JP2016030755A - Hepatocyte growth promoter comprising mesothelial cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a hepatocyte growth promoter, a fibrinolytic agent, a tissue repair agent, an antiadhesive agent and others.SOLUTION: The present invention provides a hepatocyte growth promoter, a fibrinolytic agent, a tissue repair agent, an antiadhesive agent and others comprising a mesothelial cell. The hepatocyte growth promoter, fibrinolytic agent, tissue repair agent, antiadhesive agent and others according to the present invention are formed into preparations as a cell sheet, a cell suspension agent, a cell containing gel and others.SELECTED DRAWING: Figure 3B

Description

  The present invention relates to a hepatocyte growth-promoting agent containing mesothelial cells, a fibrinolytic agent, a fibrin embolism therapeutic agent, a tissue repair agent, a tPA and / or PAI-1 expression enhancer, an adhesion inhibitor, and the like.

As a treatment method for liver cancer with a high recurrence rate, “repetitive hepatectomy” is considered to be the most effective method that can be expected to prolong survival or be cured, and is widely implemented. However, repeated hepatectomy has problems with postoperative adhesions. When postoperative adhesions occur, it is necessary to first remove the adhesions when hepatectomy is performed again, but this increases the risk of prolonged operation time, increased bleeding, and increased complications such as infections. .
Adhesion is a phenomenon that always occurs after abdominal surgery regardless of age, sex, or race, and occurs not only in the liver but also in various places, and may cause intestinal obstruction, chronic pelvic pain, abdominal pain, infertility, and the like.

Various treatments and prevention methods have been proposed so far for post-operative adhesions, which are considered to occur at a high rate of 93 to 100% after surgery, even if they are even light in degree. For example, detachment of adhesions by laparotomy or laparoscopic re-operation can be mentioned, but the former places an excessive burden on the patient, and the latter requires advanced techniques from the operator. In addition, there is a problem that new adhesion resulting from re-operation itself may occur.
Attempts have also been made to reduce postoperative adhesions by medication, but at the present time little effect has been observed.
Currently, the most common countermeasure for postoperative adhesion is the application of an absorbable anti-adhesive agent using a polymer material. It has been reported that the degree of adhesion is reduced by applying an absorbable anti-adhesive agent (Non-patent Document 1). However, recent meta-analysis has revealed that the frequency of intestinal obstruction itself does not decrease, and that the frequency of intraabdominal abscess and suture failure increases (Non-Patent Documents 2 and 3). Further, it has been pointed out that the absorbable anti-adhesive agent may inhibit wound healing and may increase the risk of postoperative bile leakage when used in the liver.

  In addition, in repeated hepatectomy, in addition to the problem of adhesion, there is also a problem that the reserve capacity of the remaining liver is reduced. Since the decrease in reserve ability leads to liver failure, there is a problem in that the number of resections and the range of resection can be limited.

  Furthermore, in order to solve the problems associated with repeated hepatectomy, methods for promoting hepatocyte proliferation, dissolving blood coagulation / clots / thrombi etc. with fibrin produced by injury, and repairing tissues are also required. Has been.

Fazio, VW. Et al., Dis ColonRectum, 49, 1-11, 2006 Tang, CL. Et al., Ann Surg., 243, 449-455, 2006 Zeng, Q. et al., World J Surg., 31, 2125-2131, 2007

  An object of the present invention is to provide means capable of solving various problems associated with repeated hepatectomy, specifically, a hepatocyte growth promoter, a fibrinolytic agent, a tissue repair agent, an adhesion inhibitor, and the like.

As a result of repeated studies to solve the above-mentioned problems, the present inventors have found that mesothelial cells have the effect of preventing the adhesion of dissection surfaces of tissues caused by surgery or the like, and the proliferation of surrounding hepatocytes. And the present invention has been found to have a fibrinolytic action and a tissue repair action by promoting the expression of tPA and PAI-1 in surrounding cells.
That is, the present invention
[1] Hepatocyte proliferation promoter containing mesothelial cells;
[2] The hepatocyte proliferation promoter according to [1] above, further comprising basic fibroblast growth factor (bFGF) and oncostatin M;
[3] The hepatocyte proliferation promoter according to [1] or [2] above, wherein the mesothelial cells are hepatic mesothelial cells;
[4] The hepatocyte proliferation promoter according to any one of [1] to [3] above, wherein the mesothelial cells are derived from fetus to infant or differentiated from stem cells;
[5] The hepatocyte proliferation promoter according to any one of [1] to [4], which is formulated as a cell sheet, a cell-containing gel, or a cell suspension;
[6] A fibrinolytic agent containing mesothelial cells;
[7] A therapeutic agent for fibrosis or fibrin embolism containing mesothelial cells;
[8] A tissue repair agent containing mesothelial cells;
[9] The tissue repair agent according to [8] above, wherein the tissue repair is dissolution and removal of damaged tissue;
[10] tPA and / or PAI-1 expression enhancer containing mesothelial cells;
[11] The agent according to any one of [6] to [10], wherein the mesothelial cells are liver mesothelial cells;
[12] The agent according to any one of [6] to [10] above, wherein the mesothelial cells are derived from an individual from a fetus to an infant, or differentiated from stem cells;
[13] The agent according to any one of [6] to [12], which is used for a liver;
[14] The agent according to any one of [6] to [13], which is formulated as a cell sheet, a cell-containing gel, or a cell suspension;
[15] An adhesion-preventing agent comprising mesothelial cells and formulated as a cell-containing gel or cell suspension;
[16] An anti-adhesion agent comprising mesothelial cells and having an anti-adhesion effect that lasts for 1 year or more, or 1 year and more;
[17] The anti-adhesion agent according to [15] or [16] above, wherein the mesothelial cells are hepatic mesothelial cells;
[18] The adhesion-preventing agent according to any one of [15] to [17] above, wherein the mesothelial cells are derived from a fetus to an infant or differentiated from stem cells; 19] The anti-adhesion agent according to any one of [15] to [18], which is used for prevention of adhesion at a separated surface after partial hepatectomy or prevention of peritoneal adhesion, and can maintain an adhesion prevention effect for a long period of time.
About.

