JP2014027956A - Detection of bacterium of campylobacter species by targeting cell distending toxin - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new method for detecting bacterium of Campylobacter species using cell distending toxin (cdt)gene.SOLUTION: The method uses multiplex PCR with primer sets that can multiply the cdt gene species-specifically to detect several kinds of bacterium of Campylobacter sp(Campylobacter jejuni, Campylobacter coli and Campylobacter fetus) at the same time with high specificity. When a domestic animal or human is mixedly infected by several kinds of bacterium of Campylobacter species, this method can identify the Campylobacter species at the species level by one operation.

Description

  The present invention relates to a method for determining the presence or absence of Campylobacter bacteria in a specimen, targeting cell expansion lethal toxin of bacteria belonging to the genus Campylobacter.

  In order to identify the species of Campylobacter spp., A culture test is usually used. However, this genus spp. Is microaerobic and, depending on the species, it must be cultured at different temperatures. However, there are strains that are difficult to examine, and it is cumbersome and requires a lot of labor. Usually, the culture test for Campylobacter bacteria takes a long time of 7 to 10 days to include isolation and identification.

  Currently, about 94% of Campylobacter bacteria isolated from diarrhea patients are Campylobacter jejuni (hereinafter referred to as `` C. jejuni ''), and 4% are Campylobacter coli (hereinafter referred to as `` C. It is called “Kori”), and most of them are occupied by both species. Therefore, the Campylobacter bacteria are usually tested on the site only for C. jejuni and C. coli, which are designated as food poisoning bacteria. In addition, the selective medium often used for the test is also developed mainly for C. jejuni and C. coli, and is usually cultured at 42 ° C. For this reason, it is difficult to say that the target is Campylobacter fetus (Campylobacter fetus, hereinafter referred to as “C. fetus”) and other bacteria belonging to the genus Campylobacter. On the other hand, mass food poisoning due to C. fetus occurred in Osaka in 2005. C. Fetus infections cause not only gastroenteritis such as diarrhea but also severe symptoms such as sepsis and meningitis in humans, and animal infections may cause infertility such as cattle and miscarriages. Become. Therefore, it is important to prepare a system for testing Campylobacter bacteria, including C. fetus.

  The identification of the species of Campylobacter bacteria based on biochemical properties is not only rapid, but the biochemical properties of Campylobacter bacteria are very similar between species, so the differentiation by biochemical properties is Often difficult. In particular, C. jejuni and C. coli are differentiated based on the presence or absence of hippuric acid hydrolase activity. Therefore, there are problems such as easy determination of C. jejuni as C. coli when the enzyme activity is weak. Therefore, a method for examining the presence or absence of hippuric acid hydrolase gene by the PCR method has been adopted at the inspection site. In recent years, analysis of 16S rRNA gene is often used as a method for identifying bacterial species at the gene level. However, in the analysis of the 16S rRNA gene, C. jejuni and C. coli are extremely homologous and often cannot be distinguished.

  In order to solve the above problems, the inventors of the present application are proceeding with academic research on CDT by focusing on Cytolethal Distending Toxin (CDT) (Non-patent Documents 1 and 2), A method for detecting Campylobacter bacteria using cell swelling lethal toxin genes (cdtA, cdtB, and cdtC) has been developed (Patent Document 1). However, since both the incidence and number of patients of Campylobacter spp. Are increasing (Ministry of Health, Labor and Welfare, “Food poisoning by pathogen”), further development of a simple and rapid identification method for Campylobacter spp. Is expected. .

WO2005 / 054472

Asakura M. et al., Microbial Pathogenesis 42 (2007) 174-183 Yamasaki S. et al., Toxin Reviews, 25: 61-88, 2006

  The present invention has been made in view of the above situation, and the problem to be solved by the present invention is to provide a novel method for detecting Campylobacter bacteria using the cdt gene.

In order to solve the above problems, the present inventors have conducted extensive research. Produces primers for multiplex PCR that can amplify C. jejuni, C. coli, and C. fetus cdt genes in a species-specific manner, including Campylobacter and other cdt gene positive bacteria, including many clinical isolates, In addition, multiplex PCR was evaluated using representative intestinal infection-causing bacteria. In addition, the present inventors tried to simultaneously detect a plurality of Campylobacter bacteria by multiplex PCR using cdtB amplification primers. As a result, it has been proved that the multiplex PCR using the primers for cdtB amplification by the present inventors can simultaneously detect a plurality of Campylobacter bacteria with high specificity. The method of the present invention can identify Campylobacter bacteria at the bacterial species level by a single operation when livestock and humans are mixedly infected with multiple Campylobacter species. That is, the present invention relates to a method for detecting Campylobacter bacteria by cdt gene amplification in Campylobacter bacteria, and specifically provides the following inventions.
(1) A method for detecting Campylobacter bacteria in a test sample, comprising the following two (a) and (b) comprising two polynucleotides capable of specifically binding to Campylobacter bacteria cdtB genomic DNA or mRNA: A method comprising a step of performing a nucleic acid amplification reaction on a test sample using any one or more of the primer pairs (a) a Campylobacter bacterium amplified by the primer pair comprising the sequences of SEQ ID NOs: 1 and 2 A pair of primers capable of amplifying the region of cdtB genomic DNA or the region of mRNA corresponding to the region of genomic DNA to be amplified (b) Campylobacter genus amplified by a primer pair comprising the sequences of SEQ ID NOs: 3 and 4 A plasmid capable of amplifying a bacterial cdtB genomic DNA region or an mRNA region corresponding to the genomic DNA region to be amplified. Timer pair,
(2) The nucleic acid amplification reaction is performed using the primer pair described in (a) and (b) above and the primer pair described in (c) below (c) (c) SEQ ID NO: 5 and A primer pair capable of amplifying a region of Camptlobacter cdtB genomic DNA amplified by a primer pair consisting of the sequence according to 6, or an mRNA region corresponding to the genomic DNA region to be amplified;
(3) Before or after the step of carrying out the nucleic acid amplification reaction, nucleic acid amplification is performed using a common primer pair consisting of two polynucleotides that can bind in common to any genomic DNA or mRNA of Camptobacter bacterium cdtA-C. The method according to (1) or (2) above, comprising a step of performing a reaction
(4) The common primer pair is a primer pair consisting of the sequences described in SEQ ID NOs: 7 and 8, a primer pair consisting of the sequences described in SEQ ID NOs: 9 and 10, SEQ ID NOs: 11, 12, and SEQ ID NO: 13 And a primer pair consisting of two sequences from the four sequences described in 14, a primer pair consisting of the sequences described in SEQ ID NOs: 15 and 16, and a primer pair consisting of the sequences described in SEQ ID NOs: 17 and 18 The method according to (3) above,
(5) A kit for use in the method described in (1) above, comprising an instruction manual and two polynucleotides that can specifically bind to cdtB genomic DNA or mRNA of Campylobacter genus (a) And (b) a kit comprising at least one primer pair of the primer pairs described in (a) a region of Camptobacter genus cdtB genomic DNA amplified by a primer pair consisting of the sequences described in SEQ ID NOs: 1 and 2, or amplification A primer pair capable of amplifying a region of mRNA corresponding to the region of genomic DNA (b) region of cdtB genomic DNA of Campylobacter bacteria amplified by a primer pair consisting of the sequences of SEQ ID NOs: 3 and 4, or A primer pair capable of amplifying a region of mRNA corresponding to the region of the genomic DNA to be amplified;
(6) The region of cdtB genomic DNA of Campylobacter bacteria amplified by the primer pair consisting of the sequence described in kit (c) SEQ ID NO: 5 and 6 described in (5), further including the primer pair described in (c) below A primer pair capable of amplifying a region of mRNA corresponding to the region of genomic DNA to be amplified,
(7) A method for detecting a Campylobacter bacterium in a test sample, wherein the test is performed using the following primer pair (a) comprising two polynucleotides capable of specifically binding to a Campylobacter bacterium cdtA genomic DNA or mRNA. A method comprising a step of performing a nucleic acid amplification reaction on a sample (a) a region of Campylobacter cdtA genomic DNA amplified by a primer pair comprising the sequences of SEQ ID NOs: 19 and 20, or the genomic DNA amplified A primer pair capable of amplifying a region of mRNA corresponding to the region;
(8) The nucleic acid amplification reaction is performed using the primer pair (a) and the following primer pairs (b) and (c): (b) the method according to (7), the sequence number: 21 and 22 A primer pair (c) that can amplify a region of Campylobacter cdtA genomic DNA amplified by a primer pair consisting of sequences, or a region of mRNA corresponding to the region of genomic DNA to be amplified (c) SEQ ID NOs: 23 and 24 A primer pair capable of amplifying a region of Campylobacter cdtA genomic DNA amplified by a primer pair consisting of the sequence of: or a region of mRNA corresponding to the region of genomic DNA to be amplified,
(9) A kit for use in the method described in (7) above, comprising an instruction manual and two polynucleotides that can specifically bind to cdtA genomic DNA or mRNA of Campylobacter bacteria (a) (A) a region of Campylobacter cdtA genomic DNA amplified by a primer pair consisting of the sequences set forth in SEQ ID NOs: 19 and 20, or mRNA corresponding to the region of the genomic DNA to be amplified A primer pair capable of amplifying the region,
(10) The kit according to (9), further comprising the primer pairs of the following (b) and (c): (b) cptA of Campylobacter bacteria amplified by the primer pair consisting of the sequences of SEQ ID NOs: 21 and 22 Primer pair capable of amplifying a region of genomic DNA or a region of mRNA corresponding to the region of genomic DNA to be amplified (c) of a Campylobacter bacterium amplified by a primer pair consisting of the sequences of SEQ ID NOs: 23 and 24 a primer pair capable of amplifying a region of cdtA genomic DNA or a region of mRNA corresponding to the region of genomic DNA to be amplified;
(11) A method for detecting a Campylobacter bacterium in a test sample, wherein the test is performed using the following primer pair (a) comprising two polynucleotides capable of specifically binding to the CdtC genomic DNA or mRNA of the Campylobacter bacterium A method comprising a step of subjecting a sample to a nucleic acid amplification reaction (a) a region of Campylobacter cdtC genomic DNA amplified by a primer pair comprising the sequences of SEQ ID NOs: 25 and 26, or the genomic DNA to be amplified A primer pair capable of amplifying a region of mRNA corresponding to the region;
(12) The nucleic acid amplification reaction is performed using the primer pair (a) and the following primer pairs (b) and (c) (b): A primer pair that can amplify a region of Camptobacter bacterium cdtC genomic DNA amplified by a primer pair consisting of a sequence, or an mRNA region corresponding to the region of genomic DNA to be amplified (c) SEQ ID NOs: 29 and 30 A primer pair capable of amplifying a region of Campylobacter cdtC genomic DNA amplified by a primer pair consisting of the sequence of: or a region of mRNA corresponding to the region of genomic DNA to be amplified,
(13) A kit for use in the method according to 11 above, comprising an instruction manual and two polynucleotides (a) below comprising two polynucleotides capable of specifically binding to Campylobacter bacterium cdtC genomic DNA or mRNA Kit comprising a pair (a) a region of Campylobacter cdtC genomic DNA amplified by a primer pair comprising the sequences of SEQ ID NOs: 25 and 26, or a region of mRNA corresponding to the region of genomic DNA to be amplified A pair of primers that can be amplified,
(14) The kit according to (13) above, which further comprises the primer pair of (b) and (c) below: (b) cdtC of Campylobacter genus bacteria amplified by the primer pair consisting of the sequences described in SEQ ID NOs: 27 and 28 Primer pair capable of amplifying a region of genomic DNA or a region of mRNA corresponding to the region of genomic DNA to be amplified (c) of a Campylobacter bacterium amplified by a primer pair comprising the sequences of SEQ ID NOs: 29 and 30 a primer pair capable of amplifying a region of cdtC genomic DNA or a region of mRNA corresponding to the region of genomic DNA to be amplified;
(15) A method for detecting a Campylobacter bacterium in a test sample, which is described in (a) to (c) below, comprising two polynucleotides that can specifically bind to a cpt genomic DNA or mRNA of a Campylobacter bacterium A method comprising a step of performing a nucleic acid amplification reaction on a test sample using any one or more of the primer pairs of (a) a Campylobacter genus amplified by a primer pair comprising the sequences of SEQ ID NOs: 37 and 38 A primer pair capable of amplifying a bacterial cdtC genomic DNA region or an mRNA region corresponding to the genomic DNA region to be amplified (b) Campylobacter amplified by a primer pair consisting of the sequences of SEQ ID NOs: 40 and 41 Increase the cdtC genomic DNA region of the genus bacteria, or the mRNA region corresponding to the genomic DNA region to be amplified. A possible primer pair (c) a region of Campylobacter cdtC genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 43 and 44, or a region of mRNA corresponding to the region of genomic DNA to be amplified A pair of primers that can be amplified,
(16) The method according to (15) above, wherein the nucleic acid amplification reaction is performed using a quantitative PCR method or a real-time quantitative PCR method,
(17) The method according to (15) or (16) above, further comprising any one or more of the steps described in (i) to (iii) below: (i) described in SEQ ID NOs: 37 and 38 A step of detecting a nucleic acid fragment amplified by the primer pair consisting of the sequence of (ii) using the probe described in SEQ ID NO: 39 (ii) a nucleic acid fragment amplified by the primer pair consisting of the sequences described in SEQ ID NO: 40 and 41 (Iii) using the probe described in SEQ ID NO: 45, the nucleic acid fragment amplified by the primer pair consisting of the sequence described in SEQ ID NO: 43 and 44 Detecting process,
(18) A kit for use in the method described in (15) above, comprising an instruction manual and two polynucleotides that can specifically bind to cdt genomic DNA or mRNA of Campylobacter bacteria (a) To (c) a kit comprising at least one primer pair (a) a region of Campylobacter cdt genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 37 and 38, or A primer pair capable of amplifying a region of mRNA corresponding to the region of genomic DNA to be amplified (b) a region of cpt genomic DNA of Campylobacter bacteria amplified by a primer pair comprising the sequences of SEQ ID NOs: 40 and 41; Or a primer pair capable of amplifying a region of mRNA corresponding to the region of genomic DNA to be amplified (c) SEQ ID NO: 4 And 44 regions of the cdt genomic DNA of Campylobacter bacteria that are amplified by the primer pair consisting of the sequences described or the genomic primer pair capable of amplifying a region of the mRNA corresponding to a region of DNA to be amplified,
(19) The kit according to (18), further comprising at least one detection probe of SEQ ID NOs: 39, 42, and 45.

