JP2014050356A - Differentiation inducer from stem cell to ectodermal cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a composition such as medicine and food to prevent, improve or treat ophthalmic disease or neurological disease of which treatment has been difficult, by finding a substance having an activity to induce differentiation from stem cell to ectodermal cell.SOLUTION: Provided is an inducer of differentiation from stem cell to ectodermal cell, of which effective component is an extract of Chinese black tea.

Description

  The present invention relates to a differentiation-inducing agent from stem cells to ectoderm cells, pharmaceuticals containing the differentiation-inducing agents, quasi-drugs, foods and drinks, and methods for producing ectoderm cells.

  A stem cell is a cell having both multipotency capable of differentiating into various cells and self-proliferation ability capable of maintaining multipotency (undifferentiated state) even after cell division. Among them, somatic stem cells exist in each tissue in the living body, and when the cells of the tissue are lost due to a disorder or disease or aging, the tissue homeostasis is supplied by supplying new cells. Is maintained. In addition, pluripotent stem cells such as ES cells (embryonic stem cells) and iPS cells (artificial pluripotent stem cells) are artificially created stem cells that have the ability to differentiate into all cell types that make up the body. (Multipotency) and unlimited proliferation.

  In recent years, in the field of advanced medicine including regenerative medicine, active researches are being carried out to apply the properties of these stem cells to regeneration of organs and tissues (Non-patent Document 1). For example, the mammalian eye, especially the retina, does not regenerate naturally once damaged. For this reason, there is no cure for retinal degeneration such as retinitis pigmentosa, leading to blindness, and regenerative medicine using stem cells is expected. Against this background, recent advances in stem cell technology have made it possible to induce eye tissues / cells such as the retina (retinal pigment epithelium, nerve retina) and lens from mouse and human ES cells and iPS cells. In the future, it is expected that transplantation of these induced ocular tissues / cells will enable treatment of eye diseases for which there has been no effective therapeutic method (Non-Patent Documents 2 and 3).

  In Japan, there are about 100,000 people with spinal cord injury, and it is said that about 5,000 people are injured every year. In severe cases, the limbs hardly move, and people are forced to live on a bedridden or wheelchair. At present, no effective treatment has been established to restore the function lost by spinal cord injury. The reason for this is that nerve regeneration after injury is very unlikely in the central nervous system. For this reason, regenerative medicine using stem cells is also expected for spinal cord injury, and various differentiation induction techniques from stem cells to the central nervous system have already been established (Non-Patent Document 4). On the other hand, in order to make regenerative medicine using the stem cells a reality, it is essential to develop substances and techniques that efficiently control the differentiation of stem cells into target cells.

  In the development process of vertebrate early embryos, cell lineage differentiation called germ layer formation occurs, and three types of cell populations are formed: ectoderm, mesoderm, and endoderm. Of these, the ectoderm produces nervous system cells, sensory system cells, and epidermis. Therefore, if differentiation and induction of ectoderm, and further cells and tissues derived from ectoderm from stem cells, the possibilities for the treatment of the above eye diseases and spinal cord injury are expanded.

  On the other hand, “black tea” commonly drunk in China is a microbial fermented tea, and its typical pu-erh tea is known to have effects such as fat absorption inhibition. Moreover, although it is reported that the extract of black tea has a blood glucose level raise inhibitory effect (patent document 1), the influence on an undifferentiated stem cell is not examined at all until now.

JP 2002-370994 A

Shinichi Nishikawa et al., Experimental Medicine Extra Number, 2008, 26, No. 5, pp.74-80 Eiraku M, Takata N, Ishibashi H, Kawada M, Sakakura E, Okuda S, Sekiguchi K, Adachi T, Sasai Y. (2011) Nature 7; 472 (7341): 51-6 Osakada F, Jin ZB, Hirami Y, Ikeda H, Danjyo T, Watanabe K, Sasai Y, Takahashi M. (2009) J Cell Sci. 122 (Pt 17): 3169-79 Ueno M, Matsumura M, Watanabe K, Nakamura T, Osakada F, Takahashi M, Kawasaki H, Kinoshita S, Sasai Y. (2006) Proc Natl Acad Sci USA. 20: 9554-9.

  An object of the present invention is to find a substance having an activity of inducing differentiation from stem cells to ectoderm cells, and to provide a drug for fundamentally preventing, improving or treating eye diseases and neurological diseases that have been difficult to treat so far. It is in providing compositions, such as food-drinks.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have increased expression of ectodermal cell-specific marker genes in stem cells by adding black tea extract to the stem cell culture system. As a result, it was confirmed that differentiation into nerve cells or eye-like structures was promoted, and the present invention was completed.

That is, the present invention includes the following inventions.
(1) An agent for inducing differentiation from stem cells to ectoderm cells, containing black tea extract as an active ingredient.
(2) The differentiation inducer according to (1), wherein the ectoderm cells are sensory organ cells or nervous cells.
(3) The differentiation inducer according to (2), wherein the sensory organ cells are constituent cells of the eye.
(4) The differentiation inducer according to (3), wherein the eye constituent cells are retina, lens, corneal epithelium, or iris cells.
(5) A pharmaceutical product or food or drink comprising the differentiation inducer according to any one of (1) to (4).
(6) The pharmaceutical product or food or drink according to (5) for the treatment or prevention of eye diseases or neurological diseases.
(7) A method for inducing differentiation from stem cells to ectoderm cells, comprising culturing stem cells in the presence of black tea extract to induce differentiation into ectoderm cells.
(8) A method for producing ectoderm cells, comprising a step of culturing stem cells in the presence of black tea extract to induce differentiation into ectoderm cells.
(9) An ectoderm cell produced by the method according to (8).