  According to the hepatocyte growth promoter, fibrinolytic agent, anti-adhesion agent and the like according to the present invention, after the operation such as partial hepatectomy, it is possible to prevent adhesion and prevent blood coagulation / It can dissolve blood clots and blood clots and promote liver regeneration. Effects such as adhesion prevention, blood coagulation / clot / thrombus dissolution, hepatocyte proliferation, and liver regeneration can also be obtained for purposes not related to surgery such as hepatectomy.

FIG. 1A shows an overview of a conventional partial hepatectomy (PHx) and our method (PPHx) for mouse liver. In the PPHx method, a cross section is formed. FIG. 1B shows a hepatic section of C57BL / 6J mice with the liver partially excised by the PPHx method. The right panel is an enlarged view of the left panel. The separated section is a portion surrounded by a dotted line. FIG. 1C shows adhesion in the hepatic section 10 days after surgery. The separated section is a portion surrounded by a dotted line. FIG. 1D is a tissue finding of the adhesion site. HE staining was performed on the liver section 10 days after the operation. The scale bar indicates 100 μm. FIG. 1E shows the adhesion rate at 10 days, 30 days, and 548 days after surgery (mean ± SD. N = 5 at 10 days and 30 days after surgery, n = 3 at 548 days after surgery, * p <0.05). Indicates. FIG. 2A shows the morphology of primary cultured fetal liver mesothelial cells, peritoneal mesothelial cells, and fibroblasts isolated from GFP transgenic mice. The cultured cells were observed with a phase contrast microscope. The scale bar indicates 100 μm. FIG. 2B shows cells transferred to a temperature responsive culture dish. By low-temperature treatment, the cells were completely detached from the culture dish as a sheet. FIG. 2C shows an overview of cell sheet transplantation. The upper panel shows the implantation of the sheet into the hepatic section formed by PPHx. The lower panel shows the observation of fluorescence of the hepatic section with a cell sheet expressing GFP immediately after PPHx. The separated section is a portion surrounded by a dotted line. FIG. 2D shows a comparison of adhesion rates (mean ± SD, n = 5, ** p <0.01 (relative to cell sheet (−)) in the four groups with or without cell sheet on day 10 after surgery. . FIG. 2E shows adhesion of the hepatic section at 30 days after surgery. The right panel is an enlarged view of the left panel. The separated section is a portion surrounded by a dotted line. FIG. 2F shows a fetal liver mesothelial cell graft in the hepatic section, 30 days after surgery. The GFP signal was detected orally (left panel). The right panel shows a vertical section of a cut liver leaf and fetal liver mesothelial cell sheet stained with anti-GFP antibody. The scale bar indicates 100 μm. FIG. 2G shows the results of measuring the relative amount of PCLP1 mRNA expression in primary cultured fetal liver mesothelial cells, peritoneal mesothelial cells, and fibroblasts by qRT-PCR (average of three independent experiments ± SD. ** p <0.01). FIG. 2H shows the results of measuring the expression level of fibrinolytic system-related genes. On the first day after the operation, a liver section including a separation surface was collected. Relative tPA and PAI-1 mRNA expression levels were measured by qRT-PCR (mean ± SD, n = 5, * p <0.05). FIG. 3A shows a comparison of hepatocyte proliferation in the three groups. On day 3 after the operation, Ki67 fluorescent staining was performed on liver sections collected from the left lobe of the non-transplanted group, the fetal liver mesothelial cell sheet transplanted group, and the peritoneal mesothelial cell sheet transplanted group. FIG. 3B shows the quantification of Ki67 positive hepatocytes in the left lobe 3 days after surgery by imaging cytometry. Black bars indicate Ki67-positive cells in the area away from the separation plane, and white bars indicate Ki67-positive cells in the area adjacent to the separation section (mean ± SD. N = 5. * P <0.05, ** p <0.01). FIG. 3C shows the results of measuring the relative mRNA expression levels of HGF, IL-6, HB-EGF, Mdk, and Ptn in cultured fetal liver mesothelial cells and cultured peritoneal mesothelial cells by qRT-PCR. (Mean ± SD. Representative examples from 3 independent experiments are shown. ** p <0.01). FIG. 3D shows an overview of the co-culture system. Primary adult hepatocytes were co-cultured with fetal liver mesothelial cells in transwells. Fetal liver mesothelial cells were isolated from E12.5 mice and expanded in vitro in the presence of bFGF and OSM. Hepatocyte proliferation in the co-culture system was measured by WST-1 assay (mean ± SD. N = 3. ** p <0.01 (control). ++ p <0.01 (control)) . FIG. 3E shows the serum albumin concentration on the third day after surgery (mean ± SD, n = 5, * p <0.05). FIG. 3F shows serum albumin concentrations on the days indicated after PPHx (mean ± SD. N = 5 (n = 4 on the 10th day after peritoneal mesothelial cell transplantation group). * P <0.05. * * p <0.01 (for day 0 after surgery)). FIG. 4A shows the fetal liver mesothelial cell sheet prepared from the GFP transgenic mouse of C57BL / 6J mouse, transplanted to BALP / c mouse, FVB / NJcl mouse, and C3H / H3JJcl mouse, and adhesion after 30 days. It is the result of comparing the rates (mean ± SD, n = 5, ** p <0.01). FIG. 4B shows the result of measuring Ki67 positive hepatocytes in the left lobe on the third day after surgery in an experiment similar to FIG. 4A by imaging cytometry. Bars indicate the percentage of Ki67 positive cells in the area away from the separation plane (mean ± SD, n = 5, * p <0.05). FIG. 5 shows the time course of liver injury after PHx or PPHx. ALT and AST levels were measured on the days indicated (mean ± SD, PHx n = 4, PPHx n = 6). FIG. 6 shows the results of comparing the adhesion rate of 30 days after surgery for the four groups (mean ± SD, n = 5, * p <0.05 (vs. cell sheet (−))). FIG. 7 shows liver regeneration on the second day after PPHx. For the non-transplanted group, fetal liver mesothelial cell transplanted group, and peritoneal mesothelial cell transplanted group, Ki67 immunofluorescence staining was performed on liver sections of the left lobe on the second day after the operation. Nuclei were stained with Hoechst33342 and the cell periphery was counterstained with Alexa Fluor 488 phalloidin. Ki67 positive cells were quantified by imaging cytometry. Black bars indicate Ki67 positive cells in the area away from the separation plane, and white bars indicate Ki67 positive cells in the area adjacent to the separation plane.

