JP2018501820A - Use of human adipose-derived stem cells for growing serum-derived hepatitis C virus and uses thereof - Google Patents

Abstract

Hepatitis C virus replication in the extrahepatic position has been suggested, but complete virus replication has been confirmed only in hepatocytes. Here, we have found that human adipogenic DLK-1 + stem cells (hADSC) newly isolated from HCV-infected individuals contain viral transcripts, replication intermediates and viral antigens in vivo, It shows that it increased in the supernatant during long-term in vitro culture. In addition, naive hADSC isolated from HCV (−) individuals supports complete replication of clinical isolates in vitro, infection is donor-specific for cells and genotype crossover for viruses It is sex. Viral infection / replication is mediated by CD81, LDL-R, SR-B1, EGFR, apolipoprotein E, occludin, claudin-1, NPC1L1 and diacylglycerol acetyltransferase-1 and can be inhibited by antiviral drugs. Furthermore, the physical properties of hADSC-propagating virus particles are similar to clinical isolates rather than JFH1 / HCVcc, and viruses propagated in vitro infected hADSC are infectious to human primary hepatocytes. Thus, hADSC is an in vivo HCV-bearing host and represents a novel location for clinical virus-host interactions. Clinical isolates can also be propagated using hADSC as a physiologically relevant primary cell culture system.

Description

  The present invention relates to a system and method for propagating hepatitis C virus (HCV) and uses thereof.

HCV is a plus-strand RNA virus with a Flaviviridae envelope. It contains a 9.6 kb genome starting from the untranslated region (5′-UTR), followed by structural proteins (core, E1 and E2) and non-structural (including p7, NS2, NS3, NS4 and NS5) NS) protein sequence (see references ^{1 and 2 for} review). Unlike hepatitis B virus (HBV) infection, HCV infection is a multifaceted disease that presents both liver and extrahepatic signs ³ , although HCV can be present in non-hepatocytes ^4-6 , It may play a role in virus persistence and reactivation. However, in vitro systems that examine extrahepatic replication of HCV have been severely constrained. With respect to primary cells, direct infection with serum HCV (HCVser) has only been demonstrated in human and chimpanzee hepatocytes, which are difficult to maintain in culture, and cellular properties vary significantly between donors. In addition, most in vitro cell culture methods use molecular clones rather than natural viruses (see reference ⁷ for a review). These models also propagate the virus in non-primary cells, including the HLZ01 hepatocytoma cell line recently reported to support infection with clinical HCV isolates ⁸ . Thus, the extent to which data can be extrapolated to actual clinical virus-host interactions continues to be a concern.

  Accordingly, there remains a need for alternative systems and methods for propagating serum hepatitis C virus (HCV).

  This summary is provided to present a summary of the invention that briefly illustrates the nature and nature of the invention. This is provided with the understanding that it will not be used to interpret or limit the scope of the claims or the meaning of the claims.

  In one aspect, the disclosure is a system based on human adipose-derived stem cells (hADSC) for growing hepatitis C virus (HCV), comprising hADSC, a medium suitable for culturing hADSC, and HCV. Provide a system. In some embodiments, the hADSC is a primary or passaged cell, preferably a 1st to 15th passage cell, more preferably a 1st to 6th passage cell. In some embodiments, hADSC is positive for the specific marker DLK-1 (ie, Pref-1). In some embodiments, the HCV is derived from the blood, serum, plasma or body fluid of an individual infected with HCV or is a clinical HCV isolate. In some embodiments, the HCV is 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, Genotype selected from the group consisting of 4i, 4j, 5a and 6a and any combination thereof, preferably genotype 1a, 1b, 2a, 2b or mixed type 2a + 2b. In some embodiments, the system supports complete replication of HCV, including production of infectious virus.

  In another aspect, the disclosure provides a method of propagating hepatitis C virus (HCV), wherein hADSC is used to grow HCV in a medium suitable for culturing hADSC under conditions suitable for HCV replication. A method is provided that includes using. In some embodiments, the hADSC is a primary or passaged cell, preferably a 1st to 15th passage cell, more preferably a 1st to 6th passage cell. In some embodiments, hADSC is positive for the specific marker DLK-1 (ie, Pref-1). In some embodiments, the HCV is derived from the blood, serum, plasma or body fluid of an individual infected with HCV or is a clinical HCV isolate. In some embodiments, the HCV is 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, Genotype selected from the group consisting of 4i, 4j, 5a and 6a and any combination thereof, preferably genotype 1a, 1b, 2a, 2b or mixed type 2a + 2b. In some embodiments, the method supports complete replication of HCV.

  In another aspect, the disclosure provides for performing HCV growth, or performing an HCV life cycle analysis, or diagnosing HCV infection, or selecting an antiviral compound, or characterization of HCV in a subject infected with such HCV. To provide the use of hADSC.

  In another aspect, the disclosure provides for diagnosing HCV infection, or performing HCV growth, or performing an HCV life cycle analysis, or selecting an antiviral compound, or characterization of HCV in a subject infected with such HCV. For this purpose, the use of hADSC in the manufacture of kits is provided.

In another aspect, the disclosure provides a method of diagnosing HCV infection in a subject comprising:
a) providing hADSC;
b) incubating hADSC with a biological sample obtained from a subject in a medium suitable for culturing hADSC;
c) culturing the hADSC for a time sufficient to allow HCV replication; and d) detecting the level of HCV replication;
A method is provided wherein detection of HCV replication indicates that the subject is infected with HCV.

  In some embodiments, the biological sample is derived from blood, serum, plasma or body fluid.

In another aspect, the disclosure provides a method of selecting an anti-HCV compound comprising:
a). Contacting hADSC in the medium in the first container with HCV in the absence of the candidate compound;
b). Determining the level of HCV in the medium in the first container in the absence of the candidate compound;
c). Contacting hADSC in the medium in the second container with HCV in the presence of the candidate compound;
d). Determining the level of HCV in the medium in the second container in the presence of the candidate compound;
e). Comparing the level of HCV in the presence of the candidate compound with the level of HCV in the absence of the candidate compound; and f). A method is provided comprising identifying a candidate compound as an anti-HCV compound when the HCV level in the presence of the candidate compound is lower than the HCV level in the absence of the candidate compound.

  In some embodiments, the level of HCV is determined by measuring HCV titer, HCV nucleic acid level, or HCV polypeptide level.

  In some embodiments, the candidate compound is at least one selected from the group consisting of chemical compounds, proteins, peptides, peptidomimetics, antibodies, nucleic acids, antisense nucleic acids, shRNAs, ribozymes, and small molecule chemical compounds. .

  In some embodiments, the HCV is genotype 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h. 4i, 4j, 5a and 6a and any combination thereof, preferably at least one HCV genotype selected from the group consisting of genotypes 1a, 1b, 2a, 2b and mixed types 2a + 2b.

  Other embodiments are described below.

  The foregoing summary, as well as the following detailed description, is better understood when read in conjunction with the appended drawings, which are included by way of example and not limitation.