It is a photograph showing the result of multiplex PCR targeting cdtA, cdtB, and cdtC genes. Multiplex PCR of the cdtA gene (A), cdtB gene (B), and cdtC gene (C) was performed using the boiled template of each strain, and the PCR products were analyzed by 2% agarose gel electrophoresis. Each 5 μL of PCR product and molecular weight marker was applied. Lane 1, 16: 100 bp Ladder marker, Lane 2: C. jejuni ATCC33560, Lane 3: C. jejuni ATCC43432, Lane 4: C. coli ATCC33559, Lane 5: C. coli ATCC43478, Lane 6: C. Fetus ATCC27374, Lane 7: C. Fetus ATCC19438, Lane 8: C. hyointestinalis ATCC35217, Lane 9: C. lari ATCC43675, Lane 10: C.upsaliensis ATCC43954, Lane 11: C. helveticus ATCC51209, Lane 12: H. Hepaticas ATCC51449, Lane 13: H. ducreyi ATCC700724, lane 14: A. actinomycetemcomitans S01, lane 15: E. coli C600. It is a photograph which shows the result of PCR with respect to various Campylobacter bacteria by the common primer which targeted the cdtB gene. PCR was performed using a common primer targeting the cdtB gene using the boiled template of each strain. PCR products were analyzed by 2% agarose gel electrophoresis. PCR products and molecular weight markers were each applied at 5 μL. It is a photograph showing the result of multiplex PCR targeting the cdtB gene using multiple bacterial species as template DNA. Multiplex PCR targeting the cdtB gene was performed using 1 μL of each of the Boil templates of C. jejuni Co1-008, C. coli Co1-192, and C. fetus Co1-187 in various combinations. . PCR products were analyzed by 2% agarose gel electrophoresis. Each 5 μL of PCR product and molecular weight marker was applied. It is a photograph showing the detection limit of multiplex PCR targeting the cdtB gene. Multiplex PCR targeting the cdtB gene was performed using a boiled template of each strain prepared so as to be 10 ³ cfu from 100 ⁰ colony forming unit (cfu) per PCR tube. PCR products were analyzed by 2% agarose gel electrophoresis. Each 5 μL of PCR product and molecular weight marker was applied. On the cdtB genomic DNA sequence of C. jejuni 81-176, a primer (primer name: Cj-CdtBU5) consisting of the sequence described in SEQ ID NO: 1 and a primer consisting of the sequence described in SEQ ID NO: 2 (primer name: Cj-CdtBR6) It is a figure which shows the position which () couple | bonds. The position where each primer binds is underlined. An asterisk (*) indicates a stop codon. The amino acid sequence below the base sequence is the amino acid sequence of the CDT subunit encoded by cdtA, cdtB, and cdtC, respectively. It is a figure which shows the continuation of FIGS. It is a figure which shows the continuation of FIG. A primer (primer name: Cf-CdtBU6) consisting of the sequence described in SEQ ID NO: 3 and a primer (primer name: Cf-CdtBR3) consisting of the sequence described in SEQ ID NO: 4 on the cdtB genomic DNA sequence of C. fetus Co1-187 It is a figure which shows the position which () couple | bonds. The position where each primer binds is indicated by an underline and the name of each primer. The underline without the primer name indicates the SD sequence. An asterisk (*) indicates a stop codon. The amino acid sequence below the base sequence is the amino acid sequence of the CDT subunit encoded by cdtA, cdtB, and cdtC, respectively. The arrow indicates the direction of translation of the encoded polypeptide. It is a figure which shows the continuation of FIGS. A primer (primer name: (Cc-CdtBU5) and a primer consisting of a sequence described in SEQ ID NO: 6 (primer name: Cc-) on the cdtB genomic DNA sequence of C. coli Co1-243 CdtBR5) shows the position where each primer binds, the position where each primer binds is indicated by the underline and each primer name, the underline without the primer name indicates the SD sequence, and the asterisk (*) indicates the stop codon The amino acid sequence below the base sequence is the amino acid sequence of the CDT subunit encoded by cdtA, cdtB, and cdtC, respectively, and the arrow indicates the direction of translation of the encoded polypeptide. It is a figure which shows the continuation of FIGS. It is a figure which shows the calibration curve of C. jejuni by Real-Time PCR. It is a figure which shows the calibration curve of C. coli by Real-Time PCR. It is a figure which shows the calibration curve of C. fetus by Real-Time PCR. It is a figure of the sequence comparison of the cdt gene (SEQ ID NO: 31) of the C. jejuni 81-176 strain and the cdt gene (Genbank accession number: AY442600) of the C. jejuni cdt gene-deficient strain. A chain line (---) indicates a cdtA gene region, a solid line indicates a cdtB gene region, and a dotted line indicates a cdtC gene region. (1) Unknown because the cdtC gene 3 'end region of the gene-deficient mutant cdt gene (AY442300) has not been reported. The dot “.” Indicates a base homologous to the base of the 81-176 strain, and the bar “-” indicates a gap. It is a figure which shows the continuation of FIG. It is a figure which shows the comparison of the C. jejuni cdtC gene and the cdtC gene (Genbank accession number: AY442300) of a C. jejuni cdt gene deletion mutant, and the position of the primer and probe for real-time PCR. It is a figure which shows the continuation of FIG. It is a figure which shows the continuation of FIG. It is a figure which shows the continuation of FIG. 12-3. It is a figure which shows the position of the primer for C. coli Col-243 stock | strain cdt gene (sequence number: 33) and other C. coli cdt genes, and a real-time PCR, and a probe. A chain line (---) indicates a cdtA gene region, a solid line indicates a cdtB gene region, and a dotted line indicates a cdtC gene region. The dot “.” Indicates a base homologous to the base of the Co1-243 strain, and the bar “-” indicates a gap. It is a figure which shows the continuation of FIG. It is a figure which shows the continuation of FIG. 13-2. It is a figure which shows the continuation of FIG. It is a figure which shows the continuation of FIG. 13-4. It is a figure which shows the continuation of FIG. 13-5. It is a figure which shows the continuation of FIG. 13-6. It is a figure which shows the continuation of FIG. 13-7. It is a figure which shows the continuation of FIG. 13-8. It is a figure which shows the continuation of FIG. 13-9. It is a figure which shows the continuation of FIGS. 13-10. It is a figure which shows the continuation of FIGS. 13-11. It is a figure which shows the continuation of FIGS. 13-12. It is a figure which shows the continuation of FIGS. 13-13. It is a figure of sequence comparison of Cdt gene of C. Fetus Co1-187 strain cdt gene (SEQ ID NO: 32) and Thai-derived C. Fetus C90 strain. A chain line (---) indicates a cdtA gene region, a solid line indicates a cdtB gene region, and a dotted line indicates a cdtC gene region. The dot “.” Indicates a base homologous to the base of the Co1-187cdt strain, and the bar “-” indicates a gap. It is a figure which shows the continuation of FIG. It is a figure which shows the continuation of FIG. 14-2. It is a figure which shows the position of the primer for C. fetus cdtC gene and the cdtC gene of Thai origin C. fetus C90 strain | stump | stock, and the primer for real-time PCR, and a probe. It is a figure which shows the continuation of FIG. It is a figure which shows the continuation of FIG. 15-2. It is a figure which shows the continuation of FIG. 15-3.