(Mesothelial cells)
As used herein, “mesothelial cell” refers to a monolayer cell that covers the outermost surface of the mesothelium (patterned tissue covering the surface of a body cavity such as the chest cavity, pericardium, abdominal cavity). The mesothelium refers to a patterned tissue that covers the surface of a body cavity such as the thoracic cavity, pericardium, or abdominal cavity. In the present specification, the term “mesothelial cell” includes mesothelial progenitor cells.

  Mesothelial cells may be isolated from tissues or organs such as the peritoneum, mesentery, testicular sheath membrane, pleura, pericardium, liver, heart, lung, large intestine, etc. Stem cells ( For example, it may be obtained by differentiating iPS cells or ES cells) or obtained by direct reprogramming from fibroblasts.

In the case of isolation from tissues or organs, mesothelial cells may be derived from any fetus or adult, but can be obtained from an individual between the fetus and the infant, for example. Fetal to infant cells are rich in growth factors such as hepatocyte growth factor (HGF) and epidermal growth factor (EGF), which is useful for preventing the adhesion and promoting the regeneration of organs and tissues. In this specification, “promotion of regeneration of organs and tissues” refers to a configuration or function originally possessed by organs or tissues so that all or part of those damaged by surgery or adhesion may be brought back to the original state. It means to recover.
Further, the mesothelial cells may be derived from the same individual as the transplantation target of the adhesion preventing agent, or may be derived from an individual different from the transplantation target.

  When obtained by differentiating from stem cells, mesothelial cells can be prepared by the following method, for example, from iPS cells via mesoderm cells.

Mouse iPS cells Mouse iPS cells can be obtained by introducing three factors into a fibroblast at the tip of a C57BL / 6 mouse with a retroviral vector according to, for example, Cell, 2010, 142, 787-799. Examples of mouse iPS cells established in this way include GT3.2 mouse iPS cells established from EGFP transgenic C57BL / 6 adult mice. .
Cell culture undifferentiated GT3.2 mouse iPS cells can be maintained on a gelatin-coated culture dish without feeder cells in a maintenance medium supplemented with LIF, CHIR99021, and PD0325901. Cell culture can be performed under conditions of 37 ° C. and 5% CO ₂ .
Cell culture media
The iPS cell maintenance medium can have the following composition, for example.
Glasgow Modified Eagle Medium (invitrogen)
10% fetal bovine serum
0.1 mM 2-mercaptoethanol (invitrogen)
0.1 mM non-essential amino acid (invitrogen)
1 mM sodium pyruvate (invitrogen)
1% L-glutamine-penicillin-streptomycin (sigma)
1000 U / ml mouse LIF (Millipore)
1 μM PD0325901 (Wako)
3 μM CHIR99021 (Millipore)
The EB medium can have the following composition, for example.
Glasgow Modified Eagle Medium (invitrogen)
10% fetal bovine serum
0.1 mM 2-mercaptoethanol (invitrogen)
0.1 mM non-essential amino acid (invitrogen)
1 mM sodium pyruvate (invitrogen)
1% L-glutamine-penicillin-streptomycin solution (sigma)
The mesodermal cell culture medium can have the following composition, for example.
MEM alpha + GlutaMAX medium (invitrogen)
10% fetal bovine serum
50 nM 2-mercaptoethanol (invitrogen)
1% L-glutamine-penicillin-streptomycin solution (sigma)
The differentiation medium can have the following composition, for example.
MEM alpha + GlutaMAX medium (invitrogen)
10% fetal bovine serum
50 nM mercaptoethanol, penicillin, streptomycin, glutamine
10 ng / mL basic fibroblast growth factor
10 ng / mL Oncostatin M
Antibodies Antibodies can be used, for example the following.
Anti-mouse biotin PCLP1 antibody (MBL)
Anti-ALCAM antibody (eBioscience)
Anti-rabbit Ki67 antibody (Leica)
Anti-mouse mesothelin antibody
The maintenance medium is replaced with EB medium for the formation of differentiated embryo bodies in vitro from mouse iPS cells to mesothelin cells . After culturing for about 4 days, the cells are cultured in a mesothelial cell culture medium for about 7 days in a culture dish coated with type IV collagen. Subsequently, the medium is replaced with a differentiation medium and cultured for about 5 days.
In order to isolate mesoderm cells derived from GT3.2 mouse iPS cells, GFP, mesothelin, and PCLP1-positive cell fractions may be selected with a cell sorter. After selection, the cells are further cultured in a differentiation medium supplemented with insulin-transferrin-selenium-X in order to differentiate into mesothelial cells.
Finally, to isolate fetal mesothelial cells derived from GT3.2 mouse iPS cells, GFP, PCLP1, and ALCAM positive cells are separated with a cell sorter.

  In the above example, mesoderm cells are differentiated from iPS cells, but the origin of mesoderm cells for producing mesothelial cells used in the present invention is not particularly limited, and from living organisms. It may be extracted or differentiated from pluripotent stem cells. In the present specification, the pluripotent stem cell is a stem cell having pluripotency that can be differentiated into any cell existing in a living body and having proliferative ability. For example, an embryonic stem cell (ES) Cells), embryonic stem cells derived from cloned embryos obtained by nuclear transfer (nuclear transfer embryonic stem cells; ntES cells), sperm stem cells (germline stem cells; GS cells), embryonic germ cells (embryonic germ cells; EG cells), Induced pluripotent stem cells (iPS cells. For example, Takahashi, K. and Yamanaka, S., Cell, 126: 663-676, 2006), cultured pluripotent cells derived from cultured fibroblasts and bone marrow stem cells (Multi-lineage differentiating stress enduring cells; Muse cells) and the like, but are not limited thereto.