Human adipose-derived DLK-1 ⁺ stem cells are targets for HCV in vivo. (A) Adipose tissue of 3 HCV (+) individuals (Table 1) was collected from surgical wounds and RNA was extracted for HCV specific 5′-UTR (223 bp) RT-PCR. Adipose tissue collected from 3 HCV (−) individuals was also studied in parallel for comparison, and HCV (+) serum was used as a positive control. (B) Adipose tissue of HCV (+) individuals was minced, homogenized, and centrifuged to form a layer of suspension, buffer and cell pellet. The cell pellet red blood cells were further lysed and SVF was collected. RNA was extracted from each cell population and subjected to 5′-UTR RT-PCR. Viral transcripts were detected in SVF cells and not in suspension (left panel). SVF cells were further immunoseparated into DLK-1 ⁺ cells and DLK-1 ⁺ cells, and RNA was extracted individually for RT-PCR. Viral transcripts were present in DLK-1 ⁺ cells and not in DLK-1 ⁻ cells (right panel). Data are representative of 3 experiments using cells from 3 HCV (+) donors. (C) RNA of DLK-1 ⁻ cells and DLK-1 ⁺ cells isolated from 3 HCV infected individuals was extracted for RT-PCR of HCV negative strand RNA. Human primary hepatocytes (PHH) isolated from HCV (+) individuals were used as positive controls. (D) DLK-1 ⁻ (panels b and e) and DLK-1 ⁺ cells (panels c and f) isolated from HCV (−) and HCV (+) individuals were isolated from virus NS5 (c brown label). ) And hematoxylin staining (nuclear blue labeling) were rotated on cytospin slides for immunocytochemistry. Staining of unfractionated SVF cells with the mouse IgG1 control antibody (panels a and d) was used as a negative control. Data are representative of samples from 3 HCV (+) donors and 3 HCV (−) donors. (E) For adipose tissue from HCV (+) or HCV (−) individuals, DLK-1 (red label, arrows on panels b, c and h) and virus NS5 (brown label, panels e and f) and hematoxylin Staining (blue label, panels df and ij) was performed sequentially on the same sections. In HCV (+) adipose tissue, DLK-1 ⁺ cells (red label, arrows, panels b and c) co-expressed NS5 Ag (brown label, arrows, panels e and f). In HCV (−) adipose tissue, DLK-1 ⁺ cells (panel h, arrow) did not express NS5 (panel j, arrow; h vs. j). Staining with rabbit IgG (panels a and g) or mouse IgG1 (panels d and i) was used as a negative control. Panels b, e and c, f were from separate donors. Data are representative of 3 HCV (+) donors and 3 HCV (−) donors. (F) DLK-1 ⁺ cells isolated from adipose tissue of 4 HCV (+) individuals were cultured in vitro for 49 days, and the supernatant was removed every 7 days for qRT-PCR of 5′-UTR It was collected. Data are expressed as mean ± SD of triplicates for each time point. Naive DLK-1 ⁺ hADSC tolerates serum HCV infection in vitro. (A) Human primary hepatocytes (PHH) were isolated from HCV (−) donors and placed in dishes for 3 days, followed by HCV ser (lane “+”, left panel) or HCV (−) control serum (lane “ -", Left) was administered. Three hours after administration, PHH was further cultured for 5 days and RNA was extracted for RT-PCR of 5'-UTR (left panel). In parallel, p-3 or p-4 DLK-1 ⁺ hADSCs isolated from HCV (−) donors were administered 0.2 moi HCVser in suspension with medium changes every 7 days. At indicated time points, supernatant and cells were collected separately and RNA was extracted for RT-PCR of 5'-UTR. Data are representative of 10 experiments. HCV (+) serum RNA was also extracted as a control for RT-PCR. (B) Supernatant and d14 and d28 HCV ser-1b infected hADSC cells were collected and RNA was extracted for RT-PCR of HCV specific minus strand RNA. Data are representative of 4 experiments. ^* : Culture supernatant on day 0 collected 1 hour after washing after infection with HCVser. (C) Rabbit anti-human DLK-1 antibody (red label, panels b and f) followed by mouse anti-NS5 antibody (panels d and h; brown label in d) and hematoxylin (blue label, c, d, g and h) D14 hADSCs administered HCVser-1b or HCV (−) control serum were spun onto cytospin slides. DLK-1 ⁺ hADSC infected with HCVser contained NS5A (panel b vs. d), but cells administered HCV (−) control serum lacked NS5 and expressed DLK-1 (panel f). Vs. h). Staining with rabbit IgG and mouse IgG1 was used as negative controls (panels a and e, and c and g, respectively). Results are representative of 4 experiments. (D) Transmission electron micrographs of HCV ser-1b-infected hADSCs of d14 (panels b and c) and d21 (panels e and f). D14V and D21 cells exposed to HCV (−) control serum are shown in panels a and d. The insets in panels b to f are enlarged views of yellow squares or yellow arrows. White arrows in the insets of panels b, c, e and f indicate viral particles, and white arrows in the inset of panel d indicate onion-shaped membrane structures of uninfected hADSC. Data are representative of two experiments from infection with HCV ser-1b and one experiment from infection with HCV ser-2a. (E) qRT-PCR of virus 5'-UTR in cell lysates (left panel) and supernatants (right panel) of HCV ser-1b infected hADSC collected every 7 days. Data are expressed as mean ± SD from three experiments. (F) Virus 5'-UTR replication (by qRT-PCR) in the supernatant of HCV ser-1b-infected hADSC continuously cultured for 1 to 4 weeks was quantified. Data are expressed as mean ± SD from 4 experiments. HCV ser infection is donor-specific for cells, genotype-crossing for viruses, and is mediated by various host factors other than miR-122. (A) HCVser-1b was infected with P-2 hADSC of “donor 1”, and the supernatant on the 21st day (labeled “HCVadsc (1)”) was filtered through a 0.22 μm pore filter. Used to infect the donor 3's p-3 hADSC, and the day 21 supernatant (labeled "HCVadsc (2)") is used to infect the "donor 3" p-6 hADSC Used for. The number of virus replication in the supernatant on day 21 was quantified by qRT-PCR. Data are expressed as mean ± SD of triplicates for each batch of infected hADSC. (B) hADSCs at p2, p6, p9 and p15 were infected with HCV ser-1b and viral transcripts in day 21 supernatant (left) and cell lysate (right) were determined by qRT-PCR. . Data are expressed as mean ± SD from three independent experiments. (C) RT-PCR of DLK-1 expression of hADSCs at p0, p2, p6, p9 and p15. Both batches of cells were from the same donor. N: No reverse transcriptase as a negative control. Data are representative of experiments using cells from 3 different donors. (D) hADSC at p5 was infected with mixed genotype 2a + 2b HCV ser and continuously cultured. Cells were recovered for RT-PCR at d21 and d56 to detect mRNA encoding a genotype specific core antigen (174 bp for left genotype 2a, 123 bp for right genotype 2b). N: d21 cells administered HCV (−) control serum as a negative control. P: HCV (+) serum itself as a positive control (mixed genotype 2a + 2b). M: Marker. Data are representative of experiments using sera from two HCV ser genotype 2a + 2b infected donors. (E) Flow cytometry for surface expression of h81SC CD81, LDL-R, SR-B1 and EGFR in p0, p2, and p6. Black line: Isotype control Ab. Red line: anti-CD81, anti-LDL-R, anti-SR-B1 or anti-EGFR Ab. Data are representative of 3 experiments for each passage of cells. (F) RT-PCR of the expression of ocrudin (OCLN), claudin-1 (CLDN1), NPC1L1 and miR-122 in hADSCs of p0, p2 and p6 (left panel). Data are representative of hADSC from 3 donors. N: No reverse transcriptase as a negative control. P: Human primary hepatocytes isolated from HCV (−) individuals as a positive control. In addition, miR-122 expression in hADSCs of p0, p2, and p6 was determined by qRT-PCR compared to Huh7.5 or HCV (−) human primary hepatocytes (PHH, right panel). Data are expressed as mean ± SD as the expression level for pAD hADSC using hADSC and PHH from 3 different donors, respectively. (G) Abs of blocking monoclonal anti-CD81 (clone JS-81), anti-LDL-R (clone C7) or anti-EGFR (clone LA1) at the indicated concentrations for 1 hour prior to administration with HCV ser-1b. Alternatively, it was pretreated with polyclonal anti-SR-B1 Ab. To block Apo-E, anti-ApoE antibody (clone E6D10) was added to the HCV ser at the indicated concentration, which was subsequently used for 3 hours incubation with hADSC. The virus 5'-UTR transcript in the 21st day supernatant was quantified. Isotype: treatment with isotype control antibody (100 μg / ml). Data are expressed as mean ± SD of fraction inhibition from 3 experiments (as opposed to treatment with isotype Ab). In addition, the cell viability after each treatment was evaluated with trypan blue. (H) p2 hADSCs were transfected with siRNA specific for OCLN, CLDN1, NPC1L1 or DGAT-1. Transfection with scrambled RNA was used as a control. Cells were washed 48 hours after transfection, infected with HCV ser-1b, and viral 5'-UTR replicas in the 21st day supernatant were quantified. The knockdown of OCLN and CLDN1 was performed in the same experiment, while the knockdown of NPC1L1 or DGAT-1 was performed in another experiment. Cell viability was measured by trypan blue dye exclusion assay after each transfection and there was no significant change compared to scrambled siRNA transfection. Data are expressed as the mean ± SD of 3 independent experiments. (I) HCV ser-1b was infected with p4-p5 adherent hADSC and graded doses of ribavirin, telaprevir and cyclosporin A were added continuously for 21 days in culture. HADSCs were also incubated with graded concentrations of IFNα for 16 hours prior to exposure to HCV ser-1b. After each treatment, cell viability was assessed with trypan blue. Data are expressed as mean ± SD from three independent experiments. HCVadsc differs in physical properties from JFH1 / HCVcc and is infectious to human primary hepatocytes. (A) HCV adsc (genotype 2a) was collected from the supernatant of HCV ser-2a-infected hADSC on day 21 and subjected to density gradient assay by equilibrium centrifugation in 10-40% iodixanol. For comparison, HCVser (genotype 2a) and JFH1 / HCVcc concentration gradient assays were also performed in parallel. Data are representative of 5 experiments. (B) HCVcc fraction 13 had the lowest amounts of HDL and LDL / VLDL, expressed as weight (ng) per virus replica. The data is representative of HCV ser from 3 donors and their corresponding HCV adsc. (C) ApoE and ApoB measurements demonstrated that ApoE content was highest in the main fraction of HCVser, followed by high HCVadsc, while HCVcc fraction 13 hardly detected any ApoE content. (Left panel). In contrast, ApoB was only detected in HCVser fraction 2 (right panel). Data are one experiment using HCVser (genotype 2a) and its corresponding HCVadsc (ie, HCVadsc was generated by HCVser-infected hADSC) and are representative of 3 HCVser donors. (D) P2 hADSCs were exposed to HCV ser (genotype 2a) or HCVcc in a 6 cm Petri dish. HADSCs after infection were continuously cultured for 14 days or 21 days (no medium change), and the number of 5′-UTR replicates in the supernatant (left panel) and cell lysate (right panel) at the end of the culture was determined by qRT-PCR. Quantified. The results showed that HCVcc did not efficiently infect / replicate in hADSC. Data are expressed as mean ± SD from three experiments. (E) RT-PCR of virus 5'-UTR in the supernatant of HCVcc infected or uninfected Huh7.5 cultures and in the supernatant of day 21 of HCVcc infected or HCVser infected hADSC. Data are representative of 3 experiments. (F) PHH isolated from HCV (−) patient was allowed to attach for 3 days and then 3 hours into the supernatant on day 21 collected from hADSC infected with HCV ser-1b or HCV ser-2b Either exposed or subjected to administration with control serum. Five days after infection, cellular RNA was extracted for RT-PCR of 5'-UTR. HCVser-1b itself was used as a positive control. Data are representative of 3 experiments. (G) 1 × 10 ⁴ / well of PHH isolated from 3 HCV (−) donors (donors 1, 2 and 3) was inoculated in a 6-well plate for 3 days to attach the cells, On the day, PHH was separately infected with one of three different batches of HCV ser-1b (collected from three separate donors). HCVser-1b was used to generate the corresponding HCVadsc and was used in parallel to infect PHH. HCVser and the corresponding HCVadsc were paired to infect the same batch of PHH. PHH supernatants were collected 5 days after infection and 5′-UTR replicates were quantified. As a negative control, PHH exposure to HCV (−) control serum (also from 3 different donors) was used. Data are expressed as mean ± SD from each of the three infections. Separation of human adipose tissue homogenate into various layers by centrifugation. ⁹ , HCV (+) individual adipose tissue was centrifuged and separated into layers of supernatant, buffer and cell pellet (left panel). The floating population contains mature adipocytes. The cell pellet is collected, treated with RBC lysis buffer to lyse erythrocytes, stromal vascular cell group (SVF) cells are collected, and SVF cells can be regarded as primary (0 passage) hADSC −1 ⁺ human adipogenic stem cells (hADSC) were subjected to immunoselection. Purity of selected fractions and RT-PCR of DLK-1. (A) MoFlo XDP flow cytometer (Becton Coulter, CA, USA) using the ^{DLK-1 +} (left) and DLK-1 ^- to determine the percentage of ^{DLK-1 +} cells in the fraction (right) And analyzed with Submit software. The exclusion of 99.5% autofluorescence of the DLK-1 ⁺ and DLK-1 ⁻ fractions was used to set up a gate to determine the positive staining cells in each fraction. Similar results were obtained using unfractionated SVF cells incubated with an isotype control antibody (rabbit IgG). Data are representative of 6 experiments. (B) RNA was extracted from unfractionated SVF cells, selected DLK-1 ⁻ and DLK-1 ⁺ cells ¹⁰ and subjected to RT-PCR of DLK-1 (primers as described ¹¹ ). In contrast to abundant expression in DLK-1 ⁺ cells, DLK-1 ⁻ cells expressed very little DLK-1 mRNA. Data are representative of 4 experiments. HCV infected human primary hepatocytes (PHH) expressed NS5 antigen. PHH was collected from HCV (−) or HCV (+) donors (panels a and b and c and d, respectively) and seeded into collagen I coated wells for culture. As a control experiment, we have isolated human primary hepatocytes (PHH) cultured in arginine-free WilliamsE medium (Invitrogen, CA, USA) freshly isolated from HCV (+) or HCV (-) donors. The specificity of NS5 staining for the seeding number 1 × 10 ⁴ cells / well). Cells were washed on day 9 and subjected to immunocytochemistry in the wells using a similarly described method of staining cells on cytospin slides (see “Methods”). Data are representative of 3 experiments using PHH from 3 HCV (+) donors and 3 HCV (−) donors. Note: Historically, it has been difficult to detect HCV antigens in infected liver tissue. However, the staining of isolated cells does not appear to be as non-specific as the staining of liver tissue as long as the time of color development is well controlled (see “Methods”). DLK-1 ⁺ cells in the adipose tissue of HCV infected individuals co-expressed the HCV NS5 antigen. Adipose tissue was collected from HCV infected individuals (Table 1) and anti-DLK-1 Ab (red label, white arrow, panels a and b) followed by anti-NS5 Ab (brown label, as described in Method). Immunostaining was performed on the same sections using white arrows, panels c and d) and hematoxylin (blue label on panels c and d). In any section of the examined HCV (+) adipose tissue, about 0 to 4 DLK-1 ⁺ NS5 ⁺ cells could be detected in a high-power field (400 times). Panels a and c were from donor 2, and panels b and d were from donor 3. The stained image with the isotype control antibody was similar to that shown in FIG. 1E. Protocol for infecting hADSC in suspension. hADSCs were prepared from HCV (-) individuals and passaged in culture as described ^12,13 . The 2nd to 6th hADSCs were adjusted by diluting HCV (+) serum with fresh medium. 0.2 moi (5 × 10 ⁵ hADSC cells had a HCV 5′-UTR replication number of 1 × 10 ⁵ ) HCV ser (Table 2). After 3 hours, the cells were washed 5 times with PBS and subsequently cultured in 6 ml of fresh medium. Supernatants and cell lysates were collected on days 7, 14, 21 and 28, and RNA was extracted for RT-PCR of 5'-UTR. Infection of HCV ser of hADSC adhered to plastic. hADSCs were inoculated and cultured in 6 cm Petri dishes for 1 day to allow the cells to attach. Subsequently, HCV ser was added to a final volume of 2 ml of medium and the cells were incubated for 3 hours with 0.5 mi (1 × 10 ⁵ 5′-UTR replicas for 2 × 10 ⁵ hADSC cells). After gentle washing, HCV ser-infected hADSCs were cultured in 5 ml of fresh medium with or without medium change every 7 days (route a or b, respectively). The viral replication efficiency of p2 and p6 hADSCs was higher than that of p9 and p15 cells. Various passages of hADSC were exposed to HCV ser-1a or HCV ser-2a in suspension. Following infection, the viral 5'-UTR transcripts and cell lysates (continuous cultures) in the supernatant on day 21 were determined by qRT-PCR. The results showed that in contrast to p2 and p6 cells, p9 and p15 cells had significantly less virus replication in cell lysates and supernatants. Data are expressed as the mean ± SD of three experiments. Blockade of CD81, LDLR, SR-B1 and EGFR and neutralization of ApoE reduced viral replication in cell lysates of day 21 HCVser infected hADSC cultures. P-2 hADSCs were pretreated using monoclonal Abs against CD81 (clone JS-81), LDL-R (clone C7) or EGFR (clone LA1), or polyclonal Abs against SR-B1 at step doses. Timed, then washed and then administered HCV ser-1b. Various concentrations of anti-ApoE antibody (clone E6D10) for ApoE blockade were added to ¹⁴ HCV (+) serum for 1 hour at room temperature as described before incubating with hADSC for 3 hours. In HCV (+) sera, consistent with measurements in the supernatant (FIG. 3G), hADSC blockade of CD81, LDL-R, SR-B1 and EGFR and neutralization of ApoE are responsible for viral transcription in cell lysates. The amount of product was significantly reduced in a dose-dependent manner. On the other hand, antibody treatment itself did not significantly affect hADSC viability. Data are expressed as mean ± SD of triplicates for each treatment. RT-PCR after siRNA transfection and viral replication number in cell lysates on day 21 after knockdown of occludin (OCLN), claudin-1 (CLDN1), NPC1L1 or DGAT-1. (A) Knockdown of occludin, claudin-1 or NPC1L1 was performed ¹⁵ and ¹⁶ as described, and ¹⁶ , ¹⁷ RT-PCR was performed as described. The knockdown of OCLN and CLDN1 was performed in the same experiment, while the knockdown of NPC1L1 was performed in a separate experiment. Data are representative of 3 experiments. (B) The DGAT1 siRNA probe was a pre-designed siRNA obtained from Ambion (catalog numbers 11782 and 11784). Transfection of scrambled RNA and DGAT1 specific siRNA, qRT-PCR, and Western blot analysis were performed ¹⁸ as described. Data are expressed as mean ± SD from 4 experiments and are expressed as relative ratios normalized to 18S rRNA. (C) After knockdown, hADSC was exposed to HCV ser-1b, and the number of 5′-UTR replications of cell lysates on day 21 was determined by qRT-PCR. The siRNA transfection itself did not significantly affect cell viability compared to scrambled siRNA transfection and was determined by trypan blue exclusion test 48 hours after transfection. Apparently, DGAT1 knockdown had a more significant inhibitory effect in the supernatant than in the cells (panel C vs. FIG. 3H). This is consistent with the finding that DGAT1 knockdown impairs both intracellular replication and release, but virus release appears to be more significantly affected ¹⁹ . Data are expressed as mean ± SD from 4 experiments and are expressed as a relative ratio to transfection with a scrambled control. RT-PCR of cyclophilin A expression in hADSC. ²⁰ RT-PCR of cyclophilin A (CypA) was performed with hADSC from p0 to p6 as described. Naive Huh7.5 cells were used as a positive control. Data are representative of 4 experiments. Total lipid content of the main fractions (by density gradient) of HCVser, JFH1 / HCVcc and HCVadsc. HDL and LDL / VLDL levels were detected by HDL and LDL / VLDL cholesterol assay kit (Abcam). The amount of ApoB and ApoE was measured with the Quantikine® ELISA human ApoB immunoassay kit and the Quantikine® ELISA human ApoE immunoassay kit (R & D) according to the manufacturer's instructions. Also, the amount of HDL and LDL / VLDL, ApoB and ApoE in the various fractions was normalized to the weight per replicate. (A) HCVser (particularly fraction 2) had higher “total” amounts of HDL and LDL / VLDL than HCVcc or HCVadsc. (B) Analysis of two other batches of HCVser and HCVadsc showed the same pattern of lipid and ApoE / B content. (C) Analysis of two other batches of HCVser and HCVadsc showed the same pattern of lipid and ApoE / B content. Efficiency of JFH1 / HCVcc infected Huh7.5 4 × 10 ⁵ Huh7.5 cells / well were seeded overnight in 6-well plates. One day later, the cells were washed and incubated with HCVcc virus inoculum (0.5 mol) for 3 hours. After washing, the cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% non-essential amino acids. Supernatants were collected 3 days after infection and RNA was extracted for qRT-PCR of 5′-UTR transcripts. Naive Huh7.5 cells that were not exposed to the virus inoculum were used as negative controls. Data are expressed as mean ± SD from three experiments. This experiment demonstrated the infectivity of the HCVcc inoculum used for infection with hADSC (FIG. 4D).