  As used herein, “cell-swelling lethal toxin” refers to a toxin factor belonging to the group of proteinaceous A-B holotoxins called cytolethal distending toxin (CDT or CLDT). In addition, this may be called cell swelling lethal toxin (elemental), cell swelling lethal toxin (elementary), or the like. Cell swelling lethal toxin has a subunit structure consisting of 3 units of A, B, and C. B subunit is the central unit of toxin activity, and A and B subunits are considered to be involved in cell adhesion. ing. When it acts on the cells, deformation such as large swelling of the cells occurs, and eventually cell death occurs. When heat-labile enterotoxin (LT) produced by enterotoxigenic Escherichia coli is experimentally applied to cells, deformation such as large swelling of the cells is observed, but when the toxin is removed, the cells recover and are lethal. Never do. However, removal of CDT does not restore the cells, leading to death.

  As used herein, “polynucleotide” means a polymer of ribonucleotides or deoxynucleotides comprising a plurality of bases or base pairs. Polynucleotides include RNA, single-stranded and double-stranded DNA. A polynucleotide is intended to include both those that are not modified from the naturally occurring state and those that are modified. Examples of modified bases include tritylated bases and special bases such as inosine.

  As used herein, “polypeptide” means a polymer composed of a plurality of amino acids. Thus, oligopeptides and proteins are also included in the polypeptide concept. Polypeptide is meant to include both unmodified and modified from the naturally occurring state. Modifications include acetylation, acylation, ADP-ribosylation, amidation, flavin covalent bond, heme moiety covalent bond, nucleotide or nucleotide derivative covalent bond, lipid or lipid derivative covalent bond, phosphatidylinositol covalent bond , Crosslinking, cyclization, disulfide bond formation, demethylation, covalent bridge formation, cystine formation, pyroglutamate formation, formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, Examples include methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer RNA-mediated addition of amino acids to proteins, ubiquitination, and the like.

  As used herein, “mutation” refers to an amino acid change in an amino acid sequence or a base change in a base sequence (ie, single or multiple amino acid or nucleotide substitutions, deletions, additions or insertions). Accordingly, “mutant” as used herein refers to an amino acid sequence in which one or more amino acids are changed or a base sequence in which one or more bases are changed. Changes in the base sequence of this variant may or may not alter the amino acid sequence of the polypeptide encoded by the reference polynucleotide. The mutant may be a naturally occurring mutant such as an allelic mutant or a mutant that is not known to exist naturally. A variant may have conservative changes in which a substituted amino acid has similar structural or chemical properties. In rare cases, the variant may have non-conservative substitutions. Guidance for determining which and how many amino acid residues to substitute, insert, or delete without inhibiting biological or immunological activity are computer programs well known in the art, such as Can be discovered using DNA Star software.

  A “deletion” is any amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues are not present, respectively, compared to the amino acid sequence or nucleotide sequence of a naturally occurring cell-expanding lethal toxin polypeptide. It is a change.

  An “insertion” or “addition” is a change in an amino acid or nucleotide sequence to which one or more amino acids or nucleotide residues are added, respectively, as compared to the amino acid sequence or nucleotide sequence of a naturally occurring cell-swelling lethal toxin polypeptide It is.

  A “substitution” is an amino acid or nucleotide sequence change in which one or more amino acids or nucleotides are each replaced with a different amino acid or nucleotide as compared to the amino acid sequence or nucleotide sequence of a naturally occurring cell-expanding lethal toxin polypeptide It is.

  As used herein, “hybridization” refers to the process by which a nucleic acid strand binds to a complementary strand through base pairing.

  As used herein, “detection” includes both qualitative and quantitative meanings. “Quantitative” includes semi-quantitative.

<Detection of the presence of Campylobacter bacteria in the test sample>
The present invention provides a method for detecting the presence of Campylobacter bacteria in a test sample. The detection of the presence of Campylobacter bacteria in the test sample can be performed for various purposes such as diagnosis of Campylobacter infection, rapid diagnosis of food contaminated with Campylobacter bacteria, validation of food processing processes, identification of causative bacteria at the time of food poisoning Is useful.

  The first embodiment of the detection method of the present invention is a method for detecting Campylobacter bacteria in a test sample, comprising two polynucleotides capable of specifically binding to Campylobacter bacteria cdtB genomic DNA or mRNA. (A) Primer capable of amplifying a region of Camptobacter bacterium cdtB genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 1 and 2, or an mRNA region corresponding to the genomic DNA region to be amplified The region of the cdtB genomic DNA of Campylobacter bacteria amplified by the primer pair consisting of the sequences described in SEQ ID NO: 3 and 4 or the mRNA region corresponding to the region of the genomic DNA to be amplified A step of performing a nucleic acid amplification reaction on a test sample using any one or more of the primer pairs that can be amplified It is the method of including.

  The above method is a method for detecting bacteria by amplifying a region specific to each cdtB genomic DNA or mRNA for C. jejuni and C. fetus. As a primer used in the above method, for C. jejuni, firstly, “a primer pair consisting of the sequences described in SEQ ID NOs: 1 and 2 (Example primer: Cj-CdtBU5 and Cj-CdtBR6)” is mentioned. However, the present invention is not limited to the above sequence itself, and is a primer pair consisting of two polynucleotides capable of specifically binding to C. jejuni cdtB genomic DNA or mRNA. Any other sequence can be used as long as it is a primer pair that can amplify the region amplified by the primer pair consisting of the sequences of Nos. 1 and 2 or the corresponding mRNA region. As used herein, “specific binding” is intended to exclude accidental binding (non-specific binding) from “binding”. FIG. 5 shows the position of the cdtB genomic DNA (SEQ ID NO: 31) of C. jejuni strain 81-176 to which “a primer pair consisting of the sequences of SEQ ID NOs: 1 and 2” binds. When the genomic DNA of C. jejuni ATCC33560 strain (DDBJ Accession No .: AB274783) or C. jejuni ATCC43432 strain (DDBJ Accession No .: AB274784) is amplified by a primer pair consisting of the sequences of SEQ ID NOs: 1 and 2, An amplification product of 714 bp is obtained.

  As for C. fetus, first, “a primer pair consisting of the sequences described in SEQ ID NOs: 3 and 4 (Example primer: Cf-CdtBU6 and Cf-CdtBR3)” can be mentioned. Any primer pair that can amplify a region amplified by the “primer pair consisting of the sequences of SEQ ID NOs: 3 and 4” or a corresponding mRNA region using C. fetus cdtB genomic DNA as a template, Even arrays can be used. FIG. 6 shows the position of the cdtB genomic DNA (SEQ ID NO: 32) of the C. fetus Co1-187 strain to which the “primer pair consisting of the sequences described in SEQ ID NOs: 3 and 4” binds. When the genomic DNAs of C. fetus ATCC27374 strain (DDBJ Accession No .: AB274802) and ATCC19438 strain (DDBJ Accession No .: AB274803) are amplified by a primer pair consisting of the sequences of SEQ ID NOs: 3 and 4, 553 bp are amplified. A product is obtained.

  The method of the present invention is described as follows: "(a) a region of Campylobacter cdtB genomic DNA amplified by a primer pair comprising the sequences of SEQ ID NOs: 1 and 2, or an mRNA corresponding to the region of the genomic DNA to be amplified" The region of the cdtB genomic DNA of Campylobacter bacteria amplified by the primer pair consisting of the sequence described in (b) SEQ ID NOs: 3 and 4, or the region of the genomic DNA to be amplified “A primer pair capable of amplifying a region of mRNA corresponding to” may be used separately, but both primer pairs may be used simultaneously in a single nucleic acid amplification reaction. As in the examples, PCR using multiple PCR primers in a single reaction system is called multiplex PCR, and electrophoresis of PCR products and observation of the size of the band enables simultaneous detection of multiple bacterial species. Can be distinguished. The present invention provides a method for detecting Campylobacter bacteria by a nucleic acid amplification method using primers and combinations thereof suitably used for amplification of a plurality of nucleic acid regions, typified by this multiplex PCR method. The nucleic acid amplification method in the present invention is not limited as long as the target amplification product is obtained. The PCR method is a specific example of a preferred nucleic acid amplification method in the present invention. The method of the present invention may be carried out as a quantitative method by a real-time PCR method or the like.