  Differentiation from pluripotent stem cells to mesoderm cells can be performed according to a known method. For example, a method via an embryonic body (EB) may be used. Mesodermal cells are characterized by mesodermal cell markers such as, for example, platelet derived growth factor α (PDGFRα), vascular endothelial growth factor 2 (VEGFR2).

In one embodiment, the mesothelial cell is a liver mesothelial cell. Liver mesothelial cells are mesothelial cells that cover the liver surface. In one embodiment, the mesothelial cells are “liver mesothelial cell precursor cells”. Hepatic mesothelial cell progenitor cells are also called fetal (fetal) hepatic mesothelial cells, and are liver mesothelial cells isolated from the fetal liver of about 11 to 13 days of gestation. Also included are cells that have been differentiated in vitro to the same extent as liver mesothelial cells isolated from fetal liver of some degree.
In the present specification, mesothelial cells may be derived from any mammal, and examples thereof include humans, mice, rats, marmosets, rabbits, cats, dogs, monkeys, sheep, pigs, cows, horses, and the like. The hepatic mesothelial cell precursor cells are not limited to these, and corresponding cells can be used.

(Hepatocyte growth-promoting agent)
The “hepatocyte proliferation promoter” according to the present invention includes mesothelial cells. As shown in Examples described later, mesothelial cells have a function of promoting proliferation of surrounding hepatocytes.
As used herein, the term “hepatocyte growth promoter” refers to an agent that promotes the proliferation of hepatocytes when coexisting with hepatocytes in vivo or in vitro as compared with the case of not coexisting. In the case of in vivo, the hepatocyte proliferation promoter according to the present invention promotes the proliferation of hepatocytes by being arranged around the liver, particularly around the isolated section after partial hepatectomy. In the case of in vitro, the proliferation of the hepatocytes of the said cell or liver tissue is promoted by adding to the culture medium which culture | cultivates a hepatocyte or all or a part of liver tissue. The hepatocyte growth promoter according to the present invention may be used as a hepatocyte growth promoter.

In one embodiment, the “hepatocyte growth promoter containing mesothelial cells” according to the present invention may be used together with basic fibroblast growth factor (bFGF) and Oncostatin M. The “hepatocyte growth promoter containing mesothelial cells” according to the present invention may contain basic fibroblast growth factor (bFGF) and oncostatin M.
The concentration of bFGF and oncostatin M can be appropriately determined by those skilled in the art. For example, the concentration of bFGF is 1 ng / mL to 100 ng / mL, 2 ng / mL to 50 ng / mL, 3 ng / mL to 25 ng / mL, It can be 5 ng / mL to 15 ng / mL, about 10 ng / mL. The concentration of oncostatin M can be 1 ng / mL to 100 ng / mL, 2 ng / mL to 50 ng / mL, 3 ng / mL to 25 ng / mL, 5 ng / mL to 15 ng / mL, about 10 ng / mL.
Further, instead of Oncostatin M, components contained in the IL-6 family may be used. Examples of IL-6 family include Cardiotrophin-1, IL-11, Leukemia Inhibitory Factor (LIF), IL-31, ciliary neurotrophic factor (CNTF), cardiotrophin-like cytokine (CLC), and the like.

(Fibrinolytic agents, etc.)
As used herein, the term “fibrinolytic agent” refers to a composition that dissolves blood coagulation, blood clots, and thrombus caused by fibrin produced by disease, trauma, or organ or tissue injury.
The “fibrinolytic agent” according to the present invention includes, for example, thrombosis or thromboembolism (eg, myocardial infarction, cerebral infarction, deep vein thrombosis, pulmonary embolism, portal vein thrombosis, renal vein thrombosis, jugular vein It is also useful as a prophylactic or therapeutic agent for thrombosis and pulmonary thromboembolism.

  In the present specification, the “tissue repair agent” means dissolution and removal of tissues and blood coagulation in a living body damaged by surgery or the like.

  The balance between the coagulation / fibrinolysis system, the blood coagulation action system by fibrin and the action system to dissolve the coagulated blood is based on the relationship with the euglobulin clot dissolution time representing the fibrinolytic activity, tissue plasminogen activator (tPA) And plasminogen activation inhibitory factor (PAI-1) concentration balance, and it is known that when tPA concentration is dominant over PAI-1 concentration, the balance is inclined to the fibrinolytic system (UranoT et al. Thromb Haemost, 2001, 85, p751-752). The present inventors have confirmed that when a mesothelial cell sheet is affixed, the expression of tPA is significantly enhanced in the surrounding tissues and cells over PAI-1. This strongly suggests that mesothelial cells have fibrinolytic activity. In fact, postoperative adhesion is thought to be caused by the fibrinolysis reaction being inhibited and prolonged fibrin deposition, and the mesothelial cell sheet has also prevented fibrinolysis, and mesothelial cells have fibrinolytic activity. I support that.

(Anti-adhesion agent)
In the present specification, the term “adhesion preventive agent” refers to the possibility of adhesion occurring for the purpose of preventing “adhesion”, which is a phenomenon in which organs and tissues that should originally be separated from each other after surgery. A substance placed in an organ or tissue.
As used herein, “preventing” not only completely prevents adhesions but also significantly suppresses adhesions.

  The anti-adhesion agent according to the present invention has an effect that lasts for a long period of time (for example, 1 year or more, or 1.5 years or more) after being placed in an organ or tissue. The anti-adhesion function and the ability to suppress adhesion for a long period of time are considered to be independent phenomena based on another mechanism, and an effect that cannot be predicted by those skilled in the art that the function can be maintained over a long period of more than one year. It is.