  Several aspects of the invention are described below with respect to the application shown for illustration. It should be understood that many specific details, relationships, and methods are set forth in order to provide a thorough understanding of the present invention. However, it will be readily recognized by those skilled in the art that the present invention may be practiced without one or more specific details or by other methods. The present invention is not limited by the order of actions or events, because some actions may occur in a different order and / or simultaneously with other actions or events. Moreover, not all illustrated acts or events are required to implement a methodology in accordance with the present invention.

(Definition)
Unless defined otherwise, scientific and technical terms and nomenclature used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In general, procedures for cell culture, infection, molecular biology methods and the like are common methods used in the art. Such standard techniques are described in reference manuals such as Sambrook et al. (1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratories) and Ausubel et al. Can do.

  As used herein, the singular forms “a”, “an” and “the” may include the plural unless the context clearly dictates otherwise. Intended. Further, the terms “including”, “includes”, “having”, “has”, “with”, or variations thereof are detailed. As used in the description and / or in the claims, such terms are intended to be inclusive as well as the term “comprising”.

  As used herein, the term “about” when referring to a measurable value, such as amount, temporal duration, etc., is ± 20% or ± 10% from the specified value, more preferably Intended to encompass variations of ± 5%, more preferably ± 1%, even more preferably ± 0.1% (if such variations are appropriate to perform the disclosed method) Yes.

  The term “adipose tissue” as used herein defines a disseminated organ of major metabolic importance consisting of white fat, yellow fat or brown fat. Adipose tissue has adipocytes and stroma. Adipose tissue is found throughout the animal's body. For example, in mammals, adipose tissue is present in the greater omentum, bone marrow, subcutaneous space, and most surrounding organs.

  The term “stem cell” as used herein defines an adult undifferentiated cell that is capable of producing itself and further differentiated progeny cells.

The terms “human adipose-derived stem cells”, “hADSC”, “human adipose-derived DLK-1 ⁺ stem cells” and “human adipogenic DLK-1 ⁺ cells” are used interchangeably and as used herein. Is a human adult stem cell that is or has a parent cell derived from a tissue source containing adipose tissue. These cells express a specific marker DLK-1 (ie, Pref-1) that is a member of the epidermal growth factor-like family ²¹ and is essential for adipogenesis, and this expression is completely extinguished in mature adipocytes ^{22 ~ 24} .

  As used herein, the term “primary cell” refers to a cell derived directly from a cell or tissue obtained from an individual. As used herein, “passage cell” refers to a cell that has been subcultured from a primary cell. As used herein, “passage number” refers to the number of times a cell has been subcultured from a primary cell. For example, the first passage cell (P1 cell) is a cell obtained by directly subculturing a primary cell, and the second passage cell (P2 cell) is a direct passage culture of the first passage cell. It is a cell obtained by doing.

  As used herein, the terms “culture”, “cultivate”, “grow”, “propagate” and “propagating” are used interchangeably, This refers to growing cells in a prepared medium in a test tube. As used herein, the terms “culture system”, “culturing system”, “propagation system”, and “propagating system” are used interchangeably. Refers to a cell culture containing cells that produce viral particles. In particular, the culture system of the present invention includes hADSC in culture that produces HCV. The system performs complete replication of HCV, including production of infectious virus (eg attachment, entry into cells, replication, maturation, etc.), in particular viral entry, (−) and (+) chain synthesis. Assists in replication, viral protein synthesis, viral assembly, viral transport, or viral release.

  As used herein, the term “sample” or “biological sample” refers to a biomaterial isolated from a subject or in vitro culture. A biological sample can contain nucleic acids, polypeptides, or any biomaterial suitable for detecting markers of other biological, physical, or pathological processes in a subject or in vitro cell culture. , Media, body fluids, tissues, and cellular and / or non-cellular material obtained from a subject or in vitro cell culture.

  As used herein, the term “diagnosis” refers to the determination of the presence of a disease or disorder. In some embodiments of the invention, a method for making a diagnosis is provided that allows the determination of the presence of a particular disease or disorder.

  As used herein, the terms “patient”, “subject”, “individual” and the like are used interchangeably and refer to any animal capable of undergoing the methods described herein. In certain non-limiting embodiments, the patient, subject or individual is a human.

(Description)
The present invention relates to the discovery that hADSC is permissive for infection by HCV.

(HADSC)
Human adipose-derived stem cells are mesoderm-derived pluripotent adult stem cells that can be easily obtained in large quantities ⁹ . These cells express a specific marker DLK-1 (ie, Pref-1) that is a member of the epidermal growth factor-like family ²¹ and is essential for adipogenesis, and this expression is completely extinguished in mature adipocytes ^{22 ~ 24} . Successive evidence has demonstrated that human adipogenic DLK-1 ⁺ cells (hADSC) can differentiate into multiple cell lines (see refs. ^{25 and 26 for} reviews), and hADSC is promising for the development of regenerative therapy It has become a tool. ^27-32 of mesenchymal stem cells in various anatomic compartments have also been reported to be susceptible to infection with the virus. However, the role of hADSC in viral diseases has not yet been explored.

  In general, hADSC can be obtained from any available source. In one embodiment, hADSC is isolated from a suitable tissue source. Suitable tissue sources of hADSC include, but are not limited to, any adipose-containing tissue, such as brown adipose tissue or white adipose tissue such as subcutaneous white adipose tissue. Typically, human adipose tissue is obtained from a living donor using surgical excision or liposuction. In some embodiments, the adipose tissue is obtained from a preselected region of the subject, ie, the abdomen, buttocks, groin and peritoneum, or any combination thereof.

  In one embodiment, hADSC is isolated from abdominal or buttocks subcutaneous adipose tissue. In one embodiment, hADSCs are primary cells, i.e. cells that are directly derived from the adipose tissue of an individual. In another embodiment, the hADSC is a passage cell, eg, a 1st to 15th passage cell, preferably a 1st to 6th passage cell.

  Methods for separating, isolating and growing ADSCs such as hADSC are known in the art, eg, US Pat. No. 6,391,2971B1; US Pat. No. 6,777,231B1; US Pat. 786,207; U.S. Patent Application No. 2005/0076396 A1; Burris et al. (1999) Mol Endocrinol 13: 410-7; Erickson et al. (2002) Biochem Biophys Res Commun. January 18, 2002; 290 (2): 763-9; Gronthos et al. (2001) Journal of Cellular Physiology, 189: 54-63; Halvorsen et al. (2001) Metabolism 50: 407-413; Halvorsen et al. (2001) Tissue. Eng. 7 (6): 729-41; Harp et al. (2001) Biochem Biophys Res Commun 281: 907-912; Saladin et al. (1999) Cell Growth & Diff 10: 43-48; Sen et al. (2001) Journal of Cellular Biochemistry 811: 319; Zhou et al. (1999) Biotechnol. Techniques 13: 513-517; Erickson et al. (2002) Biochem Biophys Res Commun. January 18, 2002; 290 (2): 763-9; Gronthos et al. (2001) Journal of Cellular Physiology, 189: 54-63; Halvorsen et al. (2001) Metabolism 50: 407-413; Halvorsen et al. (2001) Tissue. Eng. 2001 Dec 7; (6): 729-41; Harp et al. (2001) Biochem Biophys Res Commun 281: 907-912; Saladin et al. (1999) Cell Growth & Diff 10: 43-48; Sen et al. (2001) Journal of. Cellular Biochemistry 81: 312-319; Zhou et al. (1999) Biotechnol. Techniques 13: 513-517; ZuIc et al. (2001) Tissue Eng. 7: 211-228; Hauner et al. (1987) J. MoI. Clin. Endocrinol. Metabol. 64: 832-835; Katz et al. (1999) Clin. Plast. Surg. 26: 587-603.

  By way of example only, the cells can be isolated using several morphological, biochemical or molecular based methods. In one embodiment, hADSC is isolated based on cell size and particle size because hADSC is small and granular. Alternatively, hADSCs can be isolated by assaying telomere length or assaying telomerase activity because stem cells tend to have longer telomeres than differentiated cells.

Alternatively, hADSC can be separated from other cells immunohistochemically by selecting a cell marker specific for hADSC. hADSCs express mesenchymal stem cell markers CD10, CD13, CD29, CD34, CD44, CD54, CD71, CD90, CD105, CD106, CD117 and STRO-1. They are negative for the hematopoietic lineage markers CD45, CD14, CD16, CD56, CD61, CD62E, CD104 and CD106 and the endothelial cell (EC) markers CD31, CD144 and von Willebrand factor (Zuk et al., Mol Biol Cell). 13 (12): 4279-4295, 2002; Musina et al., Bull Exp Biol Med 139 (4): 504-509, 2005; Romanov et al., Bull Exp Biol Med 140 (1): 138-143, 2005). Morphologically, they are fibroblast-like and maintain their shape after growth in vitro (Zuk et al., Mol Biol Cell 13 (12): 4279-4295, 2002; Arrigoni et al., Cell Tissue Res 338 (3): 401-411, 2009; Zannetino et al., J Cell Physiol 214 (2): 413-421, 2008). In various embodiments, hADSCs are isolated by DLK-1 ⁺ immunoselection.