  The method of the present invention corresponds to the above-mentioned region of cdtB genomic DNA of Campylobacter genus bacteria amplified by the primer pair consisting of the sequences described in “(a) SEQ ID NOS: 1 and 2” or the region of the genomic DNA to be amplified. Primer pair capable of amplifying a region of mRNA "and / or" (b) a region of Campylobacter cdtB genomic DNA amplified by a primer pair comprising the sequences of SEQ ID NOs: 3 and 4, or the genome to be amplified Primer that amplifies a region specific to the Cdt. Coli cdtB genomic DNA together with a primer pair that can amplify the mRNA region corresponding to the DNA region: “(c) a primer comprising the sequence of SEQ ID NOs: 5 and 6” The region of Campylobacter cdtB genomic DNA amplified by the pair, or the region of mRNA corresponding to the region of genomic DNA to be amplified Primer pairs "which can be amplified may be used in a single nucleic acid amplification reaction system. That is, the present invention provides a method capable of simultaneously detecting three types of Campylobacter bacteria of C. jejuni, C. fetus, and C. coli in a test sample. The present inventors performed a nucleic acid amplification reaction using the above three types of primers simultaneously, and confirmed that C. jejuni, C. fetus, and C. coli can be detected at once. . As shown in the Examples, the method of the present invention is a highly specific method without misdetecting other species of Campylobacter bacteria while reliably detecting the target Campylobacter bacteria. Position of cdtB genomic DNA (SEQ ID NO: 33) of C. coli Co1-243 strain to which “a primer pair consisting of the sequences described in SEQ ID NO: 5 and 6 (Example primer: Cc-CdtBU5 and Cc-CdtBR5)” binds Is shown in FIG.

  In the method of the present invention, after the step of performing a nucleic acid amplification reaction using specific primers for C. jejuni, C. fetus, C. coli described above, “candB genomic DNA or mRNA amplified fragment of Campylobacter bacterium” The step of determining the presence of Campylobacter bacterium from the presence or absence or the molecular weight of the amplified fragment "or the" quantifying the amount of amplified fragment of cdtB genomic DNA or mRNA of Campylobacter bacterium "is included.

  In addition, the method of the present invention may be performed before or after the step of performing a nucleic acid amplification reaction using specific primers for C. jejuni, C. fetus, C. coli, and “genomic DNA of any one of Campylobacter bacteria cdtA to C”. Alternatively, the “step of performing a nucleic acid amplification reaction using a common primer pair composed of two polynucleotides that can bind to mRNA in common” can be performed. The above "common primer pair consisting of two polynucleotides capable of binding in common to any genomic DNA or mRNA of Campylobacter cdtA to C" means C. jejuni, C. fetus, and C. coli. A primer pair capable of amplifying genomic DNA encoding any one of cdtA, cdtB, and cdtC, or cdtA, cdtB, C. jejuni, C. fetus, and C. coli And a primer pair capable of amplifying mRNA encoding either cdt or cdtC. Specific examples of such a primer include a primer pair (Example cdtB common primer: C-CdtBcom1 and (C-CdtBcom2)) consisting of the sequences described in SEQ ID NOs: 7 and 8 used in Examples of the present application. In addition to the above primer pair, a primer pair (cdtB common primer pair) consisting of the sequences described in SEQ ID NO: 9 (WO2005 / 054472 SEQ ID NO: 7) and 10 (WO2005 / 054472 SEQ ID NO: 8), SEQ ID NO: 11 (WO2005 / 054472 SEQ ID NO: 47), 12 (WO2005 / 054472 SEQ ID NO: 48), SEQ ID NO: 13 (WO2005 / 054472 SEQ ID NO: 49), and 14 (WO2005 / 054472 SEQ ID NO: 50). Primer pair (cdtB common primer pair) comprising a combination of two sequences from four sequences, a primer comprising the sequences described in SEQ ID NO: 15 (WO2005 / 054472 SEQ ID NO: 64) and 16 (WO2005 / 054472 SEQ ID NO: 65) (A primer pair common to cdtA), SEQ ID NO: 17 (WO2005 / 054472 SEQ ID NO: 66) and a primer pair (cdtC common primer pair) comprising the sequences described in 18 (WO2005 / 054472 SEQ ID NO: 67) are also preferably used. The common primer pair can amplify genomic DNA encoding cdtA, cdtB, and cdtC for all bacteria of C. jejuni, C. fetus, and C. coli. This is explained in detail in WO2005 / 054472.Nucleic acid amplification reaction using the above-mentioned "common primer pair consisting of two polynucleotides capable of binding to cdtA-C genomic DNA or mRNA of Campylobacter bacteria" In combination with a nucleic acid amplification reaction using specific primers for C. jejuni, C. fetus, and C. coli. As described above, the primer pair commonly amplifies genomic DNA or mRNA that encodes cell expansion lethal toxins of at least three C. coli, C. jejuni, and C. fetus species. The common primer pair can be expected to amplify genomic DNA or mRNA encoding not only the above three bacterial species but also other Campylobacter bacteria. Similarly, for a primer pair that can amplify the same genomic DNA region or corresponding mRNA region as the primer pair, the genomic region or corresponding mRNA region can be amplified in common with the above three bacterial species, It is considered that the genomic region or the corresponding mRNA region of other Campylobacter bacteria can be amplified.

  A second embodiment of the method of the present invention is a method for detecting a Campylobacter bacterium in a test sample, which comprises a primer pair comprising two polynucleotides capable of specifically binding to Campylobacter bacterium cdtA genomic DNA or mRNA. “(A) a region of Campylobacter cdtA genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 19 and 20 or a region of mRNA corresponding to the region of genomic DNA to be amplified can be amplified. A method comprising a step of performing a nucleic acid amplification reaction on a test sample using a “primer pair”. The above method amplifies a part of cdtA genomic DNA or mRNA with a primer pair that specifically binds to C. coli cdtA genomic DNA or mRNA, and detects C. coli from the presence or absence of the amplified fragment or the molecular weight of the amplified fragment. Is possible. A specific example of the primer is “a primer pair consisting of the sequences described in SEQ ID NOs: 19 and 20 (Example primer: Cc-CdtAU1 and Cc-CdtAR1)”. In the method of the second aspect, in addition to the primer pair (a), a primer pair consisting of two polynucleotides that can specifically bind to cptA genomic DNA or mRNA of Campylobacter genus "(b) SEQ ID NO: 21" And the region corresponding to the region of cdtA genomic DNA of Campylobacter bacteria amplified by the primer pair consisting of the sequences described in 22 and 22 (Example primer: Cj-CdtAU2 and Cj-CdtAR2), or the mRNA corresponding to the region of the genomic DNA to be amplified A primer pair capable of amplifying a region ”and / or“ (c) a Campylobacter bacterium amplified by a primer pair consisting of the sequences of SEQ ID NOs: 23 and 24 (Example primers: Cf-CdtAU1 and Cf-CdtAR1) “Primer pairs that can amplify the region of cdtA genomic DNA or the region of mRNA corresponding to the region of genomic DNA to be amplified”. With occasional use, it is possible to detect C. jejuni and / or C. fetus as well as C. coli.

  In the method of the present invention, after the step of performing a nucleic acid amplification reaction using specific primers for C. jejuni, C. fetus, C. coli described above, “amplified fragment of cptA genomic DNA or mRNA of Campylobacter sp. The step of determining the presence of Campylobacter bacterium from the presence or absence or the molecular weight of the amplified fragment "or" the step of quantifying the amount of amplified fragment of cdtA genomic DNA or mRNA of Campylobacter bacterium ". The amplified fragment in the present invention may be DNA or RNA.

  A third embodiment of the method of the present invention is a method for detecting a Campylobacter bacterium in a test sample, comprising a primer pair consisting of two polynucleotides capable of specifically binding to a Campylobacter bacterium cdtC genomic DNA or mRNA. "(A) a region of Campylobacter cdtC genomic DNA amplified by a primer pair consisting of the sequences set forth in SEQ ID NOs: 25 and 26 (Example primer: Cc-CdtCU1 and Cc-CdtCR1), or the genome to be amplified A method comprising a step of performing a nucleic acid amplification reaction on a test sample using a “primer pair capable of amplifying an mRNA region corresponding to a DNA region”. The above method amplifies a part of cdtC genomic DNA or mRNA with a primer pair that specifically binds to C. coli cdtC genomic DNA or mRNA, and detects C. coli from the presence or absence of the amplified fragment or the molecular weight of the amplified fragment. Is possible. In the method of the third aspect, in addition to the above primer pair (a), a primer pair consisting of two polynucleotides capable of specifically binding to cptA genomic DNA or mRNA of Campylobacter bacteria ((b) SEQ ID NO: 27 And a region of the Camptobacter bacterium cdtC genomic DNA amplified by a primer pair consisting of the sequences described in 28 and 28 (Example primer: Cj-CdtCU1 and Cj-CdtCR2), or an mRNA corresponding to the region of the genomic DNA to be amplified A primer pair capable of amplifying a region ”and / or“ (c) a Campylobacter bacterium amplified by a primer pair consisting of the sequences of SEQ ID NOs: 29 and 30 (Example primers: Cf-CdtCU2 and Cf-CdtCR1) “Primer pairs that can amplify the region of cdtC genomic DNA or the region of mRNA corresponding to the region of genomic DNA to be amplified”. To Using, C. Coli and simultaneously, it is possible to detect either or both of C. Jejuni and C. fetus.

  In the method of the present invention, after the step of performing a nucleic acid amplification reaction using specific primers for C. jejuni, C. fetus, C. coli as described above, “candC genomic DNA or mRNA amplified fragment of Campylobacter bacterium” The step of determining the presence of Campylobacter bacterium from the presence or absence or the molecular weight of the amplified fragment ”or“ the step of quantifying the amount of amplified fragment of cdtC genomic DNA or mRNA of Campylobacter bacterium ”is included.

  A fourth embodiment of the method of the present invention is a method for detecting Campylobacter bacteria in a test sample, comprising a primer pair comprising two polynucleotides capable of specifically binding to Campylobacter bacteria cdt genomic DNA or mRNA. “(A) The region of Campylobacter cdt genomic DNA amplified by the primer pair consisting of the sequences of SEQ ID NOs: 37 and 38, or the region of mRNA corresponding to the region of genomic DNA to be amplified can be amplified. Primer pair "," (b) a region of Campylobacter cdt genomic DNA amplified by a primer pair comprising the sequences of SEQ ID NOs: 40 and 41, or a region of mRNA corresponding to the region of genomic DNA to be amplified A primer pair consisting of the sequences described in SEQ ID NOs: 43 and 44 Thus, a test sample using any one or more primer pairs of “a primer pair capable of amplifying a region of cdt genomic DNA of Campylobacter bacterium to be amplified or a region of mRNA corresponding to the region of genomic DNA to be amplified” Is a method comprising a step of performing a nucleic acid amplification reaction.