  According to the present invention, an agent for inducing differentiation from stem cells to ectoderm cells is provided. The differentiation-inducing agent of the present invention can induce differentiation from stem cells to ectodermal cells, for example, eye constituent cells such as the lens and retina, and nerve cells, so that cataracts, glaucoma, retinal detachment and other eye diseases It can be used as a pharmaceutical or food or drink for fundamentally preventing, improving or treating neurological disorders such as spinal cord injury. In addition, ectoderm cells produced by inducing differentiation from stem cells using the differentiation inducer of the present invention can be applied to regenerative medicine in which the function is restored by transplantation to the damaged site of the eye or nerve. Become. Furthermore, the differentiation-inducing agent of the present invention can be used as a reagent for basic research on differentiation of eye constituent cells such as lens and retina and nerve cells.

FIG. 1 shows the results of a differentiation induction test from an ES cell to an eye-like structure by black tea extract (top panel: stereomicroscopic image of a petri dish after 12 days of culture in the black tea extract-free group, top 2nd panel: optical microscope image (phase difference (left) and bright field (right)) of the culture dish 12 days after culturing in the black tea extract-free group, 3rd panel from the top: black tea extraction Stereomicroscopic image of a petri dish after 12 days of culture in the food addition group, bottom panel: Optical micrograph of the petri dish after 12 days of culture in the black tea extract addition group (phase difference (left) and bright field (right)) .

The present invention will be described in detail below.
The differentiation inducer for inducing differentiation from stem cells to ectoderm cells of the present invention (hereinafter sometimes referred to as “ectodermal cell differentiation inducer”) contains black tea extract as an active ingredient.

  In the present invention, “differentiation induction from stem cells to ectoderm cells” refers to inducing and promoting the differentiation of ectoderm cells from stem cells at a living body level or a culture level to increase ectoderm cells.

  In the present invention, “stem cells” refer to various stem cells that can differentiate into ectoderm cells, embryonic stem cells (ES cells), bone marrow, skin, subcutaneous fat, brain, retina, nasal odor bulb, and other tissues. And undifferentiated cells (collectively referred to as somatic stem cells), induced pluripotent stem cells (iPS cells), and the like. Examples of ES cells include ES cells established by culturing early embryos before implantation, ES cells established by culturing early embryos produced by nuclear transfer of somatic cell nuclei, And ES cells obtained by modifying genes on the chromosomes of those ES cells using genetic engineering techniques. Such ES cells can be prepared, for example, by a method known per se, but can be obtained from a predetermined institution, and further commercially available products can be purchased. In addition, these stem cells may be primary cultured cells, subcultured cells, or frozen cells.

  Further, the agent for inducing differentiation into ectoderm cells of the present invention can be applied to all mammals as long as they have equivalent characteristics regarding the direction of differentiation of stem cells and the process of differentiation. For example, the effect can be exerted on stem cells of mammals such as human, monkey, mouse, rat, guinea pig, hamster, rabbit, cat, dog, horse, cow, sheep, goat and pig.

  The ectoderm is mainly divided into superficial ectoderm and neuroectoderm. In the present invention, “ectodermal cell” refers to both superficial ectoderm cells and neuroectodermal cells. Ectodermal cells formed in the early stages of differentiation from pluripotent cells such as cells and ES cells (common precursor cells of nerves and skin), and cells that make up nerves and sensory organs that differentiate and develop from ectoderm, It is a concept that includes both skin cells and the like. The ectoderm-derived cells include sensory organ cells (retina and inner ear cells), nervous system cells (neural stem cells, neurons (eg, forebrain neurons, midbrain neurons, cerebellar neurons, hindbrain neurons, spinal nerves). Cells), neural tube cells, neural crest cells), epidermal cells (epidermal cells, lens epithelial cells) and the like.

  Whether or not the cells induced to differentiate according to the present invention are the above-mentioned ectoderm cells can be confirmed by, for example, expression of various neural cell markers and sensory organ cell markers. Examples of neuronal cell markers and sensory organ cell markers that can be used in the present invention include Otx2 (ectodermal / neural cell / eye differentiation marker: W02005 / 123902, Nature. 1992 Aug 20; 358 (6388): 687-90. Nested expression domains of four homeobox genes in developing rostral brain.Simeone A, Acampora D, Gulisano M, Stornaiuolo A, Boncinelli E. SourceInternational Institute of Genetics and Biophysics, CNR, Naples, Italy.), Sox1・ Eye differentiation marker: W02005 / 123902), Six3 (Forebrain region / Eye differentiation marker: Cereb Cortex. 2008 Mar; 18 (3): 553-62. Epub 2007 Jun 18. Six3 controls the neural progenitor status in the murine CNS. Appolloni I, Calzolari F, Corte G, Perris R, Malatesta P.), Pax6 (neural progenitor cells, ocular differentiation marker: W02005 / 123902), Tuj-1 (neural cell marker: Mod Pathol. 2007 Jul; 20 (7): 742-8. Epub 2007 Apr 27. Expression of Sox2 in mature and immature teratomas of central nervous system. Phi JH, Park SH, Paek SH, Kim SK, Lee YJ, Park CK, Cho BK, Lee DH, Wang KC.), Map2 (mature neuron marker: W02005 / 123902, J Neurosci Res. 2002 Nov 1; 70 (3 ): 327-34. Expression patterns of immature neuronal markers PSA-NCAM, CRMP-4 and NeuroD in the hippocampus of young adult and aged rodents. Seki T.), Crystalin (lens marker) and the like.