  In another embodiment, hADSCs are obtained from commercial sources or established hADSC lines. Non-limiting examples of such hADSCs include Poetics ™ human adipose derived stem cells (Catalog No. PT-5006, Lonza Group Ltd.) and ATCC® PCS-500-011 ™.

(Cell culture)
In general, hADSCs can be maintained and grown in well-known media available in the art. Examples of such a medium include, but are not limited to, keratinocyte SFM (K medium), Dulbecco's modified Eagle medium (registered trademark) (DMEM), DMEM F12 medium (registered trademark), Eagle minimal essential medium (registered trademark), F- 12K medium (registered trademark), Iskov modified Dulbecco medium (registered trademark) RPMI-1640 medium (registered trademark), mesenchymal stem cell basal medium (ATCC (registered trademark) PCS-500-030 (registered trademark)) and mesenchymal stem cell Growth kit-low serum (ATCC (R) PCS-500-040 (TM)).

  The present invention also contemplates supplementation of cell culture medium with mammalian serum, preferably fetal bovine serum. In some embodiments of the invention, such mammalian serum concentrations range from 0% to 20%, preferably 5% to 15%, more preferably 10% by volume. Examples of serum include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum ( HS), human serum, chicken serum, pig serum, sheep serum, rabbit serum, serum replacement and fetal bovine fluid.

  Additional supplements such as growth factors, hormones, amino acids, lipids, minerals, etc. can also be suitably used to supply the cells with the trace elements necessary for optimal growth and proliferation. Such supplements are commercially available. It is within the skill of one of ordinary skill in the art to determine the appropriate concentration of these supplements.

(HCV)
The HCV according to the present invention can be any HCV capable of infecting hADSC or any HCV that can be isolated from an HCV infected individual. In one embodiment, the HCV is genotype 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, At least one HCV genotype selected from the group consisting of 4i, 4j, 5a and 6a or any combination thereof. In another embodiment, the HCV is at least one of the HCV genotypes selected from the group consisting of genotypes 1a, 1b, 2a, 2b and mixed types 2a + 2b.

  In one aspect, the invention includes a hADSC based system for growing HCV, which includes hADSC. In another aspect, the present invention provides a method for performing HCV growth, or performing an HCV life cycle analysis, or diagnosing HCV infection, or selecting antiviral compounds, or characterizing HCV in a subject infected with HCV. It includes a method of using the inventive hADSC or HCV culture system.

  The level of HCV can be determined by any technique known in the art. Such techniques include anti-HCV ELISA assays (enzyme-linked immunosorbent assays) that test HCV proteins. Testing of HCV replication with amplification tested RNA (eg, polymerase chain reaction or PCR, branched DNA assay) may be used. The synthesis of HCV RNA is actually by RT-PCR in a single step using an instrument designed for real-time PCR, or by hybridization of RNA on a filter using an HCV specific radioactive probe. Can be analyzed. For example, using specific oligonucleotide primers that allow amplification of the HCV genome, isolated RNA can be paired reverse transcription and amplification, eg, reverse transcription and polymerase chain reaction (RT-PCR) amplification You may use for. The subject may then be directly sequenced to determine the genotype of the infected HCV.

  In various embodiments, the level of HCV is determined by measuring HCV titer, HCV nucleic acid level, or HCV polypeptide level.

  In various embodiments, a decrease in the level of HCV observed in the presence of the candidate compound relative to the level of HCV observed in the absence of the candidate compound indicates the inhibitory activity of the candidate compound.

  According to the present invention, candidate compounds include, but are not limited to, chemical compounds, proteins, peptides, peptidomimetics, antibodies, nucleic acids, antisense nucleic acids, shRNAs, ribozymes, and small molecule chemical compounds.

  As disclosed herein, anti-HCV compounds identified using selection methods can be further tested in susceptible animal models.

(kit)
In a related aspect, the invention also provides for performing HCV growth, or performing an HCV life cycle analysis, or diagnosing HCV infection, or selecting antiviral compounds, or characterizing HCV in a subject infected with HCV. , Kits comprising a medium suitable for culturing hADSCs and hADSCs described herein.

  The invention is further illustrated by the following examples. These examples are merely intended to illustrate the invention and are not intended to limit the scope of the invention. Experimental methods in the following examples, unless otherwise specified, are conventional conditions such as those described by Sambrook et al. In Molecular Clone: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press, 1989, or Performed under conditions indicated by the manufacturer.

<Materials and methods>
(Clinical sample)
All clinical adipose tissue and liver samples were obtained from Kaohsiung Medical University Hospital with the approval of the Institutional Research Committee (KMUH-IRB-960477, KMUH-IRB-960343 and KMUH-IRB-20120404). Prior to the procedure, written informed consent was obtained from all donors.

(Fractionation of fresh adipose tissue and culture of DLK-1 ⁺ cells)
HCV (+) adipose tissue was obtained from a surgical wound (laparotomy) to remove hepatocellular carcinoma. HCV (−) adipose tissue was obtained from a transverse axis rectus abdominal flap of a woman who had undergone breast reconstruction immediately after mastectomy of breast cancer as previously described ¹³ . HCV (−) adipose tissue was also obtained from obese subjects undergoing liposuction (Table 1). None of the patients received adjuvant chemotherapy or radiation therapy for breast cancer management prior to surgery.

After sample collection, the tissue was washed with sterile standard saline and the specimen was placed in a sterile bag and sent immediately for preparation. Fresh adipose tissue is fixed for immunohistochemistry or ^floated on top (including mature adipocytes and connective tissue) by 12, ¹³ , ³³ centrifugation (800 g, 10 min) as described It was used to fractionate into a layer (float), an intermediate buffer layer, and a sedimented cell pellet at the bottom. Briefly, adipose tissue is minced into small pieces with scissors, washed with PBS without calcium and magnesium, followed by 0.075% collagenase (37.5 mg / mL; Sigma for 30 minutes in PBS). -Aldrich) and digested at 37 ° C. with constant stirring.

The bottom layer cell pellet (ie SVF cells) was collected and treated with RBC lysis solution as ^described ( ^12,34 to lyse red blood cells) followed by filtration through a 100 μm Sterilip (Millipore) filter. The number and viability of SVF cells were measured using a Countess cell counter (Invitrogen) after staining with trypan blue. ¹⁰ SVF cells were then positively selected for DLK-1 ⁺ cells by immunomagnetic beads as described, and cellular RNA was extracted for RT-PCR or qRT-PCR. DLK-1 ⁺ cells were also subjected to immunocytochemistry (for viral NS5 antigen).

For all samples, the interval from collection of fat samples to cell isolation was 3 hours or less. To cultivate DLK-1 ⁺ cells, ¹³ ) 1 × 10 ⁵ cells were placed in a 6 cm Petri dish for 49 days as described, and the supernatant was extracted with RNA every 7 days (simultaneously with medium change) Collected for.

(Immunoselection of DLK-1 ⁺ cells)
RBC lysed unfractionated SVF cells prepared from HCV infected or HCV uninfected individuals were incubated with polyclonal rabbit anti-DLK1 antibody (Abcam, USA) at 4 ° C. for 30 minutes. The following ¹⁰ cells have been described, washed twice in HBSS containing _{0.8mmol / L MgCl 2, 20mmol /} L of HEPES,, 100 U / mL penicillin and 100 [mu] g / mL streptomycin, magnetic microbeads Incubated with goat anti-rabbit IgG (Miltenyi Biotec Inc, Auburn, Calif.) For 30 minutes at 4 ° C. The cell suspension was washed and passed through a column in a MidiMACS separator (Miltenyi Biotec). As a result, DLK-1 ^- cells passed and DLK-1 ⁺ cells were retained on the column. Both cell fractions were washed twice in HBSS. Cell viability was> 96% and> 97% for the DLK-1 ⁺ and DLK-1 ⁻ fractions, respectively. RNA was extracted for RT-PCR or qRT-PCR. In a separate experiment, cells were fixed on cytospin slides for immunocytochemistry (5-7 × 10 ³ cells / slide). In an in vitro infection experiment, after exposure to HCV (+) serum (HCVser), DLK-1 ⁺ cells were cultured and passaged for the indicated period ( ¹³ passages as described). RNA was then extracted for RT-PCR or qRT-PCR of viral 5′-UTR transcripts.

(HADSC infection by HCVser)
In this study, two protocols were employed.

(1) Protocol 1, infection in suspension-We used naive hADSC from passage 2 (p-2) to passage 6 for HCV ser infection. The HCV serum total 200μl to 5x10 ⁵ amino hADSC suspended in fresh medium 800 [mu] l (containing 1x10 ⁵ cells of 5'-UTR copies), 0.2 multiplicity of infection in an Eppendorf tube (MOI) was added followed by incubation at 37 ° C. for 3 hours. Cells were washed 3 times with PBS and cultured for an additional 7, 14, 21 and 28 days and RNA in the supernatant and cell lysate was collected for 5′-UTR RT-PCR. Cells were also collected for immunocytochemistry and transmission electron microscopy (TEM) studies.

(2) Protocol 2, infection in adherent form--P-2 to p-6 naive hADSC was inoculated in a 6 cm Petri dish for 1 day to attach the cells, and HCV ser was added to a medium with a final volume of 2 ml. ⁵ moi (1 × 10 ⁵ 5′-UTR replicates for 2 × 10 ⁵ hADSC cells) was added for 3 hours. After gentle washing, cells were cultured in 5 ml fresh medium with or without medium change every 7 days.

(5'-UTR RT-PCR and quantitative RT-PCR)
RNA was extracted from 140 μl HCV (+) serum or HCVser infected hADSC culture supernatant using the QIAamp® viral RNA mini kit (Qiagen, Basle, Switzerland). RNA from cell lysates was isolated using the PureLink® RNA mini kit (Ambion, Carlsbad, CA, USA) according to the manufacturer's instructions. Subsequently, RNA was converted to single stranded cDNA using a high-capacity cDNA reverse transcription kit, followed by PCR using GoTaq Master Mix (Promega, WI, USA). To quantify viral replicas, PCR was performed with the Hepatitis C virus advanced kit (PrimerDesign Ltd., UK) using an Applied Biosystems® ViA ™ 7 real-time PCR system. HCV specific reverse and amplification primers were designed according to ABI Primer 3.0 Express Soft Word. ³⁵ as described, primer 5'-ACTCGCAAGCACCCTATCAG-3 'is used for reverse transcription, and primers used for PCR and real-time PCR are highly conserved 5'-untranslated regions of different HCV genotypes. (UTR).

(Immunohistochemistry (IHC) against human adipose tissue)
Fresh adipose tissue was collected from surgical wounds, fixed with formalin and embedded in paraffin. The tissue was cut into 5 μm sections, dewaxed, then immersed in citrate buffer (10 mM citrate, pH 6.0) and heated in the microwave for antigen retrieval. After blocking with 5% BSA for 30 minutes at room temperature, polyclonal rabbit anti-DLK1 antibody (1: 150; catalog number ab 21682, Abcam, USA) or rabbit IgG Ab (1: 150, catalog number AB-105-C, R & D ) At 4 ° C. overnight, followed by alkaline phosphatase-conjugated anti-rabbit IgG secondary antibody (1: 500; Jason ImmunoResearch) for 1 hour at room temperature, followed by color development with fast red substrate system (Sigma Aldrich). It was. For continuous NS5 staining, samples were soaked in PBS for 10 minutes to remove coverslips and slides were incubated in 0.3% H ₂ O ₂ for 30 minutes at room temperature to derive from endogenous peroxidase Reduced non-specific background. After blocking with 5% BSA for 30 minutes at room temperature, mouse anti-NS5 antibody (1: 200, clone BGN / 1246 / 5G7, catalog number 0200-0423, AbD Serotec) or mouse IgG1 isotype Ab (1: 100, catalog number) 14-4714, eBioscience) was added overnight at 4 ° C. In our experience, since the sample was already embedded in paraffin, NS5 staining for adipose tissue did not require a cell penetration procedure. Thereafter, the sections were incubated with horseradish peroxidase polymer Quanto reagent (anti-mouse, ready-made, Thermo Scientific) for 7 minutes at room temperature, and developed with UltraVision Quanto Detection System (containing DAB substrate for color development; Thermo Scientific). The sections were then stained with hematoxylin and the coverslips were placed back, thereby slightly changing the cell contour (as shown in FIG. 1E). Electronic images of DLK1 and NS5A staining were captured with a high quality microscope (Zeiss), high speed computer hardware and a high resolution screen using TissueFAXS scanning software (TissueGnoistics). Subsequently, the same region in the image was selected and visualized for comparison and colocalization analysis.