  In the above method, for C. jejuni, C. coli, and C. fetus, a part of the cdtC genomic DNA or mRNA is amplified by a primer pair that specifically binds to the respective cdtC genomic DNA or mRNA, and the presence or absence of the amplified fragment or In this method, bacteria are detected from the molecular weight of the amplified fragment.

  As a primer used in the above method, for C. jejuni, firstly, “a primer pair consisting of the sequences described in SEQ ID NOs: 37 and 38 (Example primer: Cj cdtRTU2 and Cj cdtRTR2)” can be mentioned. Is not limited to the above sequence itself, but is a primer pair comprising two polynucleotides capable of specifically binding to C. jejuni cdtC genomic DNA or mRNA, and using C. jejuni cdtC genomic DNA as a template, “SEQ ID NO: Any other sequence can be used as long as it is a primer pair capable of amplifying the region amplified by the primer pair consisting of the sequences described in: 37 and 38 or the corresponding mRNA region. FIG. 12 shows the positions of cdtC genomic DNA of a total of 11 C. jejuni strains to which “primer pairs consisting of the sequences of SEQ ID NOs: 37 and 38” bind. An amplification product is also obtained for the mutation-deficient cdt gene (accession number: AY442300) of C. jejuni by the primer pair consisting of the sequences described in SEQ ID NOs: 37 and 38.

  As for C. coli, first, “a primer pair consisting of the sequences described in SEQ ID NOs: 40 and 41 (Example primers: Cc cdtRTU5 and Cc cdtRTR5)” can be mentioned, but the sequence is not limited thereto. As long as it is a primer pair that can amplify a region amplified by the “primer pair consisting of the sequences described in SEQ ID NOs: 40 and 41” or a corresponding mRNA region using C. coli cdtC genomic DNA as a template, It can be used even if it exists. FIG. 13 shows the positions of the cdtC genomic DNA of 18 C. coli strains to which the “primer pair consisting of the sequences of SEQ ID NOs: 40 and 41” binds.

  Furthermore, as for C. fetus, first, “a primer pair consisting of the sequences described in SEQ ID NOs: 43 and 44 (Example primer: Cf cdtRTU1 and Cf cdtRTR1)” can be mentioned, but the sequence is not limited thereto. As long as it is a primer pair that can amplify a region amplified by the “primer pair consisting of the sequences described in SEQ ID NOs: 43 and 44” or a corresponding mRNA region using C. fetus cdtC genomic DNA as a template, It can be used even if it exists. FIG. 15 shows the positions of cdtC genomic DNA of a total of 12 C. FETAS strains to which “primer pairs consisting of the sequences of SEQ ID NOs: 43 and 44” bind. An amplification product is also obtained for the cdt gene of C. fetus C90 strain isolated in Thailand by the primer pair consisting of the sequences of SEQ ID NOs: 43 and 44.

  The method of the present invention is described as follows. "(A) mRNA corresponding to a region of Campylobacter cdt genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 37 and 38, or a region of the genomic DNA to be amplified. A primer pair capable of amplifying the region of "," (b) a region of Campylobacter bacterium cdt genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 40 and 41, or a region of said genomic DNA amplified A primer pair capable of amplifying a region of mRNA corresponding to ”and“ (c) a region of Camptobacter bacterium cdt genomic DNA amplified by the primer pair consisting of the sequences set forth in SEQ ID NOs: 43 and 44; “A primer pair capable of amplifying a region of mRNA corresponding to the region of genomic DNA” may be used separately. A combination of 3 types of primer pairs in the width reactions can also be used simultaneously. The present invention provides a method for detecting Campylobacter bacteria by a nucleic acid amplification method using primers and combinations thereof suitably used for amplification of a plurality of nucleic acid regions, typified by a multiplex PCR method. The nucleic acid amplification method in the present invention is not limited as long as the target amplification product is obtained. The PCR method is a specific example of a preferred nucleic acid amplification method in the present invention.

  In the method of the present invention, after the step of performing a nucleic acid amplification reaction using specific primers for C. jejuni, C. fetus, C. coli as described above, “candC genomic DNA or mRNA amplified fragment of Campylobacter bacterium” The step of determining the presence of Campylobacter bacterium from the presence or absence or the molecular weight of the amplified fragment ”or“ the step of quantifying the amount of amplified fragment of cdtC genomic DNA or mRNA of Campylobacter bacterium ”is included.

  The step of quantifying the amount of amplified fragment may be performed by a real-time PCR method or the like. Real-time PCR is a method for monitoring and analyzing the amount of PCR amplification in real time, and does not require electrophoresis after nucleic acid fragment amplification, and is excellent in rapidity and quantification. In the present invention, as an example of the quantification of the amount of cells by the real-time PCR method, PCR is first performed using DNA prepared from a known amount of cell samples diluted serially as a standard, and constant amplification is performed in a region where amplification occurs exponentially. A calibration curve is created by plotting the number of cycles (threshold; Ct value) as the product amount on the horizontal axis and the initial DNA amount on the vertical axis. Thereafter, the test sample is also reacted under the same conditions to determine the Ct value, the DNA in the test sample is measured from the calibration curve, and the bacterial cells are quantified.

Real-time PCR monitoring is generally performed using a fluorescent reagent, and is performed using an apparatus in which a thermal cycler and a spectrofluorometer are integrated. Examples of the fluorescence monitoring method include, but are not limited to, a method using an intercalator and a known method such as a TaqMan probe method.
For the detection of the nucleic acid amplification fragment of the present invention using the real-time PCR method in the present invention, for example, “(i) Used for detection of a nucleic acid fragment amplified by a primer pair consisting of the sequences of SEQ ID NOs: 37 and 38 A sequence that can be used for detection of a nucleic acid fragment amplified by a primer pair consisting of the sequences described in SEQ ID NO: 39 (Example probe: Cj RTP2) ”,“ (ii) SEQ ID NO: 40 and 41 ” SEQ ID NO: 45, which can be used to detect a nucleic acid fragment amplified by a primer pair consisting of the sequences described in SEQ ID NO: 42 (Example probe: Cc RTP5) ”and“ (iii) SEQ ID NO: 43 and 44 ” Any one or more of the probes described in (Example Probe: Cf RTP1) ”can be used.

  These probes are preferably attached with a detectable label as appropriate. As the labeling component, a fluorescent substance, a radioisotope, a luminescent substance, an enzyme active substance, a magnetically observable substance, or the like is used. The most preferred label in the present invention includes a fluorescent label.

  When used for real-time PCR detection, the 5 'end of the probe is modified with a fluorescent substance and the 3' end is modified with a quencher substance. During the PCR extension reaction step, the 5 '→ 3' exonuclease activity of DNA polymerase degrades the probe hybridized to the DNA region that serves as the template for PCR, resulting in fluorescence that was suppressed by the quencher. The amplified fragment can be quantified. Examples of fluorescent substances used for modification in the present invention include, but are not limited to, FAM, TAMRA, Orange 560, and the like. Examples of the quencher substance include BHQ (black hole quencher), but are not limited thereto. As in the example, it is possible to detect a plurality of nucleic acid amplification fragments simultaneously by adding different fluorescent labels to each probe.

  By the method of the present invention, the presence of C. coli, C. jejuni, and C. fetus in various biological samples of humans or animals (for example, swab specimens such as stool and rectum) and foods can be easily and quickly detected. You can know for each species. When practicing the method of the present invention, a polynucleotide prepared by preparing a polynucleotide from a biological sample or food suspected of the presence of Campylobacter bacteria by a polynucleotide preparation method (such as a boil method) well known to those skilled in the art. Can be used as a test sample of the present invention.

<Kit>
The present invention provides a kit for use in the detection method of the present invention. These kits contain instructions for use in addition to the primer pairs of the present invention. Still other elements may be included, such as fluorescent probes, intercalators, polynucleotide preparation reagents, positive or negative primer pairs, and the like.

  The first aspect of the kit of the present invention is “(a) a region of Camptobacter bacterium cdtB genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 1 and 2, or the amplified genomic DNA A primer pair capable of amplifying a region of mRNA corresponding to the region, and "(b) a region of Campylobacter cdtB genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 3 and 4, or amplified A kit comprising at least one primer pair of “a primer pair capable of amplifying an mRNA region corresponding to the genomic DNA region”. The primer pair (a) amplifies C. jejuni, and the primer pair (b) C. featus amplifies a region specific to each cdtB genomic DNA or mRNA (region existing characteristically).

  As the above-mentioned primer, for C. jejuni, firstly, “a primer pair consisting of the sequences of SEQ ID NOs: 1 and 2 (Example primer: Cj-CdtBU5 and Cj-CdtBR6)” can be mentioned. It is not limited to the sequence itself, but a primer pair capable of amplifying a region amplified by “a primer pair consisting of the sequences described in SEQ ID NOs: 1 and 2” or a corresponding mRNA region using C. jejuni cdtB genomic DNA or mRNA as a template. Any other sequence of polynucleotides can be used.

  Similarly, as for C. fetus, first, “a primer pair consisting of the sequences described in SEQ ID NOs: 3 and 4 (Example primer: Cf-CdtBU6 and Cf-CdtBR3)” can be mentioned. Any primer pair that can amplify a region amplified by the “primer pair consisting of the sequences described in SEQ ID NOs: 3 and 4” or a corresponding mRNA region using C. fetus cdtB genomic DNA or mRNA as a template. Even polynucleotides of other sequences can be used.