The adhesion preventing agent can be used for preventing adhesion and / or promoting regeneration of all organs and tissues (for example, intestine and peritoneum), and is useful, for example, for preventing adhesion on a detached surface after partial hepatectomy. Adipose tissue in the abdominal cavity adheres to the separated surface after partial hepatectomy, and adhesion is likely to occur.
Currently, for primary liver cancer and colorectal cancer liver metastasis, the only treatment that can be expected to cure or prolong life by proactively trying “repetitive hepatectomy” for residual liver recurrence after hepatectomy However, when adhesion occurs, it becomes necessary to remove it during re-operation or re-operation, which increases the risk of massive bleeding and infection. Moreover, since the liver reserve ability also decreases due to adhesion, the number of repetitions is limited, and postoperative liver failure tends to occur.
According to the anti-adhesion agent containing hepatic mesothelial cells, it is possible to significantly prevent adhesion of the separated surface after partial hepatectomy, promote liver regeneration, and prevent a decrease in liver reserve ability.
In the present specification, the “separation plane” refers to a surface that appears when a part of an organ or tissue is excised or removed.

As used herein, “liver reserve ability” means the function of the liver itself. Liver reserve ability can be evaluated by a known method. For example, liver damage classification and Child-Pugh classification are often used.
The degree of liver damage is a method of measuring and evaluating ascites, serum bilirubin, serum albumin, ICG R15, and prothrombin activity. Child-Pugh is a method of encephalopathy, ascites, serum bilirubin, serum albumin, prothrombin activity It is a method of measuring and evaluating.

  In this specification, “liver regeneration is promoted” means improvement of at least one of ascites, serum bilirubin level, serum albumin level, ICG R15, prothrombin activity value, and encephalopathy value; -Improved assessment by Pugh classification; increased liver; increased liver weight; promoted hepatocyte proliferation; and at least one state of increased hepatocyte size achieved That means.

(Formulation)
The hepatocyte proliferation promoter, thrombolytic agent, tissue repair agent, and anti-adhesion agent according to the present invention are not limited in the form of the preparation, but for example, as a cell sheet, a cell-containing gel, or a cell suspension It can be formulated and administered / transplanted.
These preparations may contain components other than cells (for example, but not limited to, a medium, a medium additive, and an extracellular matrix).
In addition, these preparations may contain other cells as long as they contain mesothelial cells. The percentage of mesothelial cells in the total number of cells contained in the cell sheet is, for example, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, 99% or more can do. Mesothelial cells may include mesothelial progenitor cells that differentiate into mesothelial cells.

(Cell sheet)
In the present specification, the “cell sheet” means a sheet mainly composed of cells. As long as it has a sheet shape, the configuration is not particularly limited as long as the effects of the present invention are exhibited, but it may be a single-layer cell sheet, a sheet formed of two or more layers, or a cell that has been three-dimensionally cultured. The sheet | seat formed by may be sufficient. Typically a monolayer cell sheet.

The cell sheet can be produced by a known method for producing a cultured cell sheet or a method analogous thereto.
As an example, mesothelial cells are cultured in a culture dish coated with a temperature-responsive polymer, and when the mesothelial cells become a sheet, they can be recovered from the culture dish by changing the temperature to obtain a cell sheet. . Examples of the temperature-responsive polymer include those whose hydrophilicity changes to hydrophobic when the temperature changes. As the temperature-responsive polymer, a known one or a similar one can be used. Commercially available culture dishes that are pre-coated with a temperature-responsive polymer may be used. By using a culture dish coated with a temperature-responsive polymer, it is possible to obtain a cell sheet that is substantially free of mesothelial cells and does not contain a support.

  The cell sheet can be used by placing it on the surface of a tissue or organ that may cause an affected area or adhesions, or on the cross section.

(Cell-containing gel)
As used herein, “cell-containing gel” refers to a preparation containing cells in a gel. The gel can be placed on the affected area as it is. The material of the gel is not particularly limited as long as the cell-containing gel has desired effects such as hepatocyte growth promotion, thrombolysis, adhesion prevention, etc., and does not adversely affect the living body. For example, alginic acid, hyaluronic acid, chondroitin sulfate Dextran, dextran sulfate, chitosan, cellulose, agarose, and the like can be used. For example, alginic acid can be gelled by ion exchange, and calcium alginate gel can be obtained by adding calcium ions to an aqueous sodium alginate solution.
Further, the extracellular matrix component may be gelled. Examples of extracellular matrix components include collagen, atelocollagen, elastin, proteoglycan, fibronectin, laminin, vitronectin, gelatin and the like. Gelation of the extracellular matrix component can be performed according to a conventional method. For example, in the case of collagen, a collagen gel can be obtained by heating a collagen aqueous solution having an appropriate concentration to 37 ° C. For the gelation of the extracellular matrix, a gelling agent may be used, or a commercially available extracellular matrix such as Matrigel may be used.

  In one embodiment, the cell-containing gel can be produced by the following method. Cultured cells are collected by trypsinization and centrifugation as necessary, and are well suspended in a medium so as to form a single cell. A cell-containing gel can be obtained by mixing this cell suspension with 0.2% atelocollagen containing a medium, heating to 37 ° C. and incubating for 30 minutes. A commercially available gel cell culture kit may be used.

(Cell suspension)
As used herein, “cell suspension” refers to a preparation in which cells are suspended in a solvent. The cell suspension can be administered to the trunk or the like with a syringe or the like. The solvent is not particularly limited as long as the cell suspension exhibits desired effects such as promotion of hepatocyte proliferation, thrombolysis, adhesion prevention and the like, and does not adversely affect the living body. For example, physiological saline can be used.

1. Materials and methods [animal]
Male wild-type C57BL / 6J, BALB / c, C3H / HeJJcl, and FVB / NJcl mice (10 weeks old) were purchased from Nihon CLEA. C57BL / 6J transgenic mice expressing GFP were provided by Dr. Okabe of Osaka University. Embryo growth was counted by the number of days from the day when the vaginal plug appeared, and noon of that day was E0.5. All experiments were approved by the institutional animal care and use committee at the University of Tokyo.

[Practical Partial Hepatectomy (PPHx)]
Standard 70% partial hepatectomy (70% Partial Hepatectomy; 70% PHx) is performed using known methods (Higgins GM and Anderson RM, Arch Pathol 1931; 12: 186-202 .; Mitchell C and Willenbring H, Nature Protocols 2008; 3: 1167-1170.). The PPHx mouse model was prepared as follows. Mice were placed on their backs under general anesthesia. After laparotomy, the root of the middle leaf was ligated with a thread and cut off. Subsequently, the liver capsule around the left lobe was cauterized using an electric knife, and the left lobe was separated in the middle. On the way, the left portal vein and the left hepatic vein were ligated together and separated. Next, the epididymal adipose tissue was lifted up to the upper abdominal cavity and placed on the left cross section of the left lobe. When the abdomen was closed, the epididymal adipose tissue was sewn to the abdominal wall to prevent it from shifting.
The value obtained by dividing the longest diameter of the adhesion part by the longest diameter of the hepatic section was taken as the adhesion rate and measured for each mouse.