  The “black tea” used in the present invention refers to tea obtained by heating leaves of tea (scientific name: Camellia sinensis), fermenting them with microorganisms such as black koji molds, and drying them. Black tea is classified as “post-fermented tea” due to its manufacturing method. In addition to the “tea powder” in the form of the normal tea leaves, “tea tea” that has been pressed into a thin plate shape after the tea leaves have been deposited and post-fermentation has been advanced is there. Black tea is widely drunk in China and includes, for example, “pu-erh tea”, “six tea tea”, “black tea tea”, “tea tea”, and “kang tea” depending on the production area. Even in Japan, black tea is produced in small quantities, and is known as Kozuku's “Soseki Tea”, Tokushima's “Awabancha”, Toyama's “Batabata Tea” and so on. Any black tea used in the present invention can be used as long as it is post-fermented with microorganisms, and any of the black teas shown above may be used, but from the viewpoint of availability and effects, Pu-erh tea is preferred.

  The “black tea extract” which is an active ingredient of the present invention can be obtained by extracting from black tea leaves with a solvent. Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, 1-heptanol, 2-heptanol, etc.), liquid polyhydric alcohols (Propylene glycol, glycerin, 1,3-butylene glycol, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), And ethers (ethyl ether, propyl ether, tetrahydrofuran, etc.). Preferred are polar solvents such as water, lower alcohols, and liquid polyhydric alcohols, and more preferred are water, ethanol, propylene glycol, and 1,3-butylene glycol. These solvents may be used alone or in combination of two or more.

  The amount of solvent used for extraction is usually 2 to 200 parts by weight, preferably 10 to 100 parts by weight, per 1 part by weight of the extraction raw material. If the amount of the extraction solvent falls below this range, the extraction solvent does not reach the entire extraction raw material, and the extraction efficiency may decrease.If the amount of the extraction solvent exceeds this range, the burden of removing the extraction solvent later will be reduced. To increase.

  The extraction temperature is a temperature not higher than the boiling point of the solvent used for extraction, and is not particularly limited. For example, it may be heat extraction or room temperature extraction.

  The extraction time is 3 to 10 days for normal temperature extraction and 30 minutes to 24 hours, preferably 1 to 10 hours for heat extraction, but can be appropriately adjusted depending on conditions such as the type of extraction solvent and extraction temperature. The number of extraction operations is not particularly limited, and may be one, or a fresh extraction solvent may be added again after the first extraction, and the second and subsequent extraction operations may be performed. Moreover, you may perform extraction operation in multiple times using the same extraction solvent.

  The extraction method may be any method commonly used in the art, and is performed using an arbitrary apparatus at room temperature or under heating. Specifically, an extraction raw material is put into an extraction processing tank filled with an extraction solvent, and a soluble component is eluted with occasional stirring as necessary, followed by filtration to remove a residue to obtain an extract.

  The above extract may be used as it is, and if necessary, it may be further treated for concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc. within the range that does not affect the effect. May be used. Further, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

  The black tea extract obtained as described above has an action of inducing differentiation from stem cells to ectoderm cells at the culture level or the living body level. Therefore, the ectodermal cell differentiation inducing agent of the present invention can be obtained by culturing stem cells in a stem cell differentiation induction medium to which an effective amount thereof is added, or by administering them to mammals including humans. Differentiation into lineage cells can be induced.

  When differentiation induction from stem cells to ectoderm cells is performed by culturing stem cells, the conditions and operations of the culture method are the conditions that are conventional in the art, except that the ectoderm cell differentiation inducer is added to the medium. And according to the operation. The addition amount of the ectodermal cell differentiation inducer to the medium is 1-1000 μg / mL, preferably 10-100 μg / mL, as the concentration of black tea extract.

  For the culture of stem cells, a medium having a composition suitable for the purpose of stem cell maintenance or differentiation induction is used. Specifically, the stem cell differentiation-inducing medium includes a basic medium (for example, Dulbecco's modified Eagle's medium (D) containing components (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins) necessary for cell survival and proliferation. -MEM), Minimum Essential Medium (MEM), RPMI1640, Basal Medium Eagle (BME), Dulbecco's modified Eagle's medium: Nutrient Mixture F-12 (D-MEM / F-12), Glasgow Minimum Essential Meidum (Glasgow MEM), Hanks A medium in which at least one kind of growth factor such as basic Fibroblast Growth Factor (bFGF) or Epidermal Growth Factor (EGF) is added to the liquid (Hank's balanced salt solution) or MCDB153 medium is used. The medium also contains Tumor Necrosis Factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, bovine serum albumin as necessary to increase the cell growth rate. (BSA), fibronectin, progesterone, selenite, B27-supplement, N2-supplement, ITS-supplement, etc. may be added, and antibiotics may be added. Each component of the medium is used after being sterilized by a suitable method.