  The “polynucleotide of other sequence” constituting the primer pair of the present invention has a strand length of at least 15 bases or 20 bases or more complementary to C. jejuni or C. fetus cdtB genomic DNA or mRNA. For example, a polynucleotide having a length of 15 to 100 bases, 20 to 100 bases, a length of 15 to 35 bases, and a length of 20 to 35 bases. Here, “complementary strand” refers to the other strand with respect to one strand of a double-stranded nucleic acid consisting of A: T (U in the case of RNA) and G: C base pairs. Further, the term “complementary” is not limited to a case where the sequence is completely complementary in at least 15 consecutive nucleotide regions, and is at least 70%, preferably at least 80%, more preferably 90%, and even more preferably 95%. What is necessary is just to have the homology on the above base sequences. As an algorithm for determining homology, an algorithm usually used by those skilled in the art to determine homology can be used in addition to those described in the present specification. The above-mentioned “other polynucleotide constituting the primer pair of the present invention” hybridizes with cdtB genomic DNA under hybridization conditions, preferably under stringent conditions, and hybridizes with DNA encoding other polypeptides. Does not soy. The primer pair of the present invention does not hybridize to a region common to cdtB genomic DNA of various Campylobacter bacteria under normal hybridization conditions, preferably stringent conditions. The above-mentioned “polynucleotide of other sequence constituting the primer pair of the present invention” includes, for example, one or a plurality of bases (for example, the base sequence described in any one of SEQ ID NO: 1, 2, SEQ ID NO: 3 and 4). From 1 to 10 or 1 to 5, preferably 1 to 4, more preferably 1 to 3, most preferably 1 or 2 bases) added, deleted, substituted and / or inserted. A polynucleotide having a chain length of at least 15 bases or 20 bases or more.

  The above-mentioned “polynucleotide of other sequence constituting the primer pair of the present invention” is appropriately designed by those skilled in the art based on the polynucleotide sequence described in the above SEQ ID No. and / or the known cdtB genomic DNA sequence, It can be prepared by synthesis. Also, whether the polynucleotide prepared as described above can amplify the same genomic DNA region as the primer pair before mutation is carried out by performing a nucleic acid amplification reaction using the prepared mutation primer and analyzing the amplification product. Thus, it can be easily evaluated.

  The kit of the present invention comprises the primer pair (a) for amplifying a region specific for C. jejuni cdtB genomic DNA or mRNA, and the primer pair for amplifying a region specific for C. fetus cdtB genomic DNA or mRNA. In addition, a primer pair that amplifies a region specific for C. coli cdtB genomic DNA or mRNA can be included. As described above, the kit of the present invention including all of the specific primer pairs for each of the three types of C. jejuni, C. fetus, and C. coli can be used to perform mixed infection of the above Campylobacter bacterium once by a multiplex PCR method or the like. Can be detected. As a primer pair for amplifying a region specific to the C. coli cdtB genomic DNA, “a primer pair consisting of the sequences described in SEQ ID NOs: 5 and 6 (Example primer: Cc-CdtBU5 and Cc-CdtBR5)”, and Others capable of amplifying the region of Campylobacter cdtB genomic DNA amplified by the “primer pair consisting of the sequences of SEQ ID NOs: 5 and 6” or the mRNA region corresponding to the region of genomic DNA to be amplified Can be mentioned.

  The second embodiment of the kit of the present invention is based on the primer pair of the present invention by “(a): a primer pair consisting of the sequences described in SEQ ID NOs: 19 and 20 (Example primer: Cc-CdtAU1 and Cc-CdtAR1)” A kit comprising a primer pair capable of amplifying a region of Campylobacter cdtA genomic DNA to be amplified or a region of mRNA corresponding to the region of genomic DNA to be amplified. The primer pair (a) specifically binds to C. coli cdtA. The kit according to the second aspect includes, in addition to the primer pair (a), a primer pair consisting of the primer pair “(b) SEQ ID NOS: 21 and 22 (Example primer: Cj-CdtAU2 and Cj-CdtAR2). A primer pair capable of amplifying a region of Campylobacter cdtA genomic DNA amplified by, or a region of mRNA corresponding to the region of said genomic DNA amplified, and / or “(c) SEQ ID NOS: 23 and 24” A region of Camptobacter bacterium cdtA genomic DNA amplified by a primer pair consisting of the described sequences (Example primer: Cf-CdtAU1 and Cf-CdtAR1), or a region of mRNA corresponding to the region of genomic DNA to be amplified An “amplifying primer pair” can be included. It is considered that a kit containing the primer pair (b) and / or (c) in addition to the primer pair (a) can detect mixed infection of the Campylobacter bacteria at a time by multiplex PCR method or the like. .

  A third embodiment of the kit of the present invention is a primer pair of the present invention, comprising a primer pair consisting of the sequences described in “(a) SEQ ID NO: 25) and 26 (Example primer: Cc-CdtCU1 and Cc-CdtCR1)” A kit comprising a primer pair capable of amplifying a region of Camptobacter bacterium cdtC genomic DNA to be amplified or a region of mRNA corresponding to the region of genomic DNA to be amplified. The primer pair (a) specifically binds to C. coli cdtC. The kit according to the third aspect includes, in addition to the primer pair (a), a primer pair consisting of the primer pair “(b) SEQ ID NOS: 27 and 28 (Example primer: Cj-CdtCU1 and Cj-CdtCR2). A primer pair capable of amplifying a region of Campylobacter cdtC genomic DNA amplified by, or a region of mRNA corresponding to the region of genomic DNA amplified, and / or “(c) SEQ ID NOs: 29 and 30” A region of Camptobacter bacterium cdtC genomic DNA amplified by a primer pair consisting of the sequence described (Example primer: Cf-CdtCU2 and Cf-CdtCR1), or a region of mRNA corresponding to the region of genomic DNA to be amplified An “amplifying primer pair” can be included. It is considered that a kit containing the primer pair (b) and / or (c) in addition to the primer pair (a) can detect mixed infection of Campylobacter bacteria at one time by multiplex PCR method or the like.

The fourth aspect of the kit of the present invention is the primer pair of the present invention, wherein “(a) a region of Campylobacter cdt genomic DNA amplified by the primer pair consisting of the sequences described in SEQ ID NOs: 37 and 38, or Primer pair capable of amplifying a region of mRNA corresponding to the region of genomic DNA to be amplified (Example primer: Cj cdtRTU2 and Cj cdtRTR2) "," (b) Primer pair consisting of the sequences of SEQ ID NOs: 40 and 41 " A primer pair capable of amplifying a region of Camptobacter cdt genomic DNA amplified by the above or a region of mRNA corresponding to the region of genomic DNA to be amplified (Example primers: Cc cdtRTU5 and Cc cdtRTR5) "and" ( c) cpt genomic DNA of Campylobacter bacteria amplified by a primer pair consisting of the sequences of SEQ ID NOs: 43 and 44 Or a primer pair capable of amplifying a region of mRNA corresponding to the region of the genomic DNA to be amplified (Example primer: Cf cdtRTU1 and Cf cdtRTR1) ”. It is considered that a kit containing the primer pair (a), primer pair (b) and / or (c) can detect mixed infection of Campylobacter bacteria at one time by multiplex PCR method or the like.
Furthermore, the kit described above includes “(i) a probe according to SEQ ID NO: 39 (Example probe: Cj, which can be used for detection of a nucleic acid fragment amplified by a primer pair consisting of the sequences according to SEQ ID NO: 37 and 38”. RTP2) "," (ii) Probe according to SEQ ID NO: 42 (Example probe: Cc RTP5) that can be used for detection of a nucleic acid fragment amplified by a primer pair consisting of the sequences according to SEQ ID NO: 40 and 41 " And “(iii) Probe described in SEQ ID NO: 45 (Example probe: Cf RTP1) that can be used for detection of a nucleic acid fragment amplified by a primer pair consisting of the sequences described in SEQ ID NO: 43 and 44”. One or more detection probes may be included.

  Furthermore, the kit of the present invention can include any one or more of the common primer pairs described above.

  The type of nucleic acid amplification reaction performed using the kit of the present invention is not particularly limited as long as the target amplification product can be obtained. For example, it can be selected from known nucleic acid amplification reactions such as PCR (polymerase chain reaction) method (including RT-PCR method), ICAN method, LAMP method, SDA method, LCR method, NASBA method and the like. A suitable method is the PCR method.

The kit of the present invention can contain other components in addition to the primer pair and the instruction manual. Examples of other components include, but are not limited to, a positive primer, a negative primer, a polynucleotide preparation reagent, a fluorescently labeled probe, and the like. A positive primer can be appropriately designed and prepared from a known sequence of Campylobacter bacteria by those skilled in the art. Known sequences of Campylobacter bacteria can be easily obtained from a database. For example, the 16S rRNA sequence of C. jejuni ATCC 33560 strain is represented by accession number: M59298 (SEQ ID NO: 34), and the C. coli ATCC 33559 strain 16S rRNA sequence is accessed by accession. No .: M59073 (SEQ ID NO: 35) and C. fetus ATCC 27374 strain 16S rRNA sequence is available by accession number: M65012 (SEQ ID NO: 36).
It should be noted that all prior art documents cited in the present specification are incorporated herein by reference.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not restrict | limited to these Examples.

[1. Materials and methods]
(1-1 strain)
ATCC, patients and animal-derived Campylobacter bacteria, cdt gene positive bacteria other than Campylobacter bacteria and other intestinal infection bacteria were used (Table 1). In addition, C. jejuni Co1-008 strain, C. coli Co1-243 strain, C. fetus (C. fetus Co1-187 strain) were used as PCR positive controls, and negative As a control, E. coli C600 strain was used.

[Table 1]
(Campylobacter bacteria used for evaluation of multiplex PCR targeting the CdtB gene, Cdt-positive bacteria other than Campylobacter bacteria, and other intestinal infections)

(1-2 Medium and culture conditions, reagents, enzymes)
Campylobacter bacteria, Escherichia coli, and Shigella bacteria were cultured as follows. CM271 BLOOD AGAR BASE No.2 (Oxoid, Basingstoke, UK) [7.5 g Proteose peptone, 1.25 g Liver digest, 2.5 g Yeast extract, 2.5 g NaCl, 6.0 g Agar / 500 mL distilled water (DW), pH 7.4 ± 0.2 at 25 ℃] equine aseptic defibrillated blood (Japan Biomaterials Center, Tokyo) with 5% equine blood agar and Campylobacter selective supplement (Skirrow) (OXOID) ( A medium supplemented with 5 mg Vancomycin, 2.5 mg Trimethoprim Lactate, 1,250 iu Polymyxin B / 500 mL) (hereinafter referred to as “Skirrow medium”) was used. Campylobacter bacteria were cultured at 37 ° C for 2 to 4 days under microaerobic conditions (10% CO ₂ , 5% O ₂ ) using LOW TEMPERATURE O ₂ / CO ₂ INCUBATER MODEL-9200 (Waken Pharmaceutical, Tokyo) 85% N ₂ ). Escherichia coli is LB-Lenox liquid medium (Difco Laboratories, Detroit, MI, USA) (5.0 g Bacto tryptone, 2.5 g Bacto yeast extract, 2.5 g NaCl / 500 mL DW), LB-Lenox agar medium (Difco Laboratories) (5.0 g Bacto tryptone, 2.5 g Bacto yeast extract, 2.5 g NaCl, Agar 7.5 g / 500 mL DW) and cultured at 37 ° C. for 16 to 20 hours.