  In adipose tissue (FIG. 1E), the optimal time required for color development varied significantly among tissues from various donors (ie, variation between donors) regardless of HCV infection status. We have modified the method many times and found that the time for color development is critical. The guideline we followed was to first determine the maximum time of color development that produced the weakest color signal of isotype Ab staining (rabbit IgG or mouse IgG1), and then determined this color development period for anti-DLK-1 Adopted for Ab staining or anti-NS5 Ab staining. This was to ensure that there was almost no false positives due to substrate overcolor development and that the background of isotype Ab staining was low.

  In our study on the adipose tissue of HCV (+) donor 1 (Table 1), the maximum time for color development of rabbit IgG staining before the appearance of a significant color signal was 40-50 seconds, The color development of DLK-1 staining was set at 40-50 seconds. Similarly, the maximum color development time for mouse IgG1 staining without a significant color signal was as short as 15 seconds, which was defined as the color development time for anti-NS5 Ab staining. In contrast, for donor 2 and donor 3 adipose tissues, the optimal color development time for rabbit IgG staining was 30 seconds and for mouse IgG1 staining was only 10 seconds, so these periods were each anti-DLK. -1 and anti-NS5 Ab staining were defined for color development. Similar guidelines were followed when staining HCV (−) samples.

(Immunocytochemistry (ICC))
For immunocytochemistry of unfractionated SVF cells or DLK-1 ⁺ hADSC or DLK-1 ^- cells, the optimal color development time is predetermined as described above in any control experiment, following the same guidelines as for IHC. did. Cells were harvested at the indicated time points, adhered to polylysine-coated glass slides by cytospin, and subsequently fixed with 4% formalin for 20 minutes. For DLK-1 staining, cells were subjected to antigen retrieval with 0.05% trypsin solution at 37 ° C. for 30 minutes and then rinsed 3 times with DDW. After blocking for 5 minutes with Ultra V Block buffer (reagent in UltraVision Quanto Detection System, Thermo, USA), cells are incubated overnight at 4 ° C. with rabbit anti-DLK1 antibody or rabbit IgG followed by alkaline phosphatase-conjugated anti-antigen Incubated with a rabbit IgG secondary antibody for 1 hour at room temperature and developed with the fast red substrate system (Sigma-Aldrich) for 5-6 minutes (in most cases). For single or sequential staining of HCV-specific NS5 (stained on the same slide as shown in FIG. 2C), place the slide in PBS for 10 minutes, remove the cover slip, wash away the mounting medium, and 0. Cells were permeabilized and blocked with PBS containing 3% Tritox-100 and 1% BSA for 30 minutes, after which UltraVision Quantum Detection System (Thermo Scientific, Fremont, CA, USA) was applied. Cells were then incubated for 10 minutes in Hydrogen Peroxide Block (Abcam, MA, USA) to reduce non-specific background staining due to endogenous peroxidase. After washing, the cells are incubated with Ultra V Block (Thermo Scientific, MA, USA) for 5 minutes to block non-specific background staining and overnight at 4 ° C. with dilution buffer containing mouse monoclonal anti-NS5 antibody. Incubated. Staining with mouse IgG1 was used as a negative control. The next day, the cells were incubated with the Primary Antibody Quanto Quanto solution for 10 minutes, further incubated with HRP Polymer Quanto for 10 minutes, and washed with PBS between each reagent application. Finally, 30 μl of DAB Quanto Chromogen was added to 1 ml of DAB Quanto Substrate, swirled and applied to cells (most often) for 2-3 minutes for color development. After washing, a permanent mounting medium was placed on the slide, covered with a cover glass, visualized using a TissueFAX microscope (ZEISS), and photographed.

(Transmission electron microscopy of serum HCV-infected hADSC)
For TEM studies, hADSCs were collected, prepared ³⁶ as described, and examined with a transmission electron microscope (JEM2000 EXII; JEOL, Tokyo, Japan).

(RT-PCR of mRNA encoding the core antigens of HCV 2a and 2b)
HADSC RNA was isolated using the PureLink® RNA mini kit (Ambion, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA was converted to single stranded cDNA using a high capacity cDNA reverse transcription kit (Applied Biosystems). The specific primer used for reverse transcription was 5'-AGTTACCCCATGAGGTCGCC-3 '. Primers used for PCR were matched to the core protein region of another HCV genotype. The first PCR used a primer mixture containing (forward) 5′-CGCGCGGATAGAGAGAGACTTC-3 ′ and (reverse) 5′-CGCGCGCGCGTAAAACTTC-3 ′ using a thermal profile with the following settings: : 94 ° C for 2 minutes, followed by 35 cycles of 94 ° C for 45 seconds, 55 ° C for 45 seconds and 72 ° C for 90 seconds, then 7 minutes at 72 ° C for final extension. The type-specific antisense primers used for genotyping in the second round of PCR are 5′-CCAAGAGGGACGGGAACCTC-3 ′ (type 2a) and 5′-ACCCTCGTTTCCGTACAGAG-3 ′ (type 2b), and the thermal profile is as follows: Set at: 95 ° C. for 2 minutes, followed by 30 cycles of 95 ° C. for 30 seconds, 60 ° C. for 30 seconds and 72 ° C. for 30 seconds, then 72 ° C. for 7 minutes ^{37, 38} for final extension.

(Flow cytometry and blocking experiments)
0.5-1 × 10 ⁵ hADSCs at various passages in suspension were incubated at 4 ° C. for 1 hour with mouse anti-human CD81 monoclonal Ab (clone JS-81, BD Biosciences), anti-LDL-R Ab ( Clone C7, Millipore), anti-EGFR Ab (clone LA1, Millipore) or rabbit polyclonal anti-SRB1 Ab (Novus Biologicals). Each control was mouse IgG1 or polyclonal rabbit IgG. After washing, the cells were further incubated with a fluorescein isothiocyanate (FITC) -conjugated secondary Ab (Jackson ImmunoResearch Laboratories, PA, USA) and by Cell Quanta ™ SC high resolution flow cytometry (Beckman Coulter Fullerton, CA, USA). analyzed. To block cell surface molecules, 2 × 10 ⁵ hADSCs (adhered in wells) were pretreated at 37 ° C. with 1 ml of serum-free K medium containing the indicated dose (1-100 μg / ml) of antibody. . Treatment with each isotype antibody was used as a control. After 1 hour, undiluted HCV (+) serum was added into an Eppendorf tube to bring the MOI to 0.2 for 3 hour incubation in the presence of antibody. The cells were then washed and inoculated into 6 cm Petri dishes for continuous culture. Various concentrations of anti-ApoE antibody (clone E6D10) for ApoE blockade were added to ¹⁴ HCV (+) serum for 1 hour at room temperature as described before incubating with hADSC for 3 hours. Supernatants and cells were collected after 21 days of continuous culture and RNA was extracted to quantify the viral 5′-UTR transcript. In a separate experiment, hADSCs in wells were pretreated with indicated doses of IFNα (Sigma-Aldrich, MO, USA) for 16 hours in K medium, followed by HCV of genotypes 1a, 1b, 2a and 2b. (+) Serum exposure. After 21 days, 5′-UTR transcripts in cell lysates were quantified by qRT-PCR and results were calculated as fractional inhibition compared to cells treated with vehicle (PBS) control.

(RNA extraction for RT-PCR of miR-122)
Primers for miR-122 RT-PCR were prepared and ³⁹ performed as described. Total RNA from cells was isolated with the RNA extraction reagent REzol ™ C & T (Protech, Taipei, Taiwan). To determine miR-122 levels, we reverse-transcribed the extracted RNA using the TaqMan MicroRNA Reverse Transcriptas kit (Applied Biosystems), and used cDNA as a template for real-time PCR analysis with miR-122 TaqMan MicroRNA Assay. used.

(Synthetic siRNA and gene silencing)
SiRNA specific for occludin and claudin-1 were synthesized by ¹⁵ , ⁴⁰ , ⁴¹ Dharmacon as described. Their respective target sequences are UAACAAUUAGGACCUUAGAA (Claudin-1) and GUGAAGAGUAACAUGGCUGC (Occludin). NPC1L1 was prepared ¹⁶ as described, and DGAT-1 siRNA was prepared ¹⁹ as described. Xfect transfection reagent (Clontech) was used to transfect specific siRNA into hADSC in wells of 6-well cell plates. HCV infection was performed by incubating siRNA transfected cells with HCVser for 3 hours at 37 ° C., followed by washing out the HCVser with PBS. Cells were lysed for RT-PCR to determine the extent of gene silencing at ¹⁵ , ¹⁹ , ⁴⁰ , ⁴¹ , 48 hours post-transfection as described. HCvser infected hADSC cell lysates and supernatants were collected for qRT-PCR of 5'-UTR after 21 days of culture.

(JFH1 / HCVcc and Huh7.5 cells)
Huh7.5 cells were cultured in DMEM (Invitrogen) containing 10% heat inactivated fetal bovine serum (Invitrogen) and 0.1 mM non-essential amino acids (Invitrogen). In vitro genomic JFH-1 RNA was transcribed and delivered to cells by ⁴² electroporation as previously described. The transfected cells were then transferred to complete DMEM and passaged every 3-4 days. In normal practice, conditioned medium from cells transfected with full length JFH1 cDNA is clarified by centrifugation (3,000 × g) for 10 minutes and sterile filtered (0.2 μm cellulose acetate, Millipore) before use. did. For longer storage, HCVcc was aliquoted and stored at -80 ° C. For overnight incubation at 4 ° C., the virus was concentrated by the addition of 1/4 volume of sterile filtered 40% (w / v) polyethylene glycol-8000 in PBS. Viral precipitate was collected by centrifugation (8,000 × g, 15 min) and resuspended in ⁴³ PBS as described.

(Drug inhibition assay)
Antiviral drugs ribavirin, cyclosporin A and IFNα were all obtained from Sigma-Aldrich. Telaprevir was obtained from Selleck Chemicals, Massachusetts, USA. Staged doses of ribavirin, telaprevir or cyclosporin A were added on day 0 to the medium of HCV ser-infected hADSC in petri dishes and cultured for 21 days. For IFNα treatment, hADSC was pretreated with the indicated dose of IFNα for 16 hours and then incubated with HCV ser. Cell lysate virus 5'-UTR transcripts were then quantified and calculated as fractional inhibition compared to cells treated with vehicle control. Vehicle controls were PBS for ribavirin and IFNα, 0.1% DMSO for cyclosporin A and telaprevir.

(Floating density of HCVser, HCVadsc and HCVcc)
HCVcc and HCVadsc media were concentrated with PEG-8000 as previously described. Both samples were resuspended in 500 μl of serum-free medium and a solution containing ⁴⁴ , 10 mM Hepes (pH 7.55), 150 mM NaCl and 0.02% BSA as described above. Laminated on a continuous iodixanol (OptiPrep, Axis-Shield, Norway) density gradient of 10% to 40% iodixanol (0.5 ml each) prepared using. The gradient was ultracentrifuged at 40,000 rpm at 4 ° C. for 6 hours in a SW-41 rotor (Beckman Coulter). After ultracentrifugation, 17 fractions were collected from the upper gradient (each fraction contained 500 μl). Finally, total RNA was isolated from each fraction using the QIAamp® viral RNA mini kit (QIAGEN, Basle, Switzerland). RNA was used for HCV RNA detection by quantitative RT-PCR.

(Measurement of ApoB, ApoE and cholesterol)
Detect ApoB and ApoE expression using Quantikine® ELISA human apolipoprotein B / ApoB immunoassay kit and Quantikine® ELISA human apolipoprotein E / ApoE immunoassay kit (R & D Systems) according to manufacturer's instructions did. HDL and LDL / VLDL cholesterol were detected by HDL and LDL / VLDL cholesterol assay kit (Abcam). The expression levels of HDL and LDL / VLDL ApoB, ApoE and cholesterol in fractions with various buoyant densities were normalized to replicates.