  In addition to the above, serum is preferably contained at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in the effects, it is preferable to use the serum after a lot check.

  In order to maintain the undifferentiated state of stem cells, Mouse Embryonic Fibroblast (MEF) treated with Mitomycin C (MMC) is used as a feeder cell, and a stem cell maintenance medium (Leukemia Inhibitory Factor (LIF), L- Induction of differentiation of stem cells into ectoderm cells is performed by seeding the cultured stem cells in an undifferentiated state on another feeder cell to promote differentiation. It is performed by adding various other factors and culturing. The feeder cells are not particularly limited, but ST2 cells and PA6 cells which are mouse stromal cells are preferable. Examples of various factors that promote differentiation include, but are not limited to, dexamethasone (DEX), bFGF, Cholera Toxin (CT), and Endothelin-3 (EDN3).

  A disposable petri dish is preferably used as a container for culturing stem cells or promoting differentiation into stem cells. In addition, although it is preferable to perform culture medium exchange once every 2 to 3 days, it is more preferable to carry out daily. In addition, differentiation induction from stem cells to eye tissues including the cornea, lens (lens) and retina is preferably performed for 12 days or more.

  On the other hand, when the ectodermal cell differentiation inducer of the present invention is administered in vivo, it can be administered as it is, but within the range not impairing the effects of the present invention, along with appropriate additives, pharmaceuticals and quasi drugs. It can mix | blend with compositions, such as goods and food-drinks.

  When the ectodermal cell differentiation inducing agent of the present invention is provided as a pharmaceutical product, a black tea extract is pharmaceutically acceptable and appropriately selected according to the dosage form. Agents, binders, lubricants, coating agents, disintegrants or disintegration aids, stabilizers, preservatives, preservatives, extenders, dispersants, wetting agents, buffers, solubilizers or solubilizers, etc. Various preparations to which a tonicity agent, pH adjusting agent, propellant, coloring agent, sweetening agent, corrigent, fragrance, etc. are appropriately added and can be systemically or locally administered by various known methods orally or parenterally. What is necessary is just to prepare in a form.

  Preparations for oral administration include, for example, excipients such as starch, glucose, sucrose, fructose, lactose, sorbitol, mannitol, crystalline cellulose, magnesium carbonate, magnesium oxide, calcium phosphate, or dextrin; carboxymethyl cellulose, carboxymethyl cellulose calcium, Disintegrants or disintegration aids such as starch or hydroxypropylcellulose; binders such as hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, gum arabic, or gelatin; lubricants such as magnesium stearate, calcium stearate, or talc Coating agent such as hydroxypropylmethylcellulose, sucrose, polyethylene glycol, or titanium oxide; petrolatum, liquid paraffin, polyethylene Call, gelatin, kaolin, glycerin, purified water, or the like can be used base hard fat, but are not limited to.

  For preparations for parenteral administration, solvents such as distilled water, physiological saline, ethanol, glycerin, propylene glycol, macrogol, alum water, vegetable oil; isotonic agents such as glucose, sodium chloride, D-mannitol; inorganic acids , PH adjusters such as organic acids, inorganic bases or organic bases can be used, but are not limited thereto.

  The form of the pharmaceutical product of the present invention is not particularly limited. For example, tablets, sugar-coated tablets, capsules, troches, granules, powders, liquids, pills, emulsions, syrups, suspensions, elixirs Oral preparations such as eye drops, eye drops, injections (eg, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), drops, suppositories, ointments, lotions, sprays, transdermal Examples include skin absorption agents, transmucosal absorption agents, and parenteral preparations such as patches. Moreover, you may make it the dry product re-dissolved when using. The pharmaceutical of the present invention includes drugs used for animals, that is, veterinary medicine.

  The content of the black tea extract in the preparation is not particularly limited, but is preferably in the range of 0.001 to 30% by weight, more preferably 0.01 to 10% by weight in terms of solid content of the black tea extract with respect to the total weight of the preparation. preferable.

  Below 0.001% by weight, the effect is low, and even if it exceeds 30% by weight, the effect is hardly increased. In addition, the method for adding the active ingredient in the formulation may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  Among the above forms, the form of eye drops is preferable. The content of the black tea extract can be appropriately changed according to the indication disease and the like, but is usually 0.00001 to 5 w / v%, preferably 0.0001 to 1 w / v% with respect to the whole eye drop. In the eye drops, various additives that can be usually blended in eye drops can be appropriately blended. Examples of additives include buffers (borate buffer, citrate buffer, tartrate buffer, etc.), isotonic agents (sugars such as glucose, mannitol, sorbitol, glycerin, polyethylene glycol, propylene glycol) Polyhydric alcohols such as sodium chloride, salts such as sodium chloride), preservatives (benzalkonium chloride, chlorhexidine gluconate, methyl paraoxybenzoate, etc.), thickeners (hydroxyethylcellulose, hydroxypropylcellulose, methylcellulose, carboxymethylcellulose, etc.) ), Stabilizers, antioxidants, pH adjusters, chelating agents and the like.

  The eye drops can be prepared according to a known aqueous solution preparation method. For example, after adding the above various additives to a pharmaceutically acceptable solvent (eg, aqueous solvent such as sterilized purified water and sterilized buffer), the black tea extract is dissolved to obtain a homogeneous aqueous solution. The eye drops are prepared by aseptic operation or by sterilization at an appropriate stage.