Helicobacter hepaticus (H. hepaticus) is derived from Brucella Agar (Becton Dickinson, Franklin Lakes, NJ, USA) (5 g Proteose peptone, 5 g Pancreatic digest of casein, 0.5 g Dextrose, 1 g Yeast extract, 2.5 g NaCl, 6.0 g Agar / 500 mL DW, pH 7.4 ± 0.2 at 25 ° C) with sheep blood agar medium supplemented with sterile sheep defibrinated blood (Japan Biomaterials Center) to a final concentration of 5%, 37 ° C For 12 days under microaerobic conditions (10% CO ₂ , 5% O ₂ , 85% N ₂ ).

The flexible lower gonococcus Haemophilus ducreyi (H. ducreyi) is prepared using Solution A [25 g Heart infusion broth (Difco Laboratories), 15 g Agar / 500 mL DW, pH 7.4 ± 0.2 at 25 ℃] and Solution B [10 g Hemoglobin (Becton Dickinson) / 500 mL DW] at 121 ° C for 15 minutes under high pressure steam sterilization and Solution C [Fetal bovine serum 100 mL (Invitrogen), IsoVitaleX (Becton Dickinson) 10 mL] For 7 days at 37 ° C. under microaerobic conditions (10% CO ₂ , 5% O ₂ , 85% N ₂ ).

Actinobacillus actinomycetemcomitans (A. actinomycetemcomitans) is Trypticace soy agar (Becton Dickinson) (2.5 g Papaic digest of soybean meal, 7.5 g Pancreatic digest of casein, 2.5 g NaCl, 7.5 g Agar / 500 mL DW, pH 7.3 ± 0.2 at 25 ° C.) was added to 0.6% Yeast extract (Difco Laboratories) and cultured at 37 ° C. for 2 days under conditions containing 10% CO ₂ and 90% air.

Salmonella spp. Is Trypticace soy broth (Becton Dickinson) (1.5 g Papaic digest of soybean meal, 8.5 g Pancreatic digest of casein, 2.5 g NaCl, 1.25 g K ₂ HPO ₄ , 1.25 g Dextrose / 500 mL DW, The mixture was cultured with shaking at 37 ° C. for 16 to 20 hours using pH 7.3 ± 0.2 at 25 ° C.

  Yersinia enterocolitica was cultured in Trypticace soy broth (Becton Dickinson) at 30 ° C for 2 days.

  Vibrio chorelae was cultured in LB-Lenox Broth (Difco Laboratories) at 37 ° C. for 24 hours.

  Vibrio parahaemolyticus (V. parahaemolyticus) is an alkaline peptone water containing 3% NaCl "Nissui" (Nissui Pharmaceutical, Tokyo) (5g Peptone, 5g NaCl / 500 mL DW, pH8.8 ± 0.2 at 25 ℃) And cultured at 37 ° C. for 24 hours.

(1-3 PCR and agarose gel electrophoresis, base sequence analysis)
PCR template DNA was prepared by the boil method. Specifically, add colonies scraped from the plate to 200 μL of TE, heat-treat for 10 minutes, centrifuge at 12,800 × g for 10 minutes (Himac CT13R, HITACHI, unless otherwise specified, use this device) The obtained supernatant was used as template DNA for PCR.

  All PCRs were performed using Geneamp PCR System 2400 (PerkinElmer, Wellesley, MA, USA) or Geneamp PCR System 9700 (PerkinElmer). PCR primers and PCR conditions are shown in Table 2. Degenerated PCR primers GNW, LPF-D (10 pmol / μL) 5 μL each, prepared genomic DNA 40 ng, 2.5 mM dNTP 4 μL, 10 × Ex Taq Buffer 5 μL, Takara Ex Taq (5 U / μL) PCR was performed after 0.25 μL was made 50 μL with sterile DW. PCR products were electrophoresed on a 1% agarose gel. Agarose gel electrophoresis was performed under the conditions of 1X TAE Buffer [40 mM Tris-acetate (pH 8.5), 1 mM EDTA], 100 V using Mupid (Advance, Tokyo). After electrophoresis, stain with 1.0 μg / mL ethidium bromide (Sigma) for 15 minutes, decolorize with DW, and use the gel documentation analysis system Gel Doc 2000 (Bio-Rad, Hercules, CA, USA) to obtain the PCR product. Was photographed under ultraviolet light (260 nm).

  Base sequence analysis was performed as follows. To 100 ng of plasmid DNA, 1 μL of each base sequence analysis primer (3.2 pmol) shown in Table 4, 4 μL of Big Dye terminator, and 2 μL of 5 × sequence buffer were added, and the volume was increased to 20 μL with DW. After the reaction at 96 ° C for 5 minutes, the reaction at 96 ° C for 30 seconds, 50 ° C for 15 seconds, and 60 ° C for 4 minutes was repeated 25 times. PCR products were purified by CENTRI SPIN 20 Spin Columns (Princeton Separations, Adelphia, NJ, USA), dried under reduced pressure with TOMY CENTRIFUGAL CONCENTRATOR CC-105 (Tomy Seiko, Tokyo), and Template Suppression Reagent (Applied Biosystems, Foster City, (CA, USA) Dissolved in 20 μL. This was boiled for 3 minutes and then rapidly cooled on ice, and the base sequence was analyzed using ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The obtained base sequence was analyzed using DNASIS (HitachiSoft, Tokyo), Lasergene software (DNAstar, WI, USA). The homology search was performed using BLAST (DDBJ, http://www.ddbj.nig.ac.jp/search/blast-j.html).

[Table 2]
(Multiplex PCR primers for C. jejuni, C. coli, and C. fetus cdtA, cdtB, and cdtC genes and common primers for cdtB genes and their PCR conditions)

[Example 1] Multiplex PCR of cdt gene
Multiplex PCR for the cdtA gene amplified species-specific fragments of approximately 630 bp, 330 bp, and 490 bp in C. jejuni, C. coli, and C. fetus, respectively, as well as the positive control. In the multiplex PCR for the cdtB gene, species-specific fragments of about 710 bp, 410 bp, and 550 bp were amplified in C. jejuni, C. coli, and C. fetus, respectively, as in the positive control. In addition, in the multiplex PCR for the cdtC gene, similar to the positive control, C. jejuni, C. coli, and C. fetus amplified about 500 bp, 300 bp, and 400 bp, respectively. 1). On the other hand, other Campylobacter bacteria such as C. hyointestinalis, C. lari, C. upsaliensis, C. helveticus, etc. positive for cdt gene, H. hepaticas, H. ducreyi, A. actinomycetemcomi None of the CdtA, cdtB, and cdtC genes of Escherichia coli, which each possessed Tance, Shigella spp., And five different types of cdt genes (I, II, III, IV, V), C. jejuni, C. coli, And was specific only to the cdt genes of 3 species of C. fetus (FIG. 1, Table 3). Furthermore, no amplification bands were observed in Salmonella spp., Yersinia enterocolitica and Vibrio spp., Which are other typical intestinal infection bacteria (Table 3).

[Table 3]
(Results of multiplex PCR and PCR using common primers for cdt gene positive bacteria and other intestinal infections isolated from patients and animals)

[Example 2] Detection of Campylobacter bacteria using a common primer for the cdtB gene The cdtB gene has the highest homology across species, as to whether Campylobacter bacteria can be detected by a single PCR targeting the cdt gene. We designed and studied a common primer targeting the target. When PCR was performed with common primers, specific bands of about 720 bp from C. jejuni, C. coli, and C. fetus cdtB genes were amplified. In addition, C. jejuni, C. coli, and other Campylobacter bacteria other than C. fetus, ie, C. hyointestinalis, C. lari, C, upsaliensis and C. helveticus, also amplified a fragment of about 720 bp. (FIG. 2). As a result of analyzing the nucleotide sequences of PCR products obtained from Campylobacter bacteria other than C. jejuni, C. coli, and C. fetus, genes with high homology to the Cdtje gene of C. jejuni were confirmed. On the other hand, in cdt gene positive bacteria other than Campylobacter bacteria and other intestinal infection bacteria, H. hepaticas that had the highest homology with Campylobacter bacteria also used H. hepaticas to amplify fragments with common primers. It was not obtained (FIG. 2, Table 3). From the above results, there is a region that is conserved across the species in the cptB gene of Campylobacter genus bacteria, and at least 7 species of Campylobacter genus bacteria can be obtained at one time by targeting the CdtB gene of Campylobacter genus bacteria. It was possible to detect by PCR.

[Example 3] Simultaneous detection of a plurality of Campylobacter bacteria by multiplex PCR targeting the cdtB gene Assuming mixed infection, whether or not Campylobacter bacteria of a plurality of bacterial species can be detected at a time is targeted with the cdtB gene. The multiplex PCR was evaluated. In the previous section, the specificity was confirmed in all multiplex PCRs targeting the cdtA, cdtB, and cdtC genes, but the conservation of each subunit gene was the highest in the cdtB gene. Multiplex PCR targeting the gene was used.

  Multiplex PCR for the cdtB gene was performed in a system in which two or three genomic DNAs of C. jejuni, C. coli, and C. fetus were mixed. As a result, as shown in FIG. 3, not only the cases of C. jejuni, C. coli, and C. featus alone, but also the bands specific to each of them even when there are 2 and 3 species respectively. Could be amplified. Therefore, it was considered that multiplex PCR targeting the cdtB gene can also be applied to mixed infection tests.