(Infection of human primary hepatocytes (PHH) by HCVser or HCVadsc)
Fresh non-neoplastic liver tissue was collected from liver specimens surgically excised for HCV-related or non-HCV-related hepatocellular carcinoma and PHH was isolated and cultured for ⁴⁵ as described. PHH was inoculated for 3 days to allow cells to adhere on collagen I-coated 6-well plates. On day 4, cells were gently washed and mixed with HCVser or corresponding d21 hADSC expanded HCV (+) supernatant (containing 1 × 10 ⁴ HCV 5′-UTR replicas) free of arginine The cells were cultured in Williams E medium (Invitrogen, CA, USA) with a final volume of 0.5 ml for 3 hours. After infection, the cells were washed and further cultured in 1 ml medium with fresh medium replaced daily until d5 after infection. Cells were then lysed for RNA extraction for 5'-UTR RT-PCR.

(Example 1: hADSC is a target of HCV in vivo)
Clinically, an interesting feature of HCV infection is that HCV (+) patients can have excessive fat accumulation in the chronically infected liver, i.e. fatty ^liver46,47 , and the severity of fatty liver is liver fibrosis ⁴⁸ which seems to correlate with the proportion. Furthermore, recent studies, HCV RNA replication is stimulated by increasing the availability of saturated fatty acids is inhibited by polyunsaturated fatty acids or fatty acid synthesis inhibitors, has been shown that ^{49 , 50} . These findings suggest that fat metabolism plays an important role in the life cycle of HCV. Therefore, the present inventors have hypothesized that the cellular components of adipose tissue may be involved in HCV infection in vivo.

  To test our hypothesis, we collected subcutaneous adipose tissue from HCV infected or non-HCV infected individuals (Table 1) and used HCV ser genotype 1b (HCVser-1b) as a positive control RNA was then extracted for RT-PCT of the HCV-specific 5′-UTR transcript.

Table 1A is HCV (+) donor for subcutaneous adipose and liver tissues. All patients underwent laparotomy for surgical resection of hepatocellular carcinoma. Adipose tissue [approximately (2-2.5 cm) ³ ] was collected from the surgical wound (laparotomy) and liver tissue was collected from the non-tumor part of the excised liver (away from the lesion). The patient number was the same as shown in FIG. 1F.

  Table 1B is a donor of HCV (-) liver tissue. The patient was a victim of HBV-related or non-B or non-C hepatocellular carcinoma and underwent hepatectomy.

Interestingly, the adipose tissue of HCV (+) individuals (genotype 1b or 2a patient numbers 1-3, Table 1), in contrast to that of HCV (−) individuals, virus 5′-UTR (223 bp, 1A). In order to eliminate the possibility of contamination from blood and define a source of cells that express viral transcripts, we matured adipose tissue by ¹² , ¹³ , ³³ centrifugation as described. The cells were fractionated into an upper floating layer (floating substance) containing adipocytes, an intermediate buffer layer, and a sedimented cell pellet at the bottom (FIG. 5). Cell pellets were collected and further treated with RBC lysis buffer to lyse erythrocytes, and stromal vascular cell group (SVF) cells were collected. Subsequently, RNA was extracted separately from the suspension layer and RBC-lysed SVF cells, but RNA could hardly be extracted from the buffer layer (data not shown). RT-PCR demonstrated that no virus 5′-UTR was detected in the suspension layer, while virus transcripts were detected in SVF cells (left panel, FIG. 1B).

We next performed positive selection of DLK-1 ⁺ cells from SVF cells with ¹⁰ immunomagnetic beads as described, and> 99 of positively selected cells by flow cytometry analysis. 7% were confirmed to express DLK-1 (FIG. 6). Subsequently, RNA was extracted separately from DLK-1 ⁺ cells and DLK-1 ⁻ cells for RT-PCR, and virus transcripts were present in DLK-1 ⁺ cells but not in DLK-1 ⁻ cells. This was confirmed (right diagram, Fig. 1B). We also performed RT-PCR of HCV-specific minus-strand RNA ⁵¹ using RNA extracted from HCV (+) human primary hepatocytes (PHH) as a positive control. The data confirmed that the HCV replication intermediate is present in DLK-1 ⁺ cells but not in DLK-1 ⁻ cells among the three HCV (+) donors (375 bp; FIG. 1C). . In addition, DLK-1 ⁺ cells and DLK-1 ⁻ cells were separately sited for immunocytochemistry using mouse anti-HCV NS5 antibody (clone BGN / 1246 / 5G7) and hematoxylin (to identify cell nuclei). Spin on a spin slide. Cells isolated from HCV (−) individuals were also stained for comparison. Consistent with 5′-UTR mRNA expression, DLK-1 ⁺ cells isolated from HCV (+) donors expressed NS5 antigen (brown label, panel c, FIG. 1E), whereas DLK-1 ⁻ cells NS5 expression was close to the background regardless of HCV infection status (panels b and e). Staining of unfractionated SVF cells of HCV (+) or HCV (−) with an isotype antibody (mouse IgG1) was used as a control (panels a and d, FIG. 1E). Hematoxylin staining (blue labeling) confirmed that NS5 ⁺ cells are genuine nucleated cells, not cell debris (panel c, FIG. 1E). The specificity of the anti-NS5 antibody was verified in HCV (+) PHH staining (FIG. 7).

For in vivo validation, we performed immunohistochemical studies on subcutaneous adipose tissue collected from HCV infected and non-HCV infected individuals. Tissue sections were first stained with anti-DLK-1 Ab. After soaking and washing with PBS, the same sections were stained using anti-NS5 Ab and hematoxylin. The results show that DLK-1 was detected at similarly described positions in mouse adipose tissue ⁵² in adipose tissue collected from both HCV infected and non-HCV infected individuals (red label, white arrow). Panels b and c and h, respectively, FIG. 1E) are shown. Furthermore, NS5 ⁺ cells were visualized in HCV (+) adipose tissue (brown label, white arrows, panels e and f, FIG. 1E) but not in HCV (−) samples (panel j). . Notably, virus NS5 colocalized with DLK-1 expression in HCV (+) samples (panels b vs e, and c vs f, FIG. 1E; b and e and c and g are from separate donors. Yes, see also FIG. In HCV (+) adipose tissue, approximately 0-4 DLK-1 ⁺ NS5 ⁺ cells were found per high power field (400X) in any section examined.

To determine whether hADSCs of HCV (+) individuals produced virus, we cultured DLK-1 ⁺ cells isolated from HCV (+) patients and in the supernatant The number of virus replication was quantified every 7 days. Interestingly, viral transcripts were hardly detected in the first 4 weeks, but began to be detected in supernatants after d28-d35, and the number of replicas increased in a time-dependent manner (until d49; FIG. 1F). Furthermore, the amount of viral transcripts when cultured for a long time appeared to correlate with the serum virus titer of each patient from whom the cells were isolated (FIG. 1F and Table 1).

  In summary, our data provide evidence that hADSC is a target for HCV in vivo.

Example 2: Naive HCV (−) hADSC is susceptible to HCV ser infection and replication in vitro
To determine whether naive HCV (−) hADSCs are susceptible to HCV ser infection and replication in vitro, we prepared hADSCs from HCV (−) individuals and cultured them in culture. Passed on. Passage 3 (p-3) or p-4 cells in suspension (in an Eppendorf tube) with a final volume of 1 ml for 0.2 moi (ie 5 × 10 ⁵ hADSC cells) 1 × 10 ⁵ 5′-UTR replication number) HCV ser (Table 2).

  Table 2 shows the HCV genotype and 5'-UTR replication number of the HCV (+) serum used in this study. None of the patients had any evidence of HIV or hepatitis B virus infection. The patient also had no signs of acute infection. Serum was collected from September 2011 to February 2014 and used immediately or stored at −80 ° C. until used. The sera of patient numbers 1-5 were used in FIGS. 2A-D and the rest were used in FIGS. 2E-F, 3 and 4.

After 3 hours, the cells were washed and transferred to a 6 cm Petri dish for culturing with medium changes every 7 days, and the supernatant and cell lysate were transferred on days 7, 14, 21 and 28 for RNA extraction. Collected (protocol in FIG. 9). As a control for HCV ser infectivity, HCV (−) PHH isolated from non-tumor liver tissue (as described in ⁴⁵ and Table 1) was inoculated into wells for 3 days to allow cells to adhere and then on day 4 Then, the cells were incubated with HCVser or HCV (−) control serum (blood group AB) for 3 hours. After washing, PHH was further cultured for 5 days, and then cellular RNA extraction was performed. The results show that PHH exposed to HCV ser actually expressed the virus 5′UTR (labeled “+”, left, FIG. 2A), while cells exposed to HCV (−) control serum (labeled “−”). ) Did not express it.

  Viral transcripts could not be detected in either d7 supernatant or d7 cell lysate in post-infection cultures, but in all experiments d14 cell lysates and in 10 out of 18 experiments During the cleansing, it became detectable (right, FIG. 2A; all 18 experiments using hADSC from 8 donors, Table 3). On the other hand, 5'-UTR was consistently detected in both the d21 and d28 supernatants as well as in the cell lysate among all experiments (right, Fig. 2A).

  We also examined HCV-specific minus-strand RNA and found that both d14 and d28 HCV ser-1b-infected hADSCs expressed replication intermediates that were not present in the supernatant. Was confirmed as expected (FIG. 2B). PHH isolated from HCV infected patients was used as a positive control.

For further confirmation, infected hADSCs were spun onto glass slides for sequential immunocytochemistry studies. Cells were first stained with anti-DLK-1 antibody followed by anti-NS5 antibody and hematoxylin on the same section. The results show that d14 HCV ser-1b-infected hADSCs expressed DLK-1 (red label, panel, in contrast to control serum-treated hADSCs that expressed DLK-1 (panel f) but did not express NS5 (panel h). b, FIG. 2C) was actually expressed, indicating that they also expressed NS5 (brown label, panel d, FIG. 2C) consistent with RT-PCR findings. Staining with isotype antibodies rabbit IgG and mouse IgG1 (control of anti-DLK-1 and anti-NS5 antibodies, respectively) demonstrated background color (panels a and c, and e and g, respectively). Since virtually all HCVser-infected DLK-1 ⁺ cells expressed NS5 (panel b vs. d), the tolerance of hADSC to infection of clinical isolates was limited to (one or more) subsets of cells. Instead, it seemed to be a generalized property.

  D14 and d21 HCV ser-hADSCs were also studied with a transmission electron microscope. Compared to hADSCs (panels a and d, FIG. 2D) exposed to HCV (−) control serum, virus particles of about 50-60 nm in diameter were placed outside hADSC (white arrows in panels, panels b and e, 2D) and inside (white arrows in inset, panels c and f, FIG. 2D) could be visualized. Viral particles identified outside the cell are either from double membranes (yellow arrow and enlarged inset, panel b) or electronically dense membrane structures (yellow arrow and enlarged inset, panel e). It was encased in a membrane vesicle. In contrast, the viral particles found in the cells are in free form (yellow squares and enlarged inset, panel c; viral particles indicated by white arrows) without a membrane-like covering, or It was surrounded by a number of round concentric membranes ("onion shape", yellow squares and enlarged inset, panel f; virus particles indicated by white arrows).

In addition to infecting hADSC in suspension (FIG. 2, AD), we also infected hADSC adhered by inoculating hADSC in a 6 cm Petri dish for 1 day. The cells were then dosed with 0.5 moi (1 × 10 ⁵ 5′-UTR replicas for 2 × 10 ⁵ hADSC cells) of HCVser in a final volume of 2 ml for 3 hours. After gentle washing, cells were cultured in 5 ml of fresh medium with medium changes every 7 days (FIG. 10). Supernatant and cell lysate RNA was extracted on days 7, 14, 21 and 28 and subjected to qRT-PCR. The results revealed that in day 7 cell lysates, viral transcripts were consistently detectable despite their absence in the supernatant (left panel versus right panel, FIG. 2E). Furthermore, virus replication in the cell lysate increased most significantly in the second week (left panel, FIG. 2E), but the increase in the supernatant was most prominent one week later, ie in the third week. (Right panel, FIG. 2E).

In order to measure the total viral replica produced by this system, we continuously cultured HCV ser-infected hADSCs without medium change (FIG. 10), and the supernatant was removed at the end of the indicated culture period. It was collected. qRT-PCR confirmed that the most substantial virus release (in the supernatant) occurred in the third week with a total replication number of about 3 × 10 ⁵ / ml after 28 days of culture (FIG. 2F). .