  The ectodermal cell differentiation inducing agent of the present invention has an action of promoting the differentiation from stem cells to ectodermal cells because the black tea extract as an active ingredient has an action to improve and prevent eye diseases or neurological diseases. It is effective as a medicine.

  The eye disease is not particularly limited as long as it is a disease caused by degeneration or damage of the lens, cornea, retina, and optic nerve. For example, retinal diseases (retinal detachment, retina choroiditis, retinal artery occlusion, retinal vein occlusion, diabetes mellitus) Retinopathy, hypertensive retinopathy, age-related macular degeneration, retinitis pigmentosa, central serous chorioretinopathy, etc.), optic nerve diseases (glaucoma, papilledema, optic neuritis, optic atrophy, etc.), corneal diseases (bacterial) Corneal ulcer, corneal mycosis, corneal herpes, etc.), cataract (senile, diabetic, concomitant, traumatic cataract, etc.).

  The neurological disease is not particularly limited as long as it is a disease caused by a nervous system cell, for example, spinal cord injury, Alzheimer's disease, spinocerebellar degeneration, Huntington's chorea, amyotrophic lateral sclerosis, spinal muscular atrophy. Disease, Parkinson's disease, multiple sclerosis, cerebrovascular disorder (cerebral infarction, stroke, cerebral aneurysm), dementia and movement disorder due to cerebrovascular disorder, epilepsy, cerebral trauma and the like.

  The pharmaceutical agent of the present invention functions as a prophylactic agent that suppresses the onset of the above diseases and / or a therapeutic agent that improves the normal state.

  When the pharmaceutical agent of the present invention is used as a pharmaceutical agent for the prevention and / or treatment of the aforementioned diseases, it is orally or parenterally administered over a wide range of doses to mammals such as humans, mice, rats, rabbits, dogs and cats. Can be administered.

  The dosage of the pharmaceutical agent of the present invention can be appropriately determined according to the type of disease, the age, sex, body weight, symptom level, etc. of the administration subject. For example, when orally administered to an adult, the daily dose is 1 to 1000 mg, preferably 5 to 200 mg, as a black tea extract.

  Moreover, the ectodermal cell differentiation-inducing agent of the present invention can also be added to food and drink. In the present invention, the food / beverage product is used to mean including a health food, a functional food, a dietary supplement, or a food for specified health use. Furthermore, when using the food-drinks of this invention for mammals other than a human, it can be used by the meaning containing pet food and feed. In particular, it is advantageous in that it can be taken on a daily basis when it is necessary for long-term use such as prevention of Alzheimer's disease or treatment of nerve damage.

  The form of the food or drink may be any form suitable for edible use, for example, solid, liquid, granular, granular, powder, capsule, cream, or paste.

  Specific types of food and drink include breads such as bread and confectionery bread; noodles such as buckwheat, udon, pasta, Chinese noodles and instant noodles; baked confectionery such as candy, chewing gum, chocolate, biscuits and cookies, jelly Confectionery such as ice cream, ice sherbet, shaved ice; dairy products such as processed milk, fermented milk, yogurt, butter, cheese; fishery and livestock processed foods such as kamaboko, chikuwa, ham, sausage; margarine, mayonnaise , Shortening, whipped cream, dressing and other fats and oils processed foods; seasonings such as soy sauce, sauce, vinegar, mirin; soft drinks, carbonated drinks, beauty drinks, nutrition drinks, fruit drinks, milk drinks, etc. (these Including, but not limited to, beverage concentrate concentrates and powders for preparation).

  The food / beverage products of the present invention may be appropriately blended with additives usually used depending on the type. As the additive, any food hygiene-acceptable additive can be used. For example, sweeteners such as glucose, sucrose, fructose, isomerized liquid sugar, aspartame, stevia; citric acid, malic acid, Acidic agents such as tartaric acid; excipients such as dextrin and starch; binders, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspensions Agents, preservatives and the like.

  The blending amount of the black tea extract in the food or drink of the present invention may be an amount that can exert the differentiation promoting action from stem cells to ectoderm cells, but the general intake of the target food or drink, the form of the food or drink It may be set as appropriate in consideration of efficacy / effect, taste, palatability and cost.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these. In the examples, the part of the amount is part by weight, and% is% by weight.

(Example 1) Production of black tea extract
(1) Production Example 1: Hot water extract of black tea 400 g of purified water was added to 20 g of black tea (butterfly tea), extracted at 95-100 ° C. for 2 hours, filtered, and the filtrate was concentrated and frozen. It dried and obtained 2.9g of hot water extracts of black tea.

(2) Production Example 2: 50% ethanol extract of black tea 200g of 50% ethanol was added to 20g of black tea (Batabata tea), extracted for 3 days at room temperature, filtered, and the filtrate was concentrated to dryness. 2.5 g of black tea ethanol extract was obtained.

(3) Production Example 3: 50% 1,3-butylene glycol extract of black tea After adding 200 g of purified water and 200 g of 1,3-butylene glycol to 20 g of black tea (Batabata tea), the mixture was extracted at room temperature for 7 days. Filtration yielded 360 g of 50% 1,3-butylene glycol extract of black tea.