[Isolation and culture of primary fetal liver mesothelial cells]
Fetal liver mesothelial cells were isolated from E12.5 GFP transgenic mice according to the method of Onitsuka et al. (Onitsuka, I. et al., Gastroenterology. 138, 1525-1535 (2010)). Briefly, fetal liver tissue was minced and digested with Liver Digest Medium (Life technologies). The digested liver was passed through a 70 μm cell strainer. Hemolysis buffer was added to the flow-through fraction, placed on ice for 5 minutes, and the cells were collected by centrifugation. Cells were incubated with a biotin-conjugated anti-PCLP1 antibody (MBL) followed by incubation with APC-conjugated streptavidin (Invitrogen). Samples were sorted with a cell sorter Moflo XDP (Beckman Coulter), and GFP ⁺ PCLP1 ^high cells were sorted. After sorting, in a culture dish coated with type IV collagen, MEMα medium + GlutaMAX medium (10% fetal calf serum, 50 nmol / L mercaptoethanol, penicillin, streptomycin, and glutamine, 10 ng / mL basic fibroblast growth factor) (BFGF), 10 ng / mL of oncostatin M (OSM), 10 ng / mL of bone morphogenetic protein 7, and insulin-transferrin-selenium-X.) Cultured at 37 ° C., 5% CO ₂ incubator did.

[Isolation and culture of primary adult fibroblasts and primary adult peritoneal mesothelial cells]
Adult fibroblasts were collected from the skin tissue of GFP transgenic mice. The skin tissue was minced and treated with 0.05% trypsin and 0.5 mM EDTA at 37 ° C. for 20 minutes. The cell suspension was centrifuged and resuspended in DMEM medium containing 10% FBS and penicillin, streptomycin, and glutamine.
Adult peritoneal mesothelial cells were collected from epididymal fat of GFP transgenic mice according to the method of Loureiro et al. (Loureiro, J. et al., Nephrol Dial Transplant. 25, 1098-1108 (2010)). Epididymal fat was treated with 0.05% trypsin and 0.5 mM EDTA for 30 minutes at 37 ° C. The cell suspension was centrifuged and the pellet was hemolyzed on ice for 5 minutes. After washing several times with PBS, peritoneal mesothelial cells are resuspended in RPMI1640 medium containing 20% FBS, penicillin, streptomycin, glutamine and hydrocortisone (0.4 μg / mL) and seeded in a culture dish coated with type I collagen did.

[Preparation of cell sheet and transplantation to PPHx mice]
Each primary cultured cell was transferred to an UpCell (registered trademark) plate (Cell Seed) and cultured at 37 ° C. for 4 days. By placing the plate at room temperature, the cells were recovered from the culture dish to obtain a cell sheet.
A cell sheet was transplanted to the liver cross-section of the mouse immediately after the PPHx application, and the abdomen was closed. The GFP signal was detected with a 130S-GFP camera (Science eye).

[Liver function test]
Plasma concentrations of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured with a commercially available kit (Transaminase C2-Test Wako, Wako Pure Chemical Industries, Ltd.). Serum albumin concentration was measured by Oriental Yeast.

(Histochemical analysis)
A frozen section (8 μm) of the left lobe was prepared with a Microm HM505E cryostat (Microm International GmbH) and placed on a slide glass (Matsunami Glass Co., Ltd.) coated with APS. Sections were fixed with PBS containing 4% paraformaldehyde and stained with hematoxylin and eosin (HE).
For immunohistochemical analysis, sections were blocked with PBS containing 5% skim milk for 1 hour and incubated with primary antibody overnight at 4 ° C. As primary antibodies, rabbit anti-mouse GFP antibody and rabbit anti-mouse Ki67 antibody were used. Nuclei were counterstained with Hoechst33342 (Sigma-Aldrich). The outer periphery of the cells was counterstained with Alexa Fluor 488 phalloidin. The signal was visualized with Alexa Fluor 488 donkey anti-rabbit IgG (H + L) or Alexa Fluor 555 goat anti-rabbit IgG (H + L) (Invitrogen).

[Cell size measurement and number of cells grown]
The size of hepatocytes and the number of Ki67 positive hepatocytes were measured according to the method of Miyaoka et al. Using IN Cell Analyzer 2000 (GE Healthcare) (Miyaoka Y. et al., Curr Biol. 22, 1166-1175 (2012) ). About 1600-2000 hepatocytes were examined for each mouse.

[Quantitative RT-PCR]
Total RNA was extracted from the left lobe including each cell sheet or isolated section using TRIzol reagent (Invitrogen) on the first day after surgery, and cDNA was synthesized with High Capacity cDNA Reverse Transcription Kit (Takara Bio). . Quantitative RT-PCR was performed using LightCycler 480 (Roche) and the following primers. Samples were standardized using mouse β-actin and Universal Probe Library Mouse ACTB Gene Assay (Roche).
Mouse PCLP1:
TCCTTGTTGCTGCCCTCT (SEQ ID NO: 1)
CTCTGTGAGCCGTTGCTG (SEQ ID NO: 2)
Mouse HGF:
CACCCCTTGGGAGTATTGTG (SEQ ID NO: 3)
GGGACATCAGTCTCATTCACAG (SEQ ID NO: 4)
Mouse IL6:
GCTACCAAACTGGATATAATCAGGA (SEQ ID NO: 5)
CCAGGTAGCTATGGTACTCCAGAA (SEQ ID NO: 6)
Mouse Mdk:
CGCACTGGTAAAACCGAACT (SEQ ID NO: 7)
GAAGAAGCCTCGGTGCTG (SEQ ID NO: 8)
Mouse Ptn:
AGGACCTCTGCAAGCCAAA (SEQ ID NO: 9)
CACAGCTGCCAAGATGAAAAT (SEQ ID NO: 10)
Mouse β-actin:
CTAAGGCCAACCGTGAAAAG (SEQ ID NO: 11)
ACCAGAGGCATACAGGGACA (SEQ ID NO: 12)
Mouse tPA:
GCTACGGCAAGCATGAGG (SEQ ID NO: 13)
GGACGGGTACAGTCTGACG (SEQ ID NO: 14)
Mouse PAI-1
AGGATCGAGGTAAACGAGAGC (SEQ ID NO: 15)
GCGGGCTGAGATGACAAA (SEQ ID NO: 16)
Mouse HB-EGF
TGATAGCTTTGCGCTGTGAC (SEQ ID NO: 17)
CCAAGGAAGAAGGGCTTTGT (SEQ ID NO: 18)