Example 3: hADSC-producing virions are genuine “virions” that exhibit the biological properties of clinical isolates
In order to examine the infectivity of hADSC producing virions (labeled “HCVadsc”), we infected HCVser-1b with pAD hADSC of “donor 1” and on day 21 the supernatant (“HCVadsc (1 ) ”) Was recovered. After filtration through a 0.22 μm pore filter, HCVadsc (1) was used to infect “donor 2” hADSC to make HCVadsc (2), which was subsequently used to “donor 3” hADSC Infected with. The results confirmed that HCVadsc is infectious to naïve hADSCs of various donors with relatively consistent replication efficiency as seen in the initial infection with HCVser (FIG. 3A). Similar observations were made for HCV adsc derived from the supernatant of hADSC initially infected with HCV ser-1a, HCV ser-2a and HCV ser-2b (data not shown).

  We next studied the permissiveness of hADSC at various passages by infecting pAD, p6, p9 and p15 hADSCs with HCV ser-1b, and after 21 days of continuous culture, It was measured. The results showed that p9 and p15 hADSCs had very low levels of viral transcripts in both supernatant and cell lysate, as opposed to p2 and p6 cells (left panel and Right panel, FIG. 3B). Similar observations were made for infection with HCV ser-1a and HCV ser-2a (FIG. 11). In experiments defining DLK-1 expression in naïve [HCV (−)] hADSC, we followed the similar trend that DLK-1 expression was noted for permissibility of HCV infection, from p0 to p6. We found that it was detectable up to, but decreased at p9 and undetectable at p15 (FIG. 3C).

  Moreover, hADSCs do not like genotype 1 or 2 infections (FIGS. 3B and 11). To further investigate this, we infected p5 hADSCs with mixed genotype 2a + 2b HCV ser, collected cells for RT-PCR, and obtained mRNA encoding a genotype-specific core antigen. Detected. In practice, the mixed type 2a + 2b HCVser itself (as a positive control), mRNAs encoding both genotype 2a and 2b core antigens (174 bp and 123 bp, lane “P”, left and right panels, respectively; FIG. 3D), which was also detected in d21 and d56 cell lysates of genotype 2a + 2b infected hADSC. In this experiment, cells administered HCV (−) control serum were used as negative controls (labeled “N”). Thus, hADSC tolerance to infection by clinical isolates is genotype-crossing for at least genotypes 1a, 1b, 2a and 2b.

Tetraspanin CD81, LDL-R, SR-B1, epidermal growth factor receptor (EGFR), apolipoprotein (Apo) E, occludin, claudin-1, Neimanpic C1-like 1 (NPC1L1) cholesterol absorption receptor and diacylglycerol acetyl Host factors including transferase 1 (DGAT-1) have been shown to mediate HCV infection / replication in human hepatocytes or hepatoma cell lines, either at the viral attachment or post-attachment stage ^{15 16, 19, 53-58} . We examined the expression of these molecules in hADSC by flow cytometry or RT-PCR.

  Flow cytometry revealed that hADSCs of p0 (ie adherent SVF cells), p2 and p6 clearly express CD81, LDL-R, SR-B1 and EGFR (FIG. 3E). RT-PCR also confirmed that mRNA encoding occludin (OCLN), claudin-1 (CLDN1) and NPC1L1 was expressed, but miR-122 was not expressed (FIG. 3F left). In contrast, miR-122 was abundantly expressed in Huh7.5 hepatoma cells (about 60-fold higher than hADSC) and more abundant in PHH (about 2000-fold higher; FIG. 3F right).

To determine the role of these molecules, we performed a hADSC of p2 for 1 hour prior to administration of HCVser-1b, CD81 (clone JS-81), LDL-R (clone C7) or EGFR (clone Pre-treatment with stepwise doses of monoclonal Ab against LA-1) or polyclonal Ab against SR-B1. Various concentrations of anti-ApoE antibody (clone E6D10) for ApoE blockade were added to ¹⁴ HCV (+) serum for 1 hour at room temperature as described before use for infection. From the quantification of viral transcripts in day 21 supernatant, blocking of CD81, LDL-R, SR-B1, EGFR and neutralization of ApoE in HCV (+) serum significantly increased the amount of virus replication in a dose-dependent manner. While the treatment itself did not significantly affect cell viability (FIG. 3G). A similar dose response reduction of cell lysate virus replicas was also observed (FIG. 12).

We have also transfected p2 hADSC with siRNA specific for occludin or claudin-1 prior to infection with HCV ser-1b, or for ¹⁵ , ¹⁶ NPC1L1 as described Transfected in separate experiments. We also investigated the role of DGAT-1, a ¹⁹ molecule important for HCV production in hepatocellular cell lines, required for transport of HCV nucleocapsid core into lipid droplets. RT-PCR confirmed the effect of mRNA knockdown (Figure 13), which then reduced viral replication in the supernatant (Figure 3H) and cell lysate (Figure 13) after 21 days of culture. .

  Finally, the present inventors examined the inhibitory effect of antiviral drugs. Cells of p4-5 were inoculated into wells, exposed to HCV ser-1b, and graded concentrations of antiviral drugs including ribavirin, telaprevir or cyclosporin A (cyclophilin A inhibitor) were added to the medium. For IFNα treatment, hADSC was pretreated with the indicated dose of IFNα for 16 hours and then incubated with HCV ser. Viral transcripts in day 21 cell lysates were then measured and calculated as fractional inhibition compared to cells treated with vehicle control. The results demonstrated that HCV replication is dose-responsively inhibited by ribavirin, telaprevir, cyclosporin A and IFNα (FIG. 3I). Cyclophilin A expression in p0, p2 and p6 hADSCs was confirmed in our preliminary experiments (FIG. 14). HCVadsc is therefore a genuine “virion” that exhibits the biological properties of clinical isolates.

Example 4: hADSC is an in vivo HCV reservoir that allows complete HCV replication
To evaluate the physical properties of HCVadsc, we compared the HCVser, HCVcc and HCVadsc buoyant density profiles by ⁴³ equilibrium centrifugation as described. All viruses studied were derived from genotype 2a. ^Consistent with previous reports ⁴³ , 59, 60, HCV ser had large amounts of RNA in the lower density fractions of 1.039 (fraction 2) and 1.080 (fraction 7), but HCVcc In this case, a peak was found at 1.132 (fraction 13; FIG. 4A). The highest amount of RNA on HCVadsc was found at a density of 1.080 (fraction 7), followed by two peaks at higher densities 1.124 and 1.156 (fractions 12 and 15). Interestingly, the HCVadsc 1.080 peak was identical to the HCVser peak (FIG. 4A). Thus, the physical properties of HCVadsc are similar to clinical isolates rather than HCVcc.

  We also determined lipid and apolipoprotein (Apo) profiles for each major fraction, including HDL, VLDL / LDL, and ApoE and ApoB. HCVser appeared to have the highest total lipid content compared to HCVcc and HCVadsc (FIG. 15), but it was not unexpected because the viral growth microenvironment was different (serum vs medium) . Furthermore, expressed as weight (ng) per virus replica, HCVcc fraction 13 had the lowest HDL and LDL / VLDL content (FIG. 4B). Also, the main fraction of HCVser had the highest ApoE content (pg / replicated), followed by HCVadsc and HCVcc fraction 13 having almost no detectable ApoE level (FIG. 4C). Thus, HCVadsc shows higher similarity to HCVser than HCVcc in the virion-related lipid content. Interestingly, ApoB was not detected in any fraction of HCVadsc, suggesting that ApoB, in contrast to ApoE, may not be required for infection in hADSC (FIG. 3G).

  We also compared the infectivity of various viruses to hADSC by infecting pAD hADSC with a JFH1 / HCVcc virus inoculum in addition to HCVser. As a control, HCVcc replication in Huh7.5 cells was performed in parallel. We found that HCVcc-infected hADSCs in either supernatant or cell lysate after 14 or 21 days of culture, in contrast to efficient replication of HCVcc in Huh7.5 cells (FIG. 16). It was found that '-UTR transcripts were hardly produced (FIG. 4D), and HCV ser infection of hADSC exhibited similar replication kinetics (FIG. 4D vs. 3A). Naïve Huh7.5 and HCVcc infected Huh7.5 cell day 21 supernatants and HCVcc infected or HCVser infected hADSC supernatants were collected for RNA extraction and subjected to RT-PCR. The results support that no viral transcripts were detected in HCVcc-infected hADSC supernatants, in contrast to Huh7.5 HCVcc infection and hADSC HCVser infection (lanes 2 and 4, respectively, FIG. 4E). (Lane 3, FIG. 4E).

Next, the inventors examined the infectivity of HCV adsc to naive PHH. ⁴⁵ PHH was isolated from HCV (−) individuals as described and cultured for 3 days (1 × 10 ⁴ cells / dish) to allow cell attachment, after which day 21 of HCV ser-1b infected hADCS culture Were exposed to HCV adsc prepared from the supernatant. Cellular RNA was extracted for RT-PCR 5 days after infection. The results show that HCVadsc-infected PHH is actually virus 5′-UTR (“2” and “2” and “ 3 "and shown to express, FIG. 4F).

Finally, PHHs from three different donors were prepared and seeded in the wells as described above. On day 4, cells were infected with HCV (−) control serum (from 3 different individuals), HCV ser-1b (from 3 separate donors) and the corresponding HCV adsc. HCVser and corresponding HCVadsc were paired and infected with the same batch of PHH. Supernatants were collected 5 days after infection and 5′-UTR replicas were quantified. Exposure of PHH to HCV (−) control serum was used as a negative control. The results showed that infection with ⁶¹ HCV ser resulted in highly variable replication kinetics as previously reported in PHH infection with clinical isolates. Infection with HCVadsc also resulted in an increase in virus titer, which was as highly variable as in the case of HCVser infection (FIG. 4G). These findings confirmed the infectivity of HCVadsc to hepatocytes.

  In summary, hADSC is an in vivo HCV-bearing host that allows complete HCV replication and represents a previously unrecognized location for clinical HCV-host interactions. In addition, hADSC is the first non-liver primary cell type that allows in vitro growth of clinical HCV isolates, which can be a new tool for reading the life cycle of HCV and developing antiviral strategies Can promote.

  All publications and patents mentioned in this specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it is to be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in cell culture, molecular biology, biochemistry, or related fields are intended to be within the scope of the following claims. Has been.