(Example 2) Differentiation induction of stem cells (mouse ES cells) into ectoderm cells by black tea extract
(1) Preparation of ES cells Cultivate MMC-treated MEF in a gelatin-coated 35 mm petri dish in a confluent state, and inoculate 10-20 × 10 ⁴ mouse ES cells on it, at 37 ° C., 5% CO Pre-cultured in ₂ incubators. The medium was added to DMEM with chemicon's additional factor for ES cells (L-glutamine solution, 2 mercaptoethanol solution, nucleoside solution, non-essential amino acid solution) at the recommended concentration, then LIF 1000 units / mL, Fetal Bovine Serum ( An ES cell undifferentiated maintenance medium (hereinafter referred to as “ES cell medium”) supplemented with 15% FBS) was used.

  The ES cells and MEF cultured by the above method were detached from the petri dish by trypsin treatment and seeded again in a 35 mm petri dish treated with gelatin. After seeding, it was allowed to stand for 30 minutes, and then the medium was collected in another tube. At this time, MEF having strong adhesiveness remains in the petri dish, and only ES cells are collected. The following experiment was performed using the undifferentiated ES cells collected in this manner.

(2) Induction of differentiation of stem cells into ectoderm cells by black tea extract in a culture system using feeder cells
ES cells separated from MEFs were seeded again on MMC-treated MEFs cultured in 24 well plates (5 × 10 ⁴ cells / well), and cultured using a medium obtained by removing LIF from the ES cell medium. At that time, the black tea extract prepared in Production Example 1 was added at concentrations of 25.0, 50.0, and 100.0 μg / mL.

  After 4 days of culture, only ES cells were collected, the cells were washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). After reverse transcription of RNA to cDNA using 2-STEP real-time PCR kit (Applied Biosystems), real-time PCR (95 ° C: 15 seconds, 60 ° C: 30 ° C) using the following primer sets using ABI7300 (Applied Biosystems) Nanocycle (Undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embryonic stem cell pluripotency. Pan G, Thomson JA.), Otx2 (Expression of ectoderm / nerve cell marker), Sox1 (nerve cell marker), Six3 (forebrain region, eye differentiation marker) expression of each marker gene was confirmed. Other operations were carried out in accordance with established methods.

Primer set for Nanog (undifferentiated marker):
ATGCCTGCAGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Otx2 (ectoderm, nerve cell marker):
GAAAATCAACTTGCCAGAATCCA (SEQ ID NO: 3)
GCGGCACTTAGCTCTTCGAT (SEQ ID NO: 4)
Sox1 (nerve cell marker) primer set:
GCCGAGTGGAAGGTCATGT (SEQ ID NO: 5)
TGTAATCCGGGTGTTCCTTCAT (SEQ ID NO: 6)
Six3 (forebrain region) primer set:
CCCTAGATCTCTATTCCTCCCACTTC (SEQ ID NO: 7)
GAAGTAGGGAGCAGTGGTGAGAA (SEQ ID NO: 8)
Primer set for Gapdh (internal standard):
CCGTGTTCCTACCCCCAAT (SEQ ID NO: 9)
TGCCTGCTTCACCACCTTCT (SEQ ID NO: 10)

  Regarding the expression of the marker gene in each cell, the relative expression level (each gene was calculated as the ratio of the expression level of each gene mRNA in the cells cultured without adding black tea extract to the expression level of Gapdh mRNA as an internal standard. The value of the relative expression level of each gene in each cell induced to differentiate by adding black tea extract was calculated and evaluated. The results are shown in Table 1.

  As shown in Table 1, expression of Nanog, an undifferentiated marker, was suppressed depending on the concentration of the black tea extract. On the other hand, the expression of ectodermal and neuronal markers Otx2 and Sox1 was clarified. In addition, the expression of Six3, a gene whose expression is promoted in the forebrain region, was also promoted during the development of the early embryo in the ectoderm.

(3) Induction of differentiation of stem cells into ectoderm cells by black tea extract in a culture system without feeder cells
Undifferentiated ES cells separated from MEF were seeded directly in gelatin-coated 24-well plates (without MEF) (5 × 10 ⁴ cells / well), and LIF was removed from the ES cell medium in the same manner as above. The black tea extract of each concentration was added. After 4 days of culture, RNA was collected and the expression of each marker gene was analyzed by real-time PCR. The results are shown in Table 2.

  As shown in Table 2, as in the case of (2), Nanog expression suppression and Otx2, Sox1, and Six3 expression promotion were confirmed.

(4) Stem cell differentiation into ectodermal cells induced by black tea extract in a culture system that forms EB
Undifferentiated mouse ES cells separated from MEF were suspended in a medium for ES cells excluding LIF, and hanging drops were formed at a cell concentration of 2000 cells / 20 μL to prepare EB (embryoid body). At that time, black tea extract of each concentration was added, and RNA was collected after 4 days of culture. Nanog (undifferentiation marker), Otx2 (ectodermal / neural cell marker), Sox1 (neural cell marker), Six3 (previous) The expression of each marker gene (brain area marker) was analyzed by real-time PCR. The results are shown in Table 3.

  As shown in Table 3, as in the case of (2), Nanog expression suppression and Otx2, Sox1 and Six3 expression promotion were confirmed.

  From the results shown in Tables 1 to 3 above, black tea extract is an undifferentiated mouse ES cell in any culture system (culture system using feeder cells, culture system not using feeder cells, culture system forming EB). It was found to suppress maintenance while promoting differentiation to ectoderm cells.

