₂ SO ₄ 20 g, soy protein 2.5 g, Corn Step Solids 5 g, urea 3 g, KH ₂ PO ₄ 1 g, MgSO ₄ .7H ₂ O 0.5 g, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium-pantothenic acid, 3000 μg of nicotinamide, and 30 g of CaCO ₃ (based on 1 L of distilled water).

  After completion of the culture, the concentration of L-threonine in the culture broth was analyzed using HPLC. When acetic acid is not added, L-threonine concentrations in the culture solution for Corynebacterium glutamicum KCCM11222P and KCCM11222P :: dapA-PaceA are as shown in Table 11 below.

  In addition, except that 5 g / L of acetic acid was added to the production medium, the strain was cultured in the same manner, and the L-threonine production ability was compared. The L-threonine concentration in the culture solution is as shown in Table 12 below.

  As shown in Table 11, it was confirmed that the threonine producing ability of the KCCM11222P :: dapA-PaceA strain was unchanged in the absence of acetic acid as compared to the parent strain KCCM11222P.

  However, as shown in Table 12, in the presence of acetic acid, in the case of KCCM11222P :: dapA-PaceA strain, it was confirmed that the threonine production ability was improved by 50% or more compared to the parent strain KCCM11222P. .

Contracting organization: Korean Culture Center of Microorganisms (International Depositary)
Accession Number: KCCM11432P
Contract date: June 12, 2013

  As described above, the present invention reduces the expression of the target gene by adding acetic acid within an appropriate time by using an acetic acid-inducible promoter, and the target L-amino acid is obtained in a high yield. Since it can produce, it can utilize effectively for production of L-amino acid.

  It should be understood that the foregoing examples are merely illustrative of the invention and that the scope of the invention is not limited thereto. It should generally be understood that the features and characteristics described in each embodiment can utilize other similar features and characteristics in other embodiments.

One or more embodiments of the present invention will be described with reference to the drawings, and various modifications in form and specific form to those skilled in the art will be defined by the following claims. It should be understood that this can be done without departing from the scope.

Claims (5)

1) culturing a recombinant coryneform microorganism having L-amino acid-producing ability transformed by introducing an acetic acid-inducible promoter downstream of a stop codon of a target gene in a chromosome; and 2) the culturing step Adding the acetic acid in step to reduce the expression of the target gene during the culture and enhance the L-amino acid-producing ability of the recombinant coryneform microorganism;
A method for producing an L-amino acid comprising   The method for producing an L-amino acid according to claim 1, wherein the downstream of the stop codon is between the stop codon of the target gene and the upstream of the transcription terminator.   The method for producing an L-amino acid according to claim 1, wherein the acetic acid-inducible promoter has the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.   The target gene includes a gene encoding pyruvate dehydrogenase subunit E1 (NCgl12167), a gene encoding homoserine dehydrogenase (NCgl1136), UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase The production of an L-amino acid according to claim 1, wherein one or more genes are selected from the group consisting of a gene (NCgl2083) coding for and a gene (NCgl1896) coding for dihydrodipicolinate synthase. Method. The method for producing an L-amino acid according to claim 4, wherein the L-amino acid is L-lysine or L-threonine.

Images