(References)
1. Lindenbach, B.M. D. And Rice, C.I. M.M. Unravelling hepatitis C virus replication from genome to function. Nature 436, 933-938 (2005).
2. Scheel, T .; K. And Rice, C.I. M.M. Understanding the hepatitis C virus life cycle pave the way for high effective therapies. Nature Medicine 19, 837-849 (2013).
3. Blackard, J.M. T.A. Kemmer, N .; And Sherman, K .; E. Extrahepatic replication of HCV: insights into clinical manifestations and biologic consequences. Hepatology 44, 15-22 (2006).
4). Laporte, J. et al. Et al., Differential distribution and internal translation efficiency of hepatitis C virus quasispecies present in dendritic and liver cells. Blood 101, 52-57 (2003).
5. Wilkinson, J.M. , Radkowski, M .; And Laskus, T .; Hepatitis C virus neuroinvasion: identification of infected cells. Journal of virology 83, 1312-1319 (2009).
6). Letendre, S.M. Pathogenesis of hepatitis C virus coinfection in the brains of patents affected with HIV. J Infect Dis 196, 361-370 (2007).
7). Lohmann, V.M. And Bartenschlager, R.A. On the history of hepatitis C virus cell culture systems. Journal of medicinal chemistry 57, 1627-1642 (2014).
8). Yang, D.D. Complete replication of hepatitis B virus and hepatitis C virus in a newly developed hepatoma cell line. Proc Natl Acad Sci USA 111, E1264-1273 (2014).
9. Bunnell, B.M. A. , Flaat, M .; Gagliadi, C .; Patel, B .; And Ripol, C.I. Adipose-derived stem cells: isolation, expansion and differentiation. Methods 45, 115-120 (2008).
10. Oertel, M.M. Purification of fetal liver stem / progenitor cells containing all the repopulation potential formal rat liver. Gastroenterology 134, 823-832 (2008).
11. Abdallah, B.M. M.M. Regulation of human skeleton chemical cells differentiation by DLK1 / Pref-1. Journal of bone and minor research: the official journal of the American Society for Bone and Mineral Research 19, 841-852 (2004).
12 Yoshimura, K .; Characteristic of freshly isolated and cultured cells derived from the faty and fluid fractions of lipospilation ascites. J Cell Physiol 208, 64-76 (2006).
13. Lin, S .; D. , Wang, K .; H. And Kao, A .; P. Engineered adipose tissue of predefined shape and dimensions from human adipose-derived messenger stem cells. Tissue Eng Part A 14, 571-581 (2008).
14 Jammert, B.M. Very-low-density lipoprotein (VLDL) -production and hepatitis C virus-replicating HepG2 cells secret no more lipopolyparticulates HANDL Journal of virology 87, 5065-5080 (2013).
15. Owen, D.M. M.M. Huang, H .; Ye, J .; And Gale, M .; , Jr. Apolipoprotein E on hepatitis C virion facilities influencing through interaction with low-density lipoprotein receptor. Virology 394, 99-108 (2009).
16. Sainz, B.M. , Jr. Identification of the Niemann-Pick C1-like 1 cholesterol abstraction receptor as a new hepatitis C virus entry factor. Nature Medicine 18, 281-285 (2012).
17. Dorner, M.M. Et al. A genetically humanized mouse model for hepatitis C virus infection. Nature 474, 208-211 (2011).
18. Krapivner, S.M. DGAT1 particulates in the effects of HNF4A on hepatic section of triglyceride-rich lipoproteins. Arteroscler Thromb Vasc Biol 30, 962-967 (2010).
19. Herker, E .; Efficient hepatitis C virus particle formation requirements diacylglyceryl acyltransferase-1. Nature Medicine 16, 1295-1298 (2010).
20. Kaul, A .; Et al., Essential role of cyclophilin A for hepatitis C virus replication and virus production and possessive link to polycleavage kinetics. PLoS Pathog 5, e1000546 (2009).
21. Smas, C.I. M.M. And Sul, H .; S. Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73, 725-734 (1993).
22. Lee, K.M. Inhibition of adipogenesis and development of glucose intolerance by soluble preadipositate factor-1 (Pref-1). The Journal of clinical incubation 111, 453-461 (2003).
23. Gesta, S .; Tseng, Y .; H. And Kahn, C.I. R. Developmental origin of fat: tracking obesity to its sources. Cell 131, 242-256 (2007).
24. Wang, Y .; And Sul, H .; S. Pref-1 regulates mesenchymal cell commitment and differentiation through Sox9. Cell Metab 9, 287-302 (2009).
25. Gimble, J. et al. M.M. Katz, A .; J. et al. And Bunnell, B .; A. Adipose-derived stem cells for regenerative medicine. Circulation research 100, 1249-1260 (2007).
26. Mizuno, H.M. Tobita, M .; And Uysal, A .; C. Consiste review: Adipose-delivered stem cells as a novel tool for future regenerative medicine. Stem Cells 30, 804-810 (2012).
27. Parsons, C.I. H. Szomju, B .; And Kedes, D .; H. Susceptibility of human fetal mesenchymal stem cells to Kaposi sarcoma-associated herpesvirus. Blood 104, 2736-2738 (2004).
28. Avanzi, S.M. Susceptibility of human patient-derived mesenchymal / stem cells to human herpes virus infection. PloS one 8, e71412 (2013).
29. Solid, M.M. A. Perivascular structural cells as a potential researcher of human cytomegalovirus. American journal of translation: the American Society of Transplantation and the American Society of Trans.
30. Khatri, M .; And Saif, Y .; M.M. Influenza virus infects bone mares messennial stromal cells in vitro: implications for bone marrow plantation. Cell translation 22, 461-468 (2013).
31. Gibellini, D.G. HIV-1 and recombinant gp120, the the survival and differentiation of human vessel wall-derived mestemeral cells. Retrovirology 8, 40 (2011).
32. Ma, R .; Hepatitis B virus infection and replication in human bone marshall chem chem stem cells. Virology journal 8, 486 (2011).
33. Rodbell, M.M. Metabolism of isolated fat cells. II. The similar effects of phospholipase C (Clostridium perfringens alpha toxin) and of insulin on glucose and amino acid metabolism. J Biol Chem 241, 130-139 (1966).
34. Eto, H .; Characterization of structure and cellular components of aspirated and excited adipose tissue. Plast Reconstr Surg 124, 1087-1097 (2009).
35. Bukh, J .; Purcell, R .; H. And Miller, R .; H. Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proc Natl Acad Sci USA 89, 187-191 (1992).
36. Shimizu, Y .; K. Feinstone, S .; M.M. , Kohara, M .; Purcell, R .; H. And Yoshikura, H .; Hepatitis C virus: detection of intracellular particles by electron microscopy. Hepatology 23, 205-209 (1996).
37. Okamoto, H .; Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and intracting infectivity. J Gen Virol 73 (Pt 3), 673-679 (1992).
38. Toniuto, P.A. Discordant results from hepatitis C virus genetyping by procedures based on amplification of genomic regions. J Clin Microbiol 34, 2382-2385 (1996).
39. Jopling, C.I. L. Yi, M .; Lancaster, A .; M.M. Lemon, S .; M.M. And Sarnow, P .; Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science 309, 1577-1581 (2005).
40. Al-Sadi, R.A. Et al., Occludin regulates macromolecule flux the cross epithelial epilithic junction junction. Am J Physiol Gastrointest Liver Physiol 300, G1054-1064 (2011).
41. Jiang, J. et al. Hepatitis C virus attachment medium by by apoprotein E binding to cell surface heparan sulfate. Journal of virology 86, 7256-7267 (2012).
42. Kato, T .; Cell culture and effect system for hepatitis C virus. Nature protocols 1, 2334-2339 (2006).
43. Lindenbach, B.M. D. Complete replication of hepatitis C virus in cell culture. Science 309, 623-626 (2005).
44. Lindenbach, B.M. D. Cell culture-grown hepatitis C virus is infectious in vivo and can be reconstructed in vitro. Proc Natl Acad Sci United States 103, 3805-3809 (2006).
45. Bhogal, R.A. H. Et al., Isolation of primary human hepatocytes from normal and dissipated live tissue: a one hindered river experience. PloS one 6, e18222 (2011).
46. Clark, J. et al. M.M. , Blancati, F .; L. And Diehl, A .; M.M. Nonalcoholic fatty liver disease. Gastroenterology 122, 1649-1657 (2002).
47. Negro, F.A. Mechanisms and signature of liver steatosis in hepatitis C virus infection. World journal of gastroenterology: WJG 12, 6756-6765 (2006).
48. Adinolfi, L .; E. Steatosis accelerates the progression of liver damage of chronic hepatitis C patents and correlates with the specific HCV genotypes and visci. Hepatology 33, 1358-1364 (2001).
49. Kapadia, S .; B. And Chisari, F .; V. Hepatitis C virus RNA replication is regulated by host geranygeranylation and fatty acids. Proc Natl Acad Sci USA 102, 2561-2566 (2005).
50. Mankouri, J. et al. Enhanced hepatitis C virus genome replication and lipid accumulation mediumd by inhibition of AMP-activated protein kinase. Proc Natl Acad Sci United States 107, 11549-11554 (2010).
51. Royer, C.I. Et al. A study of susceptibility of primary human Kupffer cells to hepatitis C virus. Journal of hepatology 38, 250-256 (2003).
52. Olson, L.M. E. And Soriano, P .; Dev PDGFRbeta signaling registrations manual cell plasticity and inhibits fat development. Dev Cell 20, 815-826 (2011).
53. Pileri, P.M. Binding of hepatitis C virus to CD81. Science 282, 938-941 (1998).
54. Molina, S.M. Serum-delivered hepatitis C virus infection of primary human hepatocytes is tetraspanin CD81 dependent. Journal of virology 82, 569-574 (2008).
55. Ploss, A.M. Human occludin is a hepatitis C virus entry factor required for infusion of mouse cells. Nature 457, 882-886 (2009).
56. Evans, M.M. J. et al. Claudin-1 is a hepatitis C virus co-receptor required for a late step in entry. Nature 446, 801-805 (2007).
57. Liu, S .; Et al. Human apolipoprotein E peptides inhibitor hepatitis C virus entry by blocking virus binding. Hepatology 56, 484-491 (2012).
58. Lupberger, J. et al. EGFR and EphA2 are host factors for hepatitis C virus entry and possible targets for antiviral therapy. Nature medicine 17, 589-595 (2011).
59. Kanto, T .; Et al. Buyantity of hepatitis C virus recovered from infected festiveness qualification. Hepatology 19, 296-302 (1994).
60. Bartenschlager, R.A. Frese, M .; And Pietschmann, T .; Novell insight into hepatitis C virus replication and persistence. Adv. Virus Res. 63, 71-180 (2004).
61. Gondeau, C.I. In vitro infection of primary human hepatocytes by HCV-positive ser: insights on a high relevant model. Gut (2013).

Claims (18)

  A system based on human adipose-derived stem cells (hADSC) for propagating hepatitis C virus (HCV), comprising hADSC, a medium suitable for culturing hADSC, and HCV.   The system according to claim 1, wherein the hADSC is a primary cell or a passage cell, preferably a 1st to 15th passage cell, more preferably a 1st to 6th passage cell.   The system according to claim 1 or 2, wherein the HCV is derived from blood, serum, plasma or body fluid of an individual infected with HCV or is a clinical HCV isolate.   The HCV is genotype 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, 4i, 4j, The system according to any one of claims 1 to 3, which is 5a and 6a or any combination thereof, preferably genotype 1a, 1b, 2a, 2b or mixed type 2a + 2b.   The system according to claim 1, wherein the system supports complete replication of HCV.   A method of growing hepatitis C virus (HCV), comprising using hADSC to grow HCV in a medium suitable for culturing hADSC under conditions suitable for HCV replication.   7. The method according to claim 6, wherein the hADSC is a primary cell or a passage cell, preferably a 1st to 15th passage cell, more preferably a 1st to 6th passage cell.   The method according to claim 6 or 7, wherein the HCV is derived from blood, serum, plasma or body fluid of an individual infected with HCV or is a clinical HCV isolate.   The HCV is genotype 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, 4i, 4j, 9. A method according to any one of claims 6-8, wherein 5a and 6a, or any combination thereof, preferably genotype 1a, 1b, 2a, 2b or mixed type 2a + 2b.   10. A method according to any one of claims 6 to 9, wherein the method supports complete replication of HCV.   Use of hADSC for HCV growth, or performing an HCV life cycle analysis, or diagnosing HCV infection, or selecting antiviral compounds, or characterizing HCV in a subject infected with such HCV.   HADSCs in the manufacture of kits for the diagnosis of HCV infection, or the propagation of HCV, or the performance of an HCV life cycle analysis, or the selection of antiviral compounds, or the characterization of HCV in subjects infected with such HCV use. A method for diagnosing HCV infection in a subject comprising:
a) providing hADSC;
b) incubating hADSC with a biological sample obtained from the subject in a medium suitable for culturing hADSC;
c) culturing the hADSC for a time sufficient to allow HCV replication; and d) detecting the level of HCV replication;
The method wherein detection of HCV replication indicates that the subject is infected with HCV.   The method according to claim 13, wherein the biological sample is derived from blood, serum, plasma or body fluid. A method for selecting an anti-HCV compound comprising:
a) contacting hADSC in the medium in the first container with HCV in the absence of a candidate compound;
b) determining the level of HCV in the medium in the first container in the absence of the candidate compound;
c) contacting hADSC in the medium in the second container with HCV in the presence of the candidate compound;
d) determining the level of HCV in the medium in the second container in the presence of the candidate compound;
e) comparing the level of HCV in the presence of the candidate compound with the level of HCV in the absence of the candidate compound; and f) the level of HCV in the presence of the candidate compound Identifying the candidate compound as an anti-HCV compound when lower than the HCV level in the absence.   16. The method of claim 15, wherein the level of HCV is determined by measuring HCV titer, HCV nucleic acid level, or HCV polypeptide level.   The candidate compound is at least one selected from the group consisting of a chemical compound, protein, peptide, peptidomimetic, antibody, nucleic acid, antisense nucleic acid, shRNA, ribozyme, and small molecule chemical compound. The method described in 1.   The HCV is genotype 1a, 1b, 2a, 2b, 2c, 2d, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, 4i, 4j, 18. At least one HCV genotype selected from the group consisting of 5a and 6a or any combination thereof, preferably the group consisting of genotypes 1a, 1b, 2a, 2b and mixed types 2a + 2b. The method of any one of these.

Images