(Example 3) Differentiation induction of stem cells (mouse ES cells) into neurons by black tea extract Induction of differentiation of mature nervous system cells by co-culturing ES cells with various stromal cells in serum-free culture Technology has been established (Patent No. 4294482; Kawasaki H, Mizuseki K, Nishikawa S, Kaneko S, Kuwana Y, Nakanishi S, Nishikawa SI, Sasai Y., Neuron. 2000 Oct; 28 (1): 31-40 Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity). Therefore, it was investigated whether black tea extract was added to this neural differentiation induction system to promote induction into mature neurons.

  Mouse undifferentiated ES cells isolated from MEF were seeded at a concentration of 500 cells / well on ST2 cells (mouse bone marrow-derived stromal cells) cultured to confluence in 24-well plates, and 10% KnockOut. Serum Replacement (KSR) was added to G-MEM. ), 2 mM L-glutamine, 1 mM pyruvate, 0.1 mM 2 mercaptoethanol solution, 0.1 mM non-essential amino acid solution, and cultured in a neuronal differentiation induction medium. At that time, black tea extract was added at a concentration of 100 μg / mL.

  ST2 cells and ES cells were collected 12 days after differentiation induction, and expression of Pax6 (neural progenitor cell marker), Tuj-1 (neural cell marker), and Map2 (mature neuronal cell marker), which are neuronal cell differentiation marker genes, were as follows: Each primer set was analyzed by real-time PCR.

Pax6 (neural progenitor cell marker):
GCACCAAAGGGTCATCGC (SEQ ID NO: 11)
TGGGGGGTGGATGGAAG (SEQ ID NO: 12)
Tuj-1 (nerve cell marker):
CTCAAAATGTCATCCACCTT (SEQ ID NO: 13)
GTGAACTCCATCTCATCCAT (SEQ ID NO: 14)
Map2 (mature neural cell marker):
ACTCAGCAACGTCTCATCTT (SEQ ID NO: 15)
GTATTCACAAGCCCTGCTTA (SEQ ID NO: 16)

Table 4 shows the analysis results of the expression of each marker gene by real-time PCR.

  As shown in Table 4, it was confirmed that the expression of each neuronal differentiation marker was significantly promoted by the black tea extract. From the above results, it was clarified that the black tea extract significantly promotes differentiation from ES cells to neurons.

(Example 4) Differentiation induction of stem cells (mouse ES cells) into eye-like structures by black tea extract
A system for inducing differentiation of melanocytes has been established by co-culturing ES cells with ST2 cells, which are stromal cells (Yamane T, Hayashi S, Mizoguchi M, Yamazaki H, Kunisada T., Dev Dyn. 1999 Dec; 216 (4-5): 450-8. Derivation of melanocytes from embryonic stem cells in culture.). In this differentiation induction system, it is known that various cells such as cardiomyocytes and blood cells are differentiated in addition to melanocytes. We examined which cell induction was promoted by adding black tea extract to such a system in which various cells differentiate.

  Mouse undifferentiated ES cells isolated from MEF were seeded at a concentration of 500 cells / well on ST2 cells cultured to confluence in a 24-well plate, and α-MEM was 10% FBS, 100 nM DEX, 20 pM bFGF, 10 pM CT, 100 ng / Differentiation was promoted with a differentiation induction medium containing mL EDN3. At that time, black tea extract was added at a concentration of 100 μg / mL.

  FIG. 1 shows the results of the differentiation induction test. In the black tea extract non-added group, colonies of ES cells were formed within a few days after induction, and cells having various morphologies began to appear on the 12th day of induction. On the other hand, in the black tea extract added group, colonies were formed within a few days after induction, but the form was significantly different from the non-added group, and the structure had pigment around the colony at the 12th day of induction. Many bodies began to appear.

  A system has been established to induce eye-like structures including retinal pigment epithelial cells and lenses (lenses) from ES cells (Hirano M, Yamamoto A, Yoshimura N, Tokunaga T, Motohashi T, Ishizaki K, Yoshida H, Okazaki K, Yamazaki H, Hayashi S, Kunisada T., Dev Dyn. 2003 Dec; 228 (4): 664-71. Generation of structures formed by lens and retinal cells differentiating from embryonic stem cells.). When the morphology of the colony was observed with a microscope, the structure formed by adding the black tea extract was very similar to the eye-like structure reported in the above literature (FIG. 1).

  On the 12th day of differentiation induction, cells were collected, and Otx2 (forebrain region, eye differentiation marker), Six3 (forebrain region, eye differentiation marker), Pax6 (eye differentiation marker) The expression of the marker) and Crystalin (lens marker) were analyzed by real-time PCR using the following primer sets.

Otx2 (forebrain region, eye differentiation marker):
GAAAATCAACTTGCCAGAATCCA (SEQ ID NO: 3)
GCGGCACTTAGCTCTTCGAT (SEQ ID NO: 4)
Six3 (forebrain region, eye differentiation marker):
CCCTAGATCTCTATTCCTCCCACTTC (SEQ ID NO: 7)
GAAGTAGGGAGCAGTGGTGAGAA (SEQ ID NO: 8)
Pax6 (eye differentiation marker):
GCACCAAAGGGTCATCGC (SEQ ID NO: 11)
TGGGGGGTGGATGGAAG (SEQ ID NO: 12)
Crystalin:
TGGCTGCTGGATGCTCTATG (SEQ ID NO: 17)
CCGCGACGCAGGAAGTA (SEQ ID NO: 18)

Table 5 shows the analysis results of the expression of each marker gene by real-time PCR.