[Co-culture of fetal liver mesothelial cells and hepatocytes, and WST-1 assay]
Hepatocytes were isolated from the liver of C57BL / 6J adult mice. Briefly, the liver is perfused with Liver perfusion medium (Invitrogen) followed by a basic perfusion solution (10%) containing 0.5 g / l type IV collagenase and 0.25 g / l DNase I (Sigma-Aldrich). % fetal calf serum, 136 mM NaCl, KCl of 5.4 mM, CaCl ₂ of 5 mM, 0.5 mM of _{NaH 2 PO 3 2H 2 O,} Na 2 HPO 3 12H 2 O of 0.42 mM, the 10mM of HEPES pH 7.5, 5 mM Perfused with glucose and 4.2 mM NaHCO ₃ ). The digested liver was chopped and dispersed by pipetting, and then passed through a 70 μm cell strainer. After centrifugation, the pellet was resuspended and the hepatocytes were purified by density gradient centrifugation using 50% percoll. Add MEM alpha + GlutaMAX medium (containing 10% FBS, 50 nM mercaptoethanol, penicillin, streptomycin, glutamine) to each well of a 24-well plate coated with laminin 111, and place 2 x 10 ³ hepatocytes. The cells were cultured in the presence or absence of 1 × 10 ⁵ fetal liver mesothelial cells expanded in vitro. When culturing in the presence of fetal liver mesothelial cells, a transwell (Corning) with a 3.0 μM hole was used. Fetal liver mesothelial cells were expanded and maintained in the presence of 10 ng / mL bFGF and 10 ng / mL OSM. bFGF and OSM were also added to the medium when co-cultured with hepatocytes. Hepatocyte proliferation was performed by the WST-1 assay on the third day from the start of co-culture.

2. Result (Postoperative adhesion model mouse)
As shown in the left of FIG. 1A, the partial hepatectomy model produced by the conventional method (70% PHx) was not exposed as a liver cross-section and could not be used as an adhesion model. According to the method of the present inventors (PPHx), as shown in FIG. 1A right and FIG. In order to examine the degree of liver damage in the PPHx model and the 70% PHx model, plasma concentrations of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured (FIG. 5). In both models, AST concentrations increased on the first day after surgery and decreased on the second day. On the other hand, the ALT concentration peaked on the first day after surgery in the PPHx model and gradually decreased thereafter, but rapidly decreased on the second day in the PHx model. The course of decreasing ALT levels in the PPHx model was similar to that after human hepatectomy.
On the 10th day after the operation, in the PPHx model, severe adhesion of adipose tissue was observed in a wide region of the hepatic section (FIG. 1C). In the PPHx model, a strong adhesion tissue composed of fibroblasts was observed between hepatocytes and adipocytes by HE staining (FIG. 1D). When the value obtained by dividing the longest diameter of the adhesion part by the longest diameter of the hepatic section was calculated as the adhesion rate, it was almost 100% in the C57BL / 6J mouse on the 10th day after the operation (FIG. 1E). Although the adhesion rate decreased to some extent by 30 days after the operation, the same level continued for a long time thereafter, and the adhesion was maintained even after 548 days after the operation. From the above results, the PPHx model was recognized as a model reflecting the healing process of human hepatectomy.

[Prevention of adhesion after PPHx using fetal liver mesothelial cell sheet]
Next, we examined whether fetal liver mesothelial cells can prevent postoperative adhesions in the PPHx model. Using a cell sorter, GFP-positive fetal liver mesothelial cells were isolated from GFP transgenic mice and cultured. As controls, adult peritoneal mesothelial cells and adult dermal fibroblasts were prepared (FIG. 2A). A cell sheet was formed from each cell in a temperature-responsive culture dish (FIG. 2B), and transplanted to the hepatic section of a PPHx model mouse. The GFP signal of the cells was monitored to confirm that the cell sheet adhered correctly to the detached surface (FIG. 2C). Almost no adhesion was observed 30 days after transplantation (FIG. 2E). At 10 and 30 days after surgery, the adhesion rate was significantly reduced in the transplanted group compared to the non-transplanted group, but the adhesion prevention effect was higher in the fetal liver mesothelial cells (FIG. 2D, 2E, 6). The adhesion rate also decreased in the peritoneal mesothelial cell transplant group. On the other hand, the fibroblast transplanted group showed the same degree of adhesion as the non-transplanted group.
In addition, even 30 days after the operation, the GFP signal of the fetal liver mesothelial cell sheet is detected only on the surface of the detached surface, and the fetal liver mesothelial cells infiltrate into other cells or are converted into other cells. It was confirmed that it would not.