[Example 4] Detection limits of C. jejuni, C. coli, and C. fetus in multiplex PCR targeting the cdtB gene
The detection limit of multiplex PCR targeting the cdtB gene was examined using C. jejuni, C. coli, and C. fetus. As a result, in C. jejuni and C. coli, the number of bacteria of 10 ¹ colony forming unit (cfu) was required per PCR tube in order to detect specific amplified fragments. On the other hand, in C. fetus, the number of bacteria of 10 ² cfu per PCR tube was required to detect a specific amplified fragment (FIG. 4).

  The primer of the present application was confirmed to have improved sensitivity and specificity as compared with other designed primers (WO2005 / 054472 SEQ ID NO: 11-16). When PCR was performed with the primer set of the present application using 9 sample boil templates in which nonspecific amplification was observed in the previous primer set, nonspecific amplification was not observed in all samples. In addition, when 116 samples of healthy pediatric stool were subjected to PCR with the primer set of the present application, only one sample showed very weak non-specific amplification.

[Example 5] Design of primers and probes for real-time PCR detection in C. jejuni, C. coli, and C. fetus
C. jejuni primers and probes for a total of 11 strains including the cdtB gene-deficient strain, C. coli primers and probes for a total of 18 strains including the cdt gene mutant, and C. fetus primers and probes for thai For the total of 12 strains including the cdt gene mutants isolated in (1), the respective cdt gene sequences were compared for each bacterial species, the region that can be detected in all strains was examined for each bacterial species, and the specificity was determined. Inspected and picked the best combination.

(1) C. Jejuni
When compared to the C. jejuni mutation-deficient cdt gene (AY442300) and the 81-176 cdt gene, the mutation-deficient cdt gene is largely deficient in the first half of cdtA to cdtB and in the middle of cdtB. Many base substitutions were also observed for the cdtB gene (FIG. 11). Therefore, focusing on the relatively highly conserved cdtC gene region, we attempted to design primers and probes for real-time PCR in this region.
In order to design primers and probes for real-time PCR, several cdtC genes including defective types were compared, and regions that had the least variation and could be used for primers and probes for real-time PCR were searched. Thereafter, PCR was performed using each primer set, and the most suitable primer set was set (FIG. 12).
Primer for nucleotide sequence analysis
Cj cdtRTU2: 5 'GCAAAATCTTGTCAAGATGATCTAAAAG 3' (SEQ ID NO: 37)
Cj cdtRTR2: 5 'TCCAAAACTAAAGAACGAATTTGCA 3' (SEQ ID NO: 38)
Probe for detection
Cj RTP2: 5 '(FAM) -AAACTGTATTTTCTATAATGCCAACAACAACTTCAG- (BHQ-1) 3' (SEQ ID NO: 39)
BHQ: Black hole quencher (fluorescent dye)

(2) C. coli For designing primers and probes for real-time PCR, compare several C. coli cdt genes to find the region with the fewest mutations that can be used for primers and probes for real-time PCR. did. Thereafter, PCR was performed using each PCR primer, and the most suitable primer set was set (FIG. 13).
Primer for nucleotide sequence analysis
Cc cdtRTU5: 5 'TTTAACCAATGGTGGCAATCAAT 3' (SEQ ID NO: 40)
Cc cdtRTR5: 5 'ATTCTCCTAAACCAAAGCGATTTTC 3' (SEQ ID NO: 41)
Probe for detection
Cc RTP5: 5 '(TAMRA) -CATGAGCACTTTTCCTGACTCTAGTATCGCCA- (BHQ-2) 3' (SEQ ID NO: 42)

(3) C. Fetus
The sequence of the cdt gene was determined for several strains of C. fetus, and it was found that the cdt gene of C. fetus C90 strain isolated in Thailand was slightly different from the cdt gene of domestic strains. Then, both were compared and the area | region with high preservability was searched (FIG. 14).
In order to design primers and probes for real-time PCR, we compared several C. coli cdt genes and searched for regions with the least mutation and usable for primers and probes for real-time PCR. Thereafter, PCR was performed using each PCR primer, and the most suitable primer set was set (FIG. 15).
Primer for nucleotide sequence analysis
Cf cdtRTU1: 5 'CTTTTCCTTTTGGATACGTGCAA 3' (SEQ ID NO: 43)
Cf cdtRTR1: 5 'AAAAATCCGCTAGGAGCGATCTG 3' (SEQ ID NO: 44)
Probe for detection
Cf RTP1: (Orange560) -CAAGTAGCAGCCGACGTAAAAATGTGCCT- (BHQ-1) 3 '(SEQ ID NO: 45)

[Example 6] Detection and detection limit of C. jejuni, C. coli, and C. fetus by Real-Time PCR The templates were prepared using C. jejuni: 81-176 strain, C. coli: Col-243 strain, C. Fetus: Co1-187 strain, prepare each bacterial strain to be 1, 10, 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ cfu / μL, boil method (after boiling for 10 min, The supernatant was obtained by centrifugation). That is, the amount of bacteria is 1 to 10 ⁵ bacteria per PCR tube.
Real-time PCR was performed as follows. Add 1 μL of each prepared template to 10 μL TaqMan Master Mix (Applied Biosystems), 2 μL each of the above-mentioned primer for nucleotide sequence analysis (900 nM), 10 μL each of detection probe (250 nM), and 20 μL in DW. I made a female up. After reacting at 95 ° C for 5 minutes, the reaction at 95 ° C for 15 seconds and 60 ° C for 60 seconds was repeated 40 times and stored at 4 ° C. Detection was performed using an Applied Biosystems 7500 Fast Real-Time PCR system (Applied Biosystems).

In C. jejuni, a rise was observed from the 22nd cycle at a concentration of 10 ⁵ cfu / tube. At a concentration of 10 ³ cfu / tube, a rise was observed from the 30th cycle, but no significant fluorescence was observed at 10 ² cfu / tube. The detection limit was 10 ³ cfu / tube (FIG. 8).
In C. coli, a rise was observed from the 20th cycle at a concentration of 10 ⁵ cfu / tube. 10 ² cfu / tube showed a rise from the 34th cycle. The detection limit was 10 ² cfu / tube (FIG. 9).
Also in C. fetus, a rise was observed from the 21st cycle at a concentration of 10 ⁵ cfu / tube. 10 ² cfu / tube showed a rise from the 35th cycle. The detection limit was 10 ² cfu / tube (FIG. 10).

All three species showed good results and were considered to have sufficient performance for practical use.
C. Jejuni is FAM, C. coli is TAMRA, C. Fetus is Orange 560, and probes labeled with fluorescent substances with different fluorescence wavelengths are used to detect each bacterial species. When the Biosystems 7500 Fast Real-Time PCR system is used, Multiplex Real-Time PCR that can detect three bacterial species in one tube is possible.

  According to the present invention, a novel detection method for Campylobacter bacteria and a kit for the detection method are provided. The method of the present invention enables simple and quick inspection as compared with the conventional method. In particular, the method of the present invention was confirmed to be able to identify various bacteria up to the bacterial species by performing multiplex PCR in the presence of multiple types of Campylobacter bacteria. As described above, Campylobacter bacteria are publicly important bacteria as food-borne pathogens. In actual infected patients and food contamination, there are many cases in which multiple types of bacteria are mixed. Since the method of the present invention can be detected at a time without being separated for each bacterial species, it is possible to quickly and easily find the causative bacteria such as food poisoning. The method of the present invention is extremely useful not only clinically but also in manufacturing process management of foods and the like, factory hygiene management, and the like.

Claims (5)

A method for detecting Campylobacter bacteria in a test sample, the primer pair described in (a) to (c) below, comprising two polynucleotides capable of specifically binding to cpt genomic DNA or mRNA of Campylobacter bacteria A method comprising a step of performing a nucleic acid amplification reaction on a test sample using any one or more primer pairs.
(A) Primer capable of amplifying a region of Camptobacter bacterium cdtC genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 37 and 38, or an mRNA region corresponding to the region of the genomic DNA to be amplified Pair (b) Can amplify a region of Camptolobacter cdtC genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 40 and 41, or a region of mRNA corresponding to the region of genomic DNA to be amplified Primer pair (c) Amplify a region of Campylobacter cdtC genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 43 and 44, or a region of mRNA corresponding to the region of genomic DNA to be amplified. Uru Primer Pair The method according to claim 1, wherein the nucleic acid amplification reaction is performed using a quantitative PCR method or a real-time quantitative PCR method. The method according to claim 1 or 2, further comprising any one or more of the following steps (i) to (iii).
(I) a step of detecting a nucleic acid fragment amplified by a primer pair consisting of the sequences described in SEQ ID NOs: 37 and 38 using the probe described in SEQ ID NO: 39 (ii) the sequences described in SEQ ID NOs: 40 and 41 (Iii) detecting a nucleic acid fragment amplified by the primer pair consisting of: a probe described in SEQ ID NO: 42; and a nucleic acid fragment amplified by the primer pair consisting of the sequences described in SEQ ID NO: 43 and 44, Detecting using the probe described in SEQ ID NO: 45 A kit for use in the method according to any one of claims 1 to 3, comprising an instruction manual and two polynucleotides which can specifically bind to cdt genomic DNA or mRNA of Campylobacter bacteria ( A kit comprising at least one primer pair among the primer pairs described in a) to (c).
(A) A primer capable of amplifying a region of Camptobacter bacterium cdt genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 37 and 38, or an mRNA region corresponding to the region of genomic DNA to be amplified Pair (b) Can amplify the region of Campylobacter cdt genomic DNA amplified by the primer pair consisting of the sequences of SEQ ID NOs: 40 and 41, or the region of mRNA corresponding to the region of the genomic DNA to be amplified Primer pair (c) Amplify a region of Campylobacter cdt genomic DNA amplified by a primer pair consisting of the sequences of SEQ ID NOs: 43 and 44, or a region of mRNA corresponding to the region of genomic DNA to be amplified. Uru Primer Pair The kit according to claim 4, further comprising at least one detection probe of SEQ ID NOs: 39, 42, and 45.

Images