  As shown in Table 5, it was confirmed that the addition of black tea extract promotes the expression of ocular developmental markers (Otx2, Six3, Pax6, Crystalin).

  From the above results, it was clarified that the black tea extract promotes the induction from the ES cells to the eye-like structure including the retinal pigment epithelium and the lens.

(Example 5) Differentiation induction of stem cells (human iPS cells) into ectoderm cells by black tea extract
(1) Preparation of human iPS cells MFC-treated MEF was cultured in a gelatin-coated 60 mm petri dish in a confluent state, and thawed human iPS cell mass was seeded at 37 ° C, 5% CO ₂ Pre-cultured in an incubator. The medium was an iPS cell undifferentiated maintenance medium (hereinafter referred to as “iPS cell culture medium”) in which bFGF was added at a concentration of 5 ng / mL to iPSellon manufactured by Cardio.

  The iPS cells cultured by the above method were cut and recovered using EZPassage manufactured by invitrogen, and then seeded again on MMC-treated MEF cultured in a 24-well plate, and bFGF was removed from the iPS cell culture medium. The culture medium was cultured using the same medium. At that time, black tea extract was added at a concentration of 100 μg / mL.

  RNA was collected after 4 days of culture, and expression of each marker gene of Nanog (undifferentiation marker), Otx2 (ectodermal / neural cell marker), and Sox1 (neural cell marker) was performed by real-time PCR using the following primer sets: Analyzed. The results are shown in Table 6.

Primer set for Nanog (undifferentiated marker):
CCTTCCTCCATGGATCTGCTT (SEQ ID NO: 19)
AAGTGGGTTGTTTGCCTTTGG (SEQ ID NO: 20)
Primer set for Otx2 (ectoderm, nerve cell marker):
TTCACTCGGGCGCAGCTAG (SEQ ID NO: 21)
CCATACCTGCACCCTCGACTC (SEQ ID NO: 22)
Sox1 (nerve cell marker) primer set:
GGTCAAACGGCCCATGAAC (SEQ ID NO: 23)
TGATCTCCGAGTTGTGCATCTT (SEQ ID NO: 24)
Six3 (forebrain region) primer set:
GTATTCCGCTCCCCCCTAGA (SEQ ID NO: 25)
TGGTGAGAATCGGCGAAGTT (SEQ ID NO: 26)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCTTAGC (SEQ ID NO: 27)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 28)

  As shown in Table 6, as in the case of using mouse ES cells, Nanog expression suppression and Otx2, Sox1, and Six3 expression promotion were confirmed.

  From the above, it was clarified that the black tea extract exhibits an ectodermal differentiation induction promoting effect on human iPS cells.

(Example 6) Differentiation induction of somatic stem cells into ectoderm cells by black tea extract A system for inducing differentiation of neurons from human or mouse somatic stem cells has been established (Stem Cells Dev. 2008 Oct; 17 (5): 909-16.Neuronal differentiation potential of human adipose-derived mesenchymal stem cells.Anghileri E, Marconi S, Pignatelli A, Cifelli P, Galie M, Sbarbati A, Krampera M, Belluzzi O, Bonetti B. SourceDepartment of Neurological Sciences and Vision, University of Verona, Verona, Italy.). When black tea extract was added to this differentiation induction system, it was confirmed that differentiation into nerve cells was significantly promoted as in Example 3. Therefore, it was clarified that the black tea extract significantly promotes differentiation into ectoderm for somatic stem cells as in the case of using ES cells and iPS cells.

  The ectodermal cell differentiation-inducing agent of the present invention can efficiently induce differentiation of ectodermal cells such as eye constituent cells and nerve cells from stem cells. Differentiated eye-like tissues and nerve cells can be used in the field of regenerative medicine, such as transplantation to an injured site and use as an artificial nerve / artificial retina. It can also be used in the field of manufacturing foods and drinks such as pharmaceuticals, quasi drugs, functional foods and supplements for the fundamental treatment of eye diseases and neurological diseases such as cataracts, glaucoma and retinal detachment.

Claims (9)

  An agent for inducing differentiation from stem cells to ectoderm cells, containing black tea extract as an active ingredient.   The differentiation inducer according to claim 1, wherein the ectoderm cells are sensory organ cells or nervous system cells.   The differentiation-inducing agent according to claim 2, wherein the sensory organ cells are constituent cells of the eye.   The differentiation-inducing agent according to claim 3, wherein the constituent cells of the eye are retina, lens, corneal epithelium, or iris cells.   A pharmaceutical or a food or drink comprising the differentiation inducer according to any one of claims 1 to 4.   The pharmaceutical or food or drink according to claim 5 for the treatment or prevention of an eye disease or a neurological disease.   A method for inducing differentiation from stem cells to ectoderm cells, comprising culturing stem cells in the presence of black tea extract to induce differentiation into ectoderm cells.   A method for producing ectoderm cells, comprising a step of culturing stem cells in the presence of black tea extract to induce differentiation into ectoderm cells.   An ectodermal cell produced by the method according to claim 8.

Images