[Mechanism of adhesion prevention effect by fetal liver mesothelial cell sheet]
Subsequently, the expression of podocalyxin-like protein 1 (PCLP1) in each cell sheet was examined. PCLP1 is one of the membrane-permeable sialomucin protein families and is known to be highly expressed in fetal liver mesothelial cells (Kerjaschki D. et al. J Cell Biol 1984, 98: 1591-1596. Dekan G. et al. Proc Natl Acad Sci USA 1991; 88: 5398-5402). The expression level of PCLP1 was significantly higher in the fetal liver mesothelial cell sheet and the peritoneal mesothelial cell sheet compared to the fibroblast sheet (FIG. 2G).
In addition, the severity of postoperative adhesion is involved in the fibrinolytic system. For several days after surgery, the fibrinolytic system is controlled and activated by tissue-type plasminogen activator (tPA) and type 1 plasminogen activator inhibitor (PAI-1). The tPA mRNA expression level on the first day after surgery was significantly higher in the fetal liver mesothelial cell sheet transplanted group than in the non-transplanted group (FIG. 2H), but there was no significant difference in the PAI-1 expression level. I couldn't see it. These results suggest that fetal liver mesothelial cells suppress postoperative adhesion by further activating the fibrinolytic system.

[Acceleration of liver regeneration after PPHx by fetal liver mesothelial cell sheet]
It was examined whether fetal liver mesothelial cells or peritoneal mesothelial cells contribute to the regeneration of the remaining liver. To evaluate the degree of cell division, Ki67 fluorescent staining was performed. In each group, hepatocytes entered the cell cycle on the second day after surgery (FIG. 7), and on the third day after surgery, hepatocyte proliferation was more activated (FIGS. 3A and 3B). Hepatocyte proliferation was particularly enhanced in the liver of the fetal liver mesothelial cell transplant group. In addition, hepatocyte proliferation was observed not only on the surface of the separated surface on which the fetal liver mesothelial cell sheet was placed, but also inside the liver away from the separated surface. From these results, the effect of fetal liver mesothelial cell sheets on hepatocytes is not due to direct contact between the cell sheet and the liver, but some soluble factors are released from fetal liver mesothelial cells into hepatocytes. It was also suggested that
Subsequently, the cytokines produced by each cell sheet were analyzed to examine whether they promote liver regeneration (FIG. 3C). The mRNA expression levels of heparin-binding EGF-like growth factor (HB-EGF), midkine (Mdk), and pleiotrophin (Ptn) in fetal liver mesothelial cells were significantly higher than those in peritoneal mesothelial cells. Midkine and pleiotrophin are known to promote liver development and regeneration.
Next, primary hepatocytes were co-cultured with fetal liver mesothelial cells in transwells, and hepatocyte proliferation was monitored by in vitro WST-1 assay (FIG. 3D). In order to maintain fetal liver mesothelial cells during co-culture, bFGF and OSM were added to the medium. As a result, hepatocyte proliferation was significantly promoted in the presence of fetal liver mesothelial cells.
From the above, it was considered that fetal liver mesothelial cells secrete soluble factors such as midkine and pleiotrophin to promote hepatocyte proliferation.

[Functional recovery of liver after PPHx by fetal liver mesothelial cells]
After the operation, serum albumin concentration, which is known as a clinical index of good liver function, was measured for each group of mice. On the third day after the operation, the serum albumin concentration was significantly higher in the fetal liver mesothelial cell transplantation group than in the control group (FIG. 3E). In the fetal liver mesothelial cell transplantation group, the decrease in serum albumin concentration on the third day after the operation was suppressed, and the normal level was recovered on the fifth day after the operation (FIG. 3F).
These results suggest that fetal liver mesothelial cell transplantation significantly improves liver function and promotes regeneration at an early stage after PPHx.

[Suppression of postoperative adhesion and liver regeneration by other fetal liver mesothelial cells]
A GFP-positive fetal liver mesothelial cell sheet derived from a GFP transgenic mouse prepared from C57BL / 6J was prepared and transplanted to BALB / c, FVB / NJcl, and C3H / HeJJcl mice, which are mice of different strains of MHC . Transplantation of fetal liver mesothelial cell sheets significantly reduced the adhesion rate 30 days after surgery in all strains of mice (FIG. 4A). When the proliferation of hepatocytes was examined, the proportion of Ki67-positive hepatocytes in the liver was significantly higher in the BALB / c mice in the fetal liver mesothelial cell sheet transplant group. In the FVB / NJcl and C3H / HeJJcl mice, there was a tendency that the proliferation of hepatocytes was promoted (FIG. 4B).

Claims (19)

  Hepatocyte growth promoter containing mesothelial cells.   The hepatocyte growth promoter according to claim 1, further comprising basic fibroblast growth factor (bFGF) and oncostatin M.   The hepatocyte proliferation promoter according to claim 1 or 2, wherein the mesothelial cells are hepatic mesothelial cells.   The hepatocyte proliferation promoter according to any one of claims 1 to 3, wherein the mesothelial cells are derived from a fetus to an infant individual or differentiated from stem cells.   The hepatocyte growth promoter according to any one of claims 1 to 4, which is formulated as a cell sheet, a cell-containing gel, or a cell suspension.   A fibrinolytic agent containing mesothelial cells.   A therapeutic agent for fibrosis or fibrin embolism containing mesothelial cells.   A tissue repair agent containing mesothelial cells.   The tissue repair agent according to claim 8, wherein the tissue repair is dissolution and removal of damaged tissue.   An agent for enhancing the expression of tPA and / or PAI-1 comprising mesothelial cells.   The agent according to any one of claims 6 to 10, wherein the mesothelial cells are liver mesothelial cells.   The agent according to any one of claims 6 to 10, wherein the mesothelial cell is derived from an infant individual from a fetus or differentiated from a stem cell.   The agent according to any one of claims 6 to 12, which is used for a liver.   The agent according to any one of claims 6 to 13, which is formulated as a cell sheet, a cell-containing gel, or a cell suspension.   An anti-adhesion agent comprising mesothelial cells and formulated as a cell-containing gel or cell suspension.   An anti-adhesion agent comprising mesothelial cells and having an anti-adhesion effect that lasts for one year or more, or one and a half years or more.   The adhesion preventing agent according to claim 15 or 16, wherein the mesothelial cells are liver mesothelial cells.   The adhesion-preventing agent according to any one of claims 15 to 17, wherein the mesothelial cells are derived from an infant individual from a fetus or differentiated from stem cells.   The adhesion preventing agent according to any one of claims 15 to 18, which is used for preventing adhesion at a separated surface after partial hepatectomy or preventing peritoneal adhesion and capable of maintaining an adhesion preventing effect for a long